>Feature sequence01 415 2028 gene locus_tag LOCUS_00010 415 2028 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705057.1 protein_id gnl|my_center|LOCUS_00010 2413 3783 gene locus_tag LOCUS_00020 2413 3783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098233.1 protein_id gnl|my_center|LOCUS_00020 4149 5438 gene locus_tag LOCUS_00030 gene citN 4149 5438 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42308 protein_id gnl|my_center|LOCUS_00030 5461 6807 gene locus_tag LOCUS_00040 5461 6807 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_00040 6804 7103 gene locus_tag LOCUS_00050 6804 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_00050 8934 7357 gene locus_tag LOCUS_00060 8934 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9399 10313 gene locus_tag LOCUS_00070 9399 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10782 11774 gene locus_tag LOCUS_00080 10782 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_00080 11871 12983 gene locus_tag LOCUS_00090 11871 12983 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_00090 13122 14021 gene locus_tag LOCUS_00100 13122 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14182 14433 gene locus_tag LOCUS_00110 14182 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14919 15992 gene locus_tag LOCUS_00120 14919 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17089 16004 gene locus_tag LOCUS_00130 17089 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17205 19259 gene locus_tag LOCUS_00140 17205 19259 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085536.1 protein_id gnl|my_center|LOCUS_00140 20183 19785 gene locus_tag LOCUS_00150 20183 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21250 20354 gene locus_tag LOCUS_00160 21250 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21362 22426 gene locus_tag LOCUS_00170 21362 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22921 24882 gene locus_tag LOCUS_00180 22921 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24884 27535 gene locus_tag LOCUS_00190 24884 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27887 28852 gene locus_tag LOCUS_00200 27887 28852 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974801.1 protein_id gnl|my_center|LOCUS_00200 28864 31374 gene locus_tag LOCUS_00210 28864 31374 CDS product subtilisin proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124090.1 protein_id gnl|my_center|LOCUS_00210 32881 31523 gene locus_tag LOCUS_00220 32881 31523 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_00220 33132 33046 gene locus_tag LOCUS_t00010 33132 33046 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33330 33257 gene locus_tag LOCUS_t00020 33330 33257 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 33642 33508 gene locus_tag LOCUS_00230 33642 33508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 35404 33737 gene locus_tag LOCUS_00240 35404 33737 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811649.1 protein_id gnl|my_center|LOCUS_00240 36086 36241 gene locus_tag LOCUS_00250 36086 36241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 37362 36316 gene locus_tag LOCUS_00260 gene fdhD 37362 36316 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKI6 protein_id gnl|my_center|LOCUS_00260 39699 37369 gene locus_tag LOCUS_00270 gene ydeP 39699 37369 CDS product oxidoreductase molybdopterin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207424.1 protein_id gnl|my_center|LOCUS_00270 40684 39890 gene locus_tag LOCUS_00280 40684 39890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 protein_id gnl|my_center|LOCUS_00280 41648 40749 gene locus_tag LOCUS_00290 41648 40749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 protein_id gnl|my_center|LOCUS_00290 43122 42091 gene locus_tag LOCUS_00300 43122 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064003.1 protein_id gnl|my_center|LOCUS_00300 44320 43256 gene locus_tag LOCUS_00310 44320 43256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_00310 45058 45468 gene locus_tag LOCUS_00320 45058 45468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 47675 45576 gene locus_tag LOCUS_00330 gene metG 47675 45576 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV3 protein_id gnl|my_center|LOCUS_00330 49454 48039 gene locus_tag LOCUS_00340 49454 48039 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_00340 49812 50525 gene locus_tag LOCUS_00350 49812 50525 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_00350 50651 51280 gene locus_tag LOCUS_00360 50651 51280 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_00360 51323 52123 gene locus_tag LOCUS_00370 51323 52123 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204588.1 protein_id gnl|my_center|LOCUS_00370 52333 53565 gene locus_tag LOCUS_00380 gene mrp 52333 53565 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_00380 53659 54084 gene locus_tag LOCUS_00390 53659 54084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 54112 55233 gene locus_tag LOCUS_00400 54112 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106421.1 protein_id gnl|my_center|LOCUS_00400 55346 55921 gene locus_tag LOCUS_00410 gene dcd 55346 55921 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_00410 56460 56026 gene locus_tag LOCUS_00420 gene sspB 56460 56026 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_00420 57207 56593 gene locus_tag LOCUS_00430 gene sspA 57207 56593 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_00430 58118 57405 gene locus_tag LOCUS_00440 58118 57405 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_00440 59344 58118 gene locus_tag LOCUS_00450 59344 58118 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_00450 59930 59346 gene locus_tag LOCUS_00460 59930 59346 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_00460 62386 60446 gene locus_tag LOCUS_00470 gene uup 62386 60446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_00470 62627 62884 gene locus_tag LOCUS_00480 62627 62884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 63104 64315 gene locus_tag LOCUS_00490 gene fadL 63104 64315 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206872.1 protein_id gnl|my_center|LOCUS_00490 64687 66042 gene locus_tag LOCUS_00500 64687 66042 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_00500 68006 66507 gene locus_tag LOCUS_00510 gene opuE 68006 66507 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181816.1 protein_id gnl|my_center|LOCUS_00510 69354 68482 gene locus_tag LOCUS_00520 gene gltC 69354 68482 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_00520 69827 71245 gene locus_tag LOCUS_00530 gene leuC 69827 71245 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_00530 71387 72037 gene locus_tag LOCUS_00540 gene leuD 71387 72037 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_00540 72193 72912 gene locus_tag LOCUS_00550 72193 72912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 protein_id gnl|my_center|LOCUS_00550 72952 74055 gene locus_tag LOCUS_00560 gene leuB 72952 74055 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_00560 74350 75615 gene locus_tag LOCUS_00570 74350 75615 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_00570 76093 75872 gene locus_tag LOCUS_00580 gene infA 76093 75872 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_00580 77044 76205 gene locus_tag LOCUS_00590 gene truA 77044 76205 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_00590 78188 77088 gene locus_tag LOCUS_00600 gene ansA 78188 77088 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 protein_id gnl|my_center|LOCUS_00600 80029 78347 gene locus_tag LOCUS_00610 80029 78347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 81787 80081 gene locus_tag LOCUS_00620 81787 80081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 83184 81982 gene locus_tag LOCUS_00630 gene queA 83184 81982 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY3 protein_id gnl|my_center|LOCUS_00630 84447 83362 gene locus_tag LOCUS_00640 gene dinB 84447 83362 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_00640 84956 85201 gene locus_tag LOCUS_00650 84956 85201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 85363 85277 gene locus_tag LOCUS_t00030 85363 85277 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 86275 85502 gene locus_tag LOCUS_00660 gene fpr 86275 85502 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_00660 86703 87560 gene locus_tag LOCUS_00670 86703 87560 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_00670 87619 89406 gene locus_tag LOCUS_00680 gene xcpR 87619 89406 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_00680 89581 90369 gene locus_tag LOCUS_00690 gene ycfH 89581 90369 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_00690 90604 91287 gene locus_tag LOCUS_00700 90604 91287 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_00700 91670 92278 gene locus_tag LOCUS_00710 91670 92278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 92278 92781 gene locus_tag LOCUS_00720 92278 92781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 92778 93611 gene locus_tag LOCUS_00730 gene xcpW 92778 93611 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_00730 93660 94706 gene locus_tag LOCUS_00740 gene xcpX 93660 94706 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_00740 95408 94728 gene locus_tag LOCUS_00750 95408 94728 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_00750 96931 95513 gene locus_tag LOCUS_00760 gene dgt 96931 95513 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_00760 97522 97010 gene locus_tag LOCUS_00770 97522 97010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 98799 97708 gene locus_tag LOCUS_00780 gene ychF 98799 97708 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_00780 99243 101441 gene locus_tag LOCUS_00790 gene uvrD 99243 101441 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_00790 101706 102953 gene locus_tag LOCUS_00800 101706 102953 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_00800 103005 103346 gene locus_tag LOCUS_00810 103005 103346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388929.1 protein_id gnl|my_center|LOCUS_00810 103659 103534 gene locus_tag LOCUS_00820 103659 103534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 104418 103918 gene locus_tag LOCUS_00830 104418 103918 CDS product glyoxalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474277.1 protein_id gnl|my_center|LOCUS_00830 104526 105395 gene locus_tag LOCUS_00840 104526 105395 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233142.2 protein_id gnl|my_center|LOCUS_00840 106616 105480 gene locus_tag LOCUS_00850 gene glxK 106616 105480 CDS product glycerate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_00850 108009 106729 gene locus_tag LOCUS_00860 108009 106729 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482895.1 protein_id gnl|my_center|LOCUS_00860 108658 108419 gene locus_tag LOCUS_00870 108658 108419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 109486 108980 gene locus_tag LOCUS_00880 gene rplI 109486 108980 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_00880 109737 109507 gene locus_tag LOCUS_00890 gene rpsR 109737 109507 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV1 protein_id gnl|my_center|LOCUS_00890 110158 109754 gene locus_tag LOCUS_00900 gene rpsF 110158 109754 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV0 protein_id gnl|my_center|LOCUS_00900 111392 110424 gene locus_tag LOCUS_00910 111392 110424 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 protein_id gnl|my_center|LOCUS_00910 113900 111519 gene locus_tag LOCUS_00920 gene ppsA 113900 111519 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU3 protein_id gnl|my_center|LOCUS_00920 114497 115393 gene locus_tag LOCUS_00930 114497 115393 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_00930 115552 117201 gene locus_tag LOCUS_00940 gene sthA 115552 117201 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_00940 118370 117306 gene locus_tag LOCUS_00950 gene ybhR 118370 117306 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_00950 119806 118496 gene locus_tag LOCUS_00960 119806 118496 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464455.1 protein_id gnl|my_center|LOCUS_00960 121009 119810 gene locus_tag LOCUS_00970 121009 119810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464702.1 protein_id gnl|my_center|LOCUS_00970 121786 121058 gene locus_tag LOCUS_00980 121786 121058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 123758 122091 gene locus_tag LOCUS_00990 123758 122091 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 protein_id gnl|my_center|LOCUS_00990 124563 126173 gene locus_tag LOCUS_01000 gene glpK 124563 126173 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 protein_id gnl|my_center|LOCUS_01000 126422 126934 gene locus_tag LOCUS_01010 126422 126934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 127234 128253 gene locus_tag LOCUS_01020 127234 128253 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_01020 128491 129183 gene locus_tag LOCUS_01030 gene aguR 128491 129183 CDS product transcriptional regulator AguR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_01030 130042 129257 gene locus_tag LOCUS_01040 130042 129257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 135418 130166 gene locus_tag LOCUS_01050 135418 130166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 137747 135642 gene locus_tag LOCUS_01060 137747 135642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 138278 137814 gene locus_tag LOCUS_01070 138278 137814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 140558 138528 gene locus_tag LOCUS_01080 140558 138528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 141160 143973 gene locus_tag LOCUS_01090 gene aceE 141160 143973 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB9 protein_id gnl|my_center|LOCUS_01090 143999 145696 gene locus_tag LOCUS_01100 gene aceF 143999 145696 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB8 protein_id gnl|my_center|LOCUS_01100 146485 145859 gene locus_tag LOCUS_01110 gene ompW 146485 145859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_01110 147509 148492 gene locus_tag LOCUS_01120 gene kcnb2 147509 148492 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_01120 149273 148626 gene locus_tag LOCUS_01130 149273 148626 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888853.1 protein_id gnl|my_center|LOCUS_01130 150451 149324 gene locus_tag LOCUS_01140 150451 149324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 153370 150635 gene locus_tag LOCUS_01150 gene ycbZ 153370 150635 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 protein_id gnl|my_center|LOCUS_01150 153775 154491 gene locus_tag LOCUS_01160 gene gidB 153775 154491 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_01160 154751 155530 gene locus_tag LOCUS_01170 gene soj 154751 155530 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_01170 155635 156777 gene locus_tag LOCUS_01180 155635 156777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 156879 157592 gene locus_tag LOCUS_01190 156879 157592 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_01190 157665 158096 gene locus_tag LOCUS_01200 gene exbD 157665 158096 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_01200 158173 159960 gene locus_tag LOCUS_01210 gene msbA 158173 159960 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_01210 160027 161157 gene locus_tag LOCUS_01220 gene lpxK 160027 161157 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_01220 161203 162015 gene locus_tag LOCUS_01230 gene kdsB 161203 162015 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC2 protein_id gnl|my_center|LOCUS_01230 162102 163232 gene locus_tag LOCUS_01240 gene holB 162102 163232 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_01240 163349 163696 gene locus_tag LOCUS_01250 gene pilZ 163349 163696 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_01250 164833 163820 gene locus_tag LOCUS_01260 164833 163820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_01260 166730 165102 gene locus_tag LOCUS_01270 gene fadI 166730 165102 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_01270 167299 168699 gene locus_tag LOCUS_01280 167299 168699 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_01280 169006 169917 gene locus_tag LOCUS_01290 169006 169917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_01290 169984 170571 gene locus_tag LOCUS_01300 169984 170571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 170726 172165 gene locus_tag LOCUS_01310 gene lipL 170726 172165 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_01310 173469 172222 gene locus_tag LOCUS_01320 173469 172222 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_01320 175612 173726 gene locus_tag LOCUS_01330 gene ilvD 175612 173726 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8G6 protein_id gnl|my_center|LOCUS_01330 176566 175805 gene locus_tag LOCUS_01340 176566 175805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 176784 177227 gene locus_tag LOCUS_01350 176784 177227 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_01350 177545 179590 gene locus_tag LOCUS_01360 177545 179590 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 protein_id gnl|my_center|LOCUS_01360 179712 180743 gene locus_tag LOCUS_01370 gene dusB 179712 180743 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKI7 protein_id gnl|my_center|LOCUS_01370 181227 180820 gene locus_tag LOCUS_01380 181227 180820 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 protein_id gnl|my_center|LOCUS_01380 181427 182314 gene locus_tag LOCUS_01390 181427 182314 CDS product fatty acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_01390 182860 182723 gene locus_tag LOCUS_01400 182860 182723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 183553 183092 gene locus_tag LOCUS_01410 183553 183092 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708378.1 protein_id gnl|my_center|LOCUS_01410 183841 185088 gene locus_tag LOCUS_01420 183841 185088 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence02 458 2545 gene locus_tag LOCUS_01430 gene fimX 458 2545 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_01430 2604 3062 gene locus_tag LOCUS_01440 2604 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3111 4139 gene locus_tag LOCUS_01450 gene moxR 3111 4139 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_01450 4311 5282 gene locus_tag LOCUS_01460 4311 5282 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_01460 5279 7510 gene locus_tag LOCUS_01470 gene tgpA 5279 7510 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_01470 7622 7909 gene locus_tag LOCUS_01480 7622 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_01480 8198 8001 gene locus_tag LOCUS_01490 8198 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9175 8309 gene locus_tag LOCUS_01500 9175 8309 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_01500 9472 10596 gene locus_tag LOCUS_01510 gene frmA 9472 10596 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_01510 11368 10715 gene locus_tag LOCUS_01520 11368 10715 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_01520 11910 12179 gene locus_tag LOCUS_01530 11910 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01530 12180 12380 gene locus_tag LOCUS_01540 12180 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01540 12904 13560 gene locus_tag LOCUS_01550 12904 13560 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968215.1 protein_id gnl|my_center|LOCUS_01550 13557 14549 gene locus_tag LOCUS_01560 13557 14549 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339125.1 protein_id gnl|my_center|LOCUS_01560 14552 16975 gene locus_tag LOCUS_01570 14552 16975 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 protein_id gnl|my_center|LOCUS_01570 17100 18392 gene locus_tag LOCUS_01580 gene pucA 17100 18392 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_01580 18389 19099 gene locus_tag LOCUS_01590 18389 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037855.1 protein_id gnl|my_center|LOCUS_01590 19116 19685 gene locus_tag LOCUS_01600 19116 19685 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_01600 20368 19739 gene locus_tag LOCUS_01610 20368 19739 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_01610 21356 20742 gene locus_tag LOCUS_01620 21356 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 22053 21424 gene locus_tag LOCUS_01630 22053 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 22902 22153 gene locus_tag LOCUS_01640 22902 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 23400 22906 gene locus_tag LOCUS_01650 23400 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 23846 23484 gene locus_tag LOCUS_01660 23846 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_01660 25415 24090 gene locus_tag LOCUS_01670 gene hutI 25415 24090 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLW0 protein_id gnl|my_center|LOCUS_01670 26524 25478 gene locus_tag LOCUS_01680 gene hutG 26524 25478 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ59 protein_id gnl|my_center|LOCUS_01680 28114 26552 gene locus_tag LOCUS_01690 gene hutH 28114 26552 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZA10 protein_id gnl|my_center|LOCUS_01690 29890 28178 gene locus_tag LOCUS_01700 gene hutU 29890 28178 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MIU2 protein_id gnl|my_center|LOCUS_01700 30187 30930 gene locus_tag LOCUS_01710 30187 30930 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075034.1 protein_id gnl|my_center|LOCUS_01710 31280 32116 gene locus_tag LOCUS_01720 31280 32116 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207528.1 protein_id gnl|my_center|LOCUS_01720 32116 32853 gene locus_tag LOCUS_01730 32116 32853 CDS product cysteine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687787.1 protein_id gnl|my_center|LOCUS_01730 32930 33673 gene locus_tag LOCUS_01740 32930 33673 CDS product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 protein_id gnl|my_center|LOCUS_01740 33985 34497 gene locus_tag LOCUS_01750 33985 34497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35583 34630 gene locus_tag LOCUS_01760 35583 34630 CDS product drug/metabolite transporter 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867202.1 protein_id gnl|my_center|LOCUS_01760 36558 35911 gene locus_tag LOCUS_01770 36558 35911 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_01770 38010 36592 gene locus_tag LOCUS_01780 38010 36592 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_01780 38373 38098 gene locus_tag LOCUS_01790 38373 38098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 38922 40976 gene locus_tag LOCUS_01800 gene hemR 38922 40976 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815406.1 protein_id gnl|my_center|LOCUS_01800 41140 42480 gene locus_tag LOCUS_01810 41140 42480 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_01810 43344 42574 gene locus_tag LOCUS_01820 43344 42574 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 protein_id gnl|my_center|LOCUS_01820 44505 43420 gene locus_tag LOCUS_01830 44505 43420 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 protein_id gnl|my_center|LOCUS_01830 45597 44620 gene locus_tag LOCUS_01840 45597 44620 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951404.1 protein_id gnl|my_center|LOCUS_01840 45575 45775 gene locus_tag LOCUS_01850 45575 45775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 46834 45797 gene locus_tag LOCUS_01860 46834 45797 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 protein_id gnl|my_center|LOCUS_01860 47346 48326 gene locus_tag LOCUS_01870 47346 48326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 48435 49121 gene locus_tag LOCUS_01880 gene exbB 48435 49121 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_01880 49172 49573 gene locus_tag LOCUS_01890 gene exbD 49172 49573 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_01890 50307 49774 gene locus_tag LOCUS_01900 50307 49774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 50708 51310 gene locus_tag LOCUS_01910 50708 51310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 51667 54270 gene locus_tag LOCUS_01920 gene topA 51667 54270 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM24 protein_id gnl|my_center|LOCUS_01920 54908 54351 gene locus_tag LOCUS_01930 54908 54351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 55910 55104 gene locus_tag LOCUS_01940 55910 55104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 58968 56368 gene locus_tag LOCUS_01950 gene lon 58968 56368 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ1 protein_id gnl|my_center|LOCUS_01950 59394 60755 gene locus_tag LOCUS_01960 59394 60755 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 protein_id gnl|my_center|LOCUS_01960 61123 60869 gene locus_tag LOCUS_01970 61123 60869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 61809 61123 gene locus_tag LOCUS_01980 61809 61123 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ2 protein_id gnl|my_center|LOCUS_01980 61996 63399 gene locus_tag LOCUS_01990 gene fumC 61996 63399 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYR9 protein_id gnl|my_center|LOCUS_01990 63590 64681 gene locus_tag LOCUS_02000 63590 64681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888356.1 protein_id gnl|my_center|LOCUS_02000 65642 64827 gene locus_tag LOCUS_02010 65642 64827 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_02010 66820 65783 gene locus_tag LOCUS_02020 66820 65783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 68114 66927 gene locus_tag LOCUS_02030 gene lldD 68114 66927 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_02030 68464 68153 gene locus_tag LOCUS_02040 68464 68153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 68673 69359 gene locus_tag LOCUS_02050 gene mtgA 68673 69359 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_02050 69618 71861 gene locus_tag LOCUS_02060 gene ppk 69618 71861 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_02060 72222 72392 gene locus_tag LOCUS_02070 72222 72392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 72462 72707 gene locus_tag LOCUS_02080 72462 72707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 72766 73125 gene locus_tag LOCUS_02090 72766 73125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 73257 73451 gene locus_tag LOCUS_02100 73257 73451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 74413 73625 gene locus_tag LOCUS_02110 gene miaE 74413 73625 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_02110 75154 77352 gene locus_tag LOCUS_02120 gene glcB 75154 77352 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_02120 77963 79072 gene locus_tag LOCUS_02130 gene porB 77963 79072 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_02130 79268 80455 gene locus_tag LOCUS_02140 gene porB 79268 80455 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_02140 80686 82320 gene locus_tag LOCUS_02150 gene pyrG 80686 82320 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFQ0 protein_id gnl|my_center|LOCUS_02150 82554 83429 gene locus_tag LOCUS_02160 gene kdsA 82554 83429 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP9 protein_id gnl|my_center|LOCUS_02160 83457 83711 gene locus_tag LOCUS_02170 83457 83711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 83944 84168 gene locus_tag LOCUS_02180 gene merP 83944 84168 CDS product mercuric transport protein periplasmic component MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003614305.1 protein_id gnl|my_center|LOCUS_02180 84514 86871 gene locus_tag LOCUS_02190 84514 86871 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222365.1 protein_id gnl|my_center|LOCUS_02190 87197 88513 gene locus_tag LOCUS_02200 gene eno 87197 88513 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP8 protein_id gnl|my_center|LOCUS_02200 88675 88983 gene locus_tag LOCUS_02210 88675 88983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 89114 89848 gene locus_tag LOCUS_02220 gene ispD 89114 89848 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP3 protein_id gnl|my_center|LOCUS_02220 90199 90807 gene locus_tag LOCUS_02230 90199 90807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 91158 91083 gene locus_tag LOCUS_t00040 91158 91083 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 91408 91211 gene locus_tag LOCUS_02240 91408 91211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 92517 91690 gene locus_tag LOCUS_02250 92517 91690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 93617 92634 gene locus_tag LOCUS_02260 gene pyrC 93617 92634 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_02260 93998 95236 gene locus_tag LOCUS_02270 gene argG 93998 95236 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_02270 95402 95707 gene locus_tag LOCUS_02280 95402 95707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 95682 96245 gene locus_tag LOCUS_02290 95682 96245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920724.1 protein_id gnl|my_center|LOCUS_02290 97572 96295 gene locus_tag LOCUS_02300 97572 96295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 97777 98229 gene locus_tag LOCUS_02310 97777 98229 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_02310 100068 98482 gene locus_tag LOCUS_02320 100068 98482 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064458.1 protein_id gnl|my_center|LOCUS_02320 101809 100223 gene locus_tag LOCUS_02330 gene aceA 101809 100223 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_02330 102463 103452 gene locus_tag LOCUS_02340 gene nahR 102463 103452 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_02340 103819 105198 gene locus_tag LOCUS_02350 103819 105198 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_02350 106152 105469 gene locus_tag LOCUS_02360 gene purN 106152 105469 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ50 protein_id gnl|my_center|LOCUS_02360 107201 106152 gene locus_tag LOCUS_02370 gene purM 107201 106152 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_02370 107525 108631 gene locus_tag LOCUS_02380 gene rp630 107525 108631 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_02380 108948 109751 gene locus_tag LOCUS_02390 gene dnaA 108948 109751 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_02390 109855 110556 gene locus_tag LOCUS_02400 109855 110556 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_02400 111161 110676 gene locus_tag LOCUS_02410 111161 110676 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_02410 112077 111418 gene locus_tag LOCUS_02420 112077 111418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_02420 112564 113850 gene locus_tag LOCUS_02430 gene serS 112564 113850 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_02430 114146 116143 gene locus_tag LOCUS_02440 gene tktA 114146 116143 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM84 protein_id gnl|my_center|LOCUS_02440 116226 117233 gene locus_tag LOCUS_02450 116226 117233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 117298 118815 gene locus_tag LOCUS_02460 117298 118815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 118856 119851 gene locus_tag LOCUS_02470 118856 119851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 120835 119864 gene locus_tag LOCUS_02480 120835 119864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094452.1 protein_id gnl|my_center|LOCUS_02480 121905 120832 gene locus_tag LOCUS_02490 121905 120832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112857.1 protein_id gnl|my_center|LOCUS_02490 122821 121907 gene locus_tag LOCUS_02500 gene dppC 122821 121907 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550972.1 protein_id gnl|my_center|LOCUS_02500 123997 122981 gene locus_tag LOCUS_02510 123997 122981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110329.1 protein_id gnl|my_center|LOCUS_02510 125811 124240 gene locus_tag LOCUS_02520 gene dppA 125811 124240 CDS product periplasmic dipeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523055.1 protein_id gnl|my_center|LOCUS_02520 126826 126500 gene locus_tag LOCUS_02530 126826 126500 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 protein_id gnl|my_center|LOCUS_02530 128055 127027 gene locus_tag LOCUS_02540 128055 127027 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_02540 129819 128293 gene locus_tag LOCUS_02550 gene aldA 129819 128293 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_02550 130161 132098 gene locus_tag LOCUS_02560 gene pif1 130161 132098 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_02560 132243 133391 gene locus_tag LOCUS_02570 gene epD 132243 133391 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_02570 133484 133574 gene locus_tag LOCUS_t00050 133484 133574 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 134420 133689 gene locus_tag LOCUS_02580 134420 133689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 135105 134773 gene locus_tag LOCUS_02590 135105 134773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 135371 135296 gene locus_tag LOCUS_t00060 135371 135296 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 135864 136208 gene locus_tag LOCUS_02600 135864 136208 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311727.1 protein_id gnl|my_center|LOCUS_02600 136210 136803 gene locus_tag LOCUS_02610 136210 136803 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972227.1 protein_id gnl|my_center|LOCUS_02610 136910 138412 gene locus_tag LOCUS_02620 gene betB 136910 138412 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ1 protein_id gnl|my_center|LOCUS_02620 138517 140217 gene locus_tag LOCUS_02630 gene betA 138517 140217 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ2 protein_id gnl|my_center|LOCUS_02630 140495 142540 gene locus_tag LOCUS_02640 gene betT 140495 142540 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768464.1 protein_id gnl|my_center|LOCUS_02640 142783 143271 gene locus_tag LOCUS_02650 142783 143271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 protein_id gnl|my_center|LOCUS_02650 143659 144597 gene locus_tag LOCUS_02660 143659 144597 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_02660 144815 146575 gene locus_tag LOCUS_02670 144815 146575 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_02670 146654 147355 gene locus_tag LOCUS_02680 146654 147355 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_02680 147399 147941 gene locus_tag LOCUS_02690 147399 147941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085399.1 protein_id gnl|my_center|LOCUS_02690 148004 148417 gene locus_tag LOCUS_02700 148004 148417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_02700 148823 148464 gene locus_tag LOCUS_02710 148823 148464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 149139 148828 gene locus_tag LOCUS_02720 149139 148828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02720 149356 149123 gene locus_tag LOCUS_02730 149356 149123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 150228 149434 gene locus_tag LOCUS_02740 150228 149434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 150791 150321 gene locus_tag LOCUS_02750 gene dgkA 150791 150321 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216810.1 protein_id gnl|my_center|LOCUS_02750 152239 151031 gene locus_tag LOCUS_02760 152239 151031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 153156 152455 gene locus_tag LOCUS_02770 gene colR 153156 152455 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_02770 154916 153213 gene locus_tag LOCUS_02780 154916 153213 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267098.1 protein_id gnl|my_center|LOCUS_02780 155766 155077 gene locus_tag LOCUS_02790 155766 155077 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185910.1 protein_id gnl|my_center|LOCUS_02790 155852 156643 gene locus_tag LOCUS_02800 155852 156643 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_02800 157060 159417 gene locus_tag LOCUS_02810 157060 159417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 159451 160383 gene locus_tag LOCUS_02820 159451 160383 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_02820 160857 160507 gene locus_tag LOCUS_02830 160857 160507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 160911 161078 gene locus_tag LOCUS_02840 160911 161078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 161927 161232 gene locus_tag LOCUS_02850 161927 161232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 162367 162095 gene locus_tag LOCUS_02860 162367 162095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 162910 163773 gene locus_tag LOCUS_02870 162910 163773 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114205.1 protein_id gnl|my_center|LOCUS_02870 164143 164661 gene locus_tag LOCUS_02880 164143 164661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02880 164725 165567 gene locus_tag LOCUS_02890 164725 165567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02890 166691 165705 gene locus_tag LOCUS_02900 166691 165705 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMH1 protein_id gnl|my_center|LOCUS_02900 167081 166803 gene locus_tag LOCUS_02910 167081 166803 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124506.1 protein_id gnl|my_center|LOCUS_02910 168111 167257 gene locus_tag LOCUS_02920 gene yjjU 168111 167257 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 protein_id gnl|my_center|LOCUS_02920 168714 168259 gene locus_tag LOCUS_02930 168714 168259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02930 169614 170777 gene locus_tag LOCUS_02940 gene ybdR 169614 170777 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206331.1 protein_id gnl|my_center|LOCUS_02940 171119 170991 gene locus_tag LOCUS_02950 171119 170991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 171322 171921 gene locus_tag LOCUS_02960 171322 171921 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007890845.1 protein_id gnl|my_center|LOCUS_02960 172186 172521 gene locus_tag LOCUS_02970 172186 172521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02970 172522 172872 gene locus_tag LOCUS_02980 172522 172872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02980 173553 173269 gene locus_tag LOCUS_02990 173553 173269 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970105.1 protein_id gnl|my_center|LOCUS_02990 174744 173746 gene locus_tag LOCUS_03000 174744 173746 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208299.1 protein_id gnl|my_center|LOCUS_03000 175558 174818 gene locus_tag LOCUS_03010 175558 174818 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_03010 175630 176592 gene locus_tag LOCUS_03020 175630 176592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705387.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence03 1619 336 gene locus_tag LOCUS_03030 1619 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_03030 2057 4018 gene locus_tag LOCUS_03040 gene acsA 2057 4018 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3L1 protein_id gnl|my_center|LOCUS_03040 4256 5419 gene locus_tag LOCUS_03050 4256 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6050 6778 gene locus_tag LOCUS_03060 gene pgsA 6050 6778 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_03060 7373 6879 gene locus_tag LOCUS_03070 7373 6879 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_03070 8178 7684 gene locus_tag LOCUS_03080 8178 7684 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_03080 8617 12606 gene locus_tag LOCUS_03090 gene purL 8617 12606 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL47 protein_id gnl|my_center|LOCUS_03090 12774 13109 gene locus_tag LOCUS_03100 12774 13109 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_03100 13099 13380 gene locus_tag LOCUS_03110 13099 13380 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_03110 13856 14251 gene locus_tag LOCUS_03120 13856 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 14656 14453 gene locus_tag LOCUS_03130 14656 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 15421 14672 gene locus_tag LOCUS_03140 15421 14672 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_03140 16193 15447 gene locus_tag LOCUS_03150 gene pdxJ 16193 15447 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_03150 17252 16365 gene locus_tag LOCUS_03160 17252 16365 CDS product anhydro-N-acetylmuramyl-tripeptide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016195.1 protein_id gnl|my_center|LOCUS_03160 17597 17349 gene locus_tag LOCUS_03170 17597 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 18109 17612 gene locus_tag LOCUS_03180 18109 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 18362 18102 gene locus_tag LOCUS_03190 18362 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19304 18576 gene locus_tag LOCUS_03200 19304 18576 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526296.1 protein_id gnl|my_center|LOCUS_03200 19928 19515 gene locus_tag LOCUS_03210 gene rsfS 19928 19515 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_03210 20980 20060 gene locus_tag LOCUS_03220 20980 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 23487 21340 gene locus_tag LOCUS_03230 gene pta 23487 21340 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM7 protein_id gnl|my_center|LOCUS_03230 24854 23622 gene locus_tag LOCUS_03240 gene ackA 24854 23622 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM8 protein_id gnl|my_center|LOCUS_03240 25577 25891 gene locus_tag LOCUS_03250 25577 25891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 25938 27314 gene locus_tag LOCUS_03260 gene lysA 25938 27314 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL94 protein_id gnl|my_center|LOCUS_03260 27528 28415 gene locus_tag LOCUS_03270 gene dapF 27528 28415 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_03270 28447 29487 gene locus_tag LOCUS_03280 gene xerC 28447 29487 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_03280 30429 29530 gene locus_tag LOCUS_03290 30429 29530 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_03290 30728 32374 gene locus_tag LOCUS_03300 gene rpoN 30728 32374 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_03300 32734 33114 gene locus_tag LOCUS_03310 gene yfiA-2 32734 33114 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_03310 33543 33343 gene locus_tag LOCUS_03320 33543 33343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 34048 33674 gene locus_tag LOCUS_03330 34048 33674 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_03330 35098 34073 gene locus_tag LOCUS_03340 gene rpoH 35098 34073 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_03340 35645 35178 gene locus_tag LOCUS_03350 35645 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 36182 37660 gene locus_tag LOCUS_03360 36182 37660 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ0 protein_id gnl|my_center|LOCUS_03360 38214 37765 gene locus_tag LOCUS_03370 38214 37765 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_03370 38635 38420 gene locus_tag LOCUS_03380 gene rpsU 38635 38420 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII8 protein_id gnl|my_center|LOCUS_03380 39005 39370 gene locus_tag LOCUS_03390 39005 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 39460 39963 gene locus_tag LOCUS_03400 39460 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 40185 41222 gene locus_tag LOCUS_03410 gene tsaD 40185 41222 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_03410 41267 41638 gene locus_tag LOCUS_03420 gene crcB 41267 41638 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y2N1 protein_id gnl|my_center|LOCUS_03420 42426 41839 gene locus_tag LOCUS_03430 42426 41839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347453.1 protein_id gnl|my_center|LOCUS_03430 42901 42449 gene locus_tag LOCUS_03440 42901 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 44018 43128 gene locus_tag LOCUS_03450 gene metR 44018 43128 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_03450 44898 44110 gene locus_tag LOCUS_03460 gene potC 44898 44110 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419249.1 protein_id gnl|my_center|LOCUS_03460 45776 44898 gene locus_tag LOCUS_03470 45776 44898 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 protein_id gnl|my_center|LOCUS_03470 47017 45776 gene locus_tag LOCUS_03480 gene potA 47017 45776 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PH3 protein_id gnl|my_center|LOCUS_03480 47449 48087 gene locus_tag LOCUS_03490 gene cynT 47449 48087 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_03490 48242 48799 gene locus_tag LOCUS_03500 gene gloA 48242 48799 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCX6 protein_id gnl|my_center|LOCUS_03500 48877 49851 gene locus_tag LOCUS_03510 48877 49851 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_03510 50595 50122 gene locus_tag LOCUS_03520 50595 50122 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 protein_id gnl|my_center|LOCUS_03520 51884 50886 gene locus_tag LOCUS_03530 gene hemF 51884 50886 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC3 protein_id gnl|my_center|LOCUS_03530 52551 51892 gene locus_tag LOCUS_03540 gene ribA 52551 51892 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_03540 53181 55142 gene locus_tag LOCUS_03550 gene dxs 53181 55142 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC1 protein_id gnl|my_center|LOCUS_03550 55496 56323 gene locus_tag LOCUS_03560 gene suhB 55496 56323 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 protein_id gnl|my_center|LOCUS_03560 57808 56381 gene locus_tag LOCUS_03570 57808 56381 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_03570 58767 57943 gene locus_tag LOCUS_03580 gene thiG 58767 57943 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_03580 59110 60663 gene locus_tag LOCUS_03590 gene xcpR 59110 60663 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_03590 61287 60811 gene locus_tag LOCUS_03600 61287 60811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 62103 61375 gene locus_tag LOCUS_03610 62103 61375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 62413 63876 gene locus_tag LOCUS_03620 62413 63876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 63889 65430 gene locus_tag LOCUS_03630 63889 65430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 65664 65740 gene locus_tag LOCUS_t00070 65664 65740 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65849 65925 gene locus_tag LOCUS_t00080 65849 65925 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65967 66042 gene locus_tag LOCUS_t00090 65967 66042 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 66477 67412 gene locus_tag LOCUS_03640 gene araC 66477 67412 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_03640 67705 68760 gene locus_tag LOCUS_03650 67705 68760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 68948 68790 gene locus_tag LOCUS_03660 68948 68790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 68989 70191 gene locus_tag LOCUS_03670 gene xcpS 68989 70191 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_03670 70794 71234 gene locus_tag LOCUS_03680 70794 71234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 71476 72042 gene locus_tag LOCUS_03690 71476 72042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 72090 74264 gene locus_tag LOCUS_03700 72090 74264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 74633 76045 gene locus_tag LOCUS_03710 74633 76045 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208542.1 protein_id gnl|my_center|LOCUS_03710 76086 76922 gene locus_tag LOCUS_03720 76086 76922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 77321 77136 gene locus_tag LOCUS_03730 77321 77136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 77251 77688 gene locus_tag LOCUS_03740 77251 77688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 77688 78254 gene locus_tag LOCUS_03750 77688 78254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 78254 79234 gene locus_tag LOCUS_03760 gene comB 78254 79234 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 protein_id gnl|my_center|LOCUS_03760 79256 80131 gene locus_tag LOCUS_03770 79256 80131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 80164 84147 gene locus_tag LOCUS_03780 80164 84147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 84160 84711 gene locus_tag LOCUS_03790 gene comE 84160 84711 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207810.1 protein_id gnl|my_center|LOCUS_03790 84711 85154 gene locus_tag LOCUS_03800 gene pilE 84711 85154 CDS product pilus assembly protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_03800 85518 85976 gene locus_tag LOCUS_03810 gene pilE 85518 85976 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_03810 86067 86516 gene locus_tag LOCUS_03820 gene pilE 86067 86516 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_03820 86595 87338 gene locus_tag LOCUS_03830 86595 87338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 87753 87430 gene locus_tag LOCUS_03840 gene fdxA 87753 87430 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_03840 90934 87851 gene locus_tag LOCUS_03850 gene mutS 90934 87851 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY01 protein_id gnl|my_center|LOCUS_03850 91394 94186 gene locus_tag LOCUS_03860 gene secA 91394 94186 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNT4 protein_id gnl|my_center|LOCUS_03860 94419 94949 gene locus_tag LOCUS_03870 94419 94949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 95621 95055 gene locus_tag LOCUS_03880 95621 95055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 96712 95864 gene locus_tag LOCUS_03890 96712 95864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUR8 protein_id gnl|my_center|LOCUS_03890 98350 97169 gene locus_tag LOCUS_03900 gene thlA 98350 97169 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_03900 99858 98500 gene locus_tag LOCUS_03910 gene hom 99858 98500 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK50 protein_id gnl|my_center|LOCUS_03910 101099 100245 gene locus_tag LOCUS_03920 gene dsbC 101099 100245 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_03920 101520 102449 gene locus_tag LOCUS_03930 101520 102449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_03930 106777 102575 gene locus_tag LOCUS_03940 gene rne 106777 102575 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY4 protein_id gnl|my_center|LOCUS_03940 107978 108988 gene locus_tag LOCUS_03950 gene rluC 107978 108988 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_03950 109128 109841 gene locus_tag LOCUS_03960 gene ppaX 109128 109841 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_03960 110694 109927 gene locus_tag LOCUS_03970 gene engB 110694 109927 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA1 protein_id gnl|my_center|LOCUS_03970 111365 111700 gene locus_tag LOCUS_03980 111365 111700 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096979.1 protein_id gnl|my_center|LOCUS_03980 112024 112692 gene locus_tag LOCUS_03990 gene cytcB 112024 112692 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_03990 113005 114132 gene locus_tag LOCUS_04000 113005 114132 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_04000 114120 114485 gene locus_tag LOCUS_04010 114120 114485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 114940 114536 gene locus_tag LOCUS_04020 gene bamE 114940 114536 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_04020 115283 115717 gene locus_tag LOCUS_04030 gene fur 115283 115717 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_04030 116975 115854 gene locus_tag LOCUS_04040 gene pilU 116975 115854 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_04040 118150 117095 gene locus_tag LOCUS_04050 gene pilT 118150 117095 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_04050 118507 119244 gene locus_tag LOCUS_04060 gene yggS 118507 119244 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_04060 120585 119311 gene locus_tag LOCUS_04070 120585 119311 CDS product UPF0053 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44717 protein_id gnl|my_center|LOCUS_04070 >Feature sequence04 2257 305 gene locus_tag LOCUS_04080 gene rpoD 2257 305 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF3 protein_id gnl|my_center|LOCUS_04080 4985 2760 gene locus_tag LOCUS_04090 4985 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6306 5125 gene locus_tag LOCUS_04100 gene comL 6306 5125 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH3 protein_id gnl|my_center|LOCUS_04100 7035 8276 gene locus_tag LOCUS_04110 gene rluD 7035 8276 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH4 protein_id gnl|my_center|LOCUS_04110 8390 9385 gene locus_tag LOCUS_04120 8390 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9489 10100 gene locus_tag LOCUS_04130 gene wrbA 9489 10100 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 protein_id gnl|my_center|LOCUS_04130 11078 12784 gene locus_tag LOCUS_04140 gene xdhA 11078 12784 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_04140 12882 15455 gene locus_tag LOCUS_04150 gene xdhB 12882 15455 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_04150 15418 16467 gene locus_tag LOCUS_04160 15418 16467 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889439.1 protein_id gnl|my_center|LOCUS_04160 16554 17984 gene locus_tag LOCUS_04170 16554 17984 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_04170 18655 18128 gene locus_tag LOCUS_04180 gene allA 18655 18128 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVG9 protein_id gnl|my_center|LOCUS_04180 19773 18655 gene locus_tag LOCUS_04190 gene alc1 19773 18655 CDS product putative allantoicase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T53 protein_id gnl|my_center|LOCUS_04190 20857 19877 gene locus_tag LOCUS_04200 20857 19877 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_04200 22262 20940 gene locus_tag LOCUS_04210 22262 20940 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_04210 22724 22356 gene locus_tag LOCUS_04220 22724 22356 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHE6 protein_id gnl|my_center|LOCUS_04220 23363 22842 gene locus_tag LOCUS_04230 gene uao 23363 22842 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207943.1 protein_id gnl|my_center|LOCUS_04230 23832 24497 gene locus_tag LOCUS_04240 23832 24497 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_04240 26010 24604 gene locus_tag LOCUS_04250 26010 24604 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 protein_id gnl|my_center|LOCUS_04250 27783 26491 gene locus_tag LOCUS_04260 gene tolB 27783 26491 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL57 protein_id gnl|my_center|LOCUS_04260 29087 28062 gene locus_tag LOCUS_04270 29087 28062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 29606 29145 gene locus_tag LOCUS_04280 gene tolR 29606 29145 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_04280 30325 29603 gene locus_tag LOCUS_04290 30325 29603 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_04290 30874 32169 gene locus_tag LOCUS_04300 30874 32169 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_04300 32879 36127 gene locus_tag LOCUS_04310 32879 36127 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FF3 protein_id gnl|my_center|LOCUS_04310 36139 36831 gene locus_tag LOCUS_04320 36139 36831 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263650.1 protein_id gnl|my_center|LOCUS_04320 38205 37021 gene locus_tag LOCUS_04330 38205 37021 CDS product putative ribosomal oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44683 protein_id gnl|my_center|LOCUS_04330 38324 38518 gene locus_tag LOCUS_04340 38324 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 40091 38700 gene locus_tag LOCUS_04350 gene purB 40091 38700 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX8 protein_id gnl|my_center|LOCUS_04350 41530 40304 gene locus_tag LOCUS_04360 gene trmU 41530 40304 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX6 protein_id gnl|my_center|LOCUS_04360 41791 42294 gene locus_tag LOCUS_04370 gene ispF 41791 42294 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE4 protein_id gnl|my_center|LOCUS_04370 42412 42762 gene locus_tag LOCUS_04380 gene grxD 42412 42762 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_04380 43042 43581 gene locus_tag LOCUS_04390 43042 43581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 43842 45737 gene locus_tag LOCUS_04400 gene mnmG 43842 45737 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW1 protein_id gnl|my_center|LOCUS_04400 45978 46937 gene locus_tag LOCUS_04410 45978 46937 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_04410 47204 47034 gene locus_tag LOCUS_04420 47204 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 48254 47235 gene locus_tag LOCUS_04430 48254 47235 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066859.1 protein_id gnl|my_center|LOCUS_04430 50719 48536 gene locus_tag LOCUS_04440 50719 48536 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_04440 52227 51298 gene locus_tag LOCUS_04450 gene gltC 52227 51298 CDS product cys regulon transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_04450 54933 52558 gene locus_tag LOCUS_04460 gene katG1 54933 52558 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E981 protein_id gnl|my_center|LOCUS_04460 55516 57141 gene locus_tag LOCUS_04470 55516 57141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 57190 58062 gene locus_tag LOCUS_04480 gene hemK 57190 58062 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT0 protein_id gnl|my_center|LOCUS_04480 58108 58899 gene locus_tag LOCUS_04490 gene moeB 58108 58899 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_04490 58981 60324 gene locus_tag LOCUS_04500 58981 60324 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_04500 60454 61707 gene locus_tag LOCUS_04510 60454 61707 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705343.1 protein_id gnl|my_center|LOCUS_04510 62218 61730 gene locus_tag LOCUS_04520 62218 61730 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_04520 62440 64224 gene locus_tag LOCUS_04530 gene leuA-2 62440 64224 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_04530 64504 65124 gene locus_tag LOCUS_04540 64504 65124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 66648 65287 gene locus_tag LOCUS_04550 gene accC 66648 65287 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 protein_id gnl|my_center|LOCUS_04550 67202 66774 gene locus_tag LOCUS_04560 gene accB 67202 66774 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_04560 68811 67444 gene locus_tag LOCUS_04570 gene norM 68811 67444 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_04570 69645 69157 gene locus_tag LOCUS_04580 69645 69157 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_04580 70103 71431 gene locus_tag LOCUS_04590 70103 71431 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_04590 71680 71540 gene locus_tag LOCUS_04600 71680 71540 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_04600 71705 71875 gene locus_tag LOCUS_04610 71705 71875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 71942 72502 gene locus_tag LOCUS_04620 gene trmL 71942 72502 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR4 protein_id gnl|my_center|LOCUS_04620 72954 72595 gene locus_tag LOCUS_04630 gene tusE 72954 72595 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF7 protein_id gnl|my_center|LOCUS_04630 73280 72951 gene locus_tag LOCUS_04640 73280 72951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 73657 73334 gene locus_tag LOCUS_04650 73657 73334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 74174 73710 gene locus_tag LOCUS_04660 gene tusD 74174 73710 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_04660 74573 77437 gene locus_tag LOCUS_04670 gene glnE 74573 77437 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY1 protein_id gnl|my_center|LOCUS_04670 77750 78679 gene locus_tag LOCUS_04680 gene ilvE 77750 78679 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_04680 78786 79622 gene locus_tag LOCUS_04690 78786 79622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706089.1 protein_id gnl|my_center|LOCUS_04690 79696 80562 gene locus_tag LOCUS_04700 79696 80562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 80628 81707 gene locus_tag LOCUS_04710 80628 81707 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_04710 81773 82342 gene locus_tag LOCUS_04720 81773 82342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 82352 82882 gene locus_tag LOCUS_04730 82352 82882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 83716 82949 gene locus_tag LOCUS_04740 83716 82949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 84813 83800 gene locus_tag LOCUS_04750 gene uge 84813 83800 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_04750 85979 84813 gene locus_tag LOCUS_04760 85979 84813 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_04760 87074 86073 gene locus_tag LOCUS_04770 87074 86073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_04770 87364 88485 gene locus_tag LOCUS_04780 gene wabH 87364 88485 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 protein_id gnl|my_center|LOCUS_04780 89353 88496 gene locus_tag LOCUS_04790 89353 88496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 90253 89459 gene locus_tag LOCUS_04800 90253 89459 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121837.1 protein_id gnl|my_center|LOCUS_04800 91364 90384 gene locus_tag LOCUS_04810 gene htrB 91364 90384 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_04810 93273 91432 gene locus_tag LOCUS_04820 gene aspS 93273 91432 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_04820 93633 94613 gene locus_tag LOCUS_04830 gene sohB 93633 94613 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 protein_id gnl|my_center|LOCUS_04830 94866 96131 gene locus_tag LOCUS_04840 94866 96131 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_04840 96321 97565 gene locus_tag LOCUS_04850 96321 97565 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_04850 97608 98369 gene locus_tag LOCUS_04860 gene gpmA 97608 98369 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_04860 98529 99398 gene locus_tag LOCUS_04870 98529 99398 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_04870 101186 99495 gene locus_tag LOCUS_04880 gene fadD 101186 99495 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_04880 103445 101748 gene locus_tag LOCUS_04890 gene fadD 103445 101748 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_04890 104800 104015 gene locus_tag LOCUS_04900 104800 104015 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_04900 105485 104895 gene locus_tag LOCUS_04910 105485 104895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_04910 106325 105738 gene locus_tag LOCUS_04920 106325 105738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 106607 106467 gene locus_tag LOCUS_04930 106607 106467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 106557 107381 gene locus_tag LOCUS_04940 106557 107381 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 protein_id gnl|my_center|LOCUS_04940 107555 108778 gene locus_tag LOCUS_04950 gene argJ 107555 108778 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_04950 109175 109573 gene locus_tag LOCUS_04960 109175 109573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 111126 109693 gene locus_tag LOCUS_04970 gene sdaB 111126 109693 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 protein_id gnl|my_center|LOCUS_04970 111679 113103 gene locus_tag LOCUS_04980 gene rutG 111679 113103 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207571.1 protein_id gnl|my_center|LOCUS_04980 114181 113249 gene locus_tag LOCUS_04990 114181 113249 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 protein_id gnl|my_center|LOCUS_04990 114565 115575 gene locus_tag LOCUS_05000 114565 115575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 116736 115687 gene locus_tag LOCUS_05010 116736 115687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_05010 116928 116764 gene locus_tag LOCUS_05020 gene rubA 116928 116764 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_05020 117278 117844 gene locus_tag LOCUS_05030 gene apt 117278 117844 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_05030 118383 117931 gene locus_tag LOCUS_05040 118383 117931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 119430 118486 gene locus_tag LOCUS_05050 gene tal 119430 118486 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL7 protein_id gnl|my_center|LOCUS_05050 >Feature sequence05 3872 987 gene locus_tag LOCUS_05060 gene sucA 3872 987 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_05060 5572 4811 gene locus_tag LOCUS_05070 gene sdhB 5572 4811 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_05070 7578 5728 gene locus_tag LOCUS_05080 gene sdhA 7578 5728 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_05080 8340 7933 gene locus_tag LOCUS_05090 gene sdhD 8340 7933 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_05090 8717 8340 gene locus_tag LOCUS_05100 gene sdhC 8717 8340 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 protein_id gnl|my_center|LOCUS_05100 9756 11036 gene locus_tag LOCUS_05110 gene gltA 9756 11036 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_05110 12067 11171 gene locus_tag LOCUS_05120 12067 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 12685 12152 gene locus_tag LOCUS_05130 12685 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13101 14390 gene locus_tag LOCUS_05140 gene rarA 13101 14390 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_05140 14701 15813 gene locus_tag LOCUS_05150 gene ribB 14701 15813 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_05150 16434 15946 gene locus_tag LOCUS_05160 16434 15946 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_05160 17525 16488 gene locus_tag LOCUS_05170 17525 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 18527 17694 gene locus_tag LOCUS_05180 gene hemD 18527 17694 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_05180 19822 18779 gene locus_tag LOCUS_05190 gene hemC 19822 18779 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_05190 20764 20027 gene locus_tag LOCUS_05200 gene algR 20764 20027 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_05200 22175 21024 gene locus_tag LOCUS_05210 22175 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22289 23662 gene locus_tag LOCUS_05220 gene argH 22289 23662 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_05220 24236 24526 gene locus_tag LOCUS_05230 24236 24526 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_05230 25392 24610 gene locus_tag LOCUS_05240 gene phoU 25392 24610 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_05240 26413 25493 gene locus_tag LOCUS_05250 gene pstB 26413 25493 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P379 protein_id gnl|my_center|LOCUS_05250 27396 26491 gene locus_tag LOCUS_05260 gene pstA 27396 26491 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSV4 protein_id gnl|my_center|LOCUS_05260 28299 27457 gene locus_tag LOCUS_05270 gene pstC 28299 27457 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBJ7 protein_id gnl|my_center|LOCUS_05270 29792 28620 gene locus_tag LOCUS_05280 gene pstS 29792 28620 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8I9 protein_id gnl|my_center|LOCUS_05280 30487 32613 gene locus_tag LOCUS_05290 gene thiC 30487 32613 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM1 protein_id gnl|my_center|LOCUS_05290 33578 32688 gene locus_tag LOCUS_05300 33578 32688 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_05300 34604 33756 gene locus_tag LOCUS_05310 34604 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809351.1 protein_id gnl|my_center|LOCUS_05310 35056 36879 gene locus_tag LOCUS_05320 35056 36879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980767.1 protein_id gnl|my_center|LOCUS_05320 36917 37807 gene locus_tag LOCUS_05330 36917 37807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_05330 37828 38445 gene locus_tag LOCUS_05340 37828 38445 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_05340 38933 38478 gene locus_tag LOCUS_05350 38933 38478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 39299 38973 gene locus_tag LOCUS_05360 39299 38973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 40551 39526 gene locus_tag LOCUS_05370 40551 39526 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480898.1 protein_id gnl|my_center|LOCUS_05370 41485 40730 gene locus_tag LOCUS_05380 41485 40730 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 protein_id gnl|my_center|LOCUS_05380 42802 41690 gene locus_tag LOCUS_05390 42802 41690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674011.1 protein_id gnl|my_center|LOCUS_05390 43507 45708 gene locus_tag LOCUS_05400 gene prlC 43507 45708 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_05400 45709 45966 gene locus_tag LOCUS_05410 45709 45966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 46088 46657 gene locus_tag LOCUS_05420 46088 46657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 46686 47249 gene locus_tag LOCUS_05430 46686 47249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 49465 47363 gene locus_tag LOCUS_05440 gene pnp 49465 47363 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE0 protein_id gnl|my_center|LOCUS_05440 50455 50189 gene locus_tag LOCUS_05450 gene rpsO 50455 50189 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_05450 51006 50830 gene locus_tag LOCUS_05460 51006 50830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 51294 51133 gene locus_tag LOCUS_05470 51294 51133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 51911 51387 gene locus_tag LOCUS_05480 51911 51387 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727021.1 protein_id gnl|my_center|LOCUS_05480 53335 52247 gene locus_tag LOCUS_05490 53335 52247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 53734 53345 gene locus_tag LOCUS_05500 gene rbfA 53734 53345 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_05500 56672 53937 gene locus_tag LOCUS_05510 gene infB 56672 53937 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB4 protein_id gnl|my_center|LOCUS_05510 58308 56824 gene locus_tag LOCUS_05520 gene nusA 58308 56824 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_05520 58946 58446 gene locus_tag LOCUS_05530 gene rimP 58946 58446 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_05530 59466 59390 gene locus_tag LOCUS_t00100 59466 59390 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59674 59591 gene locus_tag LOCUS_t00110 59674 59591 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60125 59817 gene locus_tag LOCUS_05540 gene secG 60125 59817 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_05540 61153 60341 gene locus_tag LOCUS_05550 gene tpiA 61153 60341 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2Y2 protein_id gnl|my_center|LOCUS_05550 61542 63257 gene locus_tag LOCUS_05560 gene pilB 61542 63257 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_05560 63703 64968 gene locus_tag LOCUS_05570 gene pilC 63703 64968 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_05570 64976 65878 gene locus_tag LOCUS_05580 64976 65878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 65983 66669 gene locus_tag LOCUS_05590 gene coaE 65983 66669 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_05590 67402 66632 gene locus_tag LOCUS_05600 gene rlmB 67402 66632 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA3 protein_id gnl|my_center|LOCUS_05600 67984 67649 gene locus_tag LOCUS_05610 67984 67649 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_05610 68704 70383 gene locus_tag LOCUS_05620 gene recN 68704 70383 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_05620 70502 71104 gene locus_tag LOCUS_05630 70502 71104 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_05630 71150 71731 gene locus_tag LOCUS_05640 71150 71731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 71817 72320 gene locus_tag LOCUS_05650 71817 72320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 72378 72704 gene locus_tag LOCUS_05660 72378 72704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 72734 73672 gene locus_tag LOCUS_05670 gene xerD 72734 73672 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_05670 73720 74058 gene locus_tag LOCUS_05680 gene ydzA 73720 74058 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_05680 75445 74738 gene locus_tag LOCUS_05690 75445 74738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 75651 76271 gene locus_tag LOCUS_05700 75651 76271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 77570 76362 gene locus_tag LOCUS_05710 77570 76362 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_05710 78877 77570 gene locus_tag LOCUS_05720 78877 77570 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_05720 79344 79961 gene locus_tag LOCUS_05730 79344 79961 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088377.1 protein_id gnl|my_center|LOCUS_05730 80142 81800 gene locus_tag LOCUS_05740 gene pepA 80142 81800 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_05740 81840 82343 gene locus_tag LOCUS_05750 81840 82343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 82700 83902 gene locus_tag LOCUS_05760 gene sstT 82700 83902 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5G9 protein_id gnl|my_center|LOCUS_05760 84303 83980 gene locus_tag LOCUS_05770 84303 83980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 85420 84404 gene locus_tag LOCUS_05780 gene cbpA 85420 84404 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_05780 86046 85753 gene locus_tag LOCUS_05790 86046 85753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_05790 86358 86059 gene locus_tag LOCUS_05800 gene borD 86358 86059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738423.1 protein_id gnl|my_center|LOCUS_05800 86623 87717 gene locus_tag LOCUS_05810 86623 87717 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_05810 88337 88699 gene locus_tag LOCUS_05820 88337 88699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 90838 88808 gene locus_tag LOCUS_05830 gene yheS 90838 88808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_05830 91370 91774 gene locus_tag LOCUS_05840 gene erpA 91370 91774 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_05840 92109 93692 gene locus_tag LOCUS_05850 gene gshA 92109 93692 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG2 protein_id gnl|my_center|LOCUS_05850 93745 94275 gene locus_tag LOCUS_05860 gene dsbB 93745 94275 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_05860 94813 95373 gene locus_tag LOCUS_05870 94813 95373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 95614 97101 gene locus_tag LOCUS_05880 gene mpl 95614 97101 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_05880 97482 97736 gene locus_tag LOCUS_05890 97482 97736 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378385.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence06 126 1007 gene locus_tag LOCUS_05900 126 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040388.1 protein_id gnl|my_center|LOCUS_05900 1020 1961 gene locus_tag LOCUS_05910 1020 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2028 5972 gene locus_tag LOCUS_05920 gene smc 2028 5972 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX4 protein_id gnl|my_center|LOCUS_05920 6188 7204 gene locus_tag LOCUS_05930 gene zipA 6188 7204 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX5 protein_id gnl|my_center|LOCUS_05930 7503 9617 gene locus_tag LOCUS_05940 gene ligA 7503 9617 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_05940 9818 10573 gene locus_tag LOCUS_05950 9818 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11039 11896 gene locus_tag LOCUS_05960 11039 11896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708750.1 protein_id gnl|my_center|LOCUS_05960 12469 11933 gene locus_tag LOCUS_05970 12469 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 13087 12677 gene locus_tag LOCUS_05980 13087 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15896 13422 gene locus_tag LOCUS_05990 15896 13422 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK01 protein_id gnl|my_center|LOCUS_05990 16332 17726 gene locus_tag LOCUS_06000 gene amt 16332 17726 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_06000 17737 18369 gene locus_tag LOCUS_06010 17737 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 19217 18462 gene locus_tag LOCUS_06020 19217 18462 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469191.1 protein_id gnl|my_center|LOCUS_06020 19831 19364 gene locus_tag LOCUS_06030 19831 19364 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44580 protein_id gnl|my_center|LOCUS_06030 20088 21095 gene locus_tag LOCUS_06040 20088 21095 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44579 protein_id gnl|my_center|LOCUS_06040 21874 21368 gene locus_tag LOCUS_06050 gene smpB 21874 21368 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_06050 22097 22615 gene locus_tag LOCUS_06060 gene coaD 22097 22615 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN4 protein_id gnl|my_center|LOCUS_06060 22711 22959 gene locus_tag LOCUS_06070 22711 22959 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_06070 23015 24334 gene locus_tag LOCUS_06080 23015 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 24337 25053 gene locus_tag LOCUS_06090 gene bioD 24337 25053 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K085 protein_id gnl|my_center|LOCUS_06090 25653 25729 gene locus_tag LOCUS_t00120 25653 25729 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26134 27933 gene locus_tag LOCUS_06100 gene lepA 26134 27933 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL5 protein_id gnl|my_center|LOCUS_06100 28036 28938 gene locus_tag LOCUS_06110 gene lepB 28036 28938 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_06110 29082 29474 gene locus_tag LOCUS_06120 29082 29474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29578 30375 gene locus_tag LOCUS_06130 gene rnc 29578 30375 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL2 protein_id gnl|my_center|LOCUS_06130 30573 31655 gene locus_tag LOCUS_06140 gene era 30573 31655 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_06140 31718 32494 gene locus_tag LOCUS_06150 31718 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 33428 32700 gene locus_tag LOCUS_06160 33428 32700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 34293 35477 gene locus_tag LOCUS_06170 34293 35477 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406743.1 protein_id gnl|my_center|LOCUS_06170 35826 37676 gene locus_tag LOCUS_06180 gene typA 35826 37676 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_06180 37949 38392 gene locus_tag LOCUS_06190 gene mscL 37949 38392 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_06190 38946 38506 gene locus_tag LOCUS_06200 38946 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 40103 39237 gene locus_tag LOCUS_06210 gene mutM 40103 39237 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_06210 42759 40222 gene locus_tag LOCUS_06220 gene relA 42759 40222 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_06220 44693 43140 gene locus_tag LOCUS_06230 gene rlmD 44693 43140 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC1 protein_id gnl|my_center|LOCUS_06230 45580 44756 gene locus_tag LOCUS_06240 45580 44756 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_06240 46579 45608 gene locus_tag LOCUS_06250 gene cysM 46579 45608 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_06250 46738 46589 gene locus_tag LOCUS_06260 46738 46589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 47138 50605 gene locus_tag LOCUS_06270 47138 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 51094 51906 gene locus_tag LOCUS_06280 gene ech1 51094 51906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_06280 52043 51903 gene locus_tag LOCUS_06290 52043 51903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 52200 53459 gene locus_tag LOCUS_06300 gene bcr 52200 53459 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_06300 53784 54656 gene locus_tag LOCUS_06310 53784 54656 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_06310 54738 56948 gene locus_tag LOCUS_06320 54738 56948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 57011 57373 gene locus_tag LOCUS_06330 gene cheY 57011 57373 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4H5 protein_id gnl|my_center|LOCUS_06330 57404 57853 gene locus_tag LOCUS_06340 57404 57853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 57892 58341 gene locus_tag LOCUS_06350 57892 58341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 58737 59522 gene locus_tag LOCUS_06360 gene rpsB 58737 59522 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ76 protein_id gnl|my_center|LOCUS_06360 59885 60766 gene locus_tag LOCUS_06370 gene tsf 59885 60766 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ75 protein_id gnl|my_center|LOCUS_06370 61771 60962 gene locus_tag LOCUS_06380 gene vII 61771 60962 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_06380 62966 62277 gene locus_tag LOCUS_06390 gene lrgB 62966 62277 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_06390 63357 62983 gene locus_tag LOCUS_06400 63357 62983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_06400 65201 63768 gene locus_tag LOCUS_06410 gene hflX 65201 63768 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ5 protein_id gnl|my_center|LOCUS_06410 65509 66309 gene locus_tag LOCUS_06420 gene plsC 65509 66309 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_06420 67485 66445 gene locus_tag LOCUS_06430 gene tas 67485 66445 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_06430 68030 67533 gene locus_tag LOCUS_06440 gene yaaD 68030 67533 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM2 protein_id gnl|my_center|LOCUS_06440 68189 68860 gene locus_tag LOCUS_06450 68189 68860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_06450 68881 69693 gene locus_tag LOCUS_06460 68881 69693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 70473 69823 gene locus_tag LOCUS_06470 70473 69823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 73327 70466 gene locus_tag LOCUS_06480 gene ileS 73327 70466 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM4 protein_id gnl|my_center|LOCUS_06480 74337 73780 gene locus_tag LOCUS_06490 74337 73780 CDS product thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43787 protein_id gnl|my_center|LOCUS_06490 76082 74445 gene locus_tag LOCUS_06500 76082 74445 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_06500 76616 77245 gene locus_tag LOCUS_06510 76616 77245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 78785 77343 gene locus_tag LOCUS_06520 78785 77343 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_06520 79121 80347 gene locus_tag LOCUS_06530 gene serA 79121 80347 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_06530 81565 80492 gene locus_tag LOCUS_06540 81565 80492 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_06540 82410 81829 gene locus_tag LOCUS_06550 82410 81829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_06550 83428 82811 gene locus_tag LOCUS_06560 gene metW 83428 82811 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_06560 84864 83425 gene locus_tag LOCUS_06570 gene metX 84864 83425 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_06570 85221 86240 gene locus_tag LOCUS_06580 gene hemH 85221 86240 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_06580 86706 86356 gene locus_tag LOCUS_06590 86706 86356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 87510 86974 gene locus_tag LOCUS_06600 87510 86974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 90759 87772 gene locus_tag LOCUS_06610 gene polA 90759 87772 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_06610 91387 90974 gene locus_tag LOCUS_06620 gene osmC 91387 90974 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 protein_id gnl|my_center|LOCUS_06620 91642 92544 gene locus_tag LOCUS_06630 91642 92544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence07 460 819 gene locus_tag LOCUS_06640 460 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_06640 1203 1877 gene locus_tag LOCUS_06650 1203 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1882 2415 gene locus_tag LOCUS_06660 1882 2415 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_06660 2415 2828 gene locus_tag LOCUS_06670 2415 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3820 2915 gene locus_tag LOCUS_06680 3820 2915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_06680 3980 4693 gene locus_tag LOCUS_06690 3980 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_06690 4761 5714 gene locus_tag LOCUS_06700 4761 5714 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D3 protein_id gnl|my_center|LOCUS_06700 5922 6533 gene locus_tag LOCUS_06710 5922 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 protein_id gnl|my_center|LOCUS_06710 7141 6707 gene locus_tag LOCUS_06720 7141 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_06720 8085 7354 gene locus_tag LOCUS_06730 8085 7354 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 protein_id gnl|my_center|LOCUS_06730 9268 8201 gene locus_tag LOCUS_06740 gene nadR 9268 8201 CDS product trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 protein_id gnl|my_center|LOCUS_06740 9782 10063 gene locus_tag LOCUS_06750 9782 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10397 10561 gene locus_tag LOCUS_06760 10397 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10578 11516 gene locus_tag LOCUS_06770 gene glyQ 10578 11516 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_06770 11526 13619 gene locus_tag LOCUS_06780 gene glyS 11526 13619 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_06780 13869 14165 gene locus_tag LOCUS_06790 13869 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14764 14312 gene locus_tag LOCUS_06800 14764 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 15249 14872 gene locus_tag LOCUS_06810 15249 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 15462 16115 gene locus_tag LOCUS_06820 15462 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_06820 16207 17445 gene locus_tag LOCUS_06830 16207 17445 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML86 protein_id gnl|my_center|LOCUS_06830 17600 18328 gene locus_tag LOCUS_06840 17600 18328 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530383.1 protein_id gnl|my_center|LOCUS_06840 19203 20417 gene locus_tag LOCUS_06850 gene rtcB 19203 20417 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA2 protein_id gnl|my_center|LOCUS_06850 20550 20786 gene locus_tag LOCUS_06860 20550 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 22381 20888 gene locus_tag LOCUS_06870 gene miaB 22381 20888 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_06870 22729 24861 gene locus_tag LOCUS_06880 gene slt 22729 24861 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_06880 25326 25967 gene locus_tag LOCUS_06890 25326 25967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_06890 26364 27353 gene locus_tag LOCUS_06900 gene mdh 26364 27353 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_06900 27641 27880 gene locus_tag LOCUS_06910 27641 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 protein_id gnl|my_center|LOCUS_06910 29134 28067 gene locus_tag LOCUS_06920 gene ribF 29134 28067 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_06920 29380 29991 gene locus_tag LOCUS_06930 29380 29991 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_06930 30617 30003 gene locus_tag LOCUS_06940 30617 30003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 32246 30747 gene locus_tag LOCUS_06950 gene mviN 32246 30747 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_06950 33045 32422 gene locus_tag LOCUS_06960 gene ampD 33045 32422 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_06960 33275 34378 gene locus_tag LOCUS_06970 33275 34378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 34394 35359 gene locus_tag LOCUS_06980 34394 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06980 35420 36259 gene locus_tag LOCUS_06990 35420 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_06990 36333 37325 gene locus_tag LOCUS_07000 36333 37325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37388 38104 gene locus_tag LOCUS_07010 gene pyrE 37388 38104 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_07010 38169 39140 gene locus_tag LOCUS_07020 gene gshB 38169 39140 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_07020 39417 40502 gene locus_tag LOCUS_07030 gene murG 39417 40502 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_07030 40589 42028 gene locus_tag LOCUS_07040 gene murC 40589 42028 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_07040 42052 43152 gene locus_tag LOCUS_07050 gene ddlB 42052 43152 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_07050 43804 44460 gene locus_tag LOCUS_07060 43804 44460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 44573 45910 gene locus_tag LOCUS_07070 gene ftsA 44573 45910 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_07070 46181 47386 gene locus_tag LOCUS_07080 gene ftsZ 46181 47386 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_07080 47704 48621 gene locus_tag LOCUS_07090 gene lpxC 47704 48621 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC2 protein_id gnl|my_center|LOCUS_07090 49435 48920 gene locus_tag LOCUS_07100 49435 48920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 49681 50409 gene locus_tag LOCUS_07110 49681 50409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 51271 50546 gene locus_tag LOCUS_07120 51271 50546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 51842 51531 gene locus_tag LOCUS_07130 51842 51531 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_07130 52177 52809 gene locus_tag LOCUS_07140 gene rlmE 52177 52809 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_07140 53211 55106 gene locus_tag LOCUS_07150 gene ftsH 53211 55106 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV4 protein_id gnl|my_center|LOCUS_07150 55271 56194 gene locus_tag LOCUS_07160 55271 56194 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV3 protein_id gnl|my_center|LOCUS_07160 56289 56570 gene locus_tag LOCUS_07170 56289 56570 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_07170 56623 57072 gene locus_tag LOCUS_07180 56623 57072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 57327 58040 gene locus_tag LOCUS_07190 57327 58040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_07190 59249 58167 gene locus_tag LOCUS_07200 59249 58167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 60354 59302 gene locus_tag LOCUS_07210 gene recA 60354 59302 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW5 protein_id gnl|my_center|LOCUS_07210 62230 61391 gene locus_tag LOCUS_07220 gene trmB 62230 61391 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI97 protein_id gnl|my_center|LOCUS_07220 62424 63353 gene locus_tag LOCUS_07230 62424 63353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 65263 63377 gene locus_tag LOCUS_07240 gene kefB 65263 63377 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_07240 66058 65354 gene locus_tag LOCUS_07250 66058 65354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_07250 67748 66633 gene locus_tag LOCUS_07260 gene czcD 67748 66633 CDS product cadmium, cobalt and zinc/H(+)-K(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07084 protein_id gnl|my_center|LOCUS_07260 70254 67966 gene locus_tag LOCUS_07270 gene priA 70254 67966 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE7 protein_id gnl|my_center|LOCUS_07270 70771 70391 gene locus_tag LOCUS_07280 70771 70391 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_07280 73114 70916 gene locus_tag LOCUS_07290 gene spoT 73114 70916 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_07290 73725 73465 gene locus_tag LOCUS_07300 gene rpoZ 73725 73465 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ3 protein_id gnl|my_center|LOCUS_07300 74526 73900 gene locus_tag LOCUS_07310 gene gmk 74526 73900 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_07310 74880 75836 gene locus_tag LOCUS_07320 gene ispH 74880 75836 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_07320 75890 76138 gene locus_tag LOCUS_07330 75890 76138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 76202 77017 gene locus_tag LOCUS_07340 76202 77017 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206444.1 protein_id gnl|my_center|LOCUS_07340 77480 79441 gene locus_tag LOCUS_07350 gene htpG 77480 79441 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKR1 protein_id gnl|my_center|LOCUS_07350 79888 81240 gene locus_tag LOCUS_07360 79888 81240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_07360 81339 82229 gene locus_tag LOCUS_07370 gene esd 81339 82229 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ7 protein_id gnl|my_center|LOCUS_07370 82369 82737 gene locus_tag LOCUS_07380 82369 82737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 82851 83540 gene locus_tag LOCUS_07390 gene rpe 82851 83540 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_07390 83652 84026 gene locus_tag LOCUS_07400 83652 84026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 84133 84444 gene locus_tag LOCUS_07410 84133 84444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 84663 84974 gene locus_tag LOCUS_07420 84663 84974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence08 965 2899 gene locus_tag LOCUS_07430 gene thrS 965 2899 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND4 protein_id gnl|my_center|LOCUS_07430 2923 3426 gene locus_tag LOCUS_07440 gene infC 2923 3426 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65138 protein_id gnl|my_center|LOCUS_07440 3759 5003 gene locus_tag LOCUS_07450 3759 5003 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887770.1 protein_id gnl|my_center|LOCUS_07450 5143 7407 gene locus_tag LOCUS_07460 gene rnr 5143 7407 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_07460 7796 7497 gene locus_tag LOCUS_07470 7796 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 9506 7878 gene locus_tag LOCUS_07480 9506 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10333 9596 gene locus_tag LOCUS_07490 gene hisA 10333 9596 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_07490 11415 12767 gene locus_tag LOCUS_07500 gene nqrA 11415 12767 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA6 protein_id gnl|my_center|LOCUS_07500 12773 14008 gene locus_tag LOCUS_07510 gene nqrB 12773 14008 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_07510 13989 14891 gene locus_tag LOCUS_07520 gene nqrC 13989 14891 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_07520 14893 15564 gene locus_tag LOCUS_07530 gene nqrD 14893 15564 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_07530 15564 16172 gene locus_tag LOCUS_07540 gene nqrE 15564 16172 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_07540 16295 17530 gene locus_tag LOCUS_07550 gene nqrF 16295 17530 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_07550 17708 18508 gene locus_tag LOCUS_07560 17708 18508 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_07560 18739 19818 gene locus_tag LOCUS_07570 18739 19818 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_07570 19963 20208 gene locus_tag LOCUS_07580 19963 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 20598 21752 gene locus_tag LOCUS_07590 20598 21752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_07590 21942 22778 gene locus_tag LOCUS_07600 21942 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 22791 23507 gene locus_tag LOCUS_07610 22791 23507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_07610 23504 26131 gene locus_tag LOCUS_07620 23504 26131 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_07620 26275 27225 gene locus_tag LOCUS_07630 26275 27225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 27222 27923 gene locus_tag LOCUS_07640 27222 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 28270 29586 gene locus_tag LOCUS_07650 gene avtA 28270 29586 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225657.1 protein_id gnl|my_center|LOCUS_07650 30580 29717 gene locus_tag LOCUS_07660 30580 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 31838 30906 gene locus_tag LOCUS_07670 gene hchA 31838 30906 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_07670 32422 31991 gene locus_tag LOCUS_07680 32422 31991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 33175 32540 gene locus_tag LOCUS_07690 gene hisH 33175 32540 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_07690 33967 33320 gene locus_tag LOCUS_07700 gene hisB 33967 33320 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL4 protein_id gnl|my_center|LOCUS_07700 34367 34789 gene locus_tag LOCUS_07710 34367 34789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 34912 34987 gene locus_tag LOCUS_t00130 34912 34987 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35172 35672 gene locus_tag LOCUS_07720 35172 35672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_07720 35913 36596 gene locus_tag LOCUS_07730 gene gph 35913 36596 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_07730 38232 36646 gene locus_tag LOCUS_07740 gene yifB 38232 36646 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_07740 38530 40101 gene locus_tag LOCUS_07750 gene hemN 38530 40101 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_07750 41060 40179 gene locus_tag LOCUS_07760 gene qmcA 41060 40179 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_07760 41747 41151 gene locus_tag LOCUS_07770 41747 41151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42491 41940 gene locus_tag LOCUS_07780 42491 41940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 43249 42710 gene locus_tag LOCUS_07790 43249 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 43533 44765 gene locus_tag LOCUS_07800 gene bioF 43533 44765 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44422 protein_id gnl|my_center|LOCUS_07800 44816 45673 gene locus_tag LOCUS_07810 44816 45673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 47742 45802 gene locus_tag LOCUS_07820 gene dnaK 47742 45802 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE6 protein_id gnl|my_center|LOCUS_07820 48526 47927 gene locus_tag LOCUS_07830 gene grpE 48526 47927 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_07830 48976 50370 gene locus_tag LOCUS_07840 48976 50370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 51524 50388 gene locus_tag LOCUS_07850 51524 50388 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793744.1 protein_id gnl|my_center|LOCUS_07850 52583 51612 gene locus_tag LOCUS_07860 52583 51612 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_07860 52853 52665 gene locus_tag LOCUS_07870 52853 52665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 53540 52911 gene locus_tag LOCUS_07880 gene yrdC 53540 52911 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_07880 54917 53664 gene locus_tag LOCUS_07890 gene smf 54917 53664 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_07890 56120 54975 gene locus_tag LOCUS_07900 56120 54975 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_07900 57830 56409 gene locus_tag LOCUS_07910 gene thrC 57830 56409 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 protein_id gnl|my_center|LOCUS_07910 59460 57877 gene locus_tag LOCUS_07920 gene sun 59460 57877 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_07920 60629 59541 gene locus_tag LOCUS_07930 gene fmt 60629 59541 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL4 protein_id gnl|my_center|LOCUS_07930 60944 63808 gene locus_tag LOCUS_07940 60944 63808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 64679 64005 gene locus_tag LOCUS_07950 gene ribC 64679 64005 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_07950 66156 65101 gene locus_tag LOCUS_07960 gene ribD 66156 65101 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_07960 66728 66270 gene locus_tag LOCUS_07970 gene nrdR 66728 66270 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_07970 68267 66816 gene locus_tag LOCUS_07980 gene mnmE 68267 66816 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_07980 70142 68460 gene locus_tag LOCUS_07990 gene yidC 70142 68460 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH0 protein_id gnl|my_center|LOCUS_07990 71099 70728 gene locus_tag LOCUS_08000 71099 70728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 71420 71286 gene locus_tag LOCUS_08010 gene rpmH 71420 71286 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH2 protein_id gnl|my_center|LOCUS_08010 72011 73456 gene locus_tag LOCUS_08020 gene dnaA 72011 73456 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_08020 73616 74791 gene locus_tag LOCUS_08030 gene dnaN 73616 74791 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_08030 74921 76153 gene locus_tag LOCUS_08040 gene recF 74921 76153 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_08040 76686 79316 gene locus_tag LOCUS_08050 gene gyrB 76686 79316 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH7 protein_id gnl|my_center|LOCUS_08050 79443 80012 gene locus_tag LOCUS_08060 79443 80012 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_08060 81246 80224 gene locus_tag LOCUS_08070 gene rlmF 81246 80224 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYC3 protein_id gnl|my_center|LOCUS_08070 82030 81338 gene locus_tag LOCUS_08080 gene rhtC 82030 81338 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114256.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence09 2170 296 gene locus_tag LOCUS_08090 gene ppiD 2170 296 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_08090 2779 2507 gene locus_tag LOCUS_08100 gene hup 2779 2507 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_08100 3285 3929 gene locus_tag LOCUS_08110 3285 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4399 4908 gene locus_tag LOCUS_08120 4399 4908 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_08120 4905 6131 gene locus_tag LOCUS_08130 gene iscS 4905 6131 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 protein_id gnl|my_center|LOCUS_08130 6301 6711 gene locus_tag LOCUS_08140 gene iscU 6301 6711 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_08140 6935 7255 gene locus_tag LOCUS_08150 6935 7255 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_08150 7394 7975 gene locus_tag LOCUS_08160 gene hscB 7394 7975 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z8 protein_id gnl|my_center|LOCUS_08160 8186 10066 gene locus_tag LOCUS_08170 gene hscA 8186 10066 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_08170 10153 10491 gene locus_tag LOCUS_08180 gene fdx 10153 10491 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_08180 11703 10594 gene locus_tag LOCUS_08190 11703 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12783 12352 gene locus_tag LOCUS_08200 12783 12352 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_08200 16662 12952 gene locus_tag LOCUS_08210 gene mfd 16662 12952 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX8 protein_id gnl|my_center|LOCUS_08210 17390 16869 gene locus_tag LOCUS_08220 gene menG 17390 16869 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_08220 18182 17481 gene locus_tag LOCUS_08230 18182 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 18647 18913 gene locus_tag LOCUS_08240 gene rpsT 18647 18913 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_08240 19931 19056 gene locus_tag LOCUS_08250 gene gpmA 19931 19056 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_08250 20844 20047 gene locus_tag LOCUS_08260 20844 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_08260 21757 21059 gene locus_tag LOCUS_08270 gene pyrF 21757 21059 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_08270 22238 21831 gene locus_tag LOCUS_08280 22238 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 22601 22296 gene locus_tag LOCUS_08290 gene himD 22601 22296 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_08290 24598 22910 gene locus_tag LOCUS_08300 gene rpsA 24598 22910 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD7 protein_id gnl|my_center|LOCUS_08300 25666 24899 gene locus_tag LOCUS_08310 gene cmk1 25666 24899 CDS product cytidylate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43892 protein_id gnl|my_center|LOCUS_08310 26426 25854 gene locus_tag LOCUS_08320 gene yfhC 26426 25854 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_08320 27164 26427 gene locus_tag LOCUS_08330 gene ung 27164 26427 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_08330 29878 27332 gene locus_tag LOCUS_08340 29878 27332 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082850.1 protein_id gnl|my_center|LOCUS_08340 30973 30578 gene locus_tag LOCUS_08350 gene clpS 30973 30578 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_08350 32000 31134 gene locus_tag LOCUS_08360 32000 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 33171 32104 gene locus_tag LOCUS_08370 gene argC 33171 32104 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_08370 34523 33387 gene locus_tag LOCUS_08380 gene hemE 34523 33387 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS6 protein_id gnl|my_center|LOCUS_08380 35825 34653 gene locus_tag LOCUS_08390 gene proB 35825 34653 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ0 protein_id gnl|my_center|LOCUS_08390 37109 35904 gene locus_tag LOCUS_08400 gene yhbZ 37109 35904 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_08400 38832 37399 gene locus_tag LOCUS_08410 gene gap 38832 37399 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ4 protein_id gnl|my_center|LOCUS_08410 40369 39185 gene locus_tag LOCUS_08420 40369 39185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 41942 40803 gene locus_tag LOCUS_08430 41942 40803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 42238 42402 gene locus_tag LOCUS_08440 42238 42402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 47530 42536 gene locus_tag LOCUS_08450 47530 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 51062 47631 gene locus_tag LOCUS_08460 51062 47631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 51515 52846 gene locus_tag LOCUS_08470 gene lplT 51515 52846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_08470 53030 53674 gene locus_tag LOCUS_08480 gene coq7 53030 53674 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_08480 53864 55051 gene locus_tag LOCUS_08490 53864 55051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 55422 57893 gene locus_tag LOCUS_08500 55422 57893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 58346 59845 gene locus_tag LOCUS_08510 58346 59845 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 protein_id gnl|my_center|LOCUS_08510 59845 60861 gene locus_tag LOCUS_08520 59845 60861 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886238.1 protein_id gnl|my_center|LOCUS_08520 60954 61103 gene locus_tag LOCUS_08530 60954 61103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 62025 61282 gene locus_tag LOCUS_08540 gene mpg1 62025 61282 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_08540 63151 62075 gene locus_tag LOCUS_08550 63151 62075 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_08550 63564 66614 gene locus_tag LOCUS_08560 gene lptD 63564 66614 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB2 protein_id gnl|my_center|LOCUS_08560 66864 68165 gene locus_tag LOCUS_08570 gene surA 66864 68165 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB1 protein_id gnl|my_center|LOCUS_08570 69830 68700 gene locus_tag LOCUS_08580 69830 68700 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_08580 70286 71419 gene locus_tag LOCUS_08590 gene asd 70286 71419 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_08590 71832 71521 gene locus_tag LOCUS_08600 71832 71521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 71932 73083 gene locus_tag LOCUS_08610 gene tgt 71932 73083 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_08610 74560 73208 gene locus_tag LOCUS_08620 74560 73208 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_08620 75657 74878 gene locus_tag LOCUS_08630 gene lpxA2 75657 74878 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_08630 76367 75831 gene locus_tag LOCUS_08640 gene fabZ 76367 75831 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_08640 77436 76420 gene locus_tag LOCUS_08650 gene lpxD 77436 76420 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_08650 79997 77583 gene locus_tag LOCUS_08660 gene yaeT 79997 77583 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC9 protein_id gnl|my_center|LOCUS_08660 81636 80260 gene locus_tag LOCUS_08670 81636 80260 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_08670 >Feature sequence10 333 1067 gene locus_tag LOCUS_08680 333 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2442 1078 gene locus_tag LOCUS_08690 2442 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230888.1 protein_id gnl|my_center|LOCUS_08690 4010 2808 gene locus_tag LOCUS_08700 gene nhaA 4010 2808 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBX2 protein_id gnl|my_center|LOCUS_08700 4510 5265 gene locus_tag LOCUS_08710 gene yfcA 4510 5265 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB6 protein_id gnl|my_center|LOCUS_08710 6737 5361 gene locus_tag LOCUS_08720 6737 5361 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_08720 10136 7230 gene locus_tag LOCUS_08730 gene fadE 10136 7230 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_08730 11182 10499 gene locus_tag LOCUS_08740 11182 10499 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_08740 11311 12693 gene locus_tag LOCUS_08750 gene dfp 11311 12693 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_08750 12736 13518 gene locus_tag LOCUS_08760 12736 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212540.1 protein_id gnl|my_center|LOCUS_08760 13880 13674 gene locus_tag LOCUS_08770 13880 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14854 13937 gene locus_tag LOCUS_08780 14854 13937 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_08780 15632 14964 gene locus_tag LOCUS_08790 15632 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 16874 15765 gene locus_tag LOCUS_08800 16874 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 17021 17650 gene locus_tag LOCUS_08810 gene ccmA 17021 17650 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_08810 17696 18442 gene locus_tag LOCUS_08820 17696 18442 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ8 protein_id gnl|my_center|LOCUS_08820 18635 19456 gene locus_tag LOCUS_08830 gene ccmC 18635 19456 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_08830 19473 19694 gene locus_tag LOCUS_08840 19473 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19949 20449 gene locus_tag LOCUS_08850 gene ccmE 19949 20449 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR01 protein_id gnl|my_center|LOCUS_08850 21384 20536 gene locus_tag LOCUS_08860 21384 20536 CDS product 2,5-didehydrogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388041.1 protein_id gnl|my_center|LOCUS_08860 22714 21734 gene locus_tag LOCUS_08870 22714 21734 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F501 protein_id gnl|my_center|LOCUS_08870 23600 22884 gene locus_tag LOCUS_08880 23600 22884 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 protein_id gnl|my_center|LOCUS_08880 24360 23590 gene locus_tag LOCUS_08890 24360 23590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_08890 26666 24615 gene locus_tag LOCUS_08900 26666 24615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 27465 26743 gene locus_tag LOCUS_08910 27465 26743 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_08910 28993 27773 gene locus_tag LOCUS_08920 28993 27773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 29708 30085 gene locus_tag LOCUS_08930 gene pilG 29708 30085 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_08930 30269 30631 gene locus_tag LOCUS_08940 gene pilH 30269 30631 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_08940 30635 31165 gene locus_tag LOCUS_08950 gene pilI 30635 31165 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_08950 31340 32755 gene locus_tag LOCUS_08960 31340 32755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 32865 33800 gene locus_tag LOCUS_08970 gene pilK 32865 33800 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_08970 33831 40754 gene locus_tag LOCUS_08980 33831 40754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 40744 41745 gene locus_tag LOCUS_08990 gene chpB 40744 41745 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_08990 41763 42260 gene locus_tag LOCUS_09000 41763 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 42489 42923 gene locus_tag LOCUS_09010 42489 42923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 43360 43067 gene locus_tag LOCUS_09020 gene minE 43360 43067 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_09020 44172 43360 gene locus_tag LOCUS_09030 gene minD 44172 43360 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL0 protein_id gnl|my_center|LOCUS_09030 45414 44587 gene locus_tag LOCUS_09040 gene minC 45414 44587 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL1 protein_id gnl|my_center|LOCUS_09040 46582 45491 gene locus_tag LOCUS_09050 46582 45491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_09050 47889 46924 gene locus_tag LOCUS_09060 gene yihG 47889 46924 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_09060 48118 48255 gene locus_tag LOCUS_09070 48118 48255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 48338 48994 gene locus_tag LOCUS_09080 gene yiaD 48338 48994 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_09080 49421 50878 gene locus_tag LOCUS_09090 49421 50878 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261810.1 protein_id gnl|my_center|LOCUS_09090 51189 52754 gene locus_tag LOCUS_09100 51189 52754 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261811.1 protein_id gnl|my_center|LOCUS_09100 52838 53989 gene locus_tag LOCUS_09110 52838 53989 CDS product iron-regulated protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457822.1 protein_id gnl|my_center|LOCUS_09110 54017 55525 gene locus_tag LOCUS_09120 54017 55525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 55575 56222 gene locus_tag LOCUS_09130 55575 56222 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_09130 56416 57018 gene locus_tag LOCUS_09140 gene tpm 56416 57018 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_09140 57667 56996 gene locus_tag LOCUS_09150 57667 56996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_09150 58599 57691 gene locus_tag LOCUS_09160 58599 57691 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_09160 58882 59448 gene locus_tag LOCUS_09170 58882 59448 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_09170 60113 59865 gene locus_tag LOCUS_09180 60113 59865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 protein_id gnl|my_center|LOCUS_09180 60476 62053 gene locus_tag LOCUS_09190 60476 62053 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_09190 62318 63766 gene locus_tag LOCUS_09200 62318 63766 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269396.1 protein_id gnl|my_center|LOCUS_09200 64589 63840 gene locus_tag LOCUS_09210 64589 63840 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_09210 65104 64772 gene locus_tag LOCUS_09220 gene blh 65104 64772 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_09220 65513 65178 gene locus_tag LOCUS_09230 gene blh 65513 65178 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_09230 67448 65739 gene locus_tag LOCUS_09240 67448 65739 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_09240 67928 67503 gene locus_tag LOCUS_09250 67928 67503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 68130 67936 gene locus_tag LOCUS_09260 68130 67936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 68158 69030 gene locus_tag LOCUS_09270 68158 69030 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_09270 69170 69607 gene locus_tag LOCUS_09280 gene trx 69170 69607 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_09280 70148 69747 gene locus_tag LOCUS_09290 70148 69747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 70693 70334 gene locus_tag LOCUS_09300 70693 70334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 71074 70754 gene locus_tag LOCUS_09310 gene bolA 71074 70754 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_09310 72115 71303 gene locus_tag LOCUS_09320 72115 71303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_09320 72699 72773 gene locus_tag LOCUS_t00140 72699 72773 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 73742 73104 gene locus_tag LOCUS_09330 73742 73104 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939294.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 73951 73829 gene locus_tag LOCUS_09340 73951 73829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 74150 73998 gene locus_tag LOCUS_09350 74150 73998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence11 981 199 gene locus_tag LOCUS_09360 981 199 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_09360 1290 2735 gene locus_tag LOCUS_09370 1290 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4543 2873 gene locus_tag LOCUS_09380 4543 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_09380 5006 5737 gene locus_tag LOCUS_09390 gene fklB 5006 5737 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_09390 7139 5832 gene locus_tag LOCUS_09400 gene argA 7139 5832 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN4 protein_id gnl|my_center|LOCUS_09400 7496 8083 gene locus_tag LOCUS_09410 7496 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9151 8225 gene locus_tag LOCUS_09420 gene ylbK 9151 8225 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_09420 9513 11864 gene locus_tag LOCUS_09430 9513 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 11938 12621 gene locus_tag LOCUS_09440 11938 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 12724 14079 gene locus_tag LOCUS_09450 12724 14079 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_09450 14076 17165 gene locus_tag LOCUS_09460 14076 17165 CDS product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887704.1 protein_id gnl|my_center|LOCUS_09460 17368 17886 gene locus_tag LOCUS_09470 17368 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 18159 19151 gene locus_tag LOCUS_09480 18159 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_09480 19209 20237 gene locus_tag LOCUS_09490 gene metE 19209 20237 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_09490 20329 20844 gene locus_tag LOCUS_09500 gene rutF 20329 20844 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_09500 20911 21729 gene locus_tag LOCUS_09510 20911 21729 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_09510 22671 22147 gene locus_tag LOCUS_09520 22671 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_09520 23141 22737 gene locus_tag LOCUS_09530 23141 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23994 23116 gene locus_tag LOCUS_09540 23994 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204990.1 protein_id gnl|my_center|LOCUS_09540 24081 24446 gene locus_tag LOCUS_09550 gene merR 24081 24446 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640384.1 protein_id gnl|my_center|LOCUS_09550 24759 24448 gene locus_tag LOCUS_09560 24759 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 26715 24871 gene locus_tag LOCUS_09570 gene glmS 26715 24871 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ8 protein_id gnl|my_center|LOCUS_09570 28224 26899 gene locus_tag LOCUS_09580 gene glmU 28224 26899 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_09580 29048 28443 gene locus_tag LOCUS_09590 29048 28443 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU1 protein_id gnl|my_center|LOCUS_09590 30086 29052 gene locus_tag LOCUS_09600 gene thiL 30086 29052 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_09600 30946 30095 gene locus_tag LOCUS_09610 30946 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 31681 31163 gene locus_tag LOCUS_09620 gene ribH 31681 31163 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ3 protein_id gnl|my_center|LOCUS_09620 32661 31867 gene locus_tag LOCUS_09630 gene hisF 32661 31867 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_09630 32836 34002 gene locus_tag LOCUS_09640 gene thrB 32836 34002 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_09640 34051 34440 gene locus_tag LOCUS_09650 34051 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 34441 35361 gene locus_tag LOCUS_09660 34441 35361 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687345.1 protein_id gnl|my_center|LOCUS_09660 35964 35386 gene locus_tag LOCUS_09670 35964 35386 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_09670 36725 36009 gene locus_tag LOCUS_09680 36725 36009 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_09680 36854 37906 gene locus_tag LOCUS_09690 36854 37906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 38258 41098 gene locus_tag LOCUS_09700 gene rpfA 38258 41098 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_09700 42303 41215 gene locus_tag LOCUS_09710 42303 41215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 43158 42382 gene locus_tag LOCUS_09720 43158 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_09720 43967 43314 gene locus_tag LOCUS_09730 43967 43314 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_09730 44311 44236 gene locus_tag LOCUS_t00150 44311 44236 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44547 44472 gene locus_tag LOCUS_t00160 44547 44472 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45041 44670 gene locus_tag LOCUS_09740 45041 44670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 45462 45145 gene locus_tag LOCUS_09750 45462 45145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 47097 45577 gene locus_tag LOCUS_09760 gene gltX 47097 45577 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_09760 47471 48484 gene locus_tag LOCUS_09770 gene mraW 47471 48484 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG25 protein_id gnl|my_center|LOCUS_09770 48900 49382 gene locus_tag LOCUS_09780 48900 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 49379 51463 gene locus_tag LOCUS_09790 gene ftsI 49379 51463 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_09790 51531 53285 gene locus_tag LOCUS_09800 gene murE 51531 53285 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG22 protein_id gnl|my_center|LOCUS_09800 53369 54817 gene locus_tag LOCUS_09810 gene murF 53369 54817 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG21 protein_id gnl|my_center|LOCUS_09810 54821 55939 gene locus_tag LOCUS_09820 gene mraY 54821 55939 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_09820 56149 57018 gene locus_tag LOCUS_09830 gene rrmA 56149 57018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_09830 57836 57054 gene locus_tag LOCUS_09840 gene sanA 57836 57054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207551.1 protein_id gnl|my_center|LOCUS_09840 58194 58496 gene locus_tag LOCUS_09850 58194 58496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 59369 59279 gene locus_tag LOCUS_t00170 59369 59279 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59547 60392 gene locus_tag LOCUS_09860 59547 60392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 60445 60708 gene locus_tag LOCUS_09870 60445 60708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 60969 61352 gene locus_tag LOCUS_09880 60969 61352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_09880 62811 61549 gene locus_tag LOCUS_09890 62811 61549 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_09890 63256 62918 gene locus_tag LOCUS_09900 gene glnK 63256 62918 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_09900 64573 63719 gene locus_tag LOCUS_09910 64573 63719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 66253 64754 gene locus_tag LOCUS_09920 66253 64754 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_09920 66922 68358 gene locus_tag LOCUS_09930 gene murD 66922 68358 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_09930 68761 69843 gene locus_tag LOCUS_09940 gene ftsW 68761 69843 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK57 protein_id gnl|my_center|LOCUS_09940 70931 69951 gene locus_tag LOCUS_09950 70931 69951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 71609 71172 gene locus_tag LOCUS_09960 gene dksA 71609 71172 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL8 protein_id gnl|my_center|LOCUS_09960 72924 72082 gene locus_tag LOCUS_09970 gene cpdA 72924 72082 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SJ5 protein_id gnl|my_center|LOCUS_09970 >Feature sequence12 117 791 gene locus_tag LOCUS_09980 117 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1157 2113 gene locus_tag LOCUS_09990 1157 2113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364557.1 protein_id gnl|my_center|LOCUS_09990 2361 3182 gene locus_tag LOCUS_10000 gene dapD 2361 3182 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL35 protein_id gnl|my_center|LOCUS_10000 3429 4160 gene locus_tag LOCUS_10010 gene queE 3429 4160 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_10010 4253 5365 gene locus_tag LOCUS_10020 4253 5365 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_10020 5468 6103 gene locus_tag LOCUS_10030 5468 6103 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_10030 6175 6840 gene locus_tag LOCUS_10040 6175 6840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_10040 8750 6909 gene locus_tag LOCUS_10050 gene recJ 8750 6909 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_10050 9080 9595 gene locus_tag LOCUS_10060 9080 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_10060 9769 10158 gene locus_tag LOCUS_10070 9769 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 protein_id gnl|my_center|LOCUS_10070 10658 10281 gene locus_tag LOCUS_10080 10658 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 11177 10881 gene locus_tag LOCUS_10090 11177 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 13445 11334 gene locus_tag LOCUS_10100 gene uvrB 13445 11334 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ7 protein_id gnl|my_center|LOCUS_10100 13901 14383 gene locus_tag LOCUS_10110 gene dps 13901 14383 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCK6 protein_id gnl|my_center|LOCUS_10110 15661 14573 gene locus_tag LOCUS_10120 15661 14573 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_10120 16384 15833 gene locus_tag LOCUS_10130 gene vdlD 16384 15833 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_10130 16949 16539 gene locus_tag LOCUS_10140 16949 16539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268644.1 protein_id gnl|my_center|LOCUS_10140 17879 16989 gene locus_tag LOCUS_10150 gene yafC 17879 16989 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 protein_id gnl|my_center|LOCUS_10150 17985 19157 gene locus_tag LOCUS_10160 17985 19157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_10160 20728 19274 gene locus_tag LOCUS_10170 gene cfaS 20728 19274 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_10170 21899 20811 gene locus_tag LOCUS_10180 21899 20811 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073247.1 protein_id gnl|my_center|LOCUS_10180 23666 21960 gene locus_tag LOCUS_10190 23666 21960 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_10190 24464 23727 gene locus_tag LOCUS_10200 24464 23727 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263590.1 protein_id gnl|my_center|LOCUS_10200 24987 26189 gene locus_tag LOCUS_10210 gene aspC 24987 26189 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_10210 26448 26523 gene locus_tag LOCUS_t00180 26448 26523 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 27962 26655 gene locus_tag LOCUS_10220 27962 26655 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWB9 protein_id gnl|my_center|LOCUS_10220 28771 28031 gene locus_tag LOCUS_10230 28771 28031 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_10230 29204 28791 gene locus_tag LOCUS_10240 29204 28791 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9P6 protein_id gnl|my_center|LOCUS_10240 29540 29247 gene locus_tag LOCUS_10250 29540 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 30524 30448 gene locus_tag LOCUS_t00190 30524 30448 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30652 30577 gene locus_tag LOCUS_t00200 30652 30577 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31465 30980 gene locus_tag LOCUS_10260 gene gpo 31465 30980 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_10260 32025 31600 gene locus_tag LOCUS_10270 gene msrB 32025 31600 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_10270 32426 34069 gene locus_tag LOCUS_10280 32426 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 35777 34170 gene locus_tag LOCUS_10290 35777 34170 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6H7 protein_id gnl|my_center|LOCUS_10290 38106 36418 gene locus_tag LOCUS_10300 38106 36418 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_10300 38445 39149 gene locus_tag LOCUS_10310 38445 39149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 39234 40283 gene locus_tag LOCUS_10320 gene ubiE 39234 40283 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD0 protein_id gnl|my_center|LOCUS_10320 40364 41068 gene locus_tag LOCUS_10330 40364 41068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 41187 42845 gene locus_tag LOCUS_10340 gene ubiB 41187 42845 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 protein_id gnl|my_center|LOCUS_10340 42939 43574 gene locus_tag LOCUS_10350 42939 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 44628 43645 gene locus_tag LOCUS_10360 gene ruvB 44628 43645 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_10360 45425 44805 gene locus_tag LOCUS_10370 gene ruvA 45425 44805 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_10370 46562 45525 gene locus_tag LOCUS_10380 gene fba 46562 45525 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_10380 47327 46941 gene locus_tag LOCUS_10390 47327 46941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 48796 47582 gene locus_tag LOCUS_10400 gene pgk 48796 47582 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_10400 49239 49568 gene locus_tag LOCUS_10410 49239 49568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 50266 49595 gene locus_tag LOCUS_10420 gene thiE 50266 49595 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_10420 51430 50354 gene locus_tag LOCUS_10430 gene pbpG 51430 50354 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_10430 51865 52500 gene locus_tag LOCUS_10440 gene gacA 51865 52500 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_10440 52537 54288 gene locus_tag LOCUS_10450 gene pilS 52537 54288 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208173.1 protein_id gnl|my_center|LOCUS_10450 54460 56166 gene locus_tag LOCUS_10460 54460 56166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 57724 56249 gene locus_tag LOCUS_10470 57724 56249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 59621 57957 gene locus_tag LOCUS_10480 gene gpmI 59621 57957 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_10480 60785 60165 gene locus_tag LOCUS_10490 60785 60165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 60939 61523 gene locus_tag LOCUS_10500 gene ruvC 60939 61523 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM75 protein_id gnl|my_center|LOCUS_10500 62604 61666 gene locus_tag LOCUS_10510 62604 61666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 63601 62939 gene locus_tag LOCUS_10520 63601 62939 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_10520 64463 63825 gene locus_tag LOCUS_10530 64463 63825 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_10530 66581 64842 gene locus_tag LOCUS_10540 gene glnS 66581 64842 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YQ1 protein_id gnl|my_center|LOCUS_10540 66896 67411 gene locus_tag LOCUS_10550 gene ppiB 66896 67411 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_10550 67542 68429 gene locus_tag LOCUS_10560 gene lpxH 67542 68429 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH78 protein_id gnl|my_center|LOCUS_10560 68386 68589 gene locus_tag LOCUS_10570 68386 68589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 69135 68548 gene locus_tag LOCUS_10580 gene orn 69135 68548 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_10580 69383 70486 gene locus_tag LOCUS_10590 gene engC 69383 70486 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS6 protein_id gnl|my_center|LOCUS_10590 70648 71103 gene locus_tag LOCUS_10600 gene yibN 70648 71103 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_10600 71402 71665 gene locus_tag LOCUS_10610 gene grx 71402 71665 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_10610 71844 72296 gene locus_tag LOCUS_10620 gene secB 71844 72296 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_10620 >Feature sequence13 <1 1112 gene locus_tag LOCUS_10630 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094393.1:rod shape-determining protein 1344 2198 gene locus_tag LOCUS_10640 gene mreC 1344 2198 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN35 protein_id gnl|my_center|LOCUS_10640 2331 2816 gene locus_tag LOCUS_10650 gene mreD 2331 2816 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRJ1 protein_id gnl|my_center|LOCUS_10650 2891 3577 gene locus_tag LOCUS_10660 2891 3577 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LC4 protein_id gnl|my_center|LOCUS_10660 3698 5302 gene locus_tag LOCUS_10670 gene rng 3698 5302 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_10670 5711 6022 gene locus_tag LOCUS_10680 gene rpsJ 5711 6022 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF94 protein_id gnl|my_center|LOCUS_10680 6072 6710 gene locus_tag LOCUS_10690 gene rplC 6072 6710 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF93 protein_id gnl|my_center|LOCUS_10690 6725 7327 gene locus_tag LOCUS_10700 gene rplD 6725 7327 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_10700 7324 7674 gene locus_tag LOCUS_10710 gene rplW 7324 7674 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF91 protein_id gnl|my_center|LOCUS_10710 7686 8513 gene locus_tag LOCUS_10720 gene rplB 7686 8513 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF90 protein_id gnl|my_center|LOCUS_10720 8526 8801 gene locus_tag LOCUS_10730 gene rpsS 8526 8801 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF89 protein_id gnl|my_center|LOCUS_10730 8803 9141 gene locus_tag LOCUS_10740 gene rplV 8803 9141 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF88 protein_id gnl|my_center|LOCUS_10740 9145 9873 gene locus_tag LOCUS_10750 gene rpsC 9145 9873 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF87 protein_id gnl|my_center|LOCUS_10750 9877 10290 gene locus_tag LOCUS_10760 gene rplP 9877 10290 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF86 protein_id gnl|my_center|LOCUS_10760 10290 10487 gene locus_tag LOCUS_10770 gene rpmC 10290 10487 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF85 protein_id gnl|my_center|LOCUS_10770 10484 10759 gene locus_tag LOCUS_10780 gene rpsQ 10484 10759 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_10780 10817 11311 gene locus_tag LOCUS_10790 10817 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 11320 11637 gene locus_tag LOCUS_10800 gene rplX 11320 11637 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ21 protein_id gnl|my_center|LOCUS_10800 11659 12195 gene locus_tag LOCUS_10810 gene rplE 11659 12195 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_10810 12223 12513 gene locus_tag LOCUS_10820 gene rpsN 12223 12513 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ19 protein_id gnl|my_center|LOCUS_10820 12525 12923 gene locus_tag LOCUS_10830 gene rpsH 12525 12923 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ18 protein_id gnl|my_center|LOCUS_10830 13100 13633 gene locus_tag LOCUS_10840 gene rplF 13100 13633 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_10840 13645 13995 gene locus_tag LOCUS_10850 gene rplR 13645 13995 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_10850 13998 14513 gene locus_tag LOCUS_10860 gene rpsE 13998 14513 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 protein_id gnl|my_center|LOCUS_10860 14534 14713 gene locus_tag LOCUS_10870 gene rpmD 14534 14713 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ14 protein_id gnl|my_center|LOCUS_10870 14713 15153 gene locus_tag LOCUS_10880 gene rplO 14713 15153 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ13 protein_id gnl|my_center|LOCUS_10880 15158 16504 gene locus_tag LOCUS_10890 gene secY 15158 16504 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ12 protein_id gnl|my_center|LOCUS_10890 16917 17273 gene locus_tag LOCUS_10900 gene rpsM 16917 17273 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ10 protein_id gnl|my_center|LOCUS_10900 17294 17683 gene locus_tag LOCUS_10910 gene rpsK 17294 17683 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ09 protein_id gnl|my_center|LOCUS_10910 17732 18373 gene locus_tag LOCUS_10920 gene rpsD 17732 18373 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ08 protein_id gnl|my_center|LOCUS_10920 18455 19462 gene locus_tag LOCUS_10930 gene rpoA 18455 19462 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ07 protein_id gnl|my_center|LOCUS_10930 19482 19841 gene locus_tag LOCUS_10940 gene rplQ 19482 19841 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_10940 20664 20044 gene locus_tag LOCUS_10950 20664 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_10950 21640 20897 gene locus_tag LOCUS_10960 21640 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 21823 22416 gene locus_tag LOCUS_10970 21823 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_10970 22733 22915 gene locus_tag LOCUS_10980 gene rpmF 22733 22915 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ2 protein_id gnl|my_center|LOCUS_10980 23339 24307 gene locus_tag LOCUS_10990 gene fabD 23339 24307 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_10990 24304 25032 gene locus_tag LOCUS_11000 gene fabG 24304 25032 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_11000 25297 25533 gene locus_tag LOCUS_11010 gene acpP 25297 25533 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_11010 25792 26301 gene locus_tag LOCUS_11020 gene ygaU 25792 26301 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_11020 27604 26441 gene locus_tag LOCUS_11030 gene queG 27604 26441 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM72 protein_id gnl|my_center|LOCUS_11030 27841 29664 gene locus_tag LOCUS_11040 gene yjeF 27841 29664 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM73 protein_id gnl|my_center|LOCUS_11040 30180 29683 gene locus_tag LOCUS_11050 30180 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 31025 32857 gene locus_tag LOCUS_11060 gene ilvI 31025 32857 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT6 protein_id gnl|my_center|LOCUS_11060 32857 33354 gene locus_tag LOCUS_11070 gene ilvH 32857 33354 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_11070 33494 34510 gene locus_tag LOCUS_11080 gene ilvC 33494 34510 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_11080 34863 35195 gene locus_tag LOCUS_11090 34863 35195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 35565 35777 gene locus_tag LOCUS_11100 gene cspA 35565 35777 CDS product cold shock-like protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KN00 protein_id gnl|my_center|LOCUS_11100 36016 36579 gene locus_tag LOCUS_11110 36016 36579 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_11110 37036 37785 gene locus_tag LOCUS_11120 gene etfB 37036 37785 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_11120 37937 38869 gene locus_tag LOCUS_11130 gene etfA 37937 38869 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_11130 39876 39082 gene locus_tag LOCUS_11140 39876 39082 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_11140 40953 39970 gene locus_tag LOCUS_11150 gene fbp 40953 39970 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_11150 41339 42412 gene locus_tag LOCUS_11160 gene pyrB 41339 42412 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI91 protein_id gnl|my_center|LOCUS_11160 42471 43682 gene locus_tag LOCUS_11170 gene pyrX 42471 43682 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_11170 43738 44223 gene locus_tag LOCUS_11180 43738 44223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 45586 44312 gene locus_tag LOCUS_11190 45586 44312 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_11190 47296 45725 gene locus_tag LOCUS_11200 47296 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 50440 47624 gene locus_tag LOCUS_11210 50440 47624 CDS product peptidase M66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776990.1 protein_id gnl|my_center|LOCUS_11210 52178 50607 gene locus_tag LOCUS_11220 52178 50607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 52467 53084 gene locus_tag LOCUS_11230 52467 53084 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_11230 53212 53664 gene locus_tag LOCUS_11240 53212 53664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 54547 53777 gene locus_tag LOCUS_11250 54547 53777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_11250 54990 55280 gene locus_tag LOCUS_11260 gene groS 54990 55280 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_11260 55404 57053 gene locus_tag LOCUS_11270 gene groL 55404 57053 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_11270 58075 57263 gene locus_tag LOCUS_11280 58075 57263 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9D8 protein_id gnl|my_center|LOCUS_11280 58554 59708 gene locus_tag LOCUS_11290 gene pntA1 58554 59708 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_11290 59764 60144 gene locus_tag LOCUS_11300 59764 60144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 60141 61541 gene locus_tag LOCUS_11310 gene pntB 60141 61541 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB1 protein_id gnl|my_center|LOCUS_11310 61717 62253 gene locus_tag LOCUS_11320 61717 62253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 62401 62610 gene locus_tag LOCUS_11330 62401 62610 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 protein_id gnl|my_center|LOCUS_11330 62673 63176 gene locus_tag LOCUS_11340 62673 63176 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125095.1 protein_id gnl|my_center|LOCUS_11340 65746 63560 gene locus_tag LOCUS_11350 65746 63560 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_11350 67238 66024 gene locus_tag LOCUS_11360 gene dapE 67238 66024 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_11360 68055 67300 gene locus_tag LOCUS_11370 68055 67300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 68196 69083 gene locus_tag LOCUS_11380 gene rlmJ 68196 69083 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX2 protein_id gnl|my_center|LOCUS_11380 69139 70035 gene locus_tag LOCUS_11390 gene pssA 69139 70035 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence14 152 907 gene locus_tag LOCUS_11400 152 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 919 1407 gene locus_tag LOCUS_11410 919 1407 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884106.1 protein_id gnl|my_center|LOCUS_11410 1508 1873 gene locus_tag LOCUS_11420 1508 1873 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918812.1 protein_id gnl|my_center|LOCUS_11420 1870 2154 gene locus_tag LOCUS_11430 1870 2154 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886703.1 protein_id gnl|my_center|LOCUS_11430 3972 2968 gene locus_tag LOCUS_11440 3972 2968 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_11440 4244 4071 gene locus_tag LOCUS_11450 4244 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4485 4679 gene locus_tag LOCUS_11460 4485 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6175 4775 gene locus_tag LOCUS_11470 6175 4775 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204943.1 protein_id gnl|my_center|LOCUS_11470 6338 7294 gene locus_tag LOCUS_11480 6338 7294 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948183.1 protein_id gnl|my_center|LOCUS_11480 7584 7291 gene locus_tag LOCUS_11490 7584 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 8281 9555 gene locus_tag LOCUS_11500 8281 9555 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_11500 9789 12575 gene locus_tag LOCUS_11510 gene ppc 9789 12575 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_11510 13698 12757 gene locus_tag LOCUS_11520 13698 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13991 15004 gene locus_tag LOCUS_11530 13991 15004 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552076.1 protein_id gnl|my_center|LOCUS_11530 15321 16607 gene locus_tag LOCUS_11540 15321 16607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225119.1 protein_id gnl|my_center|LOCUS_11540 16968 17861 gene locus_tag LOCUS_11550 gene prpB 16968 17861 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0X5 protein_id gnl|my_center|LOCUS_11550 17923 19050 gene locus_tag LOCUS_11560 gene prpC 17923 19050 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R2 protein_id gnl|my_center|LOCUS_11560 19323 21974 gene locus_tag LOCUS_11570 19323 21974 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_11570 22176 22415 gene locus_tag LOCUS_11580 22176 22415 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVR9 protein_id gnl|my_center|LOCUS_11580 23362 22412 gene locus_tag LOCUS_11590 23362 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 23433 24668 gene locus_tag LOCUS_11600 23433 24668 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_11600 24707 26560 gene locus_tag LOCUS_11610 24707 26560 CDS product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 protein_id gnl|my_center|LOCUS_11610 26563 27258 gene locus_tag LOCUS_11620 26563 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 27411 28952 gene locus_tag LOCUS_11630 gene prpD 27411 28952 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_11630 29771 28992 gene locus_tag LOCUS_11640 29771 28992 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_11640 29976 31364 gene locus_tag LOCUS_11650 29976 31364 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYD0 protein_id gnl|my_center|LOCUS_11650 31486 32460 gene locus_tag LOCUS_11660 31486 32460 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_11660 32586 34292 gene locus_tag LOCUS_11670 32586 34292 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 protein_id gnl|my_center|LOCUS_11670 35346 34321 gene locus_tag LOCUS_11680 35346 34321 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_11680 35710 35399 gene locus_tag LOCUS_11690 35710 35399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 37508 35826 gene locus_tag LOCUS_11700 gene cstA 37508 35826 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_11700 37816 38484 gene locus_tag LOCUS_11710 37816 38484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_11710 38577 39140 gene locus_tag LOCUS_11720 38577 39140 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_11720 41394 39223 gene locus_tag LOCUS_11730 41394 39223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 46027 41501 gene locus_tag LOCUS_11740 gene recB 46027 41501 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD6 protein_id gnl|my_center|LOCUS_11740 50596 46205 gene locus_tag LOCUS_11750 50596 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 51122 51622 gene locus_tag LOCUS_11760 51122 51622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 51696 52529 gene locus_tag LOCUS_11770 51696 52529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 52600 52675 gene locus_tag LOCUS_t00210 52600 52675 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52842 53174 gene locus_tag LOCUS_11780 52842 53174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11780 53387 53662 gene locus_tag LOCUS_11790 53387 53662 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049330.1 protein_id gnl|my_center|LOCUS_11790 54494 54009 gene locus_tag LOCUS_11800 54494 54009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_11800 54782 54522 gene locus_tag LOCUS_11810 54782 54522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 55544 54786 gene locus_tag LOCUS_11820 55544 54786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 57204 55570 gene locus_tag LOCUS_11830 gene copA 57204 55570 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_11830 57176 57382 gene locus_tag LOCUS_11840 57176 57382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 58029 57388 gene locus_tag LOCUS_11850 58029 57388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 58758 58165 gene locus_tag LOCUS_11860 58758 58165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 59123 58845 gene locus_tag LOCUS_11870 59123 58845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 59313 60035 gene locus_tag LOCUS_11880 gene cusR 59313 60035 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 protein_id gnl|my_center|LOCUS_11880 60106 61506 gene locus_tag LOCUS_11890 gene cusS 60106 61506 CDS product sensor kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77485 protein_id gnl|my_center|LOCUS_11890 62360 63271 gene locus_tag LOCUS_11900 gene pqqB 62360 63271 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP45 protein_id gnl|my_center|LOCUS_11900 63293 64060 gene locus_tag LOCUS_11910 gene pqqC 63293 64060 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP46 protein_id gnl|my_center|LOCUS_11910 64057 64353 gene locus_tag LOCUS_11920 gene pqqD 64057 64353 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP47 protein_id gnl|my_center|LOCUS_11920 64350 65501 gene locus_tag LOCUS_11930 gene pqqE 64350 65501 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP48 protein_id gnl|my_center|LOCUS_11930 65498 66559 gene locus_tag LOCUS_11940 65498 66559 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 protein_id gnl|my_center|LOCUS_11940 67334 67038 gene locus_tag LOCUS_11950 67334 67038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 67618 67331 gene locus_tag LOCUS_11960 67618 67331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 68518 67664 gene locus_tag LOCUS_11970 68518 67664 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_11970 69932 68805 gene locus_tag LOCUS_11980 69932 68805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence15 86 592 gene locus_tag LOCUS_11990 86 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 800 1105 gene locus_tag LOCUS_12000 800 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1113 1397 gene locus_tag LOCUS_12010 1113 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1398 1673 gene locus_tag LOCUS_12020 1398 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2192 2581 gene locus_tag LOCUS_12030 2192 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2688 5228 gene locus_tag LOCUS_12040 2688 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5493 5792 gene locus_tag LOCUS_12050 5493 5792 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097693.1 protein_id gnl|my_center|LOCUS_12050 5890 9120 gene locus_tag LOCUS_12060 5890 9120 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_12060 9281 9604 gene locus_tag LOCUS_12070 9281 9604 CDS product addiction module killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_12070 9601 9906 gene locus_tag LOCUS_12080 9601 9906 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_12080 9941 10159 gene locus_tag LOCUS_12090 9941 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10365 10631 gene locus_tag LOCUS_12100 10365 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10803 10618 gene locus_tag LOCUS_12110 10803 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 10759 11742 gene locus_tag LOCUS_12120 10759 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12335 11805 gene locus_tag LOCUS_12130 12335 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 13769 12627 gene locus_tag LOCUS_12140 gene iga 13769 12627 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_12140 15376 14018 gene locus_tag LOCUS_12150 gene folC 15376 14018 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_12150 16510 15563 gene locus_tag LOCUS_12160 gene accD 16510 15563 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_12160 17816 16992 gene locus_tag LOCUS_12170 gene trpA 17816 16992 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU1 protein_id gnl|my_center|LOCUS_12170 19231 17957 gene locus_tag LOCUS_12180 gene trpB 19231 17957 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_12180 20038 19367 gene locus_tag LOCUS_12190 gene trpF 20038 19367 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_12190 20240 21859 gene locus_tag LOCUS_12200 gene phr 20240 21859 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 protein_id gnl|my_center|LOCUS_12200 22604 21861 gene locus_tag LOCUS_12210 22604 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 23199 24917 gene locus_tag LOCUS_12220 gene proS 23199 24917 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_12220 25904 25035 gene locus_tag LOCUS_12230 gene queF 25904 25035 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ66 protein_id gnl|my_center|LOCUS_12230 26795 25989 gene locus_tag LOCUS_12240 gene yadH 26795 25989 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_12240 27754 26792 gene locus_tag LOCUS_12250 gene yadG 27754 26792 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_12250 28695 28054 gene locus_tag LOCUS_12260 28695 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 29063 29139 gene locus_tag LOCUS_t00220 29063 29139 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29714 29409 gene locus_tag LOCUS_12270 29714 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 29807 30607 gene locus_tag LOCUS_12280 29807 30607 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_12280 31736 30741 gene locus_tag LOCUS_12290 gene add 31736 30741 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_12290 32428 31904 gene locus_tag LOCUS_12300 32428 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610214.1 protein_id gnl|my_center|LOCUS_12300 33714 32527 gene locus_tag LOCUS_12310 33714 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 34458 33832 gene locus_tag LOCUS_12320 34458 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_12320 35477 37015 gene locus_tag LOCUS_12330 gene acp 35477 37015 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207419.1 protein_id gnl|my_center|LOCUS_12330 37856 37236 gene locus_tag LOCUS_12340 37856 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 38835 38281 gene locus_tag LOCUS_12350 38835 38281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144040.1 protein_id gnl|my_center|LOCUS_12350 39407 43210 gene locus_tag LOCUS_12360 gene metH 39407 43210 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_12360 43230 43694 gene locus_tag LOCUS_12370 43230 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 43786 45186 gene locus_tag LOCUS_12380 43786 45186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 45688 45188 gene locus_tag LOCUS_12390 45688 45188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 46281 45877 gene locus_tag LOCUS_12400 46281 45877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 47563 46544 gene locus_tag LOCUS_12410 47563 46544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 48208 47720 gene locus_tag LOCUS_12420 48208 47720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 48776 48645 gene locus_tag LOCUS_12430 48776 48645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 50050 48950 gene locus_tag LOCUS_12440 gene lifO 50050 48950 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_12440 51154 50078 gene locus_tag LOCUS_12450 gene lip 51154 50078 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_12450 51618 51325 gene locus_tag LOCUS_12460 51618 51325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 51499 52245 gene locus_tag LOCUS_12470 gene map 51499 52245 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_12470 52487 55243 gene locus_tag LOCUS_12480 gene glnD 52487 55243 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM5 protein_id gnl|my_center|LOCUS_12480 55950 55279 gene locus_tag LOCUS_12490 55950 55279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 56204 57436 gene locus_tag LOCUS_12500 gene dapL 56204 57436 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_12500 57579 59525 gene locus_tag LOCUS_12510 57579 59525 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_12510 59551 60165 gene locus_tag LOCUS_12520 59551 60165 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705925.1 protein_id gnl|my_center|LOCUS_12520 60391 62253 gene locus_tag LOCUS_12530 60391 62253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 62406 62891 gene locus_tag LOCUS_12540 62406 62891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 63041 63589 gene locus_tag LOCUS_12550 63041 63589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 63667 64167 gene locus_tag LOCUS_12560 gene rlmH 63667 64167 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ0 protein_id gnl|my_center|LOCUS_12560 64249 65142 gene locus_tag LOCUS_12570 64249 65142 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766795.1 protein_id gnl|my_center|LOCUS_12570 66685 65192 gene locus_tag LOCUS_12580 gene gatA 66685 65192 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence16 245 1228 gene locus_tag LOCUS_12590 gene dusA 245 1228 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA5 protein_id gnl|my_center|LOCUS_12590 2083 1295 gene locus_tag LOCUS_12600 2083 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3043 2153 gene locus_tag LOCUS_12610 3043 2153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_12610 4253 3198 gene locus_tag LOCUS_12620 gene nhaA 4253 3198 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_12620 7407 4450 gene locus_tag LOCUS_12630 7407 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7706 8281 gene locus_tag LOCUS_12640 7706 8281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_12640 8656 8351 gene locus_tag LOCUS_12650 8656 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 9505 8825 gene locus_tag LOCUS_12660 gene lolD 9505 8825 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_12660 10773 9538 gene locus_tag LOCUS_12670 gene lolC 10773 9538 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_12670 11223 12194 gene locus_tag LOCUS_12680 11223 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_12680 12721 12332 gene locus_tag LOCUS_12690 12721 12332 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_12690 13577 15058 gene locus_tag LOCUS_12700 13577 15058 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881190.1 protein_id gnl|my_center|LOCUS_12700 15068 15706 gene locus_tag LOCUS_12710 gene ccoO 15068 15706 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_12710 15706 15885 gene locus_tag LOCUS_12720 15706 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 15885 17030 gene locus_tag LOCUS_12730 15885 17030 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG1 protein_id gnl|my_center|LOCUS_12730 17449 18861 gene locus_tag LOCUS_12740 17449 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 19055 19636 gene locus_tag LOCUS_12750 19055 19636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_12750 20883 19741 gene locus_tag LOCUS_12760 20883 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 21313 21942 gene locus_tag LOCUS_12770 gene queC 21313 21942 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_12770 22218 22547 gene locus_tag LOCUS_12780 22218 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 22735 23232 gene locus_tag LOCUS_12790 22735 23232 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 protein_id gnl|my_center|LOCUS_12790 23349 24839 gene locus_tag LOCUS_12800 23349 24839 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_12800 24975 26171 gene locus_tag LOCUS_12810 24975 26171 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886857.1 protein_id gnl|my_center|LOCUS_12810 26414 28708 gene locus_tag LOCUS_12820 gene ycbY 26414 28708 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI89 protein_id gnl|my_center|LOCUS_12820 28968 29543 gene locus_tag LOCUS_12830 28968 29543 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266647.1 protein_id gnl|my_center|LOCUS_12830 29766 30827 gene locus_tag LOCUS_12840 29766 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_12840 31414 31989 gene locus_tag LOCUS_12850 31414 31989 CDS product tellurium resistance protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_12850 32200 32952 gene locus_tag LOCUS_12860 32200 32952 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_12860 33010 33618 gene locus_tag LOCUS_12870 33010 33618 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_12870 35146 33899 gene locus_tag LOCUS_12880 35146 33899 CDS product tellurium resistance protein TerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054787.1 protein_id gnl|my_center|LOCUS_12880 35325 35146 gene locus_tag LOCUS_12890 35325 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 35521 36585 gene locus_tag LOCUS_12900 35521 36585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 protein_id gnl|my_center|LOCUS_12900 36652 37875 gene locus_tag LOCUS_12910 36652 37875 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888T2 protein_id gnl|my_center|LOCUS_12910 37936 39024 gene locus_tag LOCUS_12920 37936 39024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 39073 40389 gene locus_tag LOCUS_12930 39073 40389 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266640.1 protein_id gnl|my_center|LOCUS_12930 40420 41250 gene locus_tag LOCUS_12940 40420 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309375.1 protein_id gnl|my_center|LOCUS_12940 41353 42534 gene locus_tag LOCUS_12950 41353 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103356.1 protein_id gnl|my_center|LOCUS_12950 42604 43683 gene locus_tag LOCUS_12960 42604 43683 CDS product citrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266643.1 protein_id gnl|my_center|LOCUS_12960 44626 43814 gene locus_tag LOCUS_12970 gene pcaD 44626 43814 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_12970 44999 45796 gene locus_tag LOCUS_12980 gene fabM 44999 45796 CDS product trans-2-decenoyl-[acyl-carrier-protein] isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSN0 protein_id gnl|my_center|LOCUS_12980 46360 45917 gene locus_tag LOCUS_12990 46360 45917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 protein_id gnl|my_center|LOCUS_12990 49208 46605 gene locus_tag LOCUS_13000 49208 46605 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LW3 protein_id gnl|my_center|LOCUS_13000 49532 49945 gene locus_tag LOCUS_13010 gene pcaC 49532 49945 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_13010 50063 51106 gene locus_tag LOCUS_13020 gene lipA 50063 51106 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_13020 53293 51251 gene locus_tag LOCUS_13030 53293 51251 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_13030 53825 53265 gene locus_tag LOCUS_13040 53825 53265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 54822 53803 gene locus_tag LOCUS_13050 54822 53803 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336881.1 protein_id gnl|my_center|LOCUS_13050 56527 55388 gene locus_tag LOCUS_13060 56527 55388 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_13060 56731 56943 gene locus_tag LOCUS_13070 56731 56943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence17 431 1345 gene locus_tag LOCUS_13080 431 1345 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_13080 2486 1491 gene locus_tag LOCUS_13090 2486 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3164 2685 gene locus_tag LOCUS_13100 3164 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5018 3330 gene locus_tag LOCUS_13110 5018 3330 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_13110 6282 5080 gene locus_tag LOCUS_13120 gene dcaF 6282 5080 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_13120 7935 6349 gene locus_tag LOCUS_13130 gene dcaH 7935 6349 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_13130 8782 8006 gene locus_tag LOCUS_13140 8782 8006 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_13140 9167 10321 gene locus_tag LOCUS_13150 gene dcaA 9167 10321 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_13150 10376 10537 gene locus_tag LOCUS_13160 10376 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10521 11705 gene locus_tag LOCUS_13170 gene dcaK 10521 11705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206439.1 protein_id gnl|my_center|LOCUS_13170 11986 12831 gene locus_tag LOCUS_13180 gene pcaR 11986 12831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_13180 12971 14065 gene locus_tag LOCUS_13190 gene frp 12971 14065 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035562.1 protein_id gnl|my_center|LOCUS_13190 14450 14875 gene locus_tag LOCUS_13200 14450 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 15732 15136 gene locus_tag LOCUS_13210 15732 15136 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_13210 15984 16835 gene locus_tag LOCUS_13220 15984 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 16892 18517 gene locus_tag LOCUS_13230 16892 18517 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464476.1 protein_id gnl|my_center|LOCUS_13230 18557 19540 gene locus_tag LOCUS_13240 18557 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19618 20469 gene locus_tag LOCUS_13250 19618 20469 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_13250 21206 20508 gene locus_tag LOCUS_13260 21206 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063765.1 protein_id gnl|my_center|LOCUS_13260 22769 21285 gene locus_tag LOCUS_13270 gene qseC 22769 21285 CDS product sensor protein QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40719 protein_id gnl|my_center|LOCUS_13270 23501 22830 gene locus_tag LOCUS_13280 gene qseB 23501 22830 CDS product transcriptional regulatory protein QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66796 protein_id gnl|my_center|LOCUS_13280 24141 23539 gene locus_tag LOCUS_13290 24141 23539 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_13290 24755 24585 gene locus_tag LOCUS_13300 24755 24585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 24823 26919 gene locus_tag LOCUS_13310 gene brfB 24823 26919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810200.1 protein_id gnl|my_center|LOCUS_13310 27131 28927 gene locus_tag LOCUS_13320 27131 28927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 protein_id gnl|my_center|LOCUS_13320 29052 31310 gene locus_tag LOCUS_13330 29052 31310 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_13330 31495 32241 gene locus_tag LOCUS_13340 31495 32241 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 protein_id gnl|my_center|LOCUS_13340 33723 32317 gene locus_tag LOCUS_13350 33723 32317 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225586.1 protein_id gnl|my_center|LOCUS_13350 34167 33826 gene locus_tag LOCUS_13360 34167 33826 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_13360 35224 34283 gene locus_tag LOCUS_13370 gene phhA 35224 34283 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_13370 36481 35366 gene locus_tag LOCUS_13380 36481 35366 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 protein_id gnl|my_center|LOCUS_13380 36643 37590 gene locus_tag LOCUS_13390 36643 37590 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975043.1 protein_id gnl|my_center|LOCUS_13390 37748 38944 gene locus_tag LOCUS_13400 gene tyrB 37748 38944 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYA1 protein_id gnl|my_center|LOCUS_13400 39145 40434 gene locus_tag LOCUS_13410 gene hmgB 39145 40434 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_13410 40532 41107 gene locus_tag LOCUS_13420 40532 41107 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_13420 41353 41577 gene locus_tag LOCUS_13430 41353 41577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 42553 41696 gene locus_tag LOCUS_13440 42553 41696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 42690 43340 gene locus_tag LOCUS_13450 42690 43340 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_13450 43715 43476 gene locus_tag LOCUS_13460 43715 43476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 43854 43645 gene locus_tag LOCUS_13470 43854 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 44102 43899 gene locus_tag LOCUS_13480 44102 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 45822 44347 gene locus_tag LOCUS_13490 45822 44347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 46628 45942 gene locus_tag LOCUS_13500 46628 45942 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368937.1 protein_id gnl|my_center|LOCUS_13500 46904 47419 gene locus_tag LOCUS_13510 46904 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 49113 47530 gene locus_tag LOCUS_13520 49113 47530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 51286 49169 gene locus_tag LOCUS_13530 51286 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 51598 53535 gene locus_tag LOCUS_13540 gene ggtA 51598 53535 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence18 198 566 gene locus_tag LOCUS_13550 198 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 570 1718 gene locus_tag LOCUS_13560 570 1718 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195010.1 protein_id gnl|my_center|LOCUS_13560 1754 3004 gene locus_tag LOCUS_13570 gene codA 1754 3004 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 protein_id gnl|my_center|LOCUS_13570 3033 3428 gene locus_tag LOCUS_13580 3033 3428 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_13580 4502 3441 gene locus_tag LOCUS_13590 4502 3441 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_13590 4762 5571 gene locus_tag LOCUS_13600 4762 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5652 6662 gene locus_tag LOCUS_13610 gene gapA 5652 6662 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_13610 6665 7897 gene locus_tag LOCUS_13620 6665 7897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 protein_id gnl|my_center|LOCUS_13620 8289 9140 gene locus_tag LOCUS_13630 gene thyA 8289 9140 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44420 protein_id gnl|my_center|LOCUS_13630 9824 9312 gene locus_tag LOCUS_13640 9824 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 11929 9821 gene locus_tag LOCUS_13650 11929 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 14382 11929 gene locus_tag LOCUS_13660 14382 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 15614 14379 gene locus_tag LOCUS_13670 gene xerC 15614 14379 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2F4 protein_id gnl|my_center|LOCUS_13670 16289 15657 gene locus_tag LOCUS_13680 16289 15657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 17077 16328 gene locus_tag LOCUS_13690 17077 16328 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074041.1 protein_id gnl|my_center|LOCUS_13690 17973 17089 gene locus_tag LOCUS_13700 gene lgt 17973 17089 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM47 protein_id gnl|my_center|LOCUS_13700 18976 18278 gene locus_tag LOCUS_13710 18976 18278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_13710 19955 19110 gene locus_tag LOCUS_13720 19955 19110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_13720 21025 19955 gene locus_tag LOCUS_13730 21025 19955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112319.1 protein_id gnl|my_center|LOCUS_13730 22850 21036 gene locus_tag LOCUS_13740 22850 21036 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_13740 24431 23079 gene locus_tag LOCUS_13750 24431 23079 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_13750 24901 26475 gene locus_tag LOCUS_13760 24901 26475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_13760 26566 27399 gene locus_tag LOCUS_13770 26566 27399 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_13770 28067 27546 gene locus_tag LOCUS_13780 gene rppH 28067 27546 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLZ5 protein_id gnl|my_center|LOCUS_13780 28519 28932 gene locus_tag LOCUS_13790 28519 28932 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_13790 28944 29372 gene locus_tag LOCUS_13800 28944 29372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_13800 30453 29422 gene locus_tag LOCUS_13810 gene dusC 30453 29422 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_13810 32016 30529 gene locus_tag LOCUS_13820 gene fbh1 32016 30529 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_13820 33078 32191 gene locus_tag LOCUS_13830 gene tatC 33078 32191 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_13830 33737 33078 gene locus_tag LOCUS_13840 33737 33078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 34006 33764 gene locus_tag LOCUS_13850 34006 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 35047 34211 gene locus_tag LOCUS_13860 gene hisI 35047 34211 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_13860 35668 35225 gene locus_tag LOCUS_13870 35668 35225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 36103 36300 gene locus_tag LOCUS_13880 gene rpmI 36103 36300 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_13880 36436 36792 gene locus_tag LOCUS_13890 gene rplT 36436 36792 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE1 protein_id gnl|my_center|LOCUS_13890 37100 38155 gene locus_tag LOCUS_13900 gene pheS 37100 38155 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_13900 38258 40663 gene locus_tag LOCUS_13910 gene pheT 38258 40663 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE4 protein_id gnl|my_center|LOCUS_13910 40912 41211 gene locus_tag LOCUS_13920 gene ihfA 40912 41211 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE5 protein_id gnl|my_center|LOCUS_13920 41756 41394 gene locus_tag LOCUS_13930 41756 41394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 42302 43192 gene locus_tag LOCUS_13940 42302 43192 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_13940 43603 43376 gene locus_tag LOCUS_13950 43603 43376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 45191 43923 gene locus_tag LOCUS_13960 gene rho 45191 43923 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE8 protein_id gnl|my_center|LOCUS_13960 46043 45717 gene locus_tag LOCUS_13970 46043 45717 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_13970 46437 47150 gene locus_tag LOCUS_13980 gene rluA 46437 47150 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_13980 47240 48844 gene locus_tag LOCUS_13990 gene hapE 47240 48844 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_13990 49813 48866 gene locus_tag LOCUS_14000 49813 48866 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_14000 50232 53135 gene locus_tag LOCUS_14010 gene hepA 50232 53135 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_14010 53509 54411 gene locus_tag LOCUS_14020 gene tesB 53509 54411 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_14020 55810 54524 gene locus_tag LOCUS_14030 55810 54524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 56236 55916 gene locus_tag LOCUS_14040 56236 55916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence19 597 1787 gene locus_tag LOCUS_14050 597 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2010 1780 gene locus_tag LOCUS_14060 2010 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1946 2953 gene locus_tag LOCUS_14070 1946 2953 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_14070 3231 3629 gene locus_tag LOCUS_14080 3231 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3819 4325 gene locus_tag LOCUS_14090 3819 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4582 5694 gene locus_tag LOCUS_14100 gene bioB 4582 5694 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM71 protein_id gnl|my_center|LOCUS_14100 5770 6204 gene locus_tag LOCUS_14110 5770 6204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_14110 7083 6319 gene locus_tag LOCUS_14120 7083 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7111 7296 gene locus_tag LOCUS_14130 7111 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7840 7349 gene locus_tag LOCUS_14140 7840 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 8676 7960 gene locus_tag LOCUS_14150 gene rph 8676 7960 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_14150 10658 8859 gene locus_tag LOCUS_14160 gene fadD 10658 8859 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_14160 12826 11099 gene locus_tag LOCUS_14170 gene fadD 12826 11099 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_14170 13605 15911 gene locus_tag LOCUS_14180 gene parC 13605 15911 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK17 protein_id gnl|my_center|LOCUS_14180 16620 16159 gene locus_tag LOCUS_14190 16620 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 17175 16921 gene locus_tag LOCUS_14200 17175 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 17499 17224 gene locus_tag LOCUS_14210 17499 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 18039 17731 gene locus_tag LOCUS_14220 18039 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 18990 18397 gene locus_tag LOCUS_14230 18990 18397 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 protein_id gnl|my_center|LOCUS_14230 19384 20223 gene locus_tag LOCUS_14240 19384 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 21078 20266 gene locus_tag LOCUS_14250 gene fabG 21078 20266 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456844.1 protein_id gnl|my_center|LOCUS_14250 21438 22565 gene locus_tag LOCUS_14260 gene potD 21438 22565 CDS product spermidine/putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2C8 protein_id gnl|my_center|LOCUS_14260 23859 22648 gene locus_tag LOCUS_14270 23859 22648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208824.1 protein_id gnl|my_center|LOCUS_14270 25486 24065 gene locus_tag LOCUS_14280 gene gltD 25486 24065 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_14280 30181 25718 gene locus_tag LOCUS_14290 gene gltB 30181 25718 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 protein_id gnl|my_center|LOCUS_14290 32166 31063 gene locus_tag LOCUS_14300 32166 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 33411 32302 gene locus_tag LOCUS_14310 gene aroB 33411 32302 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG10 protein_id gnl|my_center|LOCUS_14310 34029 33490 gene locus_tag LOCUS_14320 gene aroK 34029 33490 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_14320 36628 34256 gene locus_tag LOCUS_14330 gene pilQ 36628 34256 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_14330 37189 36656 gene locus_tag LOCUS_14340 gene pilP 37189 36656 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_14340 37923 37189 gene locus_tag LOCUS_14350 gene pilO 37923 37189 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_14350 38570 37920 gene locus_tag LOCUS_14360 gene pilN 38570 37920 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_14360 39595 38570 gene locus_tag LOCUS_14370 39595 38570 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_14370 39818 42463 gene locus_tag LOCUS_14380 gene ponA 39818 42463 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_14380 43089 42565 gene locus_tag LOCUS_14390 43089 42565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_14390 47472 43255 gene locus_tag LOCUS_14400 gene rpoC 47472 43255 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKQ3 protein_id gnl|my_center|LOCUS_14400 51742 47624 gene locus_tag LOCUS_14410 gene rpoB 51742 47624 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_14410 52883 52506 gene locus_tag LOCUS_14420 gene rplL 52883 52506 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID3 protein_id gnl|my_center|LOCUS_14420 53531 53004 gene locus_tag LOCUS_14430 gene rplJ 53531 53004 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 protein_id gnl|my_center|LOCUS_14430 54707 54006 gene locus_tag LOCUS_14440 gene rplA 54707 54006 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 protein_id gnl|my_center|LOCUS_14440 >Feature sequence20 <1 544 gene locus_tag LOCUS_14450 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLY0:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 802 2256 gene locus_tag LOCUS_14460 gene lpdG 802 2256 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX9 protein_id gnl|my_center|LOCUS_14460 2415 3581 gene locus_tag LOCUS_14470 gene sucC 2415 3581 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP4 protein_id gnl|my_center|LOCUS_14470 3680 4555 gene locus_tag LOCUS_14480 gene sucD 3680 4555 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHF4 protein_id gnl|my_center|LOCUS_14480 4891 5763 gene locus_tag LOCUS_14490 gene galU 4891 5763 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CHS0 protein_id gnl|my_center|LOCUS_14490 5766 7442 gene locus_tag LOCUS_14500 gene pgi 5766 7442 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_14500 7480 8886 gene locus_tag LOCUS_14510 7480 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10440 8953 gene locus_tag LOCUS_14520 gene manB 10440 8953 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_14520 10685 11551 gene locus_tag LOCUS_14530 gene mazG 10685 11551 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_14530 11595 11927 gene locus_tag LOCUS_14540 11595 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 12094 14238 gene locus_tag LOCUS_14550 12094 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14240 14761 gene locus_tag LOCUS_14560 gene folK 14240 14761 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_14560 14880 15680 gene locus_tag LOCUS_14570 gene panB 14880 15680 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_14570 15731 16633 gene locus_tag LOCUS_14580 gene panC 15731 16633 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC9 protein_id gnl|my_center|LOCUS_14580 16684 17664 gene locus_tag LOCUS_14590 16684 17664 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND0 protein_id gnl|my_center|LOCUS_14590 17713 18225 gene locus_tag LOCUS_14600 17713 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 18945 18325 gene locus_tag LOCUS_14610 gene dsbA 18945 18325 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_14610 19446 20294 gene locus_tag LOCUS_14620 gene ubiG 19446 20294 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_14620 20378 21088 gene locus_tag LOCUS_14630 gene gph2 20378 21088 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_14630 21187 22023 gene locus_tag LOCUS_14640 gene yciK 21187 22023 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_14640 22174 22440 gene locus_tag LOCUS_14650 22174 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 protein_id gnl|my_center|LOCUS_14650 23669 22512 gene locus_tag LOCUS_14660 gene yeiR 23669 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_14660 24549 23791 gene locus_tag LOCUS_14670 gene ompR 24549 23791 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_14670 24926 27469 gene locus_tag LOCUS_14680 gene tex 24926 27469 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 protein_id gnl|my_center|LOCUS_14680 28115 27585 gene locus_tag LOCUS_14690 28115 27585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 30125 28839 gene locus_tag LOCUS_14700 30125 28839 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_14700 30553 30708 gene locus_tag LOCUS_14710 30553 30708 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_14710 31109 30816 gene locus_tag LOCUS_14720 gene pcbD 31109 30816 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L66 protein_id gnl|my_center|LOCUS_14720 31512 31219 gene locus_tag LOCUS_14730 31512 31219 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 protein_id gnl|my_center|LOCUS_14730 33104 31737 gene locus_tag LOCUS_14740 gene des6 33104 31737 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_14740 34473 33265 gene locus_tag LOCUS_14750 gene hmp 34473 33265 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 protein_id gnl|my_center|LOCUS_14750 34917 36578 gene locus_tag LOCUS_14760 gene yjjK 34917 36578 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 protein_id gnl|my_center|LOCUS_14760 39631 36677 gene locus_tag LOCUS_14770 39631 36677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 39879 40367 gene locus_tag LOCUS_14780 39879 40367 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPI9 protein_id gnl|my_center|LOCUS_14780 40456 40830 gene locus_tag LOCUS_14790 40456 40830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 41392 40916 gene locus_tag LOCUS_14800 41392 40916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 43327 41507 gene locus_tag LOCUS_14810 gene mmgC 43327 41507 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_14810 43826 44950 gene locus_tag LOCUS_14820 43826 44950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 45850 44987 gene locus_tag LOCUS_14830 gene aroE 45850 44987 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC4 protein_id gnl|my_center|LOCUS_14830 46273 46902 gene locus_tag LOCUS_14840 46273 46902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 46906 47892 gene locus_tag LOCUS_14850 gene pabC 46906 47892 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_14850 48719 47889 gene locus_tag LOCUS_14860 48719 47889 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24918 protein_id gnl|my_center|LOCUS_14860 48970 48722 gene locus_tag LOCUS_14870 48970 48722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 49065 49316 gene locus_tag LOCUS_14880 49065 49316 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_14880 49300 50133 gene locus_tag LOCUS_14890 49300 50133 CDS product modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458962.1 protein_id gnl|my_center|LOCUS_14890 50136 51473 gene locus_tag LOCUS_14900 50136 51473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_14900 51556 52836 gene locus_tag LOCUS_14910 51556 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_14910 52923 53654 gene locus_tag LOCUS_14920 gene tmk 52923 53654 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL25 protein_id gnl|my_center|LOCUS_14920 >Feature sequence21 1524 214 gene locus_tag LOCUS_14930 gene metY 1524 214 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_14930 2417 1755 gene locus_tag LOCUS_14940 gene nfuA 2417 1755 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_14940 3031 3342 gene locus_tag LOCUS_14950 3031 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3454 4521 gene locus_tag LOCUS_14960 3454 4521 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_14960 4690 6087 gene locus_tag LOCUS_14970 4690 6087 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_14970 6081 6923 gene locus_tag LOCUS_14980 6081 6923 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206941.1 protein_id gnl|my_center|LOCUS_14980 7298 7020 gene locus_tag LOCUS_14990 gene rpmE2 7298 7020 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_14990 7798 8403 gene locus_tag LOCUS_15000 7798 8403 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919980.1 protein_id gnl|my_center|LOCUS_15000 8934 8500 gene locus_tag LOCUS_15010 8934 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 9466 11094 gene locus_tag LOCUS_15020 9466 11094 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_15020 11912 11229 gene locus_tag LOCUS_15030 11912 11229 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_15030 12389 13354 gene locus_tag LOCUS_15040 12389 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14168 13440 gene locus_tag LOCUS_15050 gene exoX 14168 13440 CDS product DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_15050 14446 14955 gene locus_tag LOCUS_15060 14446 14955 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887243.1 protein_id gnl|my_center|LOCUS_15060 16139 15024 gene locus_tag LOCUS_15070 16139 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 16936 16232 gene locus_tag LOCUS_15080 gene phoB 16936 16232 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_15080 17501 17049 gene locus_tag LOCUS_15090 gene dtd 17501 17049 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY7 protein_id gnl|my_center|LOCUS_15090 17631 18464 gene locus_tag LOCUS_15100 gene psd 17631 18464 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_15100 19185 18556 gene locus_tag LOCUS_15110 19185 18556 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_15110 19891 19316 gene locus_tag LOCUS_15120 19891 19316 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_15120 21348 20176 gene locus_tag LOCUS_15130 gene fadA 21348 20176 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_15130 23741 21582 gene locus_tag LOCUS_15140 gene fadB 23741 21582 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS1 protein_id gnl|my_center|LOCUS_15140 24548 25609 gene locus_tag LOCUS_15150 gene ispA 24548 25609 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_15150 25671 26498 gene locus_tag LOCUS_15160 25671 26498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_15160 26564 27145 gene locus_tag LOCUS_15170 26564 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 27873 27244 gene locus_tag LOCUS_15180 gene sodB 27873 27244 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_15180 28401 29054 gene locus_tag LOCUS_15190 28401 29054 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_15190 29487 30836 gene locus_tag LOCUS_15200 gene tig 29487 30836 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_15200 31794 31042 gene locus_tag LOCUS_15210 gene ureJ 31794 31042 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_15210 32535 31846 gene locus_tag LOCUS_15220 gene ureG 32535 31846 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_15220 33408 32614 gene locus_tag LOCUS_15230 gene ureF 33408 32614 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_15230 34027 33398 gene locus_tag LOCUS_15240 34027 33398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 36381 34207 gene locus_tag LOCUS_15250 gene ureC 36381 34207 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_15250 36728 36426 gene locus_tag LOCUS_15260 gene ureA 36728 36426 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 protein_id gnl|my_center|LOCUS_15260 37830 36808 gene locus_tag LOCUS_15270 gene ureD 37830 36808 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RL6 protein_id gnl|my_center|LOCUS_15270 38586 39260 gene locus_tag LOCUS_15280 gene clpP 38586 39260 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM2 protein_id gnl|my_center|LOCUS_15280 39447 40721 gene locus_tag LOCUS_15290 gene clpX 39447 40721 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_15290 41064 42092 gene locus_tag LOCUS_15300 gene ephD 41064 42092 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_15300 43280 42186 gene locus_tag LOCUS_15310 43280 42186 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_15310 44241 43429 gene locus_tag LOCUS_15320 44241 43429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 46158 44329 gene locus_tag LOCUS_15330 gene argS 46158 44329 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF4 protein_id gnl|my_center|LOCUS_15330 46602 46820 gene locus_tag LOCUS_15340 46602 46820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 47095 46856 gene locus_tag LOCUS_15350 47095 46856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 48281 47229 gene locus_tag LOCUS_15360 gene cmoB 48281 47229 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G2T3 protein_id gnl|my_center|LOCUS_15360 49117 48332 gene locus_tag LOCUS_15370 gene cmoA 49117 48332 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_15370 49328 49849 gene locus_tag LOCUS_15380 gene msrA 49328 49849 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_15380 49987 50652 gene locus_tag LOCUS_15390 gene tpm 49987 50652 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC3 protein_id gnl|my_center|LOCUS_15390 50987 52447 gene locus_tag LOCUS_15400 gene mltB 50987 52447 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence22 833 1732 gene locus_tag LOCUS_15410 gene aaeR 833 1732 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_15410 3022 1841 gene locus_tag LOCUS_15420 gene argD 3022 1841 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_15420 3255 3064 gene locus_tag LOCUS_15430 gene yacG 3255 3064 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG2 protein_id gnl|my_center|LOCUS_15430 3438 4094 gene locus_tag LOCUS_15440 gene trmB 3438 4094 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_15440 5587 4181 gene locus_tag LOCUS_15450 gene cabC1 5587 4181 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_15450 7280 5967 gene locus_tag LOCUS_15460 gene purD 7280 5967 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW7 protein_id gnl|my_center|LOCUS_15460 7417 7698 gene locus_tag LOCUS_15470 7417 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7845 12689 gene locus_tag LOCUS_15480 gene gdhB 7845 12689 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_15480 16700 12825 gene locus_tag LOCUS_15490 gene sbcC 16700 12825 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDA7 protein_id gnl|my_center|LOCUS_15490 18285 16765 gene locus_tag LOCUS_15500 18285 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 20157 18535 gene locus_tag LOCUS_15510 gene cysG 20157 18535 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_15510 20468 20647 gene locus_tag LOCUS_15520 20468 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 21330 20692 gene locus_tag LOCUS_15530 gene cysH 21330 20692 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEB8 protein_id gnl|my_center|LOCUS_15530 21959 21369 gene locus_tag LOCUS_15540 21959 21369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 23637 21952 gene locus_tag LOCUS_15550 gene cysI 23637 21952 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_15550 23993 25255 gene locus_tag LOCUS_15560 gene sat 23993 25255 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_15560 25878 25360 gene locus_tag LOCUS_15570 25878 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 26245 27372 gene locus_tag LOCUS_15580 gene sbp 26245 27372 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225284.1 protein_id gnl|my_center|LOCUS_15580 27580 28722 gene locus_tag LOCUS_15590 gene sbp 27580 28722 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225284.1 protein_id gnl|my_center|LOCUS_15590 28950 29834 gene locus_tag LOCUS_15600 gene cysT 28950 29834 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225366.1 protein_id gnl|my_center|LOCUS_15600 29836 30774 gene locus_tag LOCUS_15610 gene cysW 29836 30774 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225368.1 protein_id gnl|my_center|LOCUS_15610 30872 31594 gene locus_tag LOCUS_15620 30872 31594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 32051 31722 gene locus_tag LOCUS_15630 gene arsR 32051 31722 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 protein_id gnl|my_center|LOCUS_15630 32358 32549 gene locus_tag LOCUS_15640 32358 32549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 32924 33412 gene locus_tag LOCUS_15650 32924 33412 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8H9 protein_id gnl|my_center|LOCUS_15650 33475 33957 gene locus_tag LOCUS_15660 gene bfrB 33475 33957 CDS product putative bacterioferritin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63700 protein_id gnl|my_center|LOCUS_15660 35490 34114 gene locus_tag LOCUS_15670 35490 34114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 protein_id gnl|my_center|LOCUS_15670 35995 36834 gene locus_tag LOCUS_15680 35995 36834 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_15680 37078 38160 gene locus_tag LOCUS_15690 gene rpfI 37078 38160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 protein_id gnl|my_center|LOCUS_15690 38726 40342 gene locus_tag LOCUS_15700 38726 40342 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219125.1 protein_id gnl|my_center|LOCUS_15700 40674 40501 gene locus_tag LOCUS_15710 40674 40501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 40607 41851 gene locus_tag LOCUS_15720 40607 41851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_15720 42086 44653 gene locus_tag LOCUS_15730 gene uvrA2 42086 44653 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_15730 45032 45787 gene locus_tag LOCUS_15740 45032 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_15740 46586 45918 gene locus_tag LOCUS_15750 46586 45918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 46797 47282 gene locus_tag LOCUS_15760 46797 47282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 48592 49860 gene locus_tag LOCUS_15770 48592 49860 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 protein_id gnl|my_center|LOCUS_15770 49981 51261 gene locus_tag LOCUS_15780 49981 51261 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 protein_id gnl|my_center|LOCUS_15780 51254 51703 gene locus_tag LOCUS_15790 51254 51703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence23 158 1315 gene locus_tag LOCUS_15800 158 1315 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_15800 1326 2501 gene locus_tag LOCUS_15810 1326 2501 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708380.1 protein_id gnl|my_center|LOCUS_15810 2559 3782 gene locus_tag LOCUS_15820 2559 3782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_15820 4464 3997 gene locus_tag LOCUS_15830 4464 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5173 4643 gene locus_tag LOCUS_15840 gene ppa 5173 4643 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G4 protein_id gnl|my_center|LOCUS_15840 5210 5431 gene locus_tag LOCUS_15850 5210 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6224 5367 gene locus_tag LOCUS_15860 6224 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6620 8104 gene locus_tag LOCUS_15870 gene calB 6620 8104 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YG5 protein_id gnl|my_center|LOCUS_15870 8450 10378 gene locus_tag LOCUS_15880 8450 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10442 11335 gene locus_tag LOCUS_15890 gene proV 10442 11335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313415.1 protein_id gnl|my_center|LOCUS_15890 11608 13395 gene locus_tag LOCUS_15900 11608 13395 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951394.1 protein_id gnl|my_center|LOCUS_15900 13691 14917 gene locus_tag LOCUS_15910 gene pncB 13691 14917 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM9 protein_id gnl|my_center|LOCUS_15910 15164 14919 gene locus_tag LOCUS_15920 15164 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 16755 15223 gene locus_tag LOCUS_15930 16755 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 17351 16983 gene locus_tag LOCUS_15940 17351 16983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 17642 18292 gene locus_tag LOCUS_15950 17642 18292 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_15950 18383 19483 gene locus_tag LOCUS_15960 gene yhcM 18383 19483 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_15960 19618 20277 gene locus_tag LOCUS_15970 19618 20277 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_15970 20400 21716 gene locus_tag LOCUS_15980 gene gpsA 20400 21716 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_15980 21777 22235 gene locus_tag LOCUS_15990 21777 22235 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_15990 22396 23691 gene locus_tag LOCUS_16000 22396 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 23725 24294 gene locus_tag LOCUS_16010 23725 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 24564 24977 gene locus_tag LOCUS_16020 24564 24977 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_16020 25202 26236 gene locus_tag LOCUS_16030 gene pyrD 25202 26236 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ6 protein_id gnl|my_center|LOCUS_16030 26267 26764 gene locus_tag LOCUS_16040 26267 26764 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_16040 26971 28506 gene locus_tag LOCUS_16050 gene purF 26971 28506 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ4 protein_id gnl|my_center|LOCUS_16050 28988 28629 gene locus_tag LOCUS_16060 28988 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 29709 28978 gene locus_tag LOCUS_16070 29709 28978 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_16070 31260 29851 gene locus_tag LOCUS_16080 gene dinF 31260 29851 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134711.1 protein_id gnl|my_center|LOCUS_16080 32757 31495 gene locus_tag LOCUS_16090 32757 31495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 34644 32767 gene locus_tag LOCUS_16100 gene secD 34644 32767 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY6 protein_id gnl|my_center|LOCUS_16100 35381 35052 gene locus_tag LOCUS_16110 gene yajC 35381 35052 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_16110 36167 35973 gene locus_tag LOCUS_16120 36167 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 36166 37176 gene locus_tag LOCUS_16130 36166 37176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_16130 37451 37945 gene locus_tag LOCUS_16140 37451 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 38091 41135 gene locus_tag LOCUS_16150 gene mltD 38091 41135 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_16150 42341 41136 gene locus_tag LOCUS_16160 gene yfhD 42341 41136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_16160 44186 43350 gene locus_tag LOCUS_16170 44186 43350 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RF6 protein_id gnl|my_center|LOCUS_16170 44692 45909 gene locus_tag LOCUS_16180 gene algW 44692 45909 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_16180 46305 46036 gene locus_tag LOCUS_16190 46305 46036 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_16190 47575 46442 gene locus_tag LOCUS_16200 gene nrdB 47575 46442 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207754.2 protein_id gnl|my_center|LOCUS_16200 48033 47662 gene locus_tag LOCUS_16210 48033 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 48387 48070 gene locus_tag LOCUS_16220 48387 48070 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889208.1 protein_id gnl|my_center|LOCUS_16220 48598 48347 gene locus_tag LOCUS_16230 48598 48347 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMA1 protein_id gnl|my_center|LOCUS_16230 49218 49000 gene locus_tag LOCUS_16240 49218 49000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence24 1213 635 gene locus_tag LOCUS_16250 1213 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3895 1448 gene locus_tag LOCUS_16260 3895 1448 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_16260 5913 4129 gene locus_tag LOCUS_16270 gene acdA 5913 4129 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_16270 8036 6243 gene locus_tag LOCUS_16280 gene acdB 8036 6243 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_16280 10198 8531 gene locus_tag LOCUS_16290 10198 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 11270 10404 gene locus_tag LOCUS_16300 11270 10404 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_16300 12416 11568 gene locus_tag LOCUS_16310 gene metF 12416 11568 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_16310 13854 12430 gene locus_tag LOCUS_16320 gene sahH 13854 12430 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_16320 16141 14189 gene locus_tag LOCUS_16330 gene btuB 16141 14189 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038182.1 protein_id gnl|my_center|LOCUS_16330 16611 18473 gene locus_tag LOCUS_16340 16611 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 19146 18514 gene locus_tag LOCUS_16350 19146 18514 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 protein_id gnl|my_center|LOCUS_16350 20049 19318 gene locus_tag LOCUS_16360 20049 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_16360 21032 20157 gene locus_tag LOCUS_16370 gene trpC 21032 20157 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_16370 22226 21105 gene locus_tag LOCUS_16380 gene trpD 22226 21105 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR5 protein_id gnl|my_center|LOCUS_16380 22950 22327 gene locus_tag LOCUS_16390 gene trpG 22950 22327 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_16390 23761 25170 gene locus_tag LOCUS_16400 gene glnA 23761 25170 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ9 protein_id gnl|my_center|LOCUS_16400 25456 26085 gene locus_tag LOCUS_16410 25456 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 26908 26192 gene locus_tag LOCUS_16420 26908 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769371.1 protein_id gnl|my_center|LOCUS_16420 27467 28063 gene locus_tag LOCUS_16430 27467 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_16430 28103 31063 gene locus_tag LOCUS_16440 28103 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 31126 32016 gene locus_tag LOCUS_16450 31126 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 32109 33245 gene locus_tag LOCUS_16460 gene serC 32109 33245 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_16460 33676 35373 gene locus_tag LOCUS_16470 33676 35373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_16470 35519 36298 gene locus_tag LOCUS_16480 gene gloB 35519 36298 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPX6 protein_id gnl|my_center|LOCUS_16480 36400 37470 gene locus_tag LOCUS_16490 36400 37470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_16490 37470 38591 gene locus_tag LOCUS_16500 gene yejE 37470 38591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_16500 38593 40275 gene locus_tag LOCUS_16510 gene yejF 38593 40275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_16510 40459 41763 gene locus_tag LOCUS_16520 40459 41763 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_16520 42848 42237 gene locus_tag LOCUS_16530 gene folE 42848 42237 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_16530 43218 44027 gene locus_tag LOCUS_16540 gene fabI 43218 44027 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS9 protein_id gnl|my_center|LOCUS_16540 44287 44868 gene locus_tag LOCUS_16550 44287 44868 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 45097 44933 gene locus_tag LOCUS_16560 45097 44933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 45486 46907 gene locus_tag LOCUS_16570 45486 46907 CDS product transporter divalent anion:Na+ symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence25 1779 688 gene locus_tag LOCUS_16580 1779 688 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_16580 3093 1891 gene locus_tag LOCUS_16590 3093 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4415 3096 gene locus_tag LOCUS_16600 4415 3096 CDS product polysaccharide biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973111.1 protein_id gnl|my_center|LOCUS_16600 5492 4458 gene locus_tag LOCUS_16610 gene wbpP 5492 4458 CDS product UDP-GlkcNAc C4 epimerase WbpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_16610 6809 5532 gene locus_tag LOCUS_16620 gene wbpO 6809 5532 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_16620 8826 6850 gene locus_tag LOCUS_16630 gene wbpM 8826 6850 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_16630 11162 8883 gene locus_tag LOCUS_16640 gene ptk 11162 8883 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_16640 11639 11208 gene locus_tag LOCUS_16650 gene ptp 11639 11208 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_16650 12488 11652 gene locus_tag LOCUS_16660 gene wza 12488 11652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_16660 13290 14216 gene locus_tag LOCUS_16670 gene rluB 13290 14216 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_16670 14908 14357 gene locus_tag LOCUS_16680 14908 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 15644 14976 gene locus_tag LOCUS_16690 15644 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16622 15852 gene locus_tag LOCUS_16700 16622 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 16781 17383 gene locus_tag LOCUS_16710 16781 17383 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_16710 18144 17503 gene locus_tag LOCUS_16720 18144 17503 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ01 protein_id gnl|my_center|LOCUS_16720 19224 18364 gene locus_tag LOCUS_16730 gene nadC 19224 18364 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_16730 20426 19395 gene locus_tag LOCUS_16740 20426 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222013.1 protein_id gnl|my_center|LOCUS_16740 20776 20591 gene locus_tag LOCUS_16750 20776 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 20778 21917 gene locus_tag LOCUS_16760 gene nadA 20778 21917 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K105 protein_id gnl|my_center|LOCUS_16760 22000 23880 gene locus_tag LOCUS_16770 gene nadB 22000 23880 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH5 protein_id gnl|my_center|LOCUS_16770 24077 24988 gene locus_tag LOCUS_16780 24077 24988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706734.1 protein_id gnl|my_center|LOCUS_16780 25616 25032 gene locus_tag LOCUS_16790 25616 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 26246 25629 gene locus_tag LOCUS_16800 26246 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 27587 26328 gene locus_tag LOCUS_16810 gene ubiF 27587 26328 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_16810 29061 27754 gene locus_tag LOCUS_16820 gene ubiH 29061 27754 CDS product ubiquinone biosynthesis protein UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_16820 29648 30745 gene locus_tag LOCUS_16830 gene phoL 29648 30745 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_16830 31031 31636 gene locus_tag LOCUS_16840 31031 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 32523 31648 gene locus_tag LOCUS_16850 32523 31648 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687000.1 protein_id gnl|my_center|LOCUS_16850 33587 32700 gene locus_tag LOCUS_16860 gene tonB 33587 32700 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_16860 33919 34698 gene locus_tag LOCUS_16870 33919 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_16870 35626 34799 gene locus_tag LOCUS_16880 gene fpr 35626 34799 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_16880 37282 35804 gene locus_tag LOCUS_16890 gene nuoN 37282 35804 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_16890 38911 37286 gene locus_tag LOCUS_16900 gene nuoM 38911 37286 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_16900 40788 38914 gene locus_tag LOCUS_16910 gene nuoL 40788 38914 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J1 protein_id gnl|my_center|LOCUS_16910 41200 40793 gene locus_tag LOCUS_16920 gene nuoK 41200 40793 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET3 protein_id gnl|my_center|LOCUS_16920 41931 41200 gene locus_tag LOCUS_16930 41931 41200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 42476 41928 gene locus_tag LOCUS_16940 gene nuoI 42476 41928 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_16940 43575 42532 gene locus_tag LOCUS_16950 gene nuoH 43575 42532 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET0 protein_id gnl|my_center|LOCUS_16950 46645 43577 gene locus_tag LOCUS_16960 46645 43577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence26 1818 175 gene locus_tag LOCUS_16970 1818 175 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_16970 3302 2019 gene locus_tag LOCUS_16980 gene yliI 3302 2019 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_16980 6108 3511 gene locus_tag LOCUS_16990 gene clpB 6108 3511 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI86 protein_id gnl|my_center|LOCUS_16990 6567 6415 gene locus_tag LOCUS_17000 6567 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 6946 6794 gene locus_tag LOCUS_17010 6946 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7860 7054 gene locus_tag LOCUS_17020 7860 7054 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_17020 9636 7933 gene locus_tag LOCUS_17030 9636 7933 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_17030 11022 9904 gene locus_tag LOCUS_17040 11022 9904 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_17040 11619 11335 gene locus_tag LOCUS_17050 11619 11335 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_17050 12555 11662 gene locus_tag LOCUS_17060 gene prfB 12555 11662 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA8 protein_id gnl|my_center|LOCUS_17060 13574 12873 gene locus_tag LOCUS_17070 13574 12873 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_17070 13661 13849 gene locus_tag LOCUS_17080 13661 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 14348 13812 gene locus_tag LOCUS_17090 14348 13812 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_17090 14619 15170 gene locus_tag LOCUS_17100 14619 15170 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073616.1 protein_id gnl|my_center|LOCUS_17100 15455 16696 gene locus_tag LOCUS_17110 gene carA 15455 16696 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW0 protein_id gnl|my_center|LOCUS_17110 16849 20112 gene locus_tag LOCUS_17120 gene carB 16849 20112 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_17120 20439 20915 gene locus_tag LOCUS_17130 gene greA 20439 20915 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_17130 21418 22320 gene locus_tag LOCUS_17140 21418 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 22558 23826 gene locus_tag LOCUS_17150 22558 23826 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_17150 24145 25017 gene locus_tag LOCUS_17160 24145 25017 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_17160 25156 26547 gene locus_tag LOCUS_17170 gene lpsB 25156 26547 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_17170 26925 28298 gene locus_tag LOCUS_17180 26925 28298 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731292.1 protein_id gnl|my_center|LOCUS_17180 29826 28387 gene locus_tag LOCUS_17190 29826 28387 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_17190 31387 30128 gene locus_tag LOCUS_17200 31387 30128 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 protein_id gnl|my_center|LOCUS_17200 33028 31565 gene locus_tag LOCUS_17210 gene gabD 33028 31565 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_17210 33253 34017 gene locus_tag LOCUS_17220 33253 34017 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068700.1 protein_id gnl|my_center|LOCUS_17220 34223 34026 gene locus_tag LOCUS_17230 34223 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 35543 34326 gene locus_tag LOCUS_17240 gene caiB 35543 34326 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_17240 36945 35761 gene locus_tag LOCUS_17250 36945 35761 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_17250 37122 37952 gene locus_tag LOCUS_17260 37122 37952 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_17260 39769 37997 gene locus_tag LOCUS_17270 39769 37997 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HG0 protein_id gnl|my_center|LOCUS_17270 41469 39766 gene locus_tag LOCUS_17280 41469 39766 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_17280 41705 42613 gene locus_tag LOCUS_17290 41705 42613 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_17290 43405 42710 gene locus_tag LOCUS_17300 gene dehII 43405 42710 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 protein_id gnl|my_center|LOCUS_17300 43795 43463 gene locus_tag LOCUS_17310 43795 43463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence27 103 851 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacccgtgatgggtgcgaa 1399 1109 gene locus_tag LOCUS_17320 gene cas 1399 1109 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8P1 protein_id gnl|my_center|LOCUS_17320 2469 1438 gene locus_tag LOCUS_17330 gene cas1-2 2469 1438 CDS product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RW61 protein_id gnl|my_center|LOCUS_17330 2580 2732 gene locus_tag LOCUS_17340 2580 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3402 2767 gene locus_tag LOCUS_17350 3402 2767 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_17350 4383 3490 gene locus_tag LOCUS_17360 4383 3490 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_17360 6476 4440 gene locus_tag LOCUS_17370 6476 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7207 6473 gene locus_tag LOCUS_17380 7207 6473 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_17380 7544 7272 gene locus_tag LOCUS_17390 7544 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300143.1 protein_id gnl|my_center|LOCUS_17390 10420 7781 gene locus_tag LOCUS_17400 10420 7781 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_17400 10918 10598 gene locus_tag LOCUS_17410 10918 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 11219 10929 gene locus_tag LOCUS_17420 11219 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 12417 11206 gene locus_tag LOCUS_17430 12417 11206 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097284.1 protein_id gnl|my_center|LOCUS_17430 12644 12429 gene locus_tag LOCUS_17440 12644 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12795 13019 gene locus_tag LOCUS_17450 12795 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13338 13262 gene locus_tag LOCUS_t00230 13338 13262 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13652 14629 gene locus_tag LOCUS_17460 13652 14629 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_17460 15771 14764 gene locus_tag LOCUS_17470 gene hemB 15771 14764 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN7 protein_id gnl|my_center|LOCUS_17470 17825 16014 gene locus_tag LOCUS_17480 gene oprM 17825 16014 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_17480 21037 17822 gene locus_tag LOCUS_17490 gene acrB2 21037 17822 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_17490 22446 21073 gene locus_tag LOCUS_17500 gene acrA 22446 21073 CDS product AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_17500 24221 23196 gene locus_tag LOCUS_17510 gene ispB 24221 23196 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_17510 24790 25101 gene locus_tag LOCUS_17520 gene rplU 24790 25101 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH1 protein_id gnl|my_center|LOCUS_17520 25193 25450 gene locus_tag LOCUS_17530 gene rpmA 25193 25450 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL7 protein_id gnl|my_center|LOCUS_17530 25922 26605 gene locus_tag LOCUS_17540 gene lolA 25922 26605 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_17540 27381 26770 gene locus_tag LOCUS_17550 27381 26770 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_17550 28287 27448 gene locus_tag LOCUS_17560 28287 27448 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_17560 28895 28293 gene locus_tag LOCUS_17570 gene mdmC 28895 28293 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_17570 29986 28916 gene locus_tag LOCUS_17580 gene trpS 29986 28916 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYQ9 protein_id gnl|my_center|LOCUS_17580 31186 30095 gene locus_tag LOCUS_17590 gene htrB 31186 30095 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_17590 32032 31646 gene locus_tag LOCUS_17600 gene rpsI 32032 31646 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK4 protein_id gnl|my_center|LOCUS_17600 32471 32043 gene locus_tag LOCUS_17610 gene rplM 32471 32043 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK3 protein_id gnl|my_center|LOCUS_17610 33410 32724 gene locus_tag LOCUS_17620 gene rsmD 33410 32724 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX9 protein_id gnl|my_center|LOCUS_17620 35485 33500 gene locus_tag LOCUS_17630 gene pbpA 35485 33500 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_17630 35980 37314 gene locus_tag LOCUS_17640 35980 37314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_17640 37605 39635 gene locus_tag LOCUS_17650 37605 39635 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_17650 39637 40287 gene locus_tag LOCUS_17660 gene dsbE 39637 40287 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_17660 40284 40841 gene locus_tag LOCUS_17670 gene ccmH 40284 40841 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_17670 40838 42118 gene locus_tag LOCUS_17680 gene vacJ 40838 42118 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 protein_id gnl|my_center|LOCUS_17680 42335 42991 gene locus_tag LOCUS_17690 gene adk 42335 42991 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_17690 >Feature sequence28 659 1915 gene locus_tag LOCUS_17700 gene glyA 659 1915 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_17700 2009 2467 gene locus_tag LOCUS_17710 2009 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3341 2643 gene locus_tag LOCUS_17720 3341 2643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730514.1 protein_id gnl|my_center|LOCUS_17720 4097 3522 gene locus_tag LOCUS_17730 4097 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4565 4161 gene locus_tag LOCUS_17740 4565 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5310 4567 gene locus_tag LOCUS_17750 5310 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6734 5433 gene locus_tag LOCUS_17760 gene proA 6734 5433 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_17760 7099 7404 gene locus_tag LOCUS_17770 7099 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 7743 8540 gene locus_tag LOCUS_17780 7743 8540 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737152.1 protein_id gnl|my_center|LOCUS_17780 8845 9642 gene locus_tag LOCUS_17790 8845 9642 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_17790 9774 10691 gene locus_tag LOCUS_17800 9774 10691 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_17800 10760 11689 gene locus_tag LOCUS_17810 10760 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 12160 12894 gene locus_tag LOCUS_17820 12160 12894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342249.1 protein_id gnl|my_center|LOCUS_17820 12907 13632 gene locus_tag LOCUS_17830 12907 13632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_17830 13738 14454 gene locus_tag LOCUS_17840 gene ycgM 13738 14454 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_17840 14738 16963 gene locus_tag LOCUS_17850 14738 16963 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_17850 17223 18716 gene locus_tag LOCUS_17860 17223 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 protein_id gnl|my_center|LOCUS_17860 19183 18752 gene locus_tag LOCUS_17870 19183 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 19639 19418 gene locus_tag LOCUS_17880 19639 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 20724 19744 gene locus_tag LOCUS_17890 gene hslO 20724 19744 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_17890 21132 22118 gene locus_tag LOCUS_17900 21132 22118 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_17900 22208 22954 gene locus_tag LOCUS_17910 22208 22954 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396522.1 protein_id gnl|my_center|LOCUS_17910 22951 23622 gene locus_tag LOCUS_17920 22951 23622 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_17920 23743 23582 gene locus_tag LOCUS_17930 23743 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 23725 24528 gene locus_tag LOCUS_17940 23725 24528 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268728.1 protein_id gnl|my_center|LOCUS_17940 24859 26118 gene locus_tag LOCUS_17950 gene norW 24859 26118 CDS product nitric oxide reductase FlRd-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CL7 protein_id gnl|my_center|LOCUS_17950 26424 28202 gene locus_tag LOCUS_17960 26424 28202 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536471.1 protein_id gnl|my_center|LOCUS_17960 28329 29939 gene locus_tag LOCUS_17970 28329 29939 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_17970 30111 30929 gene locus_tag LOCUS_17980 30111 30929 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_17980 31000 33117 gene locus_tag LOCUS_17990 gene accA 31000 33117 CDS product biotin carboxylase subunit of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_17990 33133 34053 gene locus_tag LOCUS_18000 gene hmgcL 33133 34053 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_18000 34202 35389 gene locus_tag LOCUS_18010 gene ivd 34202 35389 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_18010 36253 35525 gene locus_tag LOCUS_18020 gene coaX 36253 35525 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 protein_id gnl|my_center|LOCUS_18020 37299 36325 gene locus_tag LOCUS_18030 37299 36325 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200328.1 protein_id gnl|my_center|LOCUS_18030 37757 38563 gene locus_tag LOCUS_18040 37757 38563 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_18040 >Feature sequence29 550 984 gene locus_tag LOCUS_18050 550 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1497 2663 gene locus_tag LOCUS_18060 gene dacC 1497 2663 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_18060 4807 2846 gene locus_tag LOCUS_18070 4807 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6413 4992 gene locus_tag LOCUS_18080 gene engA 6413 4992 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_18080 7878 6730 gene locus_tag LOCUS_18090 gene bamB 7878 6730 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P5 protein_id gnl|my_center|LOCUS_18090 8903 8109 gene locus_tag LOCUS_18100 8903 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 10275 8974 gene locus_tag LOCUS_18110 gene hisS 10275 8974 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_18110 11512 10397 gene locus_tag LOCUS_18120 gene ispG 11512 10397 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_18120 12445 11630 gene locus_tag LOCUS_18130 12445 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13302 12442 gene locus_tag LOCUS_18140 gene pilF 13302 12442 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_18140 14822 13593 gene locus_tag LOCUS_18150 gene rlmN 14822 13593 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_18150 15554 15123 gene locus_tag LOCUS_18160 gene ndk 15554 15123 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_18160 15903 16979 gene locus_tag LOCUS_18170 15903 16979 CDS product IS element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_454711.1 protein_id gnl|my_center|LOCUS_18170 17048 17659 gene locus_tag LOCUS_18180 17048 17659 CDS product IS607 family transposase ISTko2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250792.1 protein_id gnl|my_center|LOCUS_18180 17656 18810 gene locus_tag LOCUS_18190 17656 18810 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887311.1 protein_id gnl|my_center|LOCUS_18190 20744 19455 gene locus_tag LOCUS_18200 gene purA 20744 19455 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI77 protein_id gnl|my_center|LOCUS_18200 22187 20892 gene locus_tag LOCUS_18210 gene hisZ 22187 20892 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_18210 22675 23064 gene locus_tag LOCUS_18220 22675 23064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_18220 23159 24373 gene locus_tag LOCUS_18230 gene corA 23159 24373 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_18230 24956 24438 gene locus_tag LOCUS_18240 24956 24438 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_18240 25930 25052 gene locus_tag LOCUS_18250 gene folD 25930 25052 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_18250 27638 26160 gene locus_tag LOCUS_18260 27638 26160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 protein_id gnl|my_center|LOCUS_18260 28908 27700 gene locus_tag LOCUS_18270 gene pglC 28908 27700 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_18270 29673 28987 gene locus_tag LOCUS_18280 29673 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 30683 29670 gene locus_tag LOCUS_18290 30683 29670 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536050.1 protein_id gnl|my_center|LOCUS_18290 31468 30680 gene locus_tag LOCUS_18300 31468 30680 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_18300 32058 31465 gene locus_tag LOCUS_18310 32058 31465 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_18310 33197 32055 gene locus_tag LOCUS_18320 33197 32055 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057044.1 protein_id gnl|my_center|LOCUS_18320 34390 33197 gene locus_tag LOCUS_18330 34390 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 35562 34444 gene locus_tag LOCUS_18340 35562 34444 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_18340 36619 35606 gene locus_tag LOCUS_18350 gene uge 36619 35606 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_18350 37785 36616 gene locus_tag LOCUS_18360 gene ugd 37785 36616 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence30 307 861 gene locus_tag LOCUS_18370 gene def 307 861 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_18370 970 2151 gene locus_tag LOCUS_18380 970 2151 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_18380 3085 2234 gene locus_tag LOCUS_18390 3085 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3617 3105 gene locus_tag LOCUS_18400 3617 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3954 3598 gene locus_tag LOCUS_18410 3954 3598 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775643.1 protein_id gnl|my_center|LOCUS_18410 4922 4092 gene locus_tag LOCUS_18420 gene dapB 4922 4092 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_18420 6231 5107 gene locus_tag LOCUS_18430 gene dnaJ 6231 5107 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI50 protein_id gnl|my_center|LOCUS_18430 6646 7296 gene locus_tag LOCUS_18440 6646 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 8501 7437 gene locus_tag LOCUS_18450 8501 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 9537 8833 gene locus_tag LOCUS_18460 9537 8833 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM54 protein_id gnl|my_center|LOCUS_18460 9737 10339 gene locus_tag LOCUS_18470 9737 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_18470 10675 11724 gene locus_tag LOCUS_18480 10675 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224842.1 protein_id gnl|my_center|LOCUS_18480 11799 12341 gene locus_tag LOCUS_18490 11799 12341 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_18490 12360 12506 gene locus_tag LOCUS_18500 12360 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 13749 12841 gene locus_tag LOCUS_18510 13749 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13966 15012 gene locus_tag LOCUS_18520 13966 15012 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195311.1 protein_id gnl|my_center|LOCUS_18520 15964 15014 gene locus_tag LOCUS_18530 15964 15014 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_18530 16375 16533 gene locus_tag LOCUS_18540 16375 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16930 16595 gene locus_tag LOCUS_18550 16930 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 17152 17406 gene locus_tag LOCUS_18560 17152 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 17762 18739 gene locus_tag LOCUS_18570 gene mecR 17762 18739 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_18570 19105 20109 gene locus_tag LOCUS_18580 19105 20109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_18580 22155 20182 gene locus_tag LOCUS_18590 22155 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_18590 23871 22261 gene locus_tag LOCUS_18600 gene guaA 23871 22261 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_18600 24390 25997 gene locus_tag LOCUS_18610 24390 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 26187 25987 gene locus_tag LOCUS_18620 26187 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 26120 27391 gene locus_tag LOCUS_18630 26120 27391 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_18630 27395 28549 gene locus_tag LOCUS_18640 27395 28549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 28581 29540 gene locus_tag LOCUS_18650 28581 29540 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_18650 30318 29812 gene locus_tag LOCUS_18660 30318 29812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 31561 30488 gene locus_tag LOCUS_18670 31561 30488 CDS product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311494.1 protein_id gnl|my_center|LOCUS_18670 31834 32328 gene locus_tag LOCUS_18680 31834 32328 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_18680 33543 32527 gene locus_tag LOCUS_18690 33543 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 34478 33540 gene locus_tag LOCUS_18700 34478 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321154.1 protein_id gnl|my_center|LOCUS_18700 35330 34479 gene locus_tag LOCUS_18710 35330 34479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 36390 35590 gene locus_tag LOCUS_18720 36390 35590 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence31 255 1259 gene locus_tag LOCUS_18730 255 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1748 1440 gene locus_tag LOCUS_18740 1748 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 3326 2040 gene locus_tag LOCUS_18750 3326 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 protein_id gnl|my_center|LOCUS_18750 6708 3319 gene locus_tag LOCUS_18760 6708 3319 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_18760 7697 6720 gene locus_tag LOCUS_18770 7697 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 9223 7763 gene locus_tag LOCUS_18780 9223 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_18780 10884 9532 gene locus_tag LOCUS_18790 10884 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_18790 13003 10877 gene locus_tag LOCUS_18800 gene yeeB 13003 10877 CDS product putative ATP-dependent helicase YeeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34469 protein_id gnl|my_center|LOCUS_18800 13776 13162 gene locus_tag LOCUS_18810 13776 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 16619 13833 gene locus_tag LOCUS_18820 gene yeeA 16619 13833 CDS product putative DNA methyltransferase YeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31504 protein_id gnl|my_center|LOCUS_18820 16786 17322 gene locus_tag LOCUS_18830 16786 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 18367 17801 gene locus_tag LOCUS_18840 18367 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 18922 18437 gene locus_tag LOCUS_18850 18922 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 20752 19733 gene locus_tag LOCUS_18860 20752 19733 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479808.1 protein_id gnl|my_center|LOCUS_18860 20927 22360 gene locus_tag LOCUS_18870 20927 22360 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH2 protein_id gnl|my_center|LOCUS_18870 22470 24230 gene locus_tag LOCUS_18880 gene choB 22470 24230 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_18880 24230 26197 gene locus_tag LOCUS_18890 gene sdsA1 24230 26197 CDS product SDS hydrolase SdsA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_18890 26396 28021 gene locus_tag LOCUS_18900 26396 28021 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_18900 28255 28815 gene locus_tag LOCUS_18910 28255 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 28815 31139 gene locus_tag LOCUS_18920 28815 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 31132 34050 gene locus_tag LOCUS_18930 31132 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence32 329 574 gene locus_tag LOCUS_18940 329 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2177 693 gene locus_tag LOCUS_18950 2177 693 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_18950 2526 3131 gene locus_tag LOCUS_18960 2526 3131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 protein_id gnl|my_center|LOCUS_18960 3413 4624 gene locus_tag LOCUS_18970 gene yqhD 3413 4624 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 protein_id gnl|my_center|LOCUS_18970 4899 5948 gene locus_tag LOCUS_18980 4899 5948 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_18980 6203 6880 gene locus_tag LOCUS_18990 6203 6880 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 protein_id gnl|my_center|LOCUS_18990 6906 7553 gene locus_tag LOCUS_19000 6906 7553 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704478.1 protein_id gnl|my_center|LOCUS_19000 7964 9610 gene locus_tag LOCUS_19010 gene rmrB 7964 9610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638834.2 protein_id gnl|my_center|LOCUS_19010 9699 11015 gene locus_tag LOCUS_19020 9699 11015 CDS product multidrug transporter EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404437.1 protein_id gnl|my_center|LOCUS_19020 11784 11122 gene locus_tag LOCUS_19030 gene pdxH 11784 11122 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX20 protein_id gnl|my_center|LOCUS_19030 13248 11881 gene locus_tag LOCUS_19040 gene glmM 13248 11881 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB2 protein_id gnl|my_center|LOCUS_19040 14918 13446 gene locus_tag LOCUS_19050 gene guaB 14918 13446 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_19050 17142 15178 gene locus_tag LOCUS_19060 17142 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 18767 17307 gene locus_tag LOCUS_19070 gene cysS 18767 17307 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX2 protein_id gnl|my_center|LOCUS_19070 18959 19555 gene locus_tag LOCUS_19080 18959 19555 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_19080 20582 19701 gene locus_tag LOCUS_19090 20582 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 20994 21722 gene locus_tag LOCUS_19100 gene ugpQ 20994 21722 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_19100 21970 23373 gene locus_tag LOCUS_19110 gene olE1 21970 23373 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_19110 23517 23705 gene locus_tag LOCUS_19120 23517 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 24510 23656 gene locus_tag LOCUS_19130 24510 23656 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378754.1 protein_id gnl|my_center|LOCUS_19130 24821 24525 gene locus_tag LOCUS_19140 24821 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 25085 26566 gene locus_tag LOCUS_19150 25085 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_19150 26921 29251 gene locus_tag LOCUS_19160 gene maeB 26921 29251 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_19160 29416 30603 gene locus_tag LOCUS_19170 gene cca 29416 30603 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTY6 protein_id gnl|my_center|LOCUS_19170 30630 31442 gene locus_tag LOCUS_19180 30630 31442 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_19180 31536 31612 gene locus_tag LOCUS_t00240 31536 31612 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31783 33054 gene locus_tag LOCUS_19190 31783 33054 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_19190 33383 33643 gene locus_tag LOCUS_19200 33383 33643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence33 370 215 gene locus_tag LOCUS_19210 gene rpmG 370 215 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_19210 734 498 gene locus_tag LOCUS_19220 gene rpmB 734 498 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM34 protein_id gnl|my_center|LOCUS_19220 1220 6916 gene locus_tag LOCUS_19230 1220 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 7116 8045 gene locus_tag LOCUS_19240 gene purU1 7116 8045 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_19240 8913 8122 gene locus_tag LOCUS_19250 8913 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 9327 10865 gene locus_tag LOCUS_19260 gene ffh 9327 10865 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW9 protein_id gnl|my_center|LOCUS_19260 11131 11835 gene locus_tag LOCUS_19270 gene yeaZ 11131 11835 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_19270 11921 12763 gene locus_tag LOCUS_19280 gene uppP2 11921 12763 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_19280 12831 13730 gene locus_tag LOCUS_19290 gene rsmJ 12831 13730 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ5 protein_id gnl|my_center|LOCUS_19290 13848 14003 gene locus_tag LOCUS_19300 13848 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14198 15115 gene locus_tag LOCUS_19310 gene ubiA 14198 15115 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_19310 15108 15782 gene locus_tag LOCUS_19320 15108 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 protein_id gnl|my_center|LOCUS_19320 16567 15923 gene locus_tag LOCUS_19330 16567 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 17060 16626 gene locus_tag LOCUS_19340 17060 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_19340 19239 17167 gene locus_tag LOCUS_19350 gene mnmC 19239 17167 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC7 protein_id gnl|my_center|LOCUS_19350 19800 19369 gene locus_tag LOCUS_19360 19800 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_19360 20114 19797 gene locus_tag LOCUS_19370 20114 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 protein_id gnl|my_center|LOCUS_19370 20800 20249 gene locus_tag LOCUS_19380 gene ispZ 20800 20249 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ2 protein_id gnl|my_center|LOCUS_19380 21106 21987 gene locus_tag LOCUS_19390 gene trpH 21106 21987 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_19390 22325 23740 gene locus_tag LOCUS_19400 22325 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 25064 23769 gene locus_tag LOCUS_19410 gene truD 25064 23769 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_19410 25307 26956 gene locus_tag LOCUS_19420 25307 26956 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_19420 27042 27653 gene locus_tag LOCUS_19430 27042 27653 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_19430 29369 28014 gene locus_tag LOCUS_19440 gene gor 29369 28014 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43783 protein_id gnl|my_center|LOCUS_19440 29964 29512 gene locus_tag LOCUS_19450 29964 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 30768 29965 gene locus_tag LOCUS_19460 30768 29965 CDS product structural protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_313351.2 protein_id gnl|my_center|LOCUS_19460 30871 31152 gene locus_tag LOCUS_19470 30871 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 31241 31681 gene locus_tag LOCUS_19480 31241 31681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 32768 31980 gene locus_tag LOCUS_19490 32768 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 33124 32765 gene locus_tag LOCUS_19500 33124 32765 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647007.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence34 1146 331 gene locus_tag LOCUS_19510 1146 331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 protein_id gnl|my_center|LOCUS_19510 1127 1372 gene locus_tag LOCUS_19520 1127 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2069 1272 gene locus_tag LOCUS_19530 gene znuC 2069 1272 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF9 protein_id gnl|my_center|LOCUS_19530 2739 2161 gene locus_tag LOCUS_19540 gene zur 2739 2161 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_19540 2939 3820 gene locus_tag LOCUS_19550 gene znuA 2939 3820 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_19550 4107 4505 gene locus_tag LOCUS_19560 4107 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5188 6054 gene locus_tag LOCUS_19570 gene atpB 5188 6054 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_19570 6088 6336 gene locus_tag LOCUS_19580 6088 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6454 6924 gene locus_tag LOCUS_19590 gene atpF 6454 6924 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG5 protein_id gnl|my_center|LOCUS_19590 6938 7561 gene locus_tag LOCUS_19600 gene atpH 6938 7561 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG6 protein_id gnl|my_center|LOCUS_19600 7655 9199 gene locus_tag LOCUS_19610 gene atpA 7655 9199 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG7 protein_id gnl|my_center|LOCUS_19610 9409 10290 gene locus_tag LOCUS_19620 gene atpG 9409 10290 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG8 protein_id gnl|my_center|LOCUS_19620 10329 11762 gene locus_tag LOCUS_19630 gene atpD 10329 11762 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG9 protein_id gnl|my_center|LOCUS_19630 11878 12294 gene locus_tag LOCUS_19640 gene atpC 11878 12294 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_19640 12903 13619 gene locus_tag LOCUS_19650 gene rstA 12903 13619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_19650 13942 15630 gene locus_tag LOCUS_19660 gene rstB 13942 15630 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_19660 15762 15941 gene locus_tag LOCUS_19670 15762 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 17381 15975 gene locus_tag LOCUS_19680 gene envZ 17381 15975 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_19680 17897 18166 gene locus_tag LOCUS_19690 gene rpsP 17897 18166 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIC6 protein_id gnl|my_center|LOCUS_19690 18332 18865 gene locus_tag LOCUS_19700 gene rimM 18332 18865 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_19700 18971 19735 gene locus_tag LOCUS_19710 gene trmD 18971 19735 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY1 protein_id gnl|my_center|LOCUS_19710 19941 20360 gene locus_tag LOCUS_19720 gene rplS 19941 20360 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_19720 21195 20635 gene locus_tag LOCUS_19730 21195 20635 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_19730 21697 23223 gene locus_tag LOCUS_19740 21697 23223 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 protein_id gnl|my_center|LOCUS_19740 23376 25220 gene locus_tag LOCUS_19750 gene uvrC 23376 25220 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS7 protein_id gnl|my_center|LOCUS_19750 25914 25324 gene locus_tag LOCUS_19760 gene folA 25914 25324 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_19760 26303 25995 gene locus_tag LOCUS_19770 26303 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 28321 26489 gene locus_tag LOCUS_19780 28321 26489 CDS product HsdS polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105648.1 protein_id gnl|my_center|LOCUS_19780 29799 28324 gene locus_tag LOCUS_19790 29799 28324 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 protein_id gnl|my_center|LOCUS_19790 32342 29907 gene locus_tag LOCUS_19800 32342 29907 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence35 1852 161 gene locus_tag LOCUS_19810 gene nadE2 1852 161 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_19810 2678 3835 gene locus_tag LOCUS_19820 2678 3835 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_19820 3865 5031 gene locus_tag LOCUS_19830 gene pdxB 3865 5031 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA1 protein_id gnl|my_center|LOCUS_19830 5118 6134 gene locus_tag LOCUS_19840 gene poxA 5118 6134 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_19840 6936 6295 gene locus_tag LOCUS_19850 6936 6295 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_19850 7617 7168 gene locus_tag LOCUS_19860 7617 7168 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_19860 8945 7617 gene locus_tag LOCUS_19870 gene purK 8945 7617 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_19870 9694 9143 gene locus_tag LOCUS_19880 gene purE 9694 9143 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_19880 10759 9794 gene locus_tag LOCUS_19890 10759 9794 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_19890 11451 10843 gene locus_tag LOCUS_19900 11451 10843 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_19900 11866 13500 gene locus_tag LOCUS_19910 11866 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 13854 13669 gene locus_tag LOCUS_19920 13854 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 13970 15562 gene locus_tag LOCUS_19930 13970 15562 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206198.1 protein_id gnl|my_center|LOCUS_19930 16781 15696 gene locus_tag LOCUS_19940 gene nagZ 16781 15696 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_19940 17304 19517 gene locus_tag LOCUS_19950 gene prc 17304 19517 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_19950 20561 20076 gene locus_tag LOCUS_19960 gene slyD 20561 20076 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_19960 20885 22897 gene locus_tag LOCUS_19970 20885 22897 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 protein_id gnl|my_center|LOCUS_19970 23877 23026 gene locus_tag LOCUS_19980 23877 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 24779 24165 gene locus_tag LOCUS_19990 gene rluE 24779 24165 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFQ3 protein_id gnl|my_center|LOCUS_19990 24827 25018 gene locus_tag LOCUS_20000 24827 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 25397 26656 gene locus_tag LOCUS_20010 gene icd 25397 26656 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_20010 29135 26916 gene locus_tag LOCUS_20020 gene icd2 29135 26916 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_20020 29757 31106 gene locus_tag LOCUS_20030 29757 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_20030 31183 31686 gene locus_tag LOCUS_20040 gene ubiC 31183 31686 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_20040 >Feature sequence36 198 1991 gene locus_tag LOCUS_20050 198 1991 CDS product K(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207451.1 protein_id gnl|my_center|LOCUS_20050 2584 2006 gene locus_tag LOCUS_20060 2584 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20060 3262 2942 gene locus_tag LOCUS_20070 3262 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20070 3612 3289 gene locus_tag LOCUS_20080 3612 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4583 4050 gene locus_tag LOCUS_20090 gene yaiL 4583 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 protein_id gnl|my_center|LOCUS_20090 4916 5779 gene locus_tag LOCUS_20100 4916 5779 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_20100 5994 6677 gene locus_tag LOCUS_20110 5994 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_20110 8164 7202 gene locus_tag LOCUS_20120 gene yihG 8164 7202 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_20120 8580 8819 gene locus_tag LOCUS_20130 8580 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 9058 9660 gene locus_tag LOCUS_20140 9058 9660 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_20140 9920 9744 gene locus_tag LOCUS_20150 9920 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 11237 9975 gene locus_tag LOCUS_20160 11237 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 11426 12190 gene locus_tag LOCUS_20170 11426 12190 CDS product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528967.1 protein_id gnl|my_center|LOCUS_20170 12367 13302 gene locus_tag LOCUS_20180 12367 13302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528965.1 protein_id gnl|my_center|LOCUS_20180 13509 15440 gene locus_tag LOCUS_20190 13509 15440 CDS product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 protein_id gnl|my_center|LOCUS_20190 15548 16930 gene locus_tag LOCUS_20200 15548 16930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 protein_id gnl|my_center|LOCUS_20200 17365 19665 gene locus_tag LOCUS_20210 gene iutA 17365 19665 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_20210 20031 20603 gene locus_tag LOCUS_20220 gene mntP 20031 20603 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP9 protein_id gnl|my_center|LOCUS_20220 21163 22845 gene locus_tag LOCUS_20230 gene maeA 21163 22845 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHR8 protein_id gnl|my_center|LOCUS_20230 23940 24554 gene locus_tag LOCUS_20240 23940 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889404.1 protein_id gnl|my_center|LOCUS_20240 24645 26207 gene locus_tag LOCUS_20250 24645 26207 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227456.1 protein_id gnl|my_center|LOCUS_20250 26274 27422 gene locus_tag LOCUS_20260 26274 27422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227457.1 protein_id gnl|my_center|LOCUS_20260 27476 27595 gene locus_tag LOCUS_20270 27476 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 27673 27969 gene locus_tag LOCUS_20280 27673 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 28948 28241 gene locus_tag LOCUS_20290 28948 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 30094 29030 gene locus_tag LOCUS_20300 30094 29030 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766375.1 protein_id gnl|my_center|LOCUS_20300 30245 31150 gene locus_tag LOCUS_20310 30245 31150 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence37 1437 13 gene locus_tag LOCUS_20320 gene nuoF 1437 13 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_20320 1943 1434 gene locus_tag LOCUS_20330 gene nuoE 1943 1434 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_20330 3886 2111 gene locus_tag LOCUS_20340 gene nuoC 3886 2111 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_20340 4698 4030 gene locus_tag LOCUS_20350 gene nuoB 4698 4030 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_20350 5459 4836 gene locus_tag LOCUS_20360 5459 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 6221 8254 gene locus_tag LOCUS_20370 gene rep 6221 8254 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL5 protein_id gnl|my_center|LOCUS_20370 8399 9766 gene locus_tag LOCUS_20380 8399 9766 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_20380 9893 10357 gene locus_tag LOCUS_20390 gene dut 9893 10357 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL6 protein_id gnl|my_center|LOCUS_20390 10535 12391 gene locus_tag LOCUS_20400 gene algC 10535 12391 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_20400 12466 13368 gene locus_tag LOCUS_20410 gene argB 12466 13368 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_20410 13393 13566 gene locus_tag LOCUS_20420 13393 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 14023 13652 gene locus_tag LOCUS_20430 gene yffB 14023 13652 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_20430 14260 16947 gene locus_tag LOCUS_20440 gene leuS 14260 16947 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT5 protein_id gnl|my_center|LOCUS_20440 16998 17711 gene locus_tag LOCUS_20450 16998 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 17936 18958 gene locus_tag LOCUS_20460 gene holA 17936 18958 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 protein_id gnl|my_center|LOCUS_20460 19217 20536 gene locus_tag LOCUS_20470 19217 20536 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208495.1 protein_id gnl|my_center|LOCUS_20470 20787 22736 gene locus_tag LOCUS_20480 gene macB 20787 22736 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT1 protein_id gnl|my_center|LOCUS_20480 22929 23004 gene locus_tag LOCUS_t00250 22929 23004 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23207 23282 gene locus_tag LOCUS_t00260 23207 23282 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24145 23357 gene locus_tag LOCUS_20490 24145 23357 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490904.1 protein_id gnl|my_center|LOCUS_20490 26487 24400 gene locus_tag LOCUS_20500 gene katE 26487 24400 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBL0 protein_id gnl|my_center|LOCUS_20500 26913 27704 gene locus_tag LOCUS_20510 26913 27704 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120630.1 protein_id gnl|my_center|LOCUS_20510 28463 27804 gene locus_tag LOCUS_20520 28463 27804 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_20520 28992 28531 gene locus_tag LOCUS_20530 28992 28531 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728514.1 protein_id gnl|my_center|LOCUS_20530 29410 28997 gene locus_tag LOCUS_20540 gene osmC 29410 28997 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence38 2526 217 gene locus_tag LOCUS_20550 2526 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3485 4963 gene locus_tag LOCUS_20560 gene degP 3485 4963 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 protein_id gnl|my_center|LOCUS_20560 5618 6523 gene locus_tag LOCUS_20570 gene dapA 5618 6523 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_20570 6646 6960 gene locus_tag LOCUS_20580 6646 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7170 7883 gene locus_tag LOCUS_20590 gene purC 7170 7883 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_20590 8070 8603 gene locus_tag LOCUS_20600 8070 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 8889 9521 gene locus_tag LOCUS_20610 8889 9521 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_20610 9559 9870 gene locus_tag LOCUS_20620 9559 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 protein_id gnl|my_center|LOCUS_20620 10421 10041 gene locus_tag LOCUS_20630 10421 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 11193 10609 gene locus_tag LOCUS_20640 11193 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 12157 11954 gene locus_tag LOCUS_20650 12157 11954 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_20650 13105 13806 gene locus_tag LOCUS_20660 13105 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 13856 16054 gene locus_tag LOCUS_20670 13856 16054 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_20670 17474 16149 gene locus_tag LOCUS_20680 gene dadA 17474 16149 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930578.1 protein_id gnl|my_center|LOCUS_20680 18321 17566 gene locus_tag LOCUS_20690 18321 17566 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_20690 18618 18989 gene locus_tag LOCUS_20700 gene phnA 18618 18989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_20700 19096 20397 gene locus_tag LOCUS_20710 gene hemL 19096 20397 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF5 protein_id gnl|my_center|LOCUS_20710 20873 20457 gene locus_tag LOCUS_20720 20873 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 21262 22824 gene locus_tag LOCUS_20730 gene ppx 21262 22824 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_20730 22990 23793 gene locus_tag LOCUS_20740 gene accA 22990 23793 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_20740 23928 25484 gene locus_tag LOCUS_20750 23928 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 25808 26641 gene locus_tag LOCUS_20760 gene proC 25808 26641 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_20760 26784 27353 gene locus_tag LOCUS_20770 26784 27353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_20770 28279 27485 gene locus_tag LOCUS_20780 gene thiED 28279 27485 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence39 1180 479 gene locus_tag LOCUS_20790 1180 479 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 protein_id gnl|my_center|LOCUS_20790 1549 2208 gene locus_tag LOCUS_20800 gene upp 1549 2208 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K048 protein_id gnl|my_center|LOCUS_20800 2282 3034 gene locus_tag LOCUS_20810 2282 3034 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 protein_id gnl|my_center|LOCUS_20810 3707 3054 gene locus_tag LOCUS_20820 3707 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3997 4911 gene locus_tag LOCUS_20830 3997 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5147 4908 gene locus_tag LOCUS_20840 5147 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_20840 5749 5171 gene locus_tag LOCUS_20850 5749 5171 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_20850 7002 5788 gene locus_tag LOCUS_20860 gene tyrS 7002 5788 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI8 protein_id gnl|my_center|LOCUS_20860 7146 8537 gene locus_tag LOCUS_20870 gene anmK 7146 8537 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_20870 8634 10025 gene locus_tag LOCUS_20880 8634 10025 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH6 protein_id gnl|my_center|LOCUS_20880 10190 10975 gene locus_tag LOCUS_20890 10190 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 13007 11190 gene locus_tag LOCUS_20900 13007 11190 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951270.1 protein_id gnl|my_center|LOCUS_20900 14845 13280 gene locus_tag LOCUS_20910 14845 13280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_20910 15602 15138 gene locus_tag LOCUS_20920 15602 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 17313 15739 gene locus_tag LOCUS_20930 gene lnt 17313 15739 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF2 protein_id gnl|my_center|LOCUS_20930 18453 17590 gene locus_tag LOCUS_20940 gene corC 18453 17590 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_20940 19206 20057 gene locus_tag LOCUS_20950 19206 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 20698 20105 gene locus_tag LOCUS_20960 20698 20105 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_20960 20859 21596 gene locus_tag LOCUS_20970 20859 21596 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_20970 21768 24878 gene locus_tag LOCUS_20980 21768 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 25004 25960 gene locus_tag LOCUS_20990 25004 25960 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I94 protein_id gnl|my_center|LOCUS_20990 26090 27154 gene locus_tag LOCUS_21000 26090 27154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence40 575 1711 gene locus_tag LOCUS_21010 gene sotB 575 1711 CDS product putative sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK82 protein_id gnl|my_center|LOCUS_21010 2054 3931 gene locus_tag LOCUS_21020 gene estA 2054 3931 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_21020 4496 4083 gene locus_tag LOCUS_21030 gene yaeJ 4496 4083 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_21030 5427 4555 gene locus_tag LOCUS_21040 5427 4555 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267473.1 protein_id gnl|my_center|LOCUS_21040 6394 5633 gene locus_tag LOCUS_21050 gene dhrS4 6394 5633 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_21050 7223 6441 gene locus_tag LOCUS_21060 7223 6441 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_21060 8234 7227 gene locus_tag LOCUS_21070 8234 7227 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_21070 10062 8257 gene locus_tag LOCUS_21080 10062 8257 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_21080 10346 11356 gene locus_tag LOCUS_21090 10346 11356 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 protein_id gnl|my_center|LOCUS_21090 12664 11384 gene locus_tag LOCUS_21100 12664 11384 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695921.1 protein_id gnl|my_center|LOCUS_21100 12901 13380 gene locus_tag LOCUS_21110 12901 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 13901 13503 gene locus_tag LOCUS_21120 13901 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 14391 13909 gene locus_tag LOCUS_21130 14391 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 14840 16480 gene locus_tag LOCUS_21140 gene dnaQ 14840 16480 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHH4 protein_id gnl|my_center|LOCUS_21140 16629 18311 gene locus_tag LOCUS_21150 16629 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 18443 19387 gene locus_tag LOCUS_21160 18443 19387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20382 19453 gene locus_tag LOCUS_21170 gene yyaM 20382 19453 CDS product putative transporter YyaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37511 protein_id gnl|my_center|LOCUS_21170 20476 21366 gene locus_tag LOCUS_21180 20476 21366 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880855.1 protein_id gnl|my_center|LOCUS_21180 21671 22528 gene locus_tag LOCUS_21190 gene rnfB 21671 22528 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_21190 22620 23315 gene locus_tag LOCUS_21200 gene nth 22620 23315 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY5 protein_id gnl|my_center|LOCUS_21200 23750 24961 gene locus_tag LOCUS_21210 gene metK 23750 24961 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_21210 25045 25404 gene locus_tag LOCUS_21220 25045 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 25611 25952 gene locus_tag LOCUS_21230 25611 25952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence41 175 1509 gene locus_tag LOCUS_21240 gene rnd 175 1509 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_21240 1684 1502 gene locus_tag LOCUS_21250 1684 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2419 1715 gene locus_tag LOCUS_21260 2419 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038143.1 protein_id gnl|my_center|LOCUS_21260 2778 3152 gene locus_tag LOCUS_21270 2778 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 6163 3266 gene locus_tag LOCUS_21280 gene gcvP 6163 3266 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F761 protein_id gnl|my_center|LOCUS_21280 7019 6249 gene locus_tag LOCUS_21290 7019 6249 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_21290 7699 7319 gene locus_tag LOCUS_21300 gene gcvH 7699 7319 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L7 protein_id gnl|my_center|LOCUS_21300 8998 7817 gene locus_tag LOCUS_21310 gene gcvT 8998 7817 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L8 protein_id gnl|my_center|LOCUS_21310 9774 10094 gene locus_tag LOCUS_21320 9774 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 10371 11039 gene locus_tag LOCUS_21330 10371 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 11348 12196 gene locus_tag LOCUS_21340 11348 12196 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_21340 12254 13477 gene locus_tag LOCUS_21350 12254 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_21350 14443 13634 gene locus_tag LOCUS_21360 14443 13634 CDS product lipoprotein signal peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 protein_id gnl|my_center|LOCUS_21360 16341 14518 gene locus_tag LOCUS_21370 16341 14518 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_21370 17566 16463 gene locus_tag LOCUS_21380 gene rtcA 17566 16463 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46849 protein_id gnl|my_center|LOCUS_21380 18368 17910 gene locus_tag LOCUS_21390 18368 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_21390 19108 18380 gene locus_tag LOCUS_21400 19108 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330909.1 protein_id gnl|my_center|LOCUS_21400 20416 19184 gene locus_tag LOCUS_21410 gene rtcB 20416 19184 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46850 protein_id gnl|my_center|LOCUS_21410 20643 21590 gene locus_tag LOCUS_21420 20643 21590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 21636 23297 gene locus_tag LOCUS_21430 21636 23297 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232913.1 protein_id gnl|my_center|LOCUS_21430 23316 24305 gene locus_tag LOCUS_21440 23316 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 24335 25156 gene locus_tag LOCUS_21450 24335 25156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 25186 25878 gene locus_tag LOCUS_21460 25186 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence42 513 268 gene locus_tag LOCUS_21470 513 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 832 581 gene locus_tag LOCUS_21480 832 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1567 1209 gene locus_tag LOCUS_tm00010 1567 1209 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2324 1653 gene locus_tag LOCUS_21490 2324 1653 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_21490 2744 4114 gene locus_tag LOCUS_21500 2744 4114 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_21500 4341 5120 gene locus_tag LOCUS_21510 gene creB 4341 5120 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_21510 5137 6909 gene locus_tag LOCUS_21520 gene creC 5137 6909 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208147.1 protein_id gnl|my_center|LOCUS_21520 7040 7240 gene locus_tag LOCUS_21530 7040 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8478 7375 gene locus_tag LOCUS_21540 gene aroC 8478 7375 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ2 protein_id gnl|my_center|LOCUS_21540 9757 8582 gene locus_tag LOCUS_21550 gene prmB 9757 8582 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ1 protein_id gnl|my_center|LOCUS_21550 10099 11502 gene locus_tag LOCUS_21560 10099 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 11874 11662 gene locus_tag LOCUS_21570 11874 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12239 13876 gene locus_tag LOCUS_21580 12239 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14023 16695 gene locus_tag LOCUS_21590 gene alaS 14023 16695 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI74 protein_id gnl|my_center|LOCUS_21590 >Feature sequence43 373 555 gene locus_tag LOCUS_21600 373 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 624 1211 gene locus_tag LOCUS_21610 624 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1213 1530 gene locus_tag LOCUS_21620 1213 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1801 1604 gene locus_tag LOCUS_21630 1801 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1765 5979 gene locus_tag LOCUS_21640 gene hrpA 1765 5979 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206207.1 protein_id gnl|my_center|LOCUS_21640 6379 6050 gene locus_tag LOCUS_21650 6379 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 7051 6680 gene locus_tag LOCUS_21660 7051 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8142 7228 gene locus_tag LOCUS_21670 8142 7228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_21670 8430 9113 gene locus_tag LOCUS_21680 8430 9113 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206937.1 protein_id gnl|my_center|LOCUS_21680 9498 9223 gene locus_tag LOCUS_21690 9498 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 10265 9666 gene locus_tag LOCUS_21700 10265 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 10920 10216 gene locus_tag LOCUS_21710 gene pnuC 10920 10216 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_21710 11199 12344 gene locus_tag LOCUS_21720 gene fabH 11199 12344 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_21720 12581 13672 gene locus_tag LOCUS_21730 gene prfA 12581 13672 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT1 protein_id gnl|my_center|LOCUS_21730 13777 14085 gene locus_tag LOCUS_21740 13777 14085 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_21740 14075 14425 gene locus_tag LOCUS_21750 14075 14425 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_21750 14509 16035 gene locus_tag LOCUS_21760 gene lysS 14509 16035 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV7 protein_id gnl|my_center|LOCUS_21760 >Feature sequence44 1561 473 gene locus_tag LOCUS_21770 1561 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2140 3375 gene locus_tag LOCUS_21780 gene fabB 2140 3375 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_21780 3379 5067 gene locus_tag LOCUS_21790 gene pabB 3379 5067 CDS product p-aminobenzoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_21790 6315 5182 gene locus_tag LOCUS_21800 gene hisC 6315 5182 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH3 protein_id gnl|my_center|LOCUS_21800 7687 6392 gene locus_tag LOCUS_21810 gene hisD 7687 6392 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH2 protein_id gnl|my_center|LOCUS_21810 8667 7939 gene locus_tag LOCUS_21820 gene hisG 8667 7939 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_21820 9996 8728 gene locus_tag LOCUS_21830 gene murA 9996 8728 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH0 protein_id gnl|my_center|LOCUS_21830 10359 10108 gene locus_tag LOCUS_21840 10359 10108 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_21840 11396 10524 gene locus_tag LOCUS_21850 11396 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 12657 11857 gene locus_tag LOCUS_21860 12657 11857 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_21860 13297 12860 gene locus_tag LOCUS_21870 13297 12860 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX3 protein_id gnl|my_center|LOCUS_21870 13477 14433 gene locus_tag LOCUS_21880 gene yraL 13477 14433 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2P1 protein_id gnl|my_center|LOCUS_21880 14488 15507 gene locus_tag LOCUS_21890 14488 15507 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence45 1896 157 gene locus_tag LOCUS_21900 1896 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3195 2188 gene locus_tag LOCUS_21910 3195 2188 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_21910 3358 3930 gene locus_tag LOCUS_21920 gene efp 3358 3930 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 protein_id gnl|my_center|LOCUS_21920 5939 4149 gene locus_tag LOCUS_21930 5939 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6830 5949 gene locus_tag LOCUS_21940 6830 5949 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_21940 7886 6900 gene locus_tag LOCUS_21950 7886 6900 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_21950 10549 8399 gene locus_tag LOCUS_21960 gene xcpQ 10549 8399 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_21960 11632 10736 gene locus_tag LOCUS_21970 11632 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 12469 11633 gene locus_tag LOCUS_21980 12469 11633 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_21980 13035 12712 gene locus_tag LOCUS_21990 gene hvrA 13035 12712 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_21990 13927 13490 gene locus_tag LOCUS_22000 13927 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_22000 14503 13985 gene locus_tag LOCUS_22010 14503 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_22010 15253 14579 gene locus_tag LOCUS_22020 15253 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence46 376 1512 gene locus_tag LOCUS_22030 376 1512 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_22030 1718 2155 gene locus_tag LOCUS_22040 1718 2155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_22040 2251 2670 gene locus_tag LOCUS_22050 2251 2670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_22050 4431 2767 gene locus_tag LOCUS_22060 4431 2767 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184654.1 protein_id gnl|my_center|LOCUS_22060 4831 6966 gene locus_tag LOCUS_22070 gene fadH 4831 6966 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_22070 7849 7286 gene locus_tag LOCUS_22080 7849 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 8958 7954 gene locus_tag LOCUS_22090 gene lplA 8958 7954 CDS product lipoate-protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPK8 protein_id gnl|my_center|LOCUS_22090 9197 10003 gene locus_tag LOCUS_22100 9197 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 10639 10226 gene locus_tag LOCUS_22110 10639 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 11512 12441 gene locus_tag LOCUS_22120 11512 12441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 protein_id gnl|my_center|LOCUS_22120 12683 13789 gene locus_tag LOCUS_22130 12683 13789 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 protein_id gnl|my_center|LOCUS_22130 14853 13888 gene locus_tag LOCUS_22140 14853 13888 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_22140 14871 15527 gene locus_tag LOCUS_22150 14871 15527 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence47 522 223 gene locus_tag LOCUS_22160 522 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1757 744 gene locus_tag LOCUS_22170 1757 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2927 1923 gene locus_tag LOCUS_22180 gene murI 2927 1923 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF8 protein_id gnl|my_center|LOCUS_22180 3772 3089 gene locus_tag LOCUS_22190 3772 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_22190 4103 5863 gene locus_tag LOCUS_22200 gene etfD 4103 5863 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_22200 7332 7592 gene locus_tag LOCUS_22210 7332 7592 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_22210 7597 9465 gene locus_tag LOCUS_22220 7597 9465 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_22220 9605 10138 gene locus_tag LOCUS_22230 9605 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 protein_id gnl|my_center|LOCUS_22230 10787 10182 gene locus_tag LOCUS_22240 10787 10182 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_22240 11927 10875 gene locus_tag LOCUS_22250 11927 10875 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_22250 12202 13095 gene locus_tag LOCUS_22260 12202 13095 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_22260 14112 13333 gene locus_tag LOCUS_22270 14112 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 15074 14244 gene locus_tag LOCUS_22280 15074 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence48 734 216 gene locus_tag LOCUS_22290 734 216 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314369.1 protein_id gnl|my_center|LOCUS_22290 1651 1016 gene locus_tag LOCUS_22300 1651 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2018 4660 gene locus_tag LOCUS_22310 gene pepN 2018 4660 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207081.1 protein_id gnl|my_center|LOCUS_22310 5972 4890 gene locus_tag LOCUS_22320 gene aroF 5972 4890 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_22320 6425 7741 gene locus_tag LOCUS_22330 gene lpxB 6425 7741 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_22330 7722 8636 gene locus_tag LOCUS_22340 7722 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 8883 10064 gene locus_tag LOCUS_22350 8883 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10850 10185 gene locus_tag LOCUS_22360 10850 10185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_22360 10950 12191 gene locus_tag LOCUS_22370 gene nspC 10950 12191 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TG9 protein_id gnl|my_center|LOCUS_22370 12497 13771 gene locus_tag LOCUS_22380 12497 13771 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336769.1 protein_id gnl|my_center|LOCUS_22380 13967 14818 gene locus_tag LOCUS_22390 13967 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence49 1366 284 gene locus_tag LOCUS_22400 gene pdxA 1366 284 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_22400 1665 3068 gene locus_tag LOCUS_22410 gene dnaB 1665 3068 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV3 protein_id gnl|my_center|LOCUS_22410 3233 4339 gene locus_tag LOCUS_22420 gene alr 3233 4339 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV4 protein_id gnl|my_center|LOCUS_22420 4556 5479 gene locus_tag LOCUS_22430 gene argF 4556 5479 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_22430 6258 5599 gene locus_tag LOCUS_22440 gene rpiA 6258 5599 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_22440 6547 8100 gene locus_tag LOCUS_22450 gene ilvA 6547 8100 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR8 protein_id gnl|my_center|LOCUS_22450 8272 8694 gene locus_tag LOCUS_22460 gene hslR 8272 8694 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_22460 8901 9398 gene locus_tag LOCUS_22470 gene ptpA 8901 9398 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_22470 9597 10745 gene locus_tag LOCUS_22480 gene murB 9597 10745 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGJ6 protein_id gnl|my_center|LOCUS_22480 10798 11508 gene locus_tag LOCUS_22490 10798 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 11638 11913 gene locus_tag LOCUS_22500 11638 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 12013 12891 gene locus_tag LOCUS_22510 12013 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 14159 13005 gene locus_tag LOCUS_22520 gene rhlB 14159 13005 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK3 protein_id gnl|my_center|LOCUS_22520 >Feature sequence50 1591 155 gene locus_tag LOCUS_22530 gene radA 1591 155 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_22530 1677 1844 gene locus_tag LOCUS_22540 1677 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2638 1859 gene locus_tag LOCUS_22550 2638 1859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_22550 3304 2705 gene locus_tag LOCUS_22560 gene lptA 3304 2705 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX6 protein_id gnl|my_center|LOCUS_22560 3925 3341 gene locus_tag LOCUS_22570 3925 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4488 3922 gene locus_tag LOCUS_22580 gene kdsC 4488 3922 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_22580 5557 4565 gene locus_tag LOCUS_22590 gene kdsD 5557 4565 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_22590 6308 5778 gene locus_tag LOCUS_22600 gene hfq 6308 5778 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH82 protein_id gnl|my_center|LOCUS_22600 7861 6713 gene locus_tag LOCUS_22610 gene miaA 7861 6713 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_22610 9650 7914 gene locus_tag LOCUS_22620 9650 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 10222 9692 gene locus_tag LOCUS_22630 10222 9692 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_22630 10842 10222 gene locus_tag LOCUS_22640 10842 10222 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_22640 11184 11330 gene locus_tag LOCUS_22650 11184 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 11735 11403 gene locus_tag LOCUS_22660 11735 11403 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_22660 12454 11933 gene locus_tag LOCUS_22670 12454 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 12807 13721 gene locus_tag LOCUS_22680 gene htpX 12807 13721 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence51 474 1370 gene locus_tag LOCUS_22690 474 1370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830581.1 protein_id gnl|my_center|LOCUS_22690 2579 1473 gene locus_tag LOCUS_22700 2579 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3160 2582 gene locus_tag LOCUS_22710 3160 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 6460 3527 gene locus_tag LOCUS_22720 gene valS 6460 3527 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMI4 protein_id gnl|my_center|LOCUS_22720 6751 7071 gene locus_tag LOCUS_22730 6751 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7098 7901 gene locus_tag LOCUS_22740 7098 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 8991 8068 gene locus_tag LOCUS_22750 8991 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_22750 9837 9304 gene locus_tag LOCUS_22760 9837 9304 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_22760 10353 9916 gene locus_tag LOCUS_22770 10353 9916 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_22770 11020 10463 gene locus_tag LOCUS_22780 11020 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_22780 11505 11269 gene locus_tag LOCUS_22790 11505 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 13025 11691 gene locus_tag LOCUS_22800 13025 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence52 3274 173 gene locus_tag LOCUS_22810 3274 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 5045 3291 gene locus_tag LOCUS_22820 5045 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 5812 5222 gene locus_tag LOCUS_22830 5812 5222 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007890845.1 protein_id gnl|my_center|LOCUS_22830 6383 6108 gene locus_tag LOCUS_22840 6383 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308614.1 protein_id gnl|my_center|LOCUS_22840 6486 7379 gene locus_tag LOCUS_22850 6486 7379 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_22850 7585 7349 gene locus_tag LOCUS_22860 7585 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 8870 7548 gene locus_tag LOCUS_22870 8870 7548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_22870 9178 8900 gene locus_tag LOCUS_22880 9178 8900 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967860.1 protein_id gnl|my_center|LOCUS_22880 9440 10180 gene locus_tag LOCUS_22890 9440 10180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_22890 10197 10811 gene locus_tag LOCUS_22900 10197 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_22900 11319 10930 gene locus_tag LOCUS_22910 11319 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11576 12214 gene locus_tag LOCUS_22920 11576 12214 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973373.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence53 346 645 gene locus_tag LOCUS_22930 346 645 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004968539.1 protein_id gnl|my_center|LOCUS_22930 2449 896 gene locus_tag LOCUS_22940 2449 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3173 2439 gene locus_tag LOCUS_22950 gene cusR 3173 2439 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 protein_id gnl|my_center|LOCUS_22950 3410 3736 gene locus_tag LOCUS_22960 3410 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3887 4165 gene locus_tag LOCUS_22970 3887 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 4291 4857 gene locus_tag LOCUS_22980 4291 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4997 5626 gene locus_tag LOCUS_22990 4997 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5760 7391 gene locus_tag LOCUS_23000 gene copA 5760 7391 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_23000 7417 8508 gene locus_tag LOCUS_23010 7417 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 8604 9080 gene locus_tag LOCUS_23020 8604 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_23020 9286 10569 gene locus_tag LOCUS_23030 9286 10569 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_23030 10700 11353 gene locus_tag LOCUS_23040 10700 11353 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence54 963 241 gene locus_tag LOCUS_23050 963 241 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_23050 2489 960 gene locus_tag LOCUS_23060 gene kdtA 2489 960 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105256.1 protein_id gnl|my_center|LOCUS_23060 4180 2681 gene locus_tag LOCUS_23070 4180 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5930 4290 gene locus_tag LOCUS_23080 gene clsA 5930 4290 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU8 protein_id gnl|my_center|LOCUS_23080 6351 6426 gene locus_tag LOCUS_t00270 6351 6426 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6479 6555 gene locus_tag LOCUS_t00280 6479 6555 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8159 6882 gene locus_tag LOCUS_23090 8159 6882 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704236.1 protein_id gnl|my_center|LOCUS_23090 10489 8156 gene locus_tag LOCUS_23100 10489 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 11011 11685 gene locus_tag LOCUS_23110 11011 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence55 2146 662 gene locus_tag LOCUS_23120 gene mmsA 2146 662 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 protein_id gnl|my_center|LOCUS_23120 4485 2464 gene locus_tag LOCUS_23130 gene prpE 4485 2464 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_23130 6470 4800 gene locus_tag LOCUS_23140 6470 4800 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_23140 7902 6778 gene locus_tag LOCUS_23150 7902 6778 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_23150 8398 9144 gene locus_tag LOCUS_23160 8398 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 9233 9979 gene locus_tag LOCUS_23170 9233 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 11560 10187 gene locus_tag LOCUS_23180 gene cry 11560 10187 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JP5 protein_id gnl|my_center|LOCUS_23180 >Feature sequence56 1321 620 gene locus_tag LOCUS_23190 gene modC 1321 620 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_23190 2207 1368 gene locus_tag LOCUS_23200 2207 1368 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_23200 2691 2200 gene locus_tag LOCUS_23210 gene moaE 2691 2200 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_23210 3026 2745 gene locus_tag LOCUS_23220 gene moaD 3026 2745 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_23220 3610 3104 gene locus_tag LOCUS_23230 gene moaC 3610 3104 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y0 protein_id gnl|my_center|LOCUS_23230 4354 3653 gene locus_tag LOCUS_23240 4354 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 5231 4701 gene locus_tag LOCUS_23250 gene moaB1 5231 4701 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX98 protein_id gnl|my_center|LOCUS_23250 6443 5343 gene locus_tag LOCUS_23260 gene moaA 6443 5343 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 protein_id gnl|my_center|LOCUS_23260 7861 6566 gene locus_tag LOCUS_23270 gene moeA 7861 6566 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_23270 9443 8217 gene locus_tag LOCUS_23280 9443 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_23280 10372 9584 gene locus_tag LOCUS_23290 gene nlpD 10372 9584 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_23290 11401 10556 gene locus_tag LOCUS_23300 gene surE 11401 10556 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_23300 >Feature sequence57 1748 168 gene locus_tag LOCUS_23310 gene purH 1748 168 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_23310 2260 1898 gene locus_tag LOCUS_23320 2260 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3584 2409 gene locus_tag LOCUS_23330 3584 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 4721 3795 gene locus_tag LOCUS_23340 gene prmA 4721 3795 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_23340 5446 4790 gene locus_tag LOCUS_23350 5446 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 8021 5649 gene locus_tag LOCUS_23360 gene mrcB 8021 5649 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ35 protein_id gnl|my_center|LOCUS_23360 8591 11389 gene locus_tag LOCUS_23370 8591 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence58 591 1763 gene locus_tag LOCUS_23380 gene pheA 591 1763 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_23380 1859 3001 gene locus_tag LOCUS_23390 gene hisC2 1859 3001 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_23390 3182 5515 gene locus_tag LOCUS_23400 gene aroA 3182 5515 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_23400 5742 6692 gene locus_tag LOCUS_23410 5742 6692 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I633 protein_id gnl|my_center|LOCUS_23410 6750 7187 gene locus_tag LOCUS_23420 gene folB 6750 7187 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW6 protein_id gnl|my_center|LOCUS_23420 7162 7710 gene locus_tag LOCUS_23430 7162 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 8792 7881 gene locus_tag LOCUS_23440 gene cysE 8792 7881 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_23440 9859 8981 gene locus_tag LOCUS_23450 gene trmJ 9859 8981 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL5 protein_id gnl|my_center|LOCUS_23450 10239 9859 gene locus_tag LOCUS_23460 10239 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence59 828 214 gene locus_tag LOCUS_23470 828 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2880 1738 gene locus_tag LOCUS_23480 gene rodA 2880 1738 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_23480 3163 4131 gene locus_tag LOCUS_23490 3163 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4485 4979 gene locus_tag LOCUS_23500 4485 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 6686 5112 gene locus_tag LOCUS_23510 6686 5112 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_23510 8254 6755 gene locus_tag LOCUS_23520 8254 6755 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 protein_id gnl|my_center|LOCUS_23520 8471 8319 gene locus_tag LOCUS_23530 8471 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 8765 10135 gene locus_tag LOCUS_23540 gene ftsY 8765 10135 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence60 933 244 gene locus_tag LOCUS_23550 gene rplY 933 244 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C7 protein_id gnl|my_center|LOCUS_23550 2288 1341 gene locus_tag LOCUS_23560 gene prs 2288 1341 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_23560 2474 2399 gene locus_tag LOCUS_t00290 2474 2399 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2790 2715 gene locus_tag LOCUS_t00300 2790 2715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3542 2958 gene locus_tag LOCUS_23570 3542 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4506 3544 gene locus_tag LOCUS_23580 gene ispE 4506 3544 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_23580 5226 4597 gene locus_tag LOCUS_23590 gene lolB 5226 4597 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_23590 7057 5405 gene locus_tag LOCUS_23600 7057 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_23600 7903 9285 gene locus_tag LOCUS_23610 gene hemA 7903 9285 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T4 protein_id gnl|my_center|LOCUS_23610 >Feature sequence61 <1 1231 gene locus_tag LOCUS_23620 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705848.1:DNA polymerase V subunit UmuC 1248 1673 gene locus_tag LOCUS_23630 1248 1673 CDS product DNA polymerase V subunit UmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897380.1 protein_id gnl|my_center|LOCUS_23630 2047 2562 gene locus_tag LOCUS_23640 2047 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2559 5039 gene locus_tag LOCUS_23650 2559 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5026 8364 gene locus_tag LOCUS_23660 5026 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 8438 8659 gene locus_tag LOCUS_23670 8438 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 8656 9216 gene locus_tag LOCUS_23680 8656 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence62 657 118 gene locus_tag LOCUS_23690 657 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2257 773 gene locus_tag LOCUS_23700 2257 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2824 2384 gene locus_tag LOCUS_23710 2824 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3218 2931 gene locus_tag LOCUS_23720 3218 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4654 3362 gene locus_tag LOCUS_23730 4654 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 5672 4830 gene locus_tag LOCUS_23740 gene tatC 5672 4830 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_23740 6064 5669 gene locus_tag LOCUS_23750 6064 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 6395 6111 gene locus_tag LOCUS_23760 6395 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9085 6476 gene locus_tag LOCUS_23770 9085 6476 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence63 363 1052 gene locus_tag LOCUS_23780 363 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2061 1174 gene locus_tag LOCUS_23790 2061 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2656 3414 gene locus_tag LOCUS_23800 2656 3414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085878.1 protein_id gnl|my_center|LOCUS_23800 4517 3576 gene locus_tag LOCUS_23810 4517 3576 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H47 protein_id gnl|my_center|LOCUS_23810 5848 4589 gene locus_tag LOCUS_23820 5848 4589 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 protein_id gnl|my_center|LOCUS_23820 6702 5920 gene locus_tag LOCUS_23830 6702 5920 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_23830 <7814 6735 gene locus_tag LOCUS_23840 <7814 6735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483354.1:acyl-CoA dehydrogenase >Feature sequence64 <1 1557 gene locus_tag LOCUS_23850 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMU2:peptide chain release factor 3 2028 2774 gene locus_tag LOCUS_23860 2028 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2891 4099 gene locus_tag LOCUS_23870 2891 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4337 5833 gene locus_tag LOCUS_23880 gene trpE 4337 5833 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_23880 6028 6103 gene locus_tag LOCUS_t00310 6028 6103 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6171 6254 gene locus_tag LOCUS_t00320 6171 6254 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6340 6413 gene locus_tag LOCUS_t00330 6340 6413 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6517 6591 gene locus_tag LOCUS_t00340 6517 6591 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence65 1661 120 gene locus_tag LOCUS_23890 1661 120 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 protein_id gnl|my_center|LOCUS_23890 1958 2980 gene locus_tag LOCUS_23900 1958 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2989 4680 gene locus_tag LOCUS_23910 2989 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 4665 5177 gene locus_tag LOCUS_23920 4665 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5181 6800 gene locus_tag LOCUS_23930 5181 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 7210 6893 gene locus_tag LOCUS_23940 7210 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence66 699 79 gene locus_tag LOCUS_23950 699 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1154 807 gene locus_tag LOCUS_23960 1154 807 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_23960 1456 1157 gene locus_tag LOCUS_23970 1456 1157 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_23970 2757 1516 gene locus_tag LOCUS_23980 2757 1516 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_23980 2997 2921 gene locus_tag LOCUS_t00350 2997 2921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4638 3112 gene locus_tag LOCUS_23990 gene gatB 4638 3112 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN40 protein_id gnl|my_center|LOCUS_23990 6134 4638 gene locus_tag LOCUS_24000 gene gatA 6134 4638 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN39 protein_id gnl|my_center|LOCUS_24000 6530 6216 gene locus_tag LOCUS_24010 gene gatC 6530 6216 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_24010 >Feature sequence67 87 2012 gene locus_tag LOCUS_24020 87 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2006 2458 gene locus_tag LOCUS_24030 2006 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3556 2654 gene locus_tag LOCUS_24040 3556 2654 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_310986.1 protein_id gnl|my_center|LOCUS_24040 3873 3556 gene locus_tag LOCUS_24050 3873 3556 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165061.1 protein_id gnl|my_center|LOCUS_24050 4061 4411 gene locus_tag LOCUS_24060 4061 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4687 4442 gene locus_tag LOCUS_24070 4687 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5737 4886 gene locus_tag LOCUS_24080 5737 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5803 6099 gene locus_tag LOCUS_24090 5803 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 6150 6968 gene locus_tag LOCUS_24100 6150 6968 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336721.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence68 1284 670 gene locus_tag LOCUS_24110 gene ssb 1284 670 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR6 protein_id gnl|my_center|LOCUS_24110 2735 1371 gene locus_tag LOCUS_24120 gene yajR 2735 1371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_24120 3407 6319 gene locus_tag LOCUS_24130 gene uvrA 3407 6319 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGS6 protein_id gnl|my_center|LOCUS_24130 6496 6708 gene locus_tag LOCUS_24140 6496 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence69 1423 146 gene locus_tag LOCUS_24150 1423 146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 protein_id gnl|my_center|LOCUS_24150 3280 1673 gene locus_tag LOCUS_24160 3280 1673 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808335.1 protein_id gnl|my_center|LOCUS_24160 3754 5046 gene locus_tag LOCUS_24170 gene metZ 3754 5046 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN23 protein_id gnl|my_center|LOCUS_24170 5127 5456 gene locus_tag LOCUS_24180 5127 5456 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_24180 5575 6168 gene locus_tag LOCUS_24190 gene recR 5575 6168 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_24190 >Feature sequence70 282 136 gene locus_tag LOCUS_24200 282 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 476 1402 gene locus_tag LOCUS_24210 476 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_24210 1568 1969 gene locus_tag LOCUS_24220 1568 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2469 4745 gene locus_tag LOCUS_24230 gene nrdA 2469 4745 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKQ5 protein_id gnl|my_center|LOCUS_24230 4878 5054 gene locus_tag LOCUS_24240 4878 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 5268 5495 gene locus_tag LOCUS_24250 5268 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5613 6215 gene locus_tag LOCUS_24260 5613 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence71 265 5562 gene locus_tag LOCUS_24270 265 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5881 5591 gene locus_tag LOCUS_24280 5881 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence72 327 1649 gene locus_tag LOCUS_24290 327 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1932 1672 gene locus_tag LOCUS_24300 1932 1672 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 protein_id gnl|my_center|LOCUS_24300 2121 2774 gene locus_tag LOCUS_24310 2121 2774 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817214.1 protein_id gnl|my_center|LOCUS_24310 2885 4774 gene locus_tag LOCUS_24320 gene parE 2885 4774 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_24320 4942 5637 gene locus_tag LOCUS_24330 gene plsC2 4942 5637 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence73 547 1083 gene locus_tag LOCUS_24340 gene aroQ 547 1083 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGI2 protein_id gnl|my_center|LOCUS_24340 1225 2526 gene locus_tag LOCUS_24350 gene adcK4 1225 2526 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_24350 3393 2563 gene locus_tag LOCUS_24360 3393 2563 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_24360 3712 4461 gene locus_tag LOCUS_24370 3712 4461 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLP9 protein_id gnl|my_center|LOCUS_24370 5148 4576 gene locus_tag LOCUS_24380 5148 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence74 152 358 gene locus_tag LOCUS_24390 152 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 472 2643 gene locus_tag LOCUS_24400 472 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3730 2849 gene locus_tag LOCUS_24410 3730 2849 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_24410 3923 4696 gene locus_tag LOCUS_24420 3923 4696 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence75 394 1407 gene locus_tag LOCUS_24430 gene trxB1 394 1407 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_24430 1417 2229 gene locus_tag LOCUS_24440 gene aat 1417 2229 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_24440 2263 2697 gene locus_tag LOCUS_24450 2263 2697 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028879.1 protein_id gnl|my_center|LOCUS_24450 3268 2777 gene locus_tag LOCUS_24460 gene rimI 3268 2777 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPW4 protein_id gnl|my_center|LOCUS_24460 4086 3559 gene locus_tag LOCUS_24470 4086 3559 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066604.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence76 1042 218 gene locus_tag LOCUS_24480 1042 218 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_24480 1631 1179 gene locus_tag LOCUS_24490 1631 1179 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_24490 2018 3013 gene locus_tag LOCUS_24500 2018 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence77 453 542 gene locus_tag LOCUS_t00360 453 542 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 726 802 gene locus_tag LOCUS_t00370 726 802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1035 1697 gene locus_tag LOCUS_24510 1035 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2717 1743 gene locus_tag LOCUS_24520 2717 1743 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_24520 3286 2906 gene locus_tag LOCUS_24530 gene panD 3286 2906 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_24530 3968 3387 gene locus_tag LOCUS_24540 gene pth 3968 3387 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF04 protein_id gnl|my_center|LOCUS_24540 >Feature sequence78 3567 328 gene locus_tag LOCUS_24550 3567 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence79 2472 346 gene locus_tag LOCUS_24560 gene fusA 2472 346 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ7 protein_id gnl|my_center|LOCUS_24560 3297 2824 gene locus_tag LOCUS_24570 gene rpsG 3297 2824 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ6 protein_id gnl|my_center|LOCUS_24570 3880 3506 gene locus_tag LOCUS_24580 gene rpsL 3880 3506 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ5 protein_id gnl|my_center|LOCUS_24580 >Feature sequence80 537 782 gene locus_tag LOCUS_24590 gene csrA 537 782 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI72 protein_id gnl|my_center|LOCUS_24590 869 1243 gene locus_tag LOCUS_24600 869 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_24600 1636 1325 gene locus_tag LOCUS_24610 1636 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_24610 2724 1720 gene locus_tag LOCUS_24620 gene nadK 2724 1720 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ34 protein_id gnl|my_center|LOCUS_24620 2997 3719 gene locus_tag LOCUS_24630 2997 3719 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence81 263 817 gene locus_tag LOCUS_24640 263 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 810 2156 gene locus_tag LOCUS_24650 810 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2179 2421 gene locus_tag LOCUS_24660 2179 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence82 1253 417 gene locus_tag LOCUS_24670 gene apaH 1253 417 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_24670 2159 1305 gene locus_tag LOCUS_24680 gene rsmA 2159 1305 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_24680 >Feature sequence83 224 2401 gene locus_tag LOCUS_24690 224 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence84 1314 2174 gene locus_tag LOCUS_24700 1314 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence85 498 67 gene locus_tag LOCUS_24710 gene rplK 498 67 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP7 protein_id gnl|my_center|LOCUS_24710 1124 594 gene locus_tag LOCUS_24720 gene nusG 1124 594 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP6 protein_id gnl|my_center|LOCUS_24720 1681 1196 gene locus_tag LOCUS_24730 gene secE 1681 1196 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP5 protein_id gnl|my_center|LOCUS_24730 1808 1733 gene locus_tag LOCUS_t00380 1808 1733 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence86 388 612 gene locus_tag LOCUS_24740 388 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 769 1044 gene locus_tag LOCUS_24750 769 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence87 1045 302 gene locus_tag LOCUS_24760 1045 302 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_24760 1654 1394 gene locus_tag LOCUS_24770 1654 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence88 186 1433 gene locus_tag LOCUS_24780 186 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence89 860 213 gene locus_tag LOCUS_24790 860 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence90 360 468 gene locus_tag LOCUS_r00010 360 468 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 803 1150 gene locus_tag LOCUS_24800 803 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence91 943 41 gene locus_tag LOCUS_24810 943 41 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_311518.1 protein_id gnl|my_center|LOCUS_24810 1260 943 gene locus_tag LOCUS_24820 1260 943 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165061.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence92 771 43 gene locus_tag LOCUS_24830 771 43 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939294.1 protein_id gnl|my_center|LOCUS_24830 1118 858 gene locus_tag LOCUS_24840 1118 858 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence93 350 916 gene locus_tag LOCUS_24850 350 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850