>Feature sequence001 200 886 gene locus_tag LOCUS_00010 gene trmD 200 886 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_00010 962 1642 gene locus_tag LOCUS_00020 962 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1772 2200 gene locus_tag LOCUS_00030 1772 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3557 2256 gene locus_tag LOCUS_00040 3557 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4133 3627 gene locus_tag LOCUS_00050 4133 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5013 4120 gene locus_tag LOCUS_00060 5013 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6114 5101 gene locus_tag LOCUS_00070 6114 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6234 7775 gene locus_tag LOCUS_00080 6234 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_00080 7913 8638 gene locus_tag LOCUS_00090 7913 8638 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_00090 8834 10174 gene locus_tag LOCUS_00100 8834 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_00100 10805 10224 gene locus_tag LOCUS_00110 10805 10224 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66967 protein_id gnl|my_center|LOCUS_00110 12073 10991 gene locus_tag LOCUS_00120 12073 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12771 13844 gene locus_tag LOCUS_00130 12771 13844 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_00130 13995 14513 gene locus_tag LOCUS_00140 13995 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14663 15769 gene locus_tag LOCUS_00150 gene pdhA 14663 15769 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_00150 15825 16670 gene locus_tag LOCUS_00160 15825 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16676 16864 gene locus_tag LOCUS_00170 16676 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16903 17739 gene locus_tag LOCUS_00180 16903 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17849 18733 gene locus_tag LOCUS_00190 17849 18733 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_00190 18797 20077 gene locus_tag LOCUS_00200 gene rnd 18797 20077 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020653.1 protein_id gnl|my_center|LOCUS_00200 20555 20154 gene locus_tag LOCUS_00210 20555 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21469 20657 gene locus_tag LOCUS_00220 21469 20657 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_00220 22884 21610 gene locus_tag LOCUS_00230 gene yqhO 22884 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54513 protein_id gnl|my_center|LOCUS_00230 23193 24773 gene locus_tag LOCUS_00240 23193 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24918 26027 gene locus_tag LOCUS_00250 gene lpxK 24918 26027 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_00250 27400 26036 gene locus_tag LOCUS_00260 27400 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28341 27535 gene locus_tag LOCUS_00270 28341 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29760 28804 gene locus_tag LOCUS_00280 29760 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30830 29955 gene locus_tag LOCUS_00290 gene rimK 30830 29955 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_00290 31646 31029 gene locus_tag LOCUS_00300 31646 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32653 31841 gene locus_tag LOCUS_00310 32653 31841 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_00310 32832 34436 gene locus_tag LOCUS_00320 32832 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34513 35460 gene locus_tag LOCUS_00330 34513 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36234 36013 gene locus_tag LOCUS_00340 36234 36013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36604 36407 gene locus_tag LOCUS_00350 36604 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00350 37436 38002 gene locus_tag LOCUS_00360 37436 38002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38742 38122 gene locus_tag LOCUS_00370 38742 38122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39561 38875 gene locus_tag LOCUS_00380 39561 38875 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_00380 40437 39805 gene locus_tag LOCUS_00390 gene ribE 40437 39805 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_00390 40810 42468 gene locus_tag LOCUS_00400 40810 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42957 42571 gene locus_tag LOCUS_00410 42957 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_00410 43483 42971 gene locus_tag LOCUS_00420 43483 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_00420 44695 43802 gene locus_tag LOCUS_00430 44695 43802 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705986.1 protein_id gnl|my_center|LOCUS_00430 45846 45037 gene locus_tag LOCUS_00440 45846 45037 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_00440 46816 46007 gene locus_tag LOCUS_00450 46816 46007 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_00450 46939 47652 gene locus_tag LOCUS_00460 46939 47652 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_00460 47929 48390 gene locus_tag LOCUS_00470 47929 48390 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125095.1 protein_id gnl|my_center|LOCUS_00470 48464 49048 gene locus_tag LOCUS_00480 48464 49048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49490 49732 gene locus_tag LOCUS_00490 49490 49732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49895 50185 gene locus_tag LOCUS_00500 49895 50185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50213 50593 gene locus_tag LOCUS_00510 50213 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 50850 50924 gene locus_tag LOCUS_t00010 50850 50924 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 51044 51116 gene locus_tag LOCUS_t00020 51044 51116 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 51130 51202 gene locus_tag LOCUS_t00030 51130 51202 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 51208 51279 gene locus_tag LOCUS_t00040 51208 51279 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 51288 51360 gene locus_tag LOCUS_t00050 51288 51360 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 51366 51438 gene locus_tag LOCUS_t00060 51366 51438 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51523 51597 gene locus_tag LOCUS_t00070 51523 51597 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51873 51628 gene locus_tag LOCUS_00520 51873 51628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52371 51916 gene locus_tag LOCUS_00530 52371 51916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53073 52375 gene locus_tag LOCUS_00540 53073 52375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53230 56925 gene locus_tag LOCUS_00550 53230 56925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58661 57387 gene locus_tag LOCUS_00560 58661 57387 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_00560 59117 58950 gene locus_tag LOCUS_00570 59117 58950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59808 60599 gene locus_tag LOCUS_00580 59808 60599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_00580 63348 60673 gene locus_tag LOCUS_00590 63348 60673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 63839 63423 gene locus_tag LOCUS_00600 63839 63423 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_00600 64024 64977 gene locus_tag LOCUS_00610 gene dcyD 64024 64977 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_00610 65229 65801 gene locus_tag LOCUS_00620 65229 65801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66497 65883 gene locus_tag LOCUS_00630 66497 65883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67682 66960 gene locus_tag LOCUS_00640 gene yceI 67682 66960 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_00640 67927 69297 gene locus_tag LOCUS_00650 gene murF 67927 69297 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z76 protein_id gnl|my_center|LOCUS_00650 69357 69623 gene locus_tag LOCUS_00660 69357 69623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69620 70474 gene locus_tag LOCUS_00670 69620 70474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70475 71359 gene locus_tag LOCUS_00680 70475 71359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71666 71376 gene locus_tag LOCUS_00690 71666 71376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72944 71910 gene locus_tag LOCUS_00700 gene lpxD 72944 71910 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_00700 73835 73023 gene locus_tag LOCUS_00710 73835 73023 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_00710 74246 75223 gene locus_tag LOCUS_00720 74246 75223 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_00720 75320 77251 gene locus_tag LOCUS_00730 75320 77251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78216 77335 gene locus_tag LOCUS_00740 gene rfbA 78216 77335 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_00740 79699 78410 gene locus_tag LOCUS_00750 79699 78410 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2I6 protein_id gnl|my_center|LOCUS_00750 80623 79865 gene locus_tag LOCUS_00760 gene dapB 80623 79865 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_00760 81436 80804 gene locus_tag LOCUS_00770 81436 80804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81838 83298 gene locus_tag LOCUS_00780 81838 83298 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_00780 83488 84243 gene locus_tag LOCUS_00790 83488 84243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85254 84457 gene locus_tag LOCUS_00800 85254 84457 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_00800 85905 85468 gene locus_tag LOCUS_00810 85905 85468 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_00810 86546 87901 gene locus_tag LOCUS_00820 86546 87901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403553.1 protein_id gnl|my_center|LOCUS_00820 88028 88333 gene locus_tag LOCUS_00830 88028 88333 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_00830 88944 88342 gene locus_tag LOCUS_00840 88944 88342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90123 89062 gene locus_tag LOCUS_00850 90123 89062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 90532 93240 gene locus_tag LOCUS_00860 90532 93240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93292 93858 gene locus_tag LOCUS_00870 93292 93858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895507.1 protein_id gnl|my_center|LOCUS_00870 94543 96372 gene locus_tag LOCUS_00880 94543 96372 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_00880 96867 97886 gene locus_tag LOCUS_00890 gene mreB 96867 97886 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00890 98143 98985 gene locus_tag LOCUS_00900 98143 98985 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_00900 98990 99499 gene locus_tag LOCUS_00910 98990 99499 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_00910 100696 99731 gene locus_tag LOCUS_00920 gene hldD 100696 99731 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_00920 101257 101859 gene locus_tag LOCUS_00930 101257 101859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 102955 101957 gene locus_tag LOCUS_00940 102955 101957 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_00940 103208 104164 gene locus_tag LOCUS_00950 103208 104164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 104336 104166 gene locus_tag LOCUS_00960 104336 104166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105657 104419 gene locus_tag LOCUS_00970 105657 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 106530 105889 gene locus_tag LOCUS_00980 106530 105889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 107012 106551 gene locus_tag LOCUS_00990 107012 106551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00990 108485 107151 gene locus_tag LOCUS_01000 108485 107151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 109979 108843 gene locus_tag LOCUS_01010 109979 108843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 110248 111501 gene locus_tag LOCUS_01020 110248 111501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111529 112440 gene locus_tag LOCUS_01030 111529 112440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 112524 112697 gene locus_tag LOCUS_01040 112524 112697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 116513 112800 gene locus_tag LOCUS_01050 116513 112800 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956668.1 protein_id gnl|my_center|LOCUS_01050 117927 116776 gene locus_tag LOCUS_01060 117927 116776 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_01060 118289 117924 gene locus_tag LOCUS_01070 118289 117924 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_01070 119196 118300 gene locus_tag LOCUS_01080 119196 118300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW7 protein_id gnl|my_center|LOCUS_01080 119860 119201 gene locus_tag LOCUS_01090 119860 119201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_01090 120491 119853 gene locus_tag LOCUS_01100 120491 119853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 121212 120517 gene locus_tag LOCUS_01110 121212 120517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW5 protein_id gnl|my_center|LOCUS_01110 122145 121216 gene locus_tag LOCUS_01120 gene ykcC 122145 121216 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_01120 123305 122169 gene locus_tag LOCUS_01130 123305 122169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_01130 123945 123334 gene locus_tag LOCUS_01140 123945 123334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_01140 125801 124170 gene locus_tag LOCUS_01150 125801 124170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_01150 126829 125879 gene locus_tag LOCUS_01160 126829 125879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 127498 126923 gene locus_tag LOCUS_01170 gene ppiA 127498 126923 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH4 protein_id gnl|my_center|LOCUS_01170 127922 128779 gene locus_tag LOCUS_01180 127922 128779 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_01180 128809 129861 gene locus_tag LOCUS_01190 128809 129861 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184625.1 protein_id gnl|my_center|LOCUS_01190 129938 130936 gene locus_tag LOCUS_01200 129938 130936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 131732 130986 gene locus_tag LOCUS_01210 131732 130986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 133041 131785 gene locus_tag LOCUS_01220 gene fabF 133041 131785 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_01220 133680 133438 gene locus_tag LOCUS_01230 gene acpP 133680 133438 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_01230 134644 133874 gene locus_tag LOCUS_01240 134644 133874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262039.1 protein_id gnl|my_center|LOCUS_01240 135367 138747 gene locus_tag LOCUS_01250 135367 138747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138933 139364 gene locus_tag LOCUS_01260 138933 139364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 139377 139988 gene locus_tag LOCUS_01270 139377 139988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 140326 140766 gene locus_tag LOCUS_01280 gene ybeY 140326 140766 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01280 140843 142132 gene locus_tag LOCUS_01290 140843 142132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_01290 142933 142214 gene locus_tag LOCUS_01300 142933 142214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 143369 146404 gene locus_tag LOCUS_01310 143369 146404 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_01310 147876 146530 gene locus_tag LOCUS_01320 147876 146530 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_01320 149194 148076 gene locus_tag LOCUS_01330 149194 148076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_01330 149286 150275 gene locus_tag LOCUS_01340 149286 150275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 150994 150386 gene locus_tag LOCUS_01350 150994 150386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 152024 151077 gene locus_tag LOCUS_01360 gene ctaB 152024 151077 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_01360 153069 152083 gene locus_tag LOCUS_01370 153069 152083 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040720.1 protein_id gnl|my_center|LOCUS_01370 155209 153260 gene locus_tag LOCUS_01380 155209 153260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 155617 155216 gene locus_tag LOCUS_01390 155617 155216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 156946 156056 gene locus_tag LOCUS_01400 156946 156056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 157827 157021 gene locus_tag LOCUS_01410 gene altA 157827 157021 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071890.1 protein_id gnl|my_center|LOCUS_01410 158506 158018 gene locus_tag LOCUS_01420 158506 158018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 159247 158672 gene locus_tag LOCUS_01430 159247 158672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 160143 159229 gene locus_tag LOCUS_01440 160143 159229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 163703 160164 gene locus_tag LOCUS_01450 163703 160164 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_01450 163968 166412 gene locus_tag LOCUS_01460 163968 166412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_01460 167327 166476 gene locus_tag LOCUS_01470 167327 166476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 168554 167484 gene locus_tag LOCUS_01480 168554 167484 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_01480 168894 170150 gene locus_tag LOCUS_01490 168894 170150 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_01490 170332 171690 gene locus_tag LOCUS_01500 170332 171690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 171712 173103 gene locus_tag LOCUS_01510 171712 173103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 173497 173312 gene locus_tag LOCUS_01520 173497 173312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 173640 175691 gene locus_tag LOCUS_01530 173640 175691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 176549 175809 gene locus_tag LOCUS_01540 176549 175809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 177410 176565 gene locus_tag LOCUS_01550 177410 176565 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_01550 177509 178339 gene locus_tag LOCUS_01560 177509 178339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_01560 178407 179099 gene locus_tag LOCUS_01570 gene nth 178407 179099 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_01570 179561 179103 gene locus_tag LOCUS_01580 gene vapC 179561 179103 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_01580 179890 179558 gene locus_tag LOCUS_01590 179890 179558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 179976 180836 gene locus_tag LOCUS_01600 gene menB 179976 180836 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_01600 180936 181712 gene locus_tag LOCUS_01610 180936 181712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 181798 182376 gene locus_tag LOCUS_01620 181798 182376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 182434 183093 gene locus_tag LOCUS_01630 182434 183093 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_01630 183196 183483 gene locus_tag LOCUS_01640 183196 183483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 183527 184027 gene locus_tag LOCUS_01650 183527 184027 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_01650 185860 184079 gene locus_tag LOCUS_01660 185860 184079 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_01660 186144 187202 gene locus_tag LOCUS_01670 gene rfaF 186144 187202 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_01670 187517 188578 gene locus_tag LOCUS_01680 187517 188578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_01680 189148 188753 gene locus_tag LOCUS_01690 gene vapC 189148 188753 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_01690 189396 189148 gene locus_tag LOCUS_01700 189396 189148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 189739 189479 gene locus_tag LOCUS_01710 189739 189479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence002 190 3342 gene locus_tag LOCUS_01720 190 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3516 4286 gene locus_tag LOCUS_01730 3516 4286 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_01730 4416 5219 gene locus_tag LOCUS_01740 4416 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5389 5976 gene locus_tag LOCUS_01750 5389 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 6197 6580 gene locus_tag LOCUS_01760 6197 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6624 6839 gene locus_tag LOCUS_01770 6624 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7100 8023 gene locus_tag LOCUS_01780 7100 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8349 9557 gene locus_tag LOCUS_01790 8349 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_01790 9597 10298 gene locus_tag LOCUS_01800 9597 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11887 10397 gene locus_tag LOCUS_01810 gene crtI 11887 10397 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_01810 12093 12533 gene locus_tag LOCUS_01820 gene aroQ 12093 12533 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_01820 12546 12980 gene locus_tag LOCUS_01830 12546 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 13791 12985 gene locus_tag LOCUS_01840 13791 12985 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_01840 14352 13819 gene locus_tag LOCUS_01850 14352 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 14603 14349 gene locus_tag LOCUS_01860 14603 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 15478 14600 gene locus_tag LOCUS_01870 15478 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_01870 15717 17072 gene locus_tag LOCUS_01880 gene ndh 15717 17072 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_01880 19028 17217 gene locus_tag LOCUS_01890 19028 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 19487 20077 gene locus_tag LOCUS_01900 19487 20077 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_01900 20102 20743 gene locus_tag LOCUS_01910 20102 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20845 21216 gene locus_tag LOCUS_01920 20845 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 21825 21499 gene locus_tag LOCUS_01930 21825 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 22368 21871 gene locus_tag LOCUS_01940 22368 21871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_01940 23526 22477 gene locus_tag LOCUS_01950 gene cobT 23526 22477 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_01950 23797 23943 gene locus_tag LOCUS_01960 23797 23943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 25332 24109 gene locus_tag LOCUS_01970 25332 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 25802 25500 gene locus_tag LOCUS_01980 25802 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 27220 25892 gene locus_tag LOCUS_01990 27220 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 28277 27465 gene locus_tag LOCUS_02000 28277 27465 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_02000 30210 28288 gene locus_tag LOCUS_02010 30210 28288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 31627 30425 gene locus_tag LOCUS_02020 31627 30425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 32053 31751 gene locus_tag LOCUS_02030 32053 31751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 33411 32170 gene locus_tag LOCUS_02040 33411 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 33708 35804 gene locus_tag LOCUS_02050 33708 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 35862 37871 gene locus_tag LOCUS_02060 35862 37871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 37939 38682 gene locus_tag LOCUS_02070 37939 38682 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_02070 38911 39891 gene locus_tag LOCUS_02080 gene corA 38911 39891 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 protein_id gnl|my_center|LOCUS_02080 39913 40284 gene locus_tag LOCUS_02090 39913 40284 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_02090 40393 41631 gene locus_tag LOCUS_02100 40393 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 41715 42758 gene locus_tag LOCUS_02110 41715 42758 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_02110 44373 42727 gene locus_tag LOCUS_02120 44373 42727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 45326 44391 gene locus_tag LOCUS_02130 gene ribF 45326 44391 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_02130 46619 45528 gene locus_tag LOCUS_02140 46619 45528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 47470 46676 gene locus_tag LOCUS_02150 47470 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 48694 47522 gene locus_tag LOCUS_02160 48694 47522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 51371 48741 gene locus_tag LOCUS_02170 51371 48741 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_02170 52479 51508 gene locus_tag LOCUS_02180 52479 51508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 52761 53300 gene locus_tag LOCUS_02190 52761 53300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 53370 54143 gene locus_tag LOCUS_02200 gene trn2 53370 54143 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_02200 54568 54155 gene locus_tag LOCUS_02210 gene vapC 54568 54155 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_02210 54842 54591 gene locus_tag LOCUS_02220 54842 54591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 55545 54907 gene locus_tag LOCUS_02230 55545 54907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 56795 55548 gene locus_tag LOCUS_02240 56795 55548 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785125.1 protein_id gnl|my_center|LOCUS_02240 57968 57204 gene locus_tag LOCUS_02250 gene sodA 57968 57204 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863556.1 protein_id gnl|my_center|LOCUS_02250 58788 58051 gene locus_tag LOCUS_02260 58788 58051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 60505 59825 gene locus_tag LOCUS_02270 60505 59825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_02270 61360 60518 gene locus_tag LOCUS_02280 61360 60518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 61540 62805 gene locus_tag LOCUS_02290 61540 62805 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_02290 64660 62807 gene locus_tag LOCUS_02300 64660 62807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 65809 65027 gene locus_tag LOCUS_02310 65809 65027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 65901 66371 gene locus_tag LOCUS_02320 65901 66371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 66692 67819 gene locus_tag LOCUS_02330 66692 67819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 67963 68523 gene locus_tag LOCUS_02340 gene terD 67963 68523 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_02340 68645 69280 gene locus_tag LOCUS_02350 68645 69280 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_02350 69456 70016 gene locus_tag LOCUS_02360 gene terD 69456 70016 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_02360 70166 70726 gene locus_tag LOCUS_02370 gene terD 70166 70726 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_02370 70881 71516 gene locus_tag LOCUS_02380 70881 71516 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_02380 71604 72164 gene locus_tag LOCUS_02390 gene terD 71604 72164 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_02390 72673 73605 gene locus_tag LOCUS_02400 72673 73605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 73595 74182 gene locus_tag LOCUS_02410 73595 74182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 74179 74925 gene locus_tag LOCUS_02420 74179 74925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 75170 74997 gene locus_tag LOCUS_02430 75170 74997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 75475 77709 gene locus_tag LOCUS_02440 gene pepX1 75475 77709 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_02440 78244 77882 gene locus_tag LOCUS_02450 78244 77882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 78821 78351 gene locus_tag LOCUS_02460 78821 78351 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_02460 81273 78931 gene locus_tag LOCUS_02470 gene mrcA 81273 78931 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_02470 81888 81433 gene locus_tag LOCUS_02480 81888 81433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 83207 82011 gene locus_tag LOCUS_02490 83207 82011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_02490 84249 86615 gene locus_tag LOCUS_02500 84249 86615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 87165 86608 gene locus_tag LOCUS_02510 87165 86608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 87563 88342 gene locus_tag LOCUS_02520 gene sufC 87563 88342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_02520 88441 89793 gene locus_tag LOCUS_02530 gene sufD 88441 89793 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_02530 89990 90412 gene locus_tag LOCUS_02540 89990 90412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 92119 90506 gene locus_tag LOCUS_02550 gene porX 92119 90506 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_02550 93113 92625 gene locus_tag LOCUS_02560 93113 92625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 94038 93136 gene locus_tag LOCUS_02570 94038 93136 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_02570 96408 94171 gene locus_tag LOCUS_02580 96408 94171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 98167 96629 gene locus_tag LOCUS_02590 98167 96629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 98382 99608 gene locus_tag LOCUS_02600 98382 99608 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_02600 99790 101325 gene locus_tag LOCUS_02610 99790 101325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_02610 101413 101766 gene locus_tag LOCUS_02620 101413 101766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_02620 101910 102539 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtaaattgctttcaaaaatgtatctttaacaac 106398 102595 gene locus_tag LOCUS_02630 gene cas9 106398 102595 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZR9 protein_id gnl|my_center|LOCUS_02630 108899 106728 gene locus_tag LOCUS_02640 108899 106728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 110618 109197 gene locus_tag LOCUS_02650 110618 109197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 110818 111498 gene locus_tag LOCUS_02660 110818 111498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108994.1 protein_id gnl|my_center|LOCUS_02660 111676 111888 gene locus_tag LOCUS_02670 gene rpmF 111676 111888 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_02670 112273 120144 gene locus_tag LOCUS_02680 112273 120144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 120277 120846 gene locus_tag LOCUS_02690 120277 120846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 120864 121439 gene locus_tag LOCUS_02700 120864 121439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 121544 122017 gene locus_tag LOCUS_02710 121544 122017 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_02710 122220 122786 gene locus_tag LOCUS_02720 gene rimM 122220 122786 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_02720 123028 124251 gene locus_tag LOCUS_02730 123028 124251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_02730 125674 124274 gene locus_tag LOCUS_02740 125674 124274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 126042 126704 gene locus_tag LOCUS_02750 126042 126704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 126986 127864 gene locus_tag LOCUS_02760 126986 127864 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_02760 128216 129121 gene locus_tag LOCUS_02770 128216 129121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 129689 130222 gene locus_tag LOCUS_02780 129689 130222 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_02780 130491 131420 gene locus_tag LOCUS_02790 130491 131420 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_02790 131538 132134 gene locus_tag LOCUS_02800 131538 132134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 132354 133793 gene locus_tag LOCUS_02810 132354 133793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 133942 134340 gene locus_tag LOCUS_02820 133942 134340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 134502 135794 gene locus_tag LOCUS_02830 134502 135794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence003 644 159 gene locus_tag LOCUS_02840 644 159 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 protein_id gnl|my_center|LOCUS_02840 2920 650 gene locus_tag LOCUS_02850 2920 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3428 3967 gene locus_tag LOCUS_02860 3428 3967 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_02860 4094 4762 gene locus_tag LOCUS_02870 4094 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4910 7912 gene locus_tag LOCUS_02880 4910 7912 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_02880 8199 9629 gene locus_tag LOCUS_02890 8199 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9764 9691 gene locus_tag LOCUS_t00080 9764 9691 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10639 9881 gene locus_tag LOCUS_02900 10639 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 11664 10708 gene locus_tag LOCUS_02910 gene troA 11664 10708 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_02910 12701 11787 gene locus_tag LOCUS_02920 12701 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 12949 16410 gene locus_tag LOCUS_02930 12949 16410 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819M9 protein_id gnl|my_center|LOCUS_02930 16483 17583 gene locus_tag LOCUS_02940 16483 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17583 19220 gene locus_tag LOCUS_02950 17583 19220 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_02950 19774 19337 gene locus_tag LOCUS_02960 19774 19337 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_02960 20270 19923 gene locus_tag LOCUS_02970 20270 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 22639 20363 gene locus_tag LOCUS_02980 22639 20363 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_02980 23140 22730 gene locus_tag LOCUS_02990 23140 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 23411 24247 gene locus_tag LOCUS_03000 23411 24247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_03000 25865 24480 gene locus_tag LOCUS_03010 25865 24480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 27268 25868 gene locus_tag LOCUS_03020 27268 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 27935 27354 gene locus_tag LOCUS_03030 gene pdxH 27935 27354 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Y3 protein_id gnl|my_center|LOCUS_03030 28030 29352 gene locus_tag LOCUS_03040 28030 29352 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_03040 29666 32590 gene locus_tag LOCUS_03050 gene gcvP 29666 32590 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_03050 32756 34378 gene locus_tag LOCUS_03060 32756 34378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 34456 35460 gene locus_tag LOCUS_03070 34456 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 36314 35811 gene locus_tag LOCUS_03080 36314 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_03080 36437 36811 gene locus_tag LOCUS_03090 36437 36811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 37172 36903 gene locus_tag LOCUS_03100 37172 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_03100 38780 37278 gene locus_tag LOCUS_03110 gene atpD 38780 37278 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_03110 39515 40012 gene locus_tag LOCUS_03120 39515 40012 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03120 39993 41477 gene locus_tag LOCUS_03130 39993 41477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 41699 42418 gene locus_tag LOCUS_03140 41699 42418 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_03140 42506 43147 gene locus_tag LOCUS_03150 42506 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 43246 44013 gene locus_tag LOCUS_03160 gene bdhA1 43246 44013 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886667.1 protein_id gnl|my_center|LOCUS_03160 45406 44102 gene locus_tag LOCUS_03170 45406 44102 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186419.1 protein_id gnl|my_center|LOCUS_03170 46596 47978 gene locus_tag LOCUS_03180 gene kmo 46596 47978 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_03180 48075 48479 gene locus_tag LOCUS_03190 48075 48479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 49617 48769 gene locus_tag LOCUS_03200 49617 48769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 49916 50629 gene locus_tag LOCUS_03210 gene pnuC 49916 50629 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168038.1 protein_id gnl|my_center|LOCUS_03210 50825 51478 gene locus_tag LOCUS_03220 50825 51478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 52316 51540 gene locus_tag LOCUS_03230 gene phnP 52316 51540 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_03230 53462 52395 gene locus_tag LOCUS_03240 53462 52395 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_03240 55919 53496 gene locus_tag LOCUS_03250 55919 53496 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_03250 57531 56527 gene locus_tag LOCUS_03260 57531 56527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_03260 60786 57820 gene locus_tag LOCUS_03270 60786 57820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 61608 61054 gene locus_tag LOCUS_03280 61608 61054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 62567 61701 gene locus_tag LOCUS_03290 62567 61701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 63114 62704 gene locus_tag LOCUS_03300 63114 62704 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_03300 64368 63283 gene locus_tag LOCUS_03310 64368 63283 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_03310 64863 64375 gene locus_tag LOCUS_03320 64863 64375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 65245 64835 gene locus_tag LOCUS_03330 65245 64835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 66185 65364 gene locus_tag LOCUS_03340 gene panB 66185 65364 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_03340 67386 66361 gene locus_tag LOCUS_03350 gene thiL 67386 66361 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN4 protein_id gnl|my_center|LOCUS_03350 68396 67572 gene locus_tag LOCUS_03360 68396 67572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 69085 68573 gene locus_tag LOCUS_03370 69085 68573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 69649 71742 gene locus_tag LOCUS_03380 69649 71742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 73455 71911 gene locus_tag LOCUS_03390 gene gpmI 73455 71911 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_03390 74004 74525 gene locus_tag LOCUS_03400 74004 74525 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_03400 74578 74916 gene locus_tag LOCUS_03410 74578 74916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 75031 76335 gene locus_tag LOCUS_03420 gene purA 75031 76335 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_03420 77412 76549 gene locus_tag LOCUS_03430 77412 76549 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_03430 77666 78790 gene locus_tag LOCUS_03440 77666 78790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 78981 79790 gene locus_tag LOCUS_03450 78981 79790 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 protein_id gnl|my_center|LOCUS_03450 80713 79955 gene locus_tag LOCUS_03460 gene hisF 80713 79955 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_03460 81512 80799 gene locus_tag LOCUS_03470 gene hisA 81512 80799 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_03470 82394 81546 gene locus_tag LOCUS_03480 82394 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_03480 82898 82398 gene locus_tag LOCUS_03490 82898 82398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 83959 82955 gene locus_tag LOCUS_03500 83959 82955 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_03500 84374 84616 gene locus_tag LOCUS_03510 84374 84616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 84696 85283 gene locus_tag LOCUS_03520 84696 85283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 85647 85336 gene locus_tag LOCUS_03530 85647 85336 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_03530 86555 85797 gene locus_tag LOCUS_03540 86555 85797 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_03540 87395 86649 gene locus_tag LOCUS_03550 87395 86649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 87488 87952 gene locus_tag LOCUS_03560 87488 87952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 88166 89347 gene locus_tag LOCUS_03570 gene ftsW 88166 89347 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_03570 90016 89483 gene locus_tag LOCUS_03580 gene ndhG 90016 89483 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_03580 91582 90038 gene locus_tag LOCUS_03590 91582 90038 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_03590 93340 91751 gene locus_tag LOCUS_03600 93340 91751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 93522 93935 gene locus_tag LOCUS_03610 93522 93935 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107328.1 protein_id gnl|my_center|LOCUS_03610 94237 94887 gene locus_tag LOCUS_03620 94237 94887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016370.1 protein_id gnl|my_center|LOCUS_03620 97682 95142 gene locus_tag LOCUS_03630 97682 95142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 98972 97914 gene locus_tag LOCUS_03640 98972 97914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 103199 98994 gene locus_tag LOCUS_03650 103199 98994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 103981 103274 gene locus_tag LOCUS_03660 gene ftsE 103981 103274 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_03660 104563 104057 gene locus_tag LOCUS_03670 104563 104057 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_03670 105323 104697 gene locus_tag LOCUS_03680 105323 104697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 107311 105419 gene locus_tag LOCUS_03690 107311 105419 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088751.1 protein_id gnl|my_center|LOCUS_03690 108129 107629 gene locus_tag LOCUS_03700 108129 107629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 108420 108668 gene locus_tag LOCUS_03710 108420 108668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 109577 108744 gene locus_tag LOCUS_03720 109577 108744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 110692 109838 gene locus_tag LOCUS_03730 110692 109838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 111253 110702 gene locus_tag LOCUS_03740 111253 110702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_03740 112137 111346 gene locus_tag LOCUS_03750 112137 111346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 112268 112879 gene locus_tag LOCUS_03760 112268 112879 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_03760 112971 113789 gene locus_tag LOCUS_03770 112971 113789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 117000 114859 gene locus_tag LOCUS_03780 117000 114859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 119413 117512 gene locus_tag LOCUS_03790 gene acsA 119413 117512 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_03790 119704 120126 gene locus_tag LOCUS_03800 119704 120126 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_03800 120641 120279 gene locus_tag LOCUS_03810 120641 120279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_03810 120962 122272 gene locus_tag LOCUS_03820 120962 122272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 122438 122713 gene locus_tag LOCUS_03830 122438 122713 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_03830 122849 124585 gene locus_tag LOCUS_03840 122849 124585 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence004 460 134 gene locus_tag LOCUS_03850 460 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 815 582 gene locus_tag LOCUS_03860 815 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1212 838 gene locus_tag LOCUS_03870 1212 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3095 1620 gene locus_tag LOCUS_03880 3095 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3906 3313 gene locus_tag LOCUS_03890 3906 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4167 4673 gene locus_tag LOCUS_03900 4167 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4893 5480 gene locus_tag LOCUS_03910 4893 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5585 6568 gene locus_tag LOCUS_03920 gene qor 5585 6568 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645284.1 protein_id gnl|my_center|LOCUS_03920 7037 6630 gene locus_tag LOCUS_03930 7037 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7973 7194 gene locus_tag LOCUS_03940 7973 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8753 7980 gene locus_tag LOCUS_03950 8753 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 9154 8756 gene locus_tag LOCUS_03960 9154 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 10544 9267 gene locus_tag LOCUS_03970 gene purD 10544 9267 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_03970 12827 10638 gene locus_tag LOCUS_03980 12827 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 15061 12917 gene locus_tag LOCUS_03990 15061 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 15815 15246 gene locus_tag LOCUS_04000 15815 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 16193 15837 gene locus_tag LOCUS_04010 16193 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 16420 16190 gene locus_tag LOCUS_04020 16420 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 17127 16432 gene locus_tag LOCUS_04030 17127 16432 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_04030 17862 17527 gene locus_tag LOCUS_04040 17862 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18733 17945 gene locus_tag LOCUS_04050 gene coxP 18733 17945 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_04050 19038 19826 gene locus_tag LOCUS_04060 19038 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 20093 20443 gene locus_tag LOCUS_04070 20093 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 21490 20798 gene locus_tag LOCUS_04080 21490 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 21865 21680 gene locus_tag LOCUS_04090 21865 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 23911 22136 gene locus_tag LOCUS_04100 23911 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 26044 24110 gene locus_tag LOCUS_04110 26044 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 26787 26041 gene locus_tag LOCUS_04120 gene lytT 26787 26041 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82Z76 protein_id gnl|my_center|LOCUS_04120 26966 27472 gene locus_tag LOCUS_04130 26966 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 27661 28128 gene locus_tag LOCUS_04140 27661 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 28429 30414 gene locus_tag LOCUS_04150 28429 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 30521 30913 gene locus_tag LOCUS_04160 30521 30913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 30965 31885 gene locus_tag LOCUS_04170 30965 31885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_04170 31918 32478 gene locus_tag LOCUS_04180 31918 32478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 33459 32635 gene locus_tag LOCUS_04190 33459 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 34410 33532 gene locus_tag LOCUS_04200 34410 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_04200 34681 35976 gene locus_tag LOCUS_04210 34681 35976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 36902 36363 gene locus_tag LOCUS_04220 36902 36363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 37860 37114 gene locus_tag LOCUS_04230 37860 37114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 38231 41518 gene locus_tag LOCUS_04240 38231 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 42148 45285 gene locus_tag LOCUS_04250 42148 45285 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_04250 45398 46837 gene locus_tag LOCUS_04260 45398 46837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_04260 46915 47469 gene locus_tag LOCUS_04270 46915 47469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 47714 49348 gene locus_tag LOCUS_04280 47714 49348 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_04280 51335 49452 gene locus_tag LOCUS_04290 51335 49452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 51550 52551 gene locus_tag LOCUS_04300 gene sua5 51550 52551 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAV8 protein_id gnl|my_center|LOCUS_04300 53520 52765 gene locus_tag LOCUS_04310 53520 52765 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_04310 53838 56684 gene locus_tag LOCUS_04320 53838 56684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 57241 56786 gene locus_tag LOCUS_04330 57241 56786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 57622 57359 gene locus_tag LOCUS_04340 57622 57359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 57978 57634 gene locus_tag LOCUS_04350 57978 57634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 58132 58890 gene locus_tag LOCUS_04360 58132 58890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 60172 58970 gene locus_tag LOCUS_04370 gene mnmA 60172 58970 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_04370 60613 60314 gene locus_tag LOCUS_04380 60613 60314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_04380 61076 60834 gene locus_tag LOCUS_04390 61076 60834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 61729 61088 gene locus_tag LOCUS_04400 61729 61088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_04400 62061 61747 gene locus_tag LOCUS_04410 62061 61747 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_04410 62679 62266 gene locus_tag LOCUS_04420 62679 62266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 63317 62838 gene locus_tag LOCUS_04430 63317 62838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 63484 64437 gene locus_tag LOCUS_04440 gene ykcC 63484 64437 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_04440 64519 65229 gene locus_tag LOCUS_04450 64519 65229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 65560 66198 gene locus_tag LOCUS_04460 gene rsmG 65560 66198 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_04460 66238 66468 gene locus_tag LOCUS_04470 66238 66468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_04470 66449 66976 gene locus_tag LOCUS_04480 66449 66976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 67014 67796 gene locus_tag LOCUS_04490 67014 67796 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_04490 68116 67802 gene locus_tag LOCUS_04500 68116 67802 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_04500 68473 68129 gene locus_tag LOCUS_04510 68473 68129 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203069.1 protein_id gnl|my_center|LOCUS_04510 69004 68642 gene locus_tag LOCUS_04520 69004 68642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 69613 69188 gene locus_tag LOCUS_04530 69613 69188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 70271 69624 gene locus_tag LOCUS_04540 70271 69624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 71287 70520 gene locus_tag LOCUS_04550 71287 70520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_04550 71994 71419 gene locus_tag LOCUS_04560 71994 71419 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04560 72538 72065 gene locus_tag LOCUS_04570 72538 72065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 73380 72823 gene locus_tag LOCUS_04580 73380 72823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 75013 73538 gene locus_tag LOCUS_04590 gene murC 75013 73538 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_04590 75200 75667 gene locus_tag LOCUS_04600 75200 75667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 75750 76637 gene locus_tag LOCUS_04610 75750 76637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 76814 78574 gene locus_tag LOCUS_04620 76814 78574 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_04620 78692 79261 gene locus_tag LOCUS_04630 78692 79261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 79777 79361 gene locus_tag LOCUS_04640 gene mscL 79777 79361 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ8 protein_id gnl|my_center|LOCUS_04640 80567 79920 gene locus_tag LOCUS_04650 gene yplQ 80567 79920 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_04650 81206 80625 gene locus_tag LOCUS_04660 81206 80625 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_04660 81923 81324 gene locus_tag LOCUS_04670 81923 81324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 82231 82614 gene locus_tag LOCUS_04680 82231 82614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 84206 82872 gene locus_tag LOCUS_04690 84206 82872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 85929 84301 gene locus_tag LOCUS_04700 85929 84301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 86194 86039 gene locus_tag LOCUS_04710 86194 86039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 86584 87039 gene locus_tag LOCUS_04720 86584 87039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 94964 87411 gene locus_tag LOCUS_04730 94964 87411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 95235 96467 gene locus_tag LOCUS_04740 gene gltP 95235 96467 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962925.1 protein_id gnl|my_center|LOCUS_04740 97665 96553 gene locus_tag LOCUS_04750 gene murG 97665 96553 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A258 protein_id gnl|my_center|LOCUS_04750 97948 98649 gene locus_tag LOCUS_04760 97948 98649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 98939 98793 gene locus_tag LOCUS_04770 98939 98793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 98959 99696 gene locus_tag LOCUS_04780 98959 99696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_04780 100585 99755 gene locus_tag LOCUS_04790 100585 99755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 100958 102085 gene locus_tag LOCUS_04800 100958 102085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 102171 102701 gene locus_tag LOCUS_04810 102171 102701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_04810 102904 104565 gene locus_tag LOCUS_04820 102904 104565 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_04820 104584 105678 gene locus_tag LOCUS_04830 104584 105678 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_04830 105699 106385 gene locus_tag LOCUS_04840 105699 106385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 107030 106437 gene locus_tag LOCUS_04850 107030 106437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 107205 108572 gene locus_tag LOCUS_04860 107205 108572 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947312.1 protein_id gnl|my_center|LOCUS_04860 109213 108683 gene locus_tag LOCUS_04870 109213 108683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 109447 110856 gene locus_tag LOCUS_04880 gene speA 109447 110856 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_04880 111603 110959 gene locus_tag LOCUS_04890 111603 110959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 113802 111649 gene locus_tag LOCUS_04900 113802 111649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 113802 114011 gene locus_tag LOCUS_04910 113802 114011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 114222 114953 gene locus_tag LOCUS_04920 114222 114953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 114976 115566 gene locus_tag LOCUS_04930 114976 115566 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04930 115653 116288 gene locus_tag LOCUS_04940 115653 116288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 116916 116305 gene locus_tag LOCUS_04950 116916 116305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66416 protein_id gnl|my_center|LOCUS_04950 117173 116880 gene locus_tag LOCUS_04960 117173 116880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 118051 117176 gene locus_tag LOCUS_04970 118051 117176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_04970 118683 118222 gene locus_tag LOCUS_04980 118683 118222 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_04980 119920 118835 gene locus_tag LOCUS_04990 119920 118835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 120275 121597 gene locus_tag LOCUS_05000 120275 121597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 121660 122247 gene locus_tag LOCUS_05010 121660 122247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence005 916 212 gene locus_tag LOCUS_05020 916 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 1189 2226 gene locus_tag LOCUS_05030 gene holA 1189 2226 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_05030 2409 3419 gene locus_tag LOCUS_05040 2409 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4963 3767 gene locus_tag LOCUS_05050 4963 3767 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_05050 5866 5042 gene locus_tag LOCUS_05060 5866 5042 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_05060 7427 5982 gene locus_tag LOCUS_05070 gene tilS 7427 5982 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_05070 8072 7464 gene locus_tag LOCUS_05080 8072 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 8312 9700 gene locus_tag LOCUS_05090 8312 9700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443134.1 protein_id gnl|my_center|LOCUS_05090 10078 11118 gene locus_tag LOCUS_05100 10078 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11734 11210 gene locus_tag LOCUS_05110 11734 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11861 13258 gene locus_tag LOCUS_05120 11861 13258 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582859.1 protein_id gnl|my_center|LOCUS_05120 13621 13466 gene locus_tag LOCUS_05130 gene rpmH 13621 13466 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_05130 14571 13933 gene locus_tag LOCUS_05140 14571 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 15895 14777 gene locus_tag LOCUS_05150 gene gcvT 15895 14777 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_05150 16389 16931 gene locus_tag LOCUS_05160 16389 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 17040 18266 gene locus_tag LOCUS_05170 17040 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 18302 19207 gene locus_tag LOCUS_05180 18302 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 19357 20592 gene locus_tag LOCUS_05190 19357 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 21054 20728 gene locus_tag LOCUS_05200 gene sufA 21054 20728 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_05200 21955 21248 gene locus_tag LOCUS_05210 21955 21248 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_05210 22693 21986 gene locus_tag LOCUS_05220 22693 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW5 protein_id gnl|my_center|LOCUS_05220 23840 22740 gene locus_tag LOCUS_05230 23840 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24530 23844 gene locus_tag LOCUS_05240 24530 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 25621 24566 gene locus_tag LOCUS_05250 25621 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_05250 26729 25698 gene locus_tag LOCUS_05260 26729 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 27465 26737 gene locus_tag LOCUS_05270 27465 26737 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942616.1 protein_id gnl|my_center|LOCUS_05270 28217 27450 gene locus_tag LOCUS_05280 28217 27450 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_05280 29127 28222 gene locus_tag LOCUS_05290 29127 28222 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108897.1 protein_id gnl|my_center|LOCUS_05290 29999 29115 gene locus_tag LOCUS_05300 29999 29115 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_05300 31190 30018 gene locus_tag LOCUS_05310 31190 30018 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_05310 32279 31236 gene locus_tag LOCUS_05320 32279 31236 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_05320 33264 32383 gene locus_tag LOCUS_05330 33264 32383 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_05330 33519 34118 gene locus_tag LOCUS_05340 gene gmk 33519 34118 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_05340 34140 34712 gene locus_tag LOCUS_05350 gene nadD 34140 34712 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_05350 35876 37477 gene locus_tag LOCUS_05360 35876 37477 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_05360 37570 41007 gene locus_tag LOCUS_05370 37570 41007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 41184 42803 gene locus_tag LOCUS_05380 41184 42803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_05380 42934 43929 gene locus_tag LOCUS_05390 42934 43929 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_05390 44005 45213 gene locus_tag LOCUS_05400 gene lpxB 44005 45213 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_05400 45313 45597 gene locus_tag LOCUS_05410 45313 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 46082 46735 gene locus_tag LOCUS_05420 gene cynT 46082 46735 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_05420 47032 47727 gene locus_tag LOCUS_05430 47032 47727 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_05430 48075 51569 gene locus_tag LOCUS_05440 48075 51569 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 protein_id gnl|my_center|LOCUS_05440 52307 51858 gene locus_tag LOCUS_05450 gene vapC 52307 51858 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_05450 52606 52322 gene locus_tag LOCUS_05460 52606 52322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 54374 52665 gene locus_tag LOCUS_05470 54374 52665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 55177 54377 gene locus_tag LOCUS_05480 55177 54377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 57207 55354 gene locus_tag LOCUS_05490 57207 55354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 57394 58152 gene locus_tag LOCUS_05500 57394 58152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 59054 58302 gene locus_tag LOCUS_05510 59054 58302 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974472.1 protein_id gnl|my_center|LOCUS_05510 59381 60655 gene locus_tag LOCUS_05520 59381 60655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 60784 61359 gene locus_tag LOCUS_05530 60784 61359 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_05530 62017 61370 gene locus_tag LOCUS_05540 62017 61370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 63628 62273 gene locus_tag LOCUS_05550 gene accC 63628 62273 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_05550 64323 63811 gene locus_tag LOCUS_05560 gene accB 64323 63811 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_05560 65052 64483 gene locus_tag LOCUS_05570 gene efp 65052 64483 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_05570 65762 65193 gene locus_tag LOCUS_05580 65762 65193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 66286 65774 gene locus_tag LOCUS_05590 66286 65774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 67998 66613 gene locus_tag LOCUS_05600 gene radA 67998 66613 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_05600 71695 68291 gene locus_tag LOCUS_05610 71695 68291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 72033 72776 gene locus_tag LOCUS_05620 72033 72776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765949.1 protein_id gnl|my_center|LOCUS_05620 73157 72843 gene locus_tag LOCUS_05630 73157 72843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 73921 73367 gene locus_tag LOCUS_05640 73921 73367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 74568 76424 gene locus_tag LOCUS_05650 gene yfbK 74568 76424 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_05650 78161 76524 gene locus_tag LOCUS_05660 78161 76524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 78247 79164 gene locus_tag LOCUS_05670 78247 79164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_05670 80719 79262 gene locus_tag LOCUS_05680 gene pepA 80719 79262 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB4 protein_id gnl|my_center|LOCUS_05680 81257 80829 gene locus_tag LOCUS_05690 gene rpiB 81257 80829 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_05690 81480 82712 gene locus_tag LOCUS_05700 81480 82712 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_05700 82820 83632 gene locus_tag LOCUS_05710 82820 83632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 83684 84232 gene locus_tag LOCUS_05720 83684 84232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 84938 84468 gene locus_tag LOCUS_05730 84938 84468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 85417 86277 gene locus_tag LOCUS_05740 85417 86277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 86219 86974 gene locus_tag LOCUS_05750 86219 86974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 87004 87933 gene locus_tag LOCUS_05760 87004 87933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 88177 90120 gene locus_tag LOCUS_05770 gene thrS 88177 90120 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_05770 91543 90338 gene locus_tag LOCUS_05780 91543 90338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 92739 91828 gene locus_tag LOCUS_05790 92739 91828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 93003 93617 gene locus_tag LOCUS_05800 93003 93617 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_05800 93843 94469 gene locus_tag LOCUS_05810 gene hisI 93843 94469 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_05810 94808 95638 gene locus_tag LOCUS_05820 94808 95638 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_05820 97027 95732 gene locus_tag LOCUS_05830 gene gltP 97027 95732 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_05830 97334 97759 gene locus_tag LOCUS_05840 97334 97759 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_05840 97925 99475 gene locus_tag LOCUS_05850 gene purH 97925 99475 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_05850 99561 100433 gene locus_tag LOCUS_05860 gene rmlD 99561 100433 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_05860 100585 101019 gene locus_tag LOCUS_05870 100585 101019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 101153 102079 gene locus_tag LOCUS_05880 101153 102079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 102082 103038 gene locus_tag LOCUS_05890 102082 103038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 103039 103929 gene locus_tag LOCUS_05900 103039 103929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 104007 105056 gene locus_tag LOCUS_05910 104007 105056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_05910 105291 106742 gene locus_tag LOCUS_05920 gene gatA 105291 106742 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R679 protein_id gnl|my_center|LOCUS_05920 106787 107101 gene locus_tag LOCUS_05930 106787 107101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 107516 109471 gene locus_tag LOCUS_05940 107516 109471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 110435 109551 gene locus_tag LOCUS_05950 110435 109551 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_05950 111283 110750 gene locus_tag LOCUS_05960 gene rpsP 111283 110750 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SR3 protein_id gnl|my_center|LOCUS_05960 112056 111442 gene locus_tag LOCUS_05970 112056 111442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 112697 112311 gene locus_tag LOCUS_05980 112697 112311 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_05980 115059 112870 gene locus_tag LOCUS_05990 gene recG 115059 112870 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_05990 116207 115308 gene locus_tag LOCUS_06000 gene mvaK 116207 115308 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_06000 117515 116391 gene locus_tag LOCUS_06010 gene mvaD 117515 116391 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence006 308 411 gene locus_tag LOCUS_r00010 308 411 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1151 1903 gene locus_tag LOCUS_06020 1151 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4172 2061 gene locus_tag LOCUS_06030 4172 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4407 5222 gene locus_tag LOCUS_06040 4407 5222 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_06040 5593 6405 gene locus_tag LOCUS_06050 5593 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_06050 7103 6468 gene locus_tag LOCUS_06060 gene ydeI 7103 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_06060 7824 7228 gene locus_tag LOCUS_06070 7824 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8420 10720 gene locus_tag LOCUS_06080 gene relA 8420 10720 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_06080 11795 11256 gene locus_tag LOCUS_06090 11795 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 12066 14987 gene locus_tag LOCUS_06100 12066 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 15147 15536 gene locus_tag LOCUS_06110 15147 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 16351 15746 gene locus_tag LOCUS_06120 16351 15746 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_06120 19309 16844 gene locus_tag LOCUS_06130 gene rnr 19309 16844 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_06130 19746 20576 gene locus_tag LOCUS_06140 19746 20576 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_06140 21974 21039 gene locus_tag LOCUS_06150 21974 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 22585 21986 gene locus_tag LOCUS_06160 22585 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 23478 22666 gene locus_tag LOCUS_06170 23478 22666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 23979 23551 gene locus_tag LOCUS_06180 23979 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 24725 24126 gene locus_tag LOCUS_06190 24725 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 24825 25424 gene locus_tag LOCUS_06200 24825 25424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 25455 25955 gene locus_tag LOCUS_06210 25455 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 25986 26726 gene locus_tag LOCUS_06220 25986 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 28254 26734 gene locus_tag LOCUS_06230 28254 26734 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_06230 28496 29194 gene locus_tag LOCUS_06240 28496 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_06240 29261 29953 gene locus_tag LOCUS_06250 29261 29953 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_06250 29977 31365 gene locus_tag LOCUS_06260 29977 31365 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_06260 31743 32975 gene locus_tag LOCUS_06270 31743 32975 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107396.1 protein_id gnl|my_center|LOCUS_06270 32996 34081 gene locus_tag LOCUS_06280 32996 34081 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107397.1 protein_id gnl|my_center|LOCUS_06280 34369 37464 gene locus_tag LOCUS_06290 34369 37464 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_06290 37763 39601 gene locus_tag LOCUS_06300 gene htpG 37763 39601 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_06300 40006 39737 gene locus_tag LOCUS_06310 40006 39737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 40361 40963 gene locus_tag LOCUS_06320 40361 40963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 41036 41521 gene locus_tag LOCUS_06330 41036 41521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 41760 42833 gene locus_tag LOCUS_06340 gene cfbpA 41760 42833 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 protein_id gnl|my_center|LOCUS_06340 44160 43027 gene locus_tag LOCUS_06350 44160 43027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 44350 46599 gene locus_tag LOCUS_06360 44350 46599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 47032 46583 gene locus_tag LOCUS_06370 47032 46583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 47714 47109 gene locus_tag LOCUS_06380 47714 47109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 48557 47760 gene locus_tag LOCUS_06390 gene lpxA 48557 47760 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_06390 49677 48787 gene locus_tag LOCUS_06400 49677 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 49950 51725 gene locus_tag LOCUS_06410 49950 51725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 51922 54156 gene locus_tag LOCUS_06420 51922 54156 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_06420 54839 54195 gene locus_tag LOCUS_06430 54839 54195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 55076 55876 gene locus_tag LOCUS_06440 55076 55876 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_06440 56318 56509 gene locus_tag LOCUS_06450 56318 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 57939 56905 gene locus_tag LOCUS_06460 57939 56905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 61459 58010 gene locus_tag LOCUS_06470 gene mfd 61459 58010 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_06470 61700 61918 gene locus_tag LOCUS_06480 61700 61918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 62030 62974 gene locus_tag LOCUS_06490 62030 62974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708246.1 protein_id gnl|my_center|LOCUS_06490 64181 63591 gene locus_tag LOCUS_06500 64181 63591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 64676 64248 gene locus_tag LOCUS_06510 64676 64248 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_06510 64993 65445 gene locus_tag LOCUS_06520 64993 65445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 66389 65556 gene locus_tag LOCUS_06530 66389 65556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 67061 66414 gene locus_tag LOCUS_06540 67061 66414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 67217 68299 gene locus_tag LOCUS_06550 67217 68299 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_06550 68599 68940 gene locus_tag LOCUS_06560 68599 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 69008 69412 gene locus_tag LOCUS_06570 69008 69412 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G0 protein_id gnl|my_center|LOCUS_06570 69557 70432 gene locus_tag LOCUS_06580 gene murI 69557 70432 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_06580 70550 71083 gene locus_tag LOCUS_06590 gene pyrR1 70550 71083 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_06590 72431 71172 gene locus_tag LOCUS_06600 gene gcdH 72431 71172 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_06600 74296 72689 gene locus_tag LOCUS_06610 gene bshC 74296 72689 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_06610 75149 74454 gene locus_tag LOCUS_06620 75149 74454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 75636 75310 gene locus_tag LOCUS_06630 75636 75310 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_06630 76359 75856 gene locus_tag LOCUS_06640 76359 75856 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_06640 77619 76702 gene locus_tag LOCUS_06650 77619 76702 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_06650 78095 79093 gene locus_tag LOCUS_06660 gene coaX 78095 79093 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_06660 79080 80411 gene locus_tag LOCUS_06670 79080 80411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_06670 81415 80582 gene locus_tag LOCUS_06680 gene tsf 81415 80582 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_06680 81854 81630 gene locus_tag LOCUS_06690 81854 81630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 82936 82133 gene locus_tag LOCUS_06700 gene rpsB 82936 82133 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_06700 83600 83211 gene locus_tag LOCUS_06710 gene rpsI 83600 83211 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSE4 protein_id gnl|my_center|LOCUS_06710 84091 83642 gene locus_tag LOCUS_06720 gene rplM 84091 83642 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_06720 85234 84506 gene locus_tag LOCUS_06730 85234 84506 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_06730 85428 86444 gene locus_tag LOCUS_06740 85428 86444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 86923 87177 gene locus_tag LOCUS_06750 86923 87177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 87365 90733 gene locus_tag LOCUS_06760 gene ileS 87365 90733 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_06760 90909 91538 gene locus_tag LOCUS_06770 90909 91538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 91601 92383 gene locus_tag LOCUS_06780 91601 92383 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962428.1 protein_id gnl|my_center|LOCUS_06780 92561 93985 gene locus_tag LOCUS_06790 92561 93985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 94183 96147 gene locus_tag LOCUS_06800 94183 96147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_06800 96245 96631 gene locus_tag LOCUS_06810 96245 96631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_06810 96721 97953 gene locus_tag LOCUS_06820 gene sbcD 96721 97953 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23479 protein_id gnl|my_center|LOCUS_06820 98601 98059 gene locus_tag LOCUS_06830 98601 98059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 99034 98729 gene locus_tag LOCUS_06840 99034 98729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 100454 99213 gene locus_tag LOCUS_06850 100454 99213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 102858 100657 gene locus_tag LOCUS_06860 102858 100657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 103023 103919 gene locus_tag LOCUS_06870 103023 103919 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_06870 103933 105849 gene locus_tag LOCUS_06880 gene asnB-1 103933 105849 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772517.1 protein_id gnl|my_center|LOCUS_06880 105942 107006 gene locus_tag LOCUS_06890 105942 107006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 107609 107034 gene locus_tag LOCUS_06900 107609 107034 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_06900 108083 108871 gene locus_tag LOCUS_06910 108083 108871 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_06910 109821 109369 gene locus_tag LOCUS_06920 109821 109369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 110792 110172 gene locus_tag LOCUS_06930 110792 110172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 111347 110958 gene locus_tag LOCUS_06940 gene yjgF 111347 110958 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_06940 112637 111444 gene locus_tag LOCUS_06950 112637 111444 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_06950 112896 113258 gene locus_tag LOCUS_06960 112896 113258 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_06960 113625 113350 gene locus_tag LOCUS_06970 113625 113350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 113740 115197 gene locus_tag LOCUS_06980 gene lpdA2 113740 115197 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_06980 115405 117483 gene locus_tag LOCUS_06990 115405 117483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence007 968 498 gene locus_tag LOCUS_07000 968 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3224 1059 gene locus_tag LOCUS_07010 gene yyaL 3224 1059 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_07010 3806 3279 gene locus_tag LOCUS_07020 3806 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4758 4012 gene locus_tag LOCUS_07030 4758 4012 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_07030 5432 4926 gene locus_tag LOCUS_07040 5432 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6202 5444 gene locus_tag LOCUS_07050 gene kdsB 6202 5444 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_07050 7028 6285 gene locus_tag LOCUS_07060 7028 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_07060 7336 8118 gene locus_tag LOCUS_07070 7336 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8327 8773 gene locus_tag LOCUS_07080 8327 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9677 8790 gene locus_tag LOCUS_07090 9677 8790 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_07090 9942 10646 gene locus_tag LOCUS_07100 9942 10646 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_07100 11085 10690 gene locus_tag LOCUS_07110 11085 10690 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_07110 11267 12547 gene locus_tag LOCUS_07120 11267 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 12744 13352 gene locus_tag LOCUS_07130 gene sodA 12744 13352 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_07130 13552 14223 gene locus_tag LOCUS_07140 gene yvbH 13552 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32245 protein_id gnl|my_center|LOCUS_07140 14318 15172 gene locus_tag LOCUS_07150 14318 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 15453 16394 gene locus_tag LOCUS_07160 15453 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 17675 16554 gene locus_tag LOCUS_07170 17675 16554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_07170 18119 19144 gene locus_tag LOCUS_07180 gene trpS 18119 19144 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_07180 19226 19795 gene locus_tag LOCUS_07190 19226 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 20138 21382 gene locus_tag LOCUS_07200 20138 21382 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_07200 21710 21931 gene locus_tag LOCUS_07210 21710 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 22579 22046 gene locus_tag LOCUS_07220 22579 22046 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964804.1 protein_id gnl|my_center|LOCUS_07220 24144 22774 gene locus_tag LOCUS_07230 gene nqrF 24144 22774 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_07230 24362 24997 gene locus_tag LOCUS_07240 24362 24997 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269267.1 protein_id gnl|my_center|LOCUS_07240 25493 27640 gene locus_tag LOCUS_07250 25493 27640 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203284.1 protein_id gnl|my_center|LOCUS_07250 28649 27696 gene locus_tag LOCUS_07260 28649 27696 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_07260 28912 30321 gene locus_tag LOCUS_07270 28912 30321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 30555 30340 gene locus_tag LOCUS_07280 30555 30340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 31807 30638 gene locus_tag LOCUS_07290 31807 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 33280 32093 gene locus_tag LOCUS_07300 33280 32093 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_07300 33693 33343 gene locus_tag LOCUS_07310 33693 33343 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_07310 33925 33707 gene locus_tag LOCUS_07320 33925 33707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 35580 34036 gene locus_tag LOCUS_07330 35580 34036 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_07330 35851 36279 gene locus_tag LOCUS_07340 35851 36279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 36686 37546 gene locus_tag LOCUS_07350 36686 37546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 37672 38415 gene locus_tag LOCUS_07360 37672 38415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 38842 39315 gene locus_tag LOCUS_07370 38842 39315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 39266 39703 gene locus_tag LOCUS_07380 39266 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 40439 39795 gene locus_tag LOCUS_07390 40439 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 40784 41167 gene locus_tag LOCUS_07400 40784 41167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 43152 41281 gene locus_tag LOCUS_07410 gene mnmG 43152 41281 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_07410 43999 43379 gene locus_tag LOCUS_07420 43999 43379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 45226 44711 gene locus_tag LOCUS_07430 45226 44711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888187.1 protein_id gnl|my_center|LOCUS_07430 45596 45312 gene locus_tag LOCUS_07440 45596 45312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_07440 45887 46357 gene locus_tag LOCUS_07450 45887 46357 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_07450 46972 46517 gene locus_tag LOCUS_07460 46972 46517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 47235 47765 gene locus_tag LOCUS_07470 47235 47765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 48075 48989 gene locus_tag LOCUS_07480 48075 48989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 49868 49068 gene locus_tag LOCUS_07490 49868 49068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 50648 49908 gene locus_tag LOCUS_07500 gene ste14 50648 49908 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_07500 51830 50775 gene locus_tag LOCUS_07510 51830 50775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_07510 52002 52562 gene locus_tag LOCUS_07520 gene pth 52002 52562 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_07520 52591 53490 gene locus_tag LOCUS_07530 52591 53490 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_07530 54985 53732 gene locus_tag LOCUS_07540 gene clpX 54985 53732 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_07540 56020 55364 gene locus_tag LOCUS_07550 56020 55364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 56953 56093 gene locus_tag LOCUS_07560 gene dapD 56953 56093 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_07560 57831 57211 gene locus_tag LOCUS_07570 57831 57211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 60042 57964 gene locus_tag LOCUS_07580 60042 57964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_07580 60298 60927 gene locus_tag LOCUS_07590 60298 60927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_07590 62704 61556 gene locus_tag LOCUS_07600 gene dnaJ 62704 61556 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VI7 protein_id gnl|my_center|LOCUS_07600 63508 62903 gene locus_tag LOCUS_07610 gene grpE 63508 62903 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_07610 64236 64003 gene locus_tag LOCUS_07620 64236 64003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 64244 64738 gene locus_tag LOCUS_07630 64244 64738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 65426 64842 gene locus_tag LOCUS_07640 65426 64842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_07640 66928 65648 gene locus_tag LOCUS_07650 gene argH 66928 65648 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_07650 68122 67052 gene locus_tag LOCUS_07660 68122 67052 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_07660 68955 68176 gene locus_tag LOCUS_07670 gene argB 68955 68176 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_07670 70153 69155 gene locus_tag LOCUS_07680 gene argF' 70153 69155 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_07680 71467 70337 gene locus_tag LOCUS_07690 71467 70337 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_07690 72623 71583 gene locus_tag LOCUS_07700 gene argC 72623 71583 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_07700 73842 72613 gene locus_tag LOCUS_07710 73842 72613 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_07710 74497 73862 gene locus_tag LOCUS_07720 74497 73862 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_07720 79797 75358 gene locus_tag LOCUS_07730 79797 75358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 79977 80657 gene locus_tag LOCUS_07740 79977 80657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 81828 80902 gene locus_tag LOCUS_07750 gene gldA 81828 80902 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_07750 81959 82291 gene locus_tag LOCUS_07760 81959 82291 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_07760 83135 82350 gene locus_tag LOCUS_07770 83135 82350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 83510 83313 gene locus_tag LOCUS_07780 gene rpsU 83510 83313 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_07780 84103 84468 gene locus_tag LOCUS_07790 84103 84468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 85238 84588 gene locus_tag LOCUS_07800 gene gpm 85238 84588 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_07800 85404 86639 gene locus_tag LOCUS_07810 85404 86639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 86683 87783 gene locus_tag LOCUS_07820 86683 87783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 87866 89086 gene locus_tag LOCUS_07830 87866 89086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 89099 89389 gene locus_tag LOCUS_07840 89099 89389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 89567 89409 gene locus_tag LOCUS_07850 89567 89409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 89701 90915 gene locus_tag LOCUS_07860 89701 90915 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_07860 91041 91958 gene locus_tag LOCUS_07870 91041 91958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_07870 94906 92180 gene locus_tag LOCUS_07880 94906 92180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 95043 95954 gene locus_tag LOCUS_07890 95043 95954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 96473 95979 gene locus_tag LOCUS_07900 96473 95979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 96582 97496 gene locus_tag LOCUS_07910 96582 97496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 97503 98414 gene locus_tag LOCUS_07920 97503 98414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 98427 99329 gene locus_tag LOCUS_07930 98427 99329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 100068 99367 gene locus_tag LOCUS_07940 100068 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 100945 100139 gene locus_tag LOCUS_07950 100945 100139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 102258 101395 gene locus_tag LOCUS_07960 gene uspA 102258 101395 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_07960 103079 102480 gene locus_tag LOCUS_07970 103079 102480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 104752 103343 gene locus_tag LOCUS_07980 gene lpdA1 104752 103343 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_07980 105331 104879 gene locus_tag LOCUS_07990 105331 104879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 105586 106350 gene locus_tag LOCUS_08000 105586 106350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 106362 107114 gene locus_tag LOCUS_08010 106362 107114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 108243 107266 gene locus_tag LOCUS_08020 108243 107266 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_08020 108539 109918 gene locus_tag LOCUS_08030 108539 109918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_08030 110904 110041 gene locus_tag LOCUS_08040 gene udp 110904 110041 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08040 111789 111205 gene locus_tag LOCUS_08050 111789 111205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 113141 111786 gene locus_tag LOCUS_08060 113141 111786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence008 2064 277 gene locus_tag LOCUS_08070 2064 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3290 2394 gene locus_tag LOCUS_08080 gene accD 3290 2394 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_08080 4524 3436 gene locus_tag LOCUS_08090 4524 3436 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816851.1 protein_id gnl|my_center|LOCUS_08090 5958 4654 gene locus_tag LOCUS_08100 5958 4654 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121141.1 protein_id gnl|my_center|LOCUS_08100 6445 6152 gene locus_tag LOCUS_08110 6445 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6689 6453 gene locus_tag LOCUS_08120 6689 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 7631 6873 gene locus_tag LOCUS_08130 7631 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7985 7656 gene locus_tag LOCUS_08140 7985 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 9509 8010 gene locus_tag LOCUS_08150 9509 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 13110 9622 gene locus_tag LOCUS_08160 13110 9622 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_08160 13413 13613 gene locus_tag LOCUS_08170 13413 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13826 14698 gene locus_tag LOCUS_08180 gene folD 13826 14698 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_08180 14828 15088 gene locus_tag LOCUS_08190 14828 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15125 16195 gene locus_tag LOCUS_08200 15125 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 16192 17958 gene locus_tag LOCUS_08210 16192 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 18107 18628 gene locus_tag LOCUS_08220 18107 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 18743 19390 gene locus_tag LOCUS_08230 18743 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 19475 19768 gene locus_tag LOCUS_08240 19475 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 19891 21195 gene locus_tag LOCUS_08250 19891 21195 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_08250 21391 23661 gene locus_tag LOCUS_08260 21391 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 24013 24987 gene locus_tag LOCUS_08270 24013 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 25145 25789 gene locus_tag LOCUS_08280 25145 25789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 25887 26684 gene locus_tag LOCUS_08290 25887 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 27606 26689 gene locus_tag LOCUS_08300 27606 26689 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_08300 28930 27686 gene locus_tag LOCUS_08310 28930 27686 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_08310 29788 29126 gene locus_tag LOCUS_08320 29788 29126 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_08320 30678 29902 gene locus_tag LOCUS_08330 30678 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 33108 30805 gene locus_tag LOCUS_08340 gene maeB 33108 30805 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_08340 33914 33291 gene locus_tag LOCUS_08350 33914 33291 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_08350 35313 34171 gene locus_tag LOCUS_08360 35313 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 36248 35346 gene locus_tag LOCUS_08370 gene prmA 36248 35346 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_08370 36948 36574 gene locus_tag LOCUS_08380 36948 36574 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_08380 37601 37945 gene locus_tag LOCUS_08390 37601 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 38061 37873 gene locus_tag LOCUS_08400 38061 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 38422 40932 gene locus_tag LOCUS_08410 gene nrdA 38422 40932 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_08410 41161 41907 gene locus_tag LOCUS_08420 41161 41907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 41970 42449 gene locus_tag LOCUS_08430 41970 42449 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_08430 42452 43207 gene locus_tag LOCUS_08440 42452 43207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 43705 44649 gene locus_tag LOCUS_08450 gene ltd 43705 44649 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_08450 45327 44893 gene locus_tag LOCUS_08460 45327 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_08460 46028 45396 gene locus_tag LOCUS_08470 46028 45396 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_08470 46611 48320 gene locus_tag LOCUS_08480 46611 48320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 48947 48396 gene locus_tag LOCUS_08490 48947 48396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 49693 49067 gene locus_tag LOCUS_08500 gene bioD 49693 49067 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_08500 52951 49892 gene locus_tag LOCUS_08510 52951 49892 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_08510 53387 53866 gene locus_tag LOCUS_08520 53387 53866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 54072 54662 gene locus_tag LOCUS_08530 54072 54662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 54735 55175 gene locus_tag LOCUS_08540 54735 55175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 56330 55260 gene locus_tag LOCUS_08550 56330 55260 CDS product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_08550 56968 56423 gene locus_tag LOCUS_08560 56968 56423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 57588 57055 gene locus_tag LOCUS_08570 57588 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 59199 58027 gene locus_tag LOCUS_08580 59199 58027 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_08580 60556 59315 gene locus_tag LOCUS_08590 60556 59315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 62841 60577 gene locus_tag LOCUS_08600 gene mrcA 62841 60577 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_08600 63149 63844 gene locus_tag LOCUS_08610 gene cmk 63149 63844 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_08610 63854 64606 gene locus_tag LOCUS_08620 63854 64606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 64629 66149 gene locus_tag LOCUS_08630 64629 66149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 66167 67078 gene locus_tag LOCUS_08640 66167 67078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 67082 68068 gene locus_tag LOCUS_08650 67082 68068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 68109 69437 gene locus_tag LOCUS_08660 68109 69437 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118881.1 protein_id gnl|my_center|LOCUS_08660 69462 70496 gene locus_tag LOCUS_08670 69462 70496 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_08670 70493 71218 gene locus_tag LOCUS_08680 70493 71218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 71248 72519 gene locus_tag LOCUS_08690 71248 72519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 72497 73765 gene locus_tag LOCUS_08700 72497 73765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 73778 75079 gene locus_tag LOCUS_08710 73778 75079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 75109 76263 gene locus_tag LOCUS_08720 75109 76263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 80233 76319 gene locus_tag LOCUS_08730 80233 76319 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D7 protein_id gnl|my_center|LOCUS_08730 81155 80628 gene locus_tag LOCUS_08740 81155 80628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 81558 81169 gene locus_tag LOCUS_08750 81558 81169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 82539 81751 gene locus_tag LOCUS_08760 82539 81751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532085.1 protein_id gnl|my_center|LOCUS_08760 83600 82860 gene locus_tag LOCUS_08770 83600 82860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 84575 83802 gene locus_tag LOCUS_08780 84575 83802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 85644 84901 gene locus_tag LOCUS_08790 85644 84901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 85954 86757 gene locus_tag LOCUS_08800 85954 86757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 87658 86861 gene locus_tag LOCUS_08810 87658 86861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 88268 87732 gene locus_tag LOCUS_08820 88268 87732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 89089 88322 gene locus_tag LOCUS_08830 89089 88322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 89366 89439 gene locus_tag LOCUS_t00090 89366 89439 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 89505 89588 gene locus_tag LOCUS_t00100 89505 89588 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 89626 89699 gene locus_tag LOCUS_t00110 89626 89699 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 90346 89780 gene locus_tag LOCUS_08840 90346 89780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 90748 91560 gene locus_tag LOCUS_08850 90748 91560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 91569 92651 gene locus_tag LOCUS_08860 gene serC 91569 92651 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Y1 protein_id gnl|my_center|LOCUS_08860 92871 93161 gene locus_tag LOCUS_08870 gene rpmE2 92871 93161 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_08870 93729 93244 gene locus_tag LOCUS_08880 93729 93244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 96423 93919 gene locus_tag LOCUS_08890 96423 93919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 99243 97168 gene locus_tag LOCUS_08900 99243 97168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 99919 100815 gene locus_tag LOCUS_08910 99919 100815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 100998 101894 gene locus_tag LOCUS_08920 100998 101894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 102116 102925 gene locus_tag LOCUS_08930 102116 102925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 102991 103875 gene locus_tag LOCUS_08940 102991 103875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 103965 104756 gene locus_tag LOCUS_08950 gene kdsA 103965 104756 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 protein_id gnl|my_center|LOCUS_08950 108964 104873 gene locus_tag LOCUS_08960 108964 104873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 108963 109172 gene locus_tag LOCUS_08970 108963 109172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence009 1295 990 gene locus_tag LOCUS_08980 1295 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1824 1300 gene locus_tag LOCUS_08990 1824 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5877 2203 gene locus_tag LOCUS_09000 5877 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6342 6181 gene locus_tag LOCUS_09010 6342 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6669 7127 gene locus_tag LOCUS_09020 6669 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8407 7211 gene locus_tag LOCUS_09030 8407 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 8536 8838 gene locus_tag LOCUS_09040 8536 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8845 9345 gene locus_tag LOCUS_09050 8845 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 12719 9420 gene locus_tag LOCUS_09060 12719 9420 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_09060 13287 12928 gene locus_tag LOCUS_09070 13287 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 13706 13341 gene locus_tag LOCUS_09080 13706 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 14863 13859 gene locus_tag LOCUS_09090 14863 13859 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_09090 15906 14956 gene locus_tag LOCUS_09100 15906 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16142 16660 gene locus_tag LOCUS_09110 16142 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 17583 19508 gene locus_tag LOCUS_09120 gene dnaK 17583 19508 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_09120 19634 19813 gene locus_tag LOCUS_09130 19634 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 19800 20171 gene locus_tag LOCUS_09140 19800 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21820 20291 gene locus_tag LOCUS_09150 21820 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_09150 23218 22121 gene locus_tag LOCUS_09160 23218 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_09160 23861 23439 gene locus_tag LOCUS_09170 23861 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 25580 23937 gene locus_tag LOCUS_09180 25580 23937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 26508 29066 gene locus_tag LOCUS_09190 gene clpB 26508 29066 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_09190 29945 29130 gene locus_tag LOCUS_09200 29945 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 32107 29963 gene locus_tag LOCUS_09210 32107 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 33035 32232 gene locus_tag LOCUS_09220 33035 32232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 33538 33083 gene locus_tag LOCUS_09230 33538 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 34445 33753 gene locus_tag LOCUS_09240 34445 33753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 35722 34577 gene locus_tag LOCUS_09250 35722 34577 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_09250 36381 35785 gene locus_tag LOCUS_09260 36381 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 36942 36496 gene locus_tag LOCUS_09270 36942 36496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 38548 37040 gene locus_tag LOCUS_09280 38548 37040 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_09280 39148 38642 gene locus_tag LOCUS_09290 39148 38642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_09290 39784 39197 gene locus_tag LOCUS_09300 39784 39197 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_09300 41919 39901 gene locus_tag LOCUS_09310 gene nadE 41919 39901 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_09310 43410 42055 gene locus_tag LOCUS_09320 43410 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 43716 43522 gene locus_tag LOCUS_09330 43716 43522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 43957 43706 gene locus_tag LOCUS_09340 43957 43706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 46841 44343 gene locus_tag LOCUS_09350 46841 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 47682 46831 gene locus_tag LOCUS_09360 47682 46831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 48436 47888 gene locus_tag LOCUS_09370 48436 47888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 49228 48632 gene locus_tag LOCUS_09380 49228 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 49530 49721 gene locus_tag LOCUS_09390 49530 49721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 50159 50665 gene locus_tag LOCUS_09400 50159 50665 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_09400 54204 50776 gene locus_tag LOCUS_09410 54204 50776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 54490 55140 gene locus_tag LOCUS_09420 54490 55140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 55282 56091 gene locus_tag LOCUS_09430 55282 56091 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_09430 56198 57127 gene locus_tag LOCUS_09440 56198 57127 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_09440 57173 57649 gene locus_tag LOCUS_09450 57173 57649 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_09450 57971 60010 gene locus_tag LOCUS_09460 57971 60010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 61334 60417 gene locus_tag LOCUS_09470 61334 60417 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_09470 62066 61545 gene locus_tag LOCUS_09480 62066 61545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 62847 62311 gene locus_tag LOCUS_09490 gene dcd 62847 62311 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_09490 63998 62907 gene locus_tag LOCUS_09500 gene ribD 63998 62907 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_09500 65309 64044 gene locus_tag LOCUS_09510 65309 64044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 65643 66386 gene locus_tag LOCUS_09520 65643 66386 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_09520 66556 66741 gene locus_tag LOCUS_09530 66556 66741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 67199 66747 gene locus_tag LOCUS_09540 67199 66747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 69332 67242 gene locus_tag LOCUS_09550 69332 67242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 70264 69587 gene locus_tag LOCUS_09560 70264 69587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 72531 70336 gene locus_tag LOCUS_09570 72531 70336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 73339 72653 gene locus_tag LOCUS_09580 73339 72653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 73515 75107 gene locus_tag LOCUS_09590 73515 75107 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XD8 protein_id gnl|my_center|LOCUS_09590 76873 75191 gene locus_tag LOCUS_09600 76873 75191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 76992 77849 gene locus_tag LOCUS_09610 76992 77849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 79237 77885 gene locus_tag LOCUS_09620 79237 77885 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 protein_id gnl|my_center|LOCUS_09620 79330 79794 gene locus_tag LOCUS_09630 79330 79794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 80335 79880 gene locus_tag LOCUS_09640 80335 79880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 81322 80396 gene locus_tag LOCUS_09650 81322 80396 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 81582 82943 gene locus_tag LOCUS_09660 81582 82943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120538.1 protein_id gnl|my_center|LOCUS_09660 83626 83012 gene locus_tag LOCUS_09670 83626 83012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 85014 83713 gene locus_tag LOCUS_09680 gene pabB 85014 83713 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_09680 86091 85096 gene locus_tag LOCUS_09690 gene gapA 86091 85096 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_09690 87684 86419 gene locus_tag LOCUS_09700 87684 86419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 91146 87832 gene locus_tag LOCUS_09710 gene infB 91146 87832 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR4 protein_id gnl|my_center|LOCUS_09710 92888 91638 gene locus_tag LOCUS_09720 gene nusA 92888 91638 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_09720 93549 92932 gene locus_tag LOCUS_09730 93549 92932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 95502 93739 gene locus_tag LOCUS_09740 95502 93739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 99437 95502 gene locus_tag LOCUS_09750 99437 95502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 100094 99693 gene locus_tag LOCUS_09760 100094 99693 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_09760 104015 100149 gene locus_tag LOCUS_09770 104015 100149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 104738 104067 gene locus_tag LOCUS_09780 104738 104067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 106157 104991 gene locus_tag LOCUS_09790 106157 104991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 106595 107599 gene locus_tag LOCUS_09800 106595 107599 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_09800 107606 108739 gene locus_tag LOCUS_09810 107606 108739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence010 194 1537 gene locus_tag LOCUS_09820 194 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1750 2298 gene locus_tag LOCUS_09830 1750 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3067 2381 gene locus_tag LOCUS_09840 3067 2381 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_09840 3297 5423 gene locus_tag LOCUS_09850 3297 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5502 5855 gene locus_tag LOCUS_09860 gene ogt2 5502 5855 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_09860 6194 5856 gene locus_tag LOCUS_09870 6194 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6759 6346 gene locus_tag LOCUS_09880 6759 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6972 7784 gene locus_tag LOCUS_09890 6972 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8428 11604 gene locus_tag LOCUS_09900 8428 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11802 14696 gene locus_tag LOCUS_09910 gene leuS 11802 14696 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_09910 14746 15225 gene locus_tag LOCUS_09920 14746 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 15238 15537 gene locus_tag LOCUS_09930 15238 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 15640 16122 gene locus_tag LOCUS_09940 15640 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 16135 16734 gene locus_tag LOCUS_09950 16135 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 16751 17377 gene locus_tag LOCUS_09960 16751 17377 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_09960 17468 17935 gene locus_tag LOCUS_09970 17468 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 18065 19009 gene locus_tag LOCUS_09980 18065 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_09980 19445 19035 gene locus_tag LOCUS_09990 19445 19035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 19555 22527 gene locus_tag LOCUS_10000 19555 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 24642 22672 gene locus_tag LOCUS_10010 24642 22672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_10010 26194 24851 gene locus_tag LOCUS_10020 gene pyrC1 26194 24851 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_10020 26531 29065 gene locus_tag LOCUS_10030 gene ccoI 26531 29065 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_10030 29128 29766 gene locus_tag LOCUS_10040 29128 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 29942 29778 gene locus_tag LOCUS_10050 29942 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30466 29945 gene locus_tag LOCUS_10060 30466 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 30653 33436 gene locus_tag LOCUS_10070 30653 33436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 33521 34090 gene locus_tag LOCUS_10080 33521 34090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 34514 35929 gene locus_tag LOCUS_10090 34514 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 36000 36644 gene locus_tag LOCUS_10100 36000 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 37614 36751 gene locus_tag LOCUS_10110 37614 36751 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_10110 40474 38201 gene locus_tag LOCUS_10120 gene pnp 40474 38201 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_10120 40902 40615 gene locus_tag LOCUS_10130 gene rpsO 40902 40615 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_10130 41586 41119 gene locus_tag LOCUS_10140 41586 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 42448 41705 gene locus_tag LOCUS_10150 42448 41705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 42945 42550 gene locus_tag LOCUS_10160 42945 42550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 44136 42997 gene locus_tag LOCUS_10170 44136 42997 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_10170 45251 44517 gene locus_tag LOCUS_10180 45251 44517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_10180 45890 45468 gene locus_tag LOCUS_10190 45890 45468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 46796 46119 gene locus_tag LOCUS_10200 46796 46119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48520 47015 gene locus_tag LOCUS_10210 gene cry 48520 47015 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_10210 49363 48629 gene locus_tag LOCUS_10220 49363 48629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 49640 49912 gene locus_tag LOCUS_10230 49640 49912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887737.1 protein_id gnl|my_center|LOCUS_10230 50176 50955 gene locus_tag LOCUS_10240 50176 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 53074 51248 gene locus_tag LOCUS_10250 53074 51248 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_10250 55840 53606 gene locus_tag LOCUS_10260 gene purL 55840 53606 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 protein_id gnl|my_center|LOCUS_10260 56626 56414 gene locus_tag LOCUS_10270 56626 56414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 57990 56806 gene locus_tag LOCUS_10280 gene tuf 57990 56806 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_10280 58157 58085 gene locus_tag LOCUS_t00120 58157 58085 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 58417 58344 gene locus_tag LOCUS_t00130 58417 58344 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58670 58587 gene locus_tag LOCUS_t00140 58670 58587 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 59339 59031 gene locus_tag LOCUS_10290 59339 59031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 61144 59822 gene locus_tag LOCUS_10300 61144 59822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_10300 61225 61902 gene locus_tag LOCUS_10310 61225 61902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 61989 62420 gene locus_tag LOCUS_10320 61989 62420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 63399 62431 gene locus_tag LOCUS_10330 63399 62431 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_10330 63613 64131 gene locus_tag LOCUS_10340 63613 64131 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_10340 64986 64204 gene locus_tag LOCUS_10350 64986 64204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207948.1 protein_id gnl|my_center|LOCUS_10350 65577 65023 gene locus_tag LOCUS_10360 65577 65023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 66362 65850 gene locus_tag LOCUS_10370 66362 65850 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_10370 68406 66565 gene locus_tag LOCUS_10380 68406 66565 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_10380 68810 70180 gene locus_tag LOCUS_10390 68810 70180 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_10390 70280 70666 gene locus_tag LOCUS_10400 70280 70666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 71097 71873 gene locus_tag LOCUS_10410 71097 71873 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_10410 71975 72784 gene locus_tag LOCUS_10420 71975 72784 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_10420 72812 74119 gene locus_tag LOCUS_10430 gene kynU 72812 74119 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_10430 76136 74190 gene locus_tag LOCUS_10440 76136 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 77453 76398 gene locus_tag LOCUS_10450 77453 76398 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_10450 78504 77620 gene locus_tag LOCUS_10460 78504 77620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_10460 78813 79457 gene locus_tag LOCUS_10470 78813 79457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 79583 80020 gene locus_tag LOCUS_10480 79583 80020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 80662 80024 gene locus_tag LOCUS_10490 80662 80024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 81746 80715 gene locus_tag LOCUS_10500 gene pyrD 81746 80715 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_10500 82173 81886 gene locus_tag LOCUS_10510 82173 81886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 83018 84364 gene locus_tag LOCUS_10520 83018 84364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 85008 84547 gene locus_tag LOCUS_10530 85008 84547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_10530 85607 85233 gene locus_tag LOCUS_10540 85607 85233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 87261 86029 gene locus_tag LOCUS_10550 87261 86029 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_10550 87527 88879 gene locus_tag LOCUS_10560 87527 88879 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y98 protein_id gnl|my_center|LOCUS_10560 89026 90042 gene locus_tag LOCUS_10570 89026 90042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 90466 90128 gene locus_tag LOCUS_10580 90466 90128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 91311 90532 gene locus_tag LOCUS_10590 91311 90532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 92494 91304 gene locus_tag LOCUS_10600 92494 91304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 96131 92583 gene locus_tag LOCUS_10610 gene smc 96131 92583 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_10610 96548 96321 gene locus_tag LOCUS_10620 96548 96321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 97498 96710 gene locus_tag LOCUS_10630 97498 96710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_10630 97986 97732 gene locus_tag LOCUS_10640 97986 97732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 98882 97983 gene locus_tag LOCUS_10650 98882 97983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_10650 98978 100333 gene locus_tag LOCUS_10660 98978 100333 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXY5 protein_id gnl|my_center|LOCUS_10660 100338 101216 gene locus_tag LOCUS_10670 100338 101216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963015.1 protein_id gnl|my_center|LOCUS_10670 101327 102250 gene locus_tag LOCUS_10680 101327 102250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 102263 103015 gene locus_tag LOCUS_10690 102263 103015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 103120 105804 gene locus_tag LOCUS_10700 gene mutS 103120 105804 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_10700 105861 106394 gene locus_tag LOCUS_10710 105861 106394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence011 340 122 gene locus_tag LOCUS_10720 340 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 542 327 gene locus_tag LOCUS_10730 542 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 727 1647 gene locus_tag LOCUS_10740 727 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_10740 2089 3486 gene locus_tag LOCUS_10750 2089 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3615 4487 gene locus_tag LOCUS_10760 3615 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5779 4592 gene locus_tag LOCUS_10770 5779 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5970 5788 gene locus_tag LOCUS_10780 5970 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6751 6098 gene locus_tag LOCUS_10790 gene tpm 6751 6098 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_10790 7223 7960 gene locus_tag LOCUS_10800 gene pyrH 7223 7960 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_10800 8068 8439 gene locus_tag LOCUS_10810 8068 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8436 9251 gene locus_tag LOCUS_10820 8436 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 9326 10564 gene locus_tag LOCUS_10830 9326 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 10626 10775 gene locus_tag LOCUS_10840 10626 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10756 11064 gene locus_tag LOCUS_10850 10756 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 11066 11440 gene locus_tag LOCUS_10860 11066 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393802.1 protein_id gnl|my_center|LOCUS_10860 12740 11427 gene locus_tag LOCUS_10870 12740 11427 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_10870 14233 12941 gene locus_tag LOCUS_10880 14233 12941 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_10880 15171 14419 gene locus_tag LOCUS_10890 15171 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_10890 16411 15281 gene locus_tag LOCUS_10900 16411 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16655 17944 gene locus_tag LOCUS_10910 gene bioA 16655 17944 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_10910 18783 18229 gene locus_tag LOCUS_10920 18783 18229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20054 19203 gene locus_tag LOCUS_10930 20054 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 20367 21290 gene locus_tag LOCUS_10940 20367 21290 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_10940 21868 21942 gene locus_tag LOCUS_t00150 21868 21942 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22042 22118 gene locus_tag LOCUS_t00160 22042 22118 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22436 23044 gene locus_tag LOCUS_10950 gene purN 22436 23044 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV6 protein_id gnl|my_center|LOCUS_10950 23282 27130 gene locus_tag LOCUS_10960 23282 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 27782 27246 gene locus_tag LOCUS_10970 27782 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 28038 29555 gene locus_tag LOCUS_10980 28038 29555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 29709 30785 gene locus_tag LOCUS_10990 29709 30785 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_10990 36439 31112 gene locus_tag LOCUS_11000 36439 31112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 37177 41265 gene locus_tag LOCUS_11010 37177 41265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 41787 41356 gene locus_tag LOCUS_11020 41787 41356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 42037 44088 gene locus_tag LOCUS_11030 42037 44088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 45630 44311 gene locus_tag LOCUS_11040 45630 44311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 46561 45965 gene locus_tag LOCUS_11050 46561 45965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 48168 46966 gene locus_tag LOCUS_11060 48168 46966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 48672 48226 gene locus_tag LOCUS_11070 48672 48226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 49379 48684 gene locus_tag LOCUS_11080 gene purQ 49379 48684 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_11080 51219 49819 gene locus_tag LOCUS_11090 51219 49819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 52011 51328 gene locus_tag LOCUS_11100 gene lolD 52011 51328 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_11100 53597 52143 gene locus_tag LOCUS_11110 53597 52143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 54363 53983 gene locus_tag LOCUS_11120 54363 53983 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_11120 57987 54604 gene locus_tag LOCUS_11130 57987 54604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 59453 58806 gene locus_tag LOCUS_11140 59453 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 60948 59611 gene locus_tag LOCUS_11150 60948 59611 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_11150 61311 61946 gene locus_tag LOCUS_11160 61311 61946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 63203 62007 gene locus_tag LOCUS_11170 gene mauG 63203 62007 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_11170 65522 63288 gene locus_tag LOCUS_11180 65522 63288 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_11180 67190 65850 gene locus_tag LOCUS_11190 gene norM 67190 65850 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_11190 68094 67345 gene locus_tag LOCUS_11200 68094 67345 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_11200 68455 69564 gene locus_tag LOCUS_11210 68455 69564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 71139 69703 gene locus_tag LOCUS_11220 71139 69703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 71626 72426 gene locus_tag LOCUS_11230 71626 72426 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_11230 72881 72711 gene locus_tag LOCUS_11240 72881 72711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 72844 74103 gene locus_tag LOCUS_11250 72844 74103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 74261 76102 gene locus_tag LOCUS_11260 gene glmS 74261 76102 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_11260 76445 77635 gene locus_tag LOCUS_11270 76445 77635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 78365 77736 gene locus_tag LOCUS_11280 78365 77736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_11280 78935 78447 gene locus_tag LOCUS_11290 78935 78447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 79645 81258 gene locus_tag LOCUS_11300 gene pckA2 79645 81258 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_11300 81503 83935 gene locus_tag LOCUS_11310 81503 83935 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_11310 83949 84398 gene locus_tag LOCUS_11320 83949 84398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 85476 84463 gene locus_tag LOCUS_11330 85476 84463 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_11330 85682 86461 gene locus_tag LOCUS_11340 85682 86461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 86630 87454 gene locus_tag LOCUS_11350 86630 87454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 88742 87588 gene locus_tag LOCUS_11360 gene recA 88742 87588 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_11360 89576 89196 gene locus_tag LOCUS_11370 89576 89196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 90084 89725 gene locus_tag LOCUS_11380 90084 89725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 90287 90114 gene locus_tag LOCUS_11390 90287 90114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 90205 90585 gene locus_tag LOCUS_11400 90205 90585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 90698 91111 gene locus_tag LOCUS_11410 90698 91111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 91224 92996 gene locus_tag LOCUS_11420 gene aspS 91224 92996 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_11420 93144 93596 gene locus_tag LOCUS_11430 93144 93596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 94902 93670 gene locus_tag LOCUS_11440 94902 93670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 96686 95226 gene locus_tag LOCUS_11450 96686 95226 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_11450 96864 97865 gene locus_tag LOCUS_11460 96864 97865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 98545 97895 gene locus_tag LOCUS_11470 98545 97895 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_11470 99128 98553 gene locus_tag LOCUS_11480 99128 98553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 100026 99247 gene locus_tag LOCUS_11490 100026 99247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 102101 100128 gene locus_tag LOCUS_11500 102101 100128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_11500 102421 102185 gene locus_tag LOCUS_11510 102421 102185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 102868 105153 gene locus_tag LOCUS_11520 102868 105153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence012 3232 2006 gene locus_tag LOCUS_11530 3232 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3447 3271 gene locus_tag LOCUS_11540 3447 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4913 3624 gene locus_tag LOCUS_11550 4913 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6363 5434 gene locus_tag LOCUS_11560 6363 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7820 6372 gene locus_tag LOCUS_11570 7820 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10238 8286 gene locus_tag LOCUS_11580 10238 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 10542 10763 gene locus_tag LOCUS_11590 10542 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10990 12615 gene locus_tag LOCUS_11600 10990 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 12821 14542 gene locus_tag LOCUS_11610 12821 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 15618 14596 gene locus_tag LOCUS_11620 15618 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 16331 15615 gene locus_tag LOCUS_11630 16331 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 16820 17098 gene locus_tag LOCUS_11640 16820 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 19643 17169 gene locus_tag LOCUS_11650 gene pheT 19643 17169 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_11650 20636 19809 gene locus_tag LOCUS_11660 20636 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 21164 20640 gene locus_tag LOCUS_11670 21164 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 22611 21472 gene locus_tag LOCUS_11680 22611 21472 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066518.1 protein_id gnl|my_center|LOCUS_11680 22814 23017 gene locus_tag LOCUS_11690 22814 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 23612 23124 gene locus_tag LOCUS_11700 23612 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 24832 23792 gene locus_tag LOCUS_11710 gene ltaE 24832 23792 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_11710 25474 24842 gene locus_tag LOCUS_11720 25474 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 25693 26862 gene locus_tag LOCUS_11730 25693 26862 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_11730 28925 27174 gene locus_tag LOCUS_11740 28925 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 29322 31460 gene locus_tag LOCUS_11750 gene dnaG 29322 31460 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_11750 31735 32112 gene locus_tag LOCUS_11760 31735 32112 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_11760 33307 32234 gene locus_tag LOCUS_11770 33307 32234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 34570 33362 gene locus_tag LOCUS_11780 34570 33362 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_11780 34754 35470 gene locus_tag LOCUS_11790 34754 35470 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_11790 35460 36152 gene locus_tag LOCUS_11800 35460 36152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 36177 36746 gene locus_tag LOCUS_11810 36177 36746 CDS product quinolone resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 protein_id gnl|my_center|LOCUS_11810 37288 36977 gene locus_tag LOCUS_11820 37288 36977 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_11820 37750 39510 gene locus_tag LOCUS_11830 37750 39510 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_11830 39976 39563 gene locus_tag LOCUS_11840 39976 39563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 40495 40091 gene locus_tag LOCUS_11850 gene apaG 40495 40091 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_11850 40666 41328 gene locus_tag LOCUS_11860 gene ung2 40666 41328 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_11860 41813 41514 gene locus_tag LOCUS_11870 41813 41514 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_11870 45858 41926 gene locus_tag LOCUS_11880 45858 41926 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891879.1 protein_id gnl|my_center|LOCUS_11880 46174 46461 gene locus_tag LOCUS_11890 gene groS 46174 46461 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_11890 46639 48285 gene locus_tag LOCUS_11900 gene groL 46639 48285 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF02 protein_id gnl|my_center|LOCUS_11900 48895 48563 gene locus_tag LOCUS_11910 48895 48563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 49961 49383 gene locus_tag LOCUS_11920 49961 49383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_11920 50683 49991 gene locus_tag LOCUS_11930 50683 49991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 51666 50713 gene locus_tag LOCUS_11940 51666 50713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 52821 51895 gene locus_tag LOCUS_11950 52821 51895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_11950 54433 52895 gene locus_tag LOCUS_11960 54433 52895 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327292.1 protein_id gnl|my_center|LOCUS_11960 57207 54568 gene locus_tag LOCUS_11970 57207 54568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 57938 57603 gene locus_tag LOCUS_11980 57938 57603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 58056 58517 gene locus_tag LOCUS_11990 58056 58517 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_11990 58721 59260 gene locus_tag LOCUS_12000 58721 59260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 59333 59617 gene locus_tag LOCUS_12010 59333 59617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 60255 59563 gene locus_tag LOCUS_12020 60255 59563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 61540 60266 gene locus_tag LOCUS_12030 61540 60266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 64390 61622 gene locus_tag LOCUS_12040 64390 61622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 66248 65607 gene locus_tag LOCUS_12050 66248 65607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_12050 66830 66360 gene locus_tag LOCUS_12060 66830 66360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963612.1 protein_id gnl|my_center|LOCUS_12060 69131 66951 gene locus_tag LOCUS_12070 69131 66951 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_12070 69503 70372 gene locus_tag LOCUS_12080 69503 70372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_12080 71005 71523 gene locus_tag LOCUS_12090 71005 71523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_12090 71548 71925 gene locus_tag LOCUS_12100 71548 71925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_12100 73408 72077 gene locus_tag LOCUS_12110 73408 72077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 73591 73773 gene locus_tag LOCUS_12120 73591 73773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 74415 84434 gene locus_tag LOCUS_12130 74415 84434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 85489 84515 gene locus_tag LOCUS_12140 85489 84515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 86561 85635 gene locus_tag LOCUS_12150 86561 85635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 87692 87078 gene locus_tag LOCUS_12160 gene yoaA 87692 87078 CDS product putative N-acetyltransferase YoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34569 protein_id gnl|my_center|LOCUS_12160 89927 88047 gene locus_tag LOCUS_12170 89927 88047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 91888 89978 gene locus_tag LOCUS_12180 91888 89978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 92473 92009 gene locus_tag LOCUS_12190 92473 92009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 93365 92673 gene locus_tag LOCUS_12200 93365 92673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 93996 93823 gene locus_tag LOCUS_12210 93996 93823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 94052 94789 gene locus_tag LOCUS_12220 94052 94789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 94936 96621 gene locus_tag LOCUS_12230 94936 96621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 96862 98076 gene locus_tag LOCUS_12240 gene aspC1 96862 98076 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_12240 98468 100909 gene locus_tag LOCUS_12250 98468 100909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence013 5110 4373 gene locus_tag LOCUS_12260 gene lytT 5110 4373 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_12260 5649 5287 gene locus_tag LOCUS_12270 5649 5287 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_12270 9003 5815 gene locus_tag LOCUS_12280 9003 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10495 9191 gene locus_tag LOCUS_12290 10495 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_12290 10711 11559 gene locus_tag LOCUS_12300 gene pyrF 10711 11559 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_12300 11657 12799 gene locus_tag LOCUS_12310 11657 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13150 14343 gene locus_tag LOCUS_12320 gene porV 13150 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_12320 14631 15782 gene locus_tag LOCUS_12330 14631 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403960.1 protein_id gnl|my_center|LOCUS_12330 16552 16085 gene locus_tag LOCUS_12340 16552 16085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_12340 16751 17236 gene locus_tag LOCUS_12350 16751 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 17306 17734 gene locus_tag LOCUS_12360 17306 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 18303 17758 gene locus_tag LOCUS_12370 18303 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 22634 18462 gene locus_tag LOCUS_12380 22634 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 23655 25160 gene locus_tag LOCUS_12390 23655 25160 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_12390 25452 25814 gene locus_tag LOCUS_12400 25452 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 26635 26117 gene locus_tag LOCUS_12410 26635 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_12410 27924 26809 gene locus_tag LOCUS_12420 27924 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 28179 29264 gene locus_tag LOCUS_12430 gene nuoH 28179 29264 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_12430 29567 29265 gene locus_tag LOCUS_12440 29567 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 29769 30425 gene locus_tag LOCUS_12450 29769 30425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 30544 32613 gene locus_tag LOCUS_12460 30544 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 34825 32672 gene locus_tag LOCUS_12470 34825 32672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 35142 36107 gene locus_tag LOCUS_12480 35142 36107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 36110 36337 gene locus_tag LOCUS_12490 36110 36337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 36363 37061 gene locus_tag LOCUS_12500 36363 37061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 40015 37073 gene locus_tag LOCUS_12510 40015 37073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 41627 40452 gene locus_tag LOCUS_12520 41627 40452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 42995 41811 gene locus_tag LOCUS_12530 42995 41811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 44294 43293 gene locus_tag LOCUS_12540 gene nrdB 44294 43293 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_12540 44705 45271 gene locus_tag LOCUS_12550 44705 45271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 45789 45358 gene locus_tag LOCUS_12560 45789 45358 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_12560 46080 46847 gene locus_tag LOCUS_12570 46080 46847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 47052 49271 gene locus_tag LOCUS_12580 47052 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 49605 53462 gene locus_tag LOCUS_12590 49605 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 53991 53644 gene locus_tag LOCUS_12600 gene phnA 53991 53644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914988.1 protein_id gnl|my_center|LOCUS_12600 54627 55808 gene locus_tag LOCUS_12610 54627 55808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_12610 55950 56351 gene locus_tag LOCUS_12620 55950 56351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 58503 56446 gene locus_tag LOCUS_12630 58503 56446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_12630 58865 59476 gene locus_tag LOCUS_12640 58865 59476 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_12640 59573 60901 gene locus_tag LOCUS_12650 59573 60901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 61921 61061 gene locus_tag LOCUS_12660 61921 61061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 62454 63626 gene locus_tag LOCUS_12670 62454 63626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 63619 64272 gene locus_tag LOCUS_12680 63619 64272 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_12680 64383 66116 gene locus_tag LOCUS_12690 64383 66116 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_12690 66223 67500 gene locus_tag LOCUS_12700 66223 67500 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_12700 67736 71011 gene locus_tag LOCUS_12710 67736 71011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 71063 72073 gene locus_tag LOCUS_12720 71063 72073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 72154 73446 gene locus_tag LOCUS_12730 72154 73446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 73800 73519 gene locus_tag LOCUS_12740 73800 73519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_12740 74790 73897 gene locus_tag LOCUS_12750 74790 73897 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_12750 75040 74966 gene locus_tag LOCUS_t00170 75040 74966 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 75579 76616 gene locus_tag LOCUS_12760 75579 76616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263489.1 protein_id gnl|my_center|LOCUS_12760 76619 77542 gene locus_tag LOCUS_12770 76619 77542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 78241 79242 gene locus_tag LOCUS_12780 gene bioB 78241 79242 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_12780 79247 79381 gene locus_tag LOCUS_12790 79247 79381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 79350 79718 gene locus_tag LOCUS_12800 79350 79718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 80172 79957 gene locus_tag LOCUS_12810 80172 79957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 80791 80189 gene locus_tag LOCUS_12820 80791 80189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_12820 81302 80949 gene locus_tag LOCUS_12830 81302 80949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 82182 81472 gene locus_tag LOCUS_12840 82182 81472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 82877 82314 gene locus_tag LOCUS_12850 82877 82314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 83513 82965 gene locus_tag LOCUS_12860 83513 82965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 83685 84341 gene locus_tag LOCUS_12870 gene trmB 83685 84341 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_12870 90867 84712 gene locus_tag LOCUS_12880 90867 84712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 91016 91990 gene locus_tag LOCUS_12890 91016 91990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 92040 92648 gene locus_tag LOCUS_12900 92040 92648 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_12900 93088 96009 gene locus_tag LOCUS_12910 93088 96009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404331.1 protein_id gnl|my_center|LOCUS_12910 96116 97864 gene locus_tag LOCUS_12920 96116 97864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_12920 98369 97953 gene locus_tag LOCUS_12930 98369 97953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 99402 98950 gene locus_tag LOCUS_12940 99402 98950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 99778 100416 gene locus_tag LOCUS_12950 99778 100416 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_12950 100634 101674 gene locus_tag LOCUS_12960 100634 101674 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_12960 103448 101805 gene locus_tag LOCUS_12970 103448 101805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 104244 103876 gene locus_tag LOCUS_12980 104244 103876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence014 275 616 gene locus_tag LOCUS_12990 275 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 616 828 gene locus_tag LOCUS_13000 616 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 939 1331 gene locus_tag LOCUS_13010 939 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1809 1396 gene locus_tag LOCUS_13020 1809 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_13020 3420 1900 gene locus_tag LOCUS_13030 gene aldA 3420 1900 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_13030 3687 4646 gene locus_tag LOCUS_13040 3687 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6157 4730 gene locus_tag LOCUS_13050 6157 4730 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061566.1 protein_id gnl|my_center|LOCUS_13050 6228 7364 gene locus_tag LOCUS_13060 6228 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_13060 8215 7499 gene locus_tag LOCUS_13070 8215 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 8339 9682 gene locus_tag LOCUS_13080 8339 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9749 10282 gene locus_tag LOCUS_13090 9749 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 10306 10653 gene locus_tag LOCUS_13100 10306 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 10982 10788 gene locus_tag LOCUS_13110 10982 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 12081 11170 gene locus_tag LOCUS_13120 12081 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_13120 12812 12201 gene locus_tag LOCUS_13130 12812 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963179.1 protein_id gnl|my_center|LOCUS_13130 13107 12802 gene locus_tag LOCUS_13140 13107 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 14734 13121 gene locus_tag LOCUS_13150 14734 13121 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 protein_id gnl|my_center|LOCUS_13150 15972 14803 gene locus_tag LOCUS_13160 15972 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 17404 16007 gene locus_tag LOCUS_13170 17404 16007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_13170 17676 18452 gene locus_tag LOCUS_13180 gene dltE 17676 18452 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_13180 18486 20114 gene locus_tag LOCUS_13190 18486 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 20201 20608 gene locus_tag LOCUS_13200 20201 20608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 21546 20836 gene locus_tag LOCUS_13210 21546 20836 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_13210 21778 22878 gene locus_tag LOCUS_13220 21778 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 23184 24557 gene locus_tag LOCUS_13230 23184 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 25176 24604 gene locus_tag LOCUS_13240 25176 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 25498 27681 gene locus_tag LOCUS_13250 gene glnA 25498 27681 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_13250 27831 30056 gene locus_tag LOCUS_13260 27831 30056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 30925 30155 gene locus_tag LOCUS_13270 30925 30155 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_13270 33041 31110 gene locus_tag LOCUS_13280 gene parE 33041 31110 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_13280 33606 34502 gene locus_tag LOCUS_13290 33606 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 34568 37051 gene locus_tag LOCUS_13300 34568 37051 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_13300 37054 37800 gene locus_tag LOCUS_13310 37054 37800 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_13310 38042 39322 gene locus_tag LOCUS_13320 gene citC 38042 39322 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT9 protein_id gnl|my_center|LOCUS_13320 39570 40136 gene locus_tag LOCUS_13330 39570 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 41316 40276 gene locus_tag LOCUS_13340 gene aguA 41316 40276 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_13340 41581 42327 gene locus_tag LOCUS_13350 41581 42327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 42344 43234 gene locus_tag LOCUS_13360 42344 43234 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_13360 43376 44149 gene locus_tag LOCUS_13370 43376 44149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 44413 45189 gene locus_tag LOCUS_13380 44413 45189 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_13380 47102 45303 gene locus_tag LOCUS_13390 47102 45303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 49111 47201 gene locus_tag LOCUS_13400 49111 47201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 50039 51208 gene locus_tag LOCUS_13410 50039 51208 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108198.1 protein_id gnl|my_center|LOCUS_13410 52526 51360 gene locus_tag LOCUS_13420 52526 51360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 52994 52620 gene locus_tag LOCUS_13430 52994 52620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 53365 53069 gene locus_tag LOCUS_13440 53365 53069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 53558 53370 gene locus_tag LOCUS_13450 53558 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 54014 53607 gene locus_tag LOCUS_13460 54014 53607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 54452 54027 gene locus_tag LOCUS_13470 54452 54027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 54853 54455 gene locus_tag LOCUS_13480 54853 54455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 55174 54869 gene locus_tag LOCUS_13490 55174 54869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 57021 55171 gene locus_tag LOCUS_13500 57021 55171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 57593 57081 gene locus_tag LOCUS_13510 57593 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 58313 57612 gene locus_tag LOCUS_13520 58313 57612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 58990 58283 gene locus_tag LOCUS_13530 58990 58283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 59763 59062 gene locus_tag LOCUS_13540 59763 59062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 60209 59820 gene locus_tag LOCUS_13550 60209 59820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 60448 60182 gene locus_tag LOCUS_13560 60448 60182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 60962 60450 gene locus_tag LOCUS_13570 60962 60450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 61789 60974 gene locus_tag LOCUS_13580 61789 60974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 62008 61859 gene locus_tag LOCUS_13590 62008 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 63149 62400 gene locus_tag LOCUS_13600 63149 62400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 63781 63146 gene locus_tag LOCUS_13610 63781 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 64055 63792 gene locus_tag LOCUS_13620 64055 63792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 64713 64018 gene locus_tag LOCUS_13630 64713 64018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 65116 64670 gene locus_tag LOCUS_13640 65116 64670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 65586 65116 gene locus_tag LOCUS_13650 65586 65116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 66264 65599 gene locus_tag LOCUS_13660 66264 65599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 67260 66526 gene locus_tag LOCUS_13670 67260 66526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 68270 67257 gene locus_tag LOCUS_13680 68270 67257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 68352 68585 gene locus_tag LOCUS_13690 68352 68585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 68754 69077 gene locus_tag LOCUS_13700 68754 69077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 69096 69776 gene locus_tag LOCUS_13710 69096 69776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087768.1 protein_id gnl|my_center|LOCUS_13710 70132 69725 gene locus_tag LOCUS_13720 70132 69725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 71720 70347 gene locus_tag LOCUS_13730 71720 70347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 72158 71955 gene locus_tag LOCUS_13740 72158 71955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 72448 72155 gene locus_tag LOCUS_13750 72448 72155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 73437 72445 gene locus_tag LOCUS_13760 73437 72445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 74180 73692 gene locus_tag LOCUS_13770 74180 73692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 74466 74161 gene locus_tag LOCUS_13780 74466 74161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 74707 74459 gene locus_tag LOCUS_13790 74707 74459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 74877 74710 gene locus_tag LOCUS_13800 74877 74710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 75159 74911 gene locus_tag LOCUS_13810 75159 74911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 75342 75184 gene locus_tag LOCUS_13820 75342 75184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 75524 75348 gene locus_tag LOCUS_13830 75524 75348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 75738 75499 gene locus_tag LOCUS_13840 75738 75499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 75945 76439 gene locus_tag LOCUS_13850 75945 76439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 77143 76667 gene locus_tag LOCUS_13860 77143 76667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 78637 77204 gene locus_tag LOCUS_13870 78637 77204 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_13870 79145 78690 gene locus_tag LOCUS_13880 79145 78690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 80308 79178 gene locus_tag LOCUS_13890 80308 79178 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_13890 80749 80459 gene locus_tag LOCUS_13900 80749 80459 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_13900 81521 80904 gene locus_tag LOCUS_13910 81521 80904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 81861 81508 gene locus_tag LOCUS_13920 81861 81508 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_13920 82601 82008 gene locus_tag LOCUS_13930 82601 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 83052 83762 gene locus_tag LOCUS_13940 83052 83762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 83858 84421 gene locus_tag LOCUS_13950 83858 84421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 85384 84521 gene locus_tag LOCUS_13960 gene mvaB 85384 84521 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_13960 85895 87898 gene locus_tag LOCUS_13970 85895 87898 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_13970 88544 87915 gene locus_tag LOCUS_13980 88544 87915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 90241 88805 gene locus_tag LOCUS_13990 90241 88805 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252784.1 protein_id gnl|my_center|LOCUS_13990 90525 90241 gene locus_tag LOCUS_14000 90525 90241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 93078 90934 gene locus_tag LOCUS_14010 gene ptrB 93078 90934 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_14010 93459 93145 gene locus_tag LOCUS_14020 93459 93145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 93700 93497 gene locus_tag LOCUS_14030 93700 93497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 94037 93657 gene locus_tag LOCUS_14040 94037 93657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 94435 94247 gene locus_tag LOCUS_14050 94435 94247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 94702 94445 gene locus_tag LOCUS_14060 94702 94445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 95201 94896 gene locus_tag LOCUS_14070 gene rpsJ 95201 94896 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_14070 97572 95425 gene locus_tag LOCUS_14080 gene fusA 97572 95425 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A474 protein_id gnl|my_center|LOCUS_14080 98362 97880 gene locus_tag LOCUS_14090 gene rpsG 98362 97880 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_14090 98984 98577 gene locus_tag LOCUS_14100 gene rpsL 98984 98577 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK4 protein_id gnl|my_center|LOCUS_14100 99237 99034 gene locus_tag LOCUS_14110 99237 99034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 99425 101305 gene locus_tag LOCUS_14120 99425 101305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence015 743 486 gene locus_tag LOCUS_14130 743 486 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_14130 1058 4369 gene locus_tag LOCUS_14140 1058 4369 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_14140 5137 5610 gene locus_tag LOCUS_14150 5137 5610 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_14150 6324 5647 gene locus_tag LOCUS_14160 6324 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7551 6664 gene locus_tag LOCUS_14170 gene rpsC 7551 6664 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_14170 8010 7567 gene locus_tag LOCUS_14180 8010 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8340 8059 gene locus_tag LOCUS_14190 gene rpsS 8340 8059 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_14190 9176 8343 gene locus_tag LOCUS_14200 gene rplB 9176 8343 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_14200 9958 9653 gene locus_tag LOCUS_14210 gene rplW 9958 9653 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F1Z2 protein_id gnl|my_center|LOCUS_14210 10618 9992 gene locus_tag LOCUS_14220 gene rplD 10618 9992 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_14220 11415 10780 gene locus_tag LOCUS_14230 gene rplC 11415 10780 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_14230 12997 11936 gene locus_tag LOCUS_14240 12997 11936 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_14240 15387 13567 gene locus_tag LOCUS_14250 15387 13567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_14250 19321 15833 gene locus_tag LOCUS_14260 19321 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 23370 19393 gene locus_tag LOCUS_14270 23370 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 24066 23476 gene locus_tag LOCUS_14280 24066 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_14280 25084 24137 gene locus_tag LOCUS_14290 25084 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_14290 26509 25229 gene locus_tag LOCUS_14300 gene hutI 26509 25229 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_14300 29245 26567 gene locus_tag LOCUS_14310 29245 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 30466 29276 gene locus_tag LOCUS_14320 30466 29276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 31578 30562 gene locus_tag LOCUS_14330 31578 30562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 32697 31702 gene locus_tag LOCUS_14340 gene purC 32697 31702 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_14340 33279 33890 gene locus_tag LOCUS_14350 33279 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_14350 34007 35491 gene locus_tag LOCUS_14360 34007 35491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122321.1 protein_id gnl|my_center|LOCUS_14360 35492 36241 gene locus_tag LOCUS_14370 35492 36241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553740.1 protein_id gnl|my_center|LOCUS_14370 37637 36396 gene locus_tag LOCUS_14380 37637 36396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 37755 37958 gene locus_tag LOCUS_14390 37755 37958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 38621 37923 gene locus_tag LOCUS_14400 gene npdA 38621 37923 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_14400 39001 40266 gene locus_tag LOCUS_14410 gene mscS2 39001 40266 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_14410 40347 41123 gene locus_tag LOCUS_14420 40347 41123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 42157 41060 gene locus_tag LOCUS_14430 gene hpaIIM 42157 41060 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1V6 protein_id gnl|my_center|LOCUS_14430 43347 42190 gene locus_tag LOCUS_14440 43347 42190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 43508 44332 gene locus_tag LOCUS_14450 43508 44332 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 protein_id gnl|my_center|LOCUS_14450 45612 47960 gene locus_tag LOCUS_14460 45612 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 48246 49022 gene locus_tag LOCUS_14470 48246 49022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 49019 50086 gene locus_tag LOCUS_14480 49019 50086 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_14480 51538 50324 gene locus_tag LOCUS_14490 51538 50324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 52367 51603 gene locus_tag LOCUS_14500 52367 51603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 53367 52405 gene locus_tag LOCUS_14510 53367 52405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 54464 53748 gene locus_tag LOCUS_14520 54464 53748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 54733 57111 gene locus_tag LOCUS_14530 54733 57111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_14530 57121 57522 gene locus_tag LOCUS_14540 57121 57522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 57553 58098 gene locus_tag LOCUS_14550 57553 58098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 58341 58775 gene locus_tag LOCUS_14560 58341 58775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_14560 58937 59185 gene locus_tag LOCUS_14570 58937 59185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 59195 59725 gene locus_tag LOCUS_14580 59195 59725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 59922 61076 gene locus_tag LOCUS_14590 59922 61076 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_14590 63348 61135 gene locus_tag LOCUS_14600 63348 61135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 64149 63550 gene locus_tag LOCUS_14610 64149 63550 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_14610 65436 64315 gene locus_tag LOCUS_14620 65436 64315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 66516 65554 gene locus_tag LOCUS_14630 66516 65554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 66807 67607 gene locus_tag LOCUS_14640 gene proC 66807 67607 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 protein_id gnl|my_center|LOCUS_14640 67726 68646 gene locus_tag LOCUS_14650 67726 68646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 68787 69971 gene locus_tag LOCUS_14660 gene pdxA 68787 69971 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_14660 70208 72250 gene locus_tag LOCUS_14670 70208 72250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 72374 74221 gene locus_tag LOCUS_14680 72374 74221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_14680 74818 75810 gene locus_tag LOCUS_14690 74818 75810 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_14690 76568 75927 gene locus_tag LOCUS_14700 76568 75927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 77164 80301 gene locus_tag LOCUS_14710 77164 80301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 80465 83902 gene locus_tag LOCUS_14720 80465 83902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 84174 85178 gene locus_tag LOCUS_14730 gene miaA 84174 85178 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_14730 85814 85284 gene locus_tag LOCUS_14740 gene ppa 85814 85284 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_14740 90265 85982 gene locus_tag LOCUS_14750 90265 85982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 90492 91334 gene locus_tag LOCUS_14760 90492 91334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_14760 91446 92225 gene locus_tag LOCUS_14770 91446 92225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_14770 93310 92387 gene locus_tag LOCUS_14780 93310 92387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 93979 95385 gene locus_tag LOCUS_14790 93979 95385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 96104 95604 gene locus_tag LOCUS_14800 96104 95604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence016 1019 51 gene locus_tag LOCUS_14810 1019 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1277 2788 gene locus_tag LOCUS_14820 gene cysS 1277 2788 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_14820 4927 2849 gene locus_tag LOCUS_14830 4927 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5362 5985 gene locus_tag LOCUS_14840 5362 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 7282 6089 gene locus_tag LOCUS_14850 7282 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 7437 8114 gene locus_tag LOCUS_14860 7437 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8964 8209 gene locus_tag LOCUS_14870 8964 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 9351 10565 gene locus_tag LOCUS_14880 9351 10565 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_14880 12759 10624 gene locus_tag LOCUS_14890 12759 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14455 13043 gene locus_tag LOCUS_14900 14455 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14729 15556 gene locus_tag LOCUS_14910 14729 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_14910 15599 16390 gene locus_tag LOCUS_14920 15599 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 17011 16406 gene locus_tag LOCUS_14930 17011 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 18371 17127 gene locus_tag LOCUS_14940 gene trpB 18371 17127 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_14940 18844 20520 gene locus_tag LOCUS_14950 gene speE1 18844 20520 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_14950 20653 21288 gene locus_tag LOCUS_14960 20653 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_14960 21767 21333 gene locus_tag LOCUS_14970 21767 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 22894 21818 gene locus_tag LOCUS_14980 gene prfA 22894 21818 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y2 protein_id gnl|my_center|LOCUS_14980 23038 23508 gene locus_tag LOCUS_14990 23038 23508 CDS product aminoalkylphosphonic acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095101.1 protein_id gnl|my_center|LOCUS_14990 23789 24499 gene locus_tag LOCUS_15000 23789 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 26631 24613 gene locus_tag LOCUS_15010 26631 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_15010 28254 26794 gene locus_tag LOCUS_15020 gene putA 28254 26794 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_15020 28330 29193 gene locus_tag LOCUS_15030 28330 29193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 30167 29205 gene locus_tag LOCUS_15040 30167 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 30433 30164 gene locus_tag LOCUS_15050 30433 30164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 30962 30435 gene locus_tag LOCUS_15060 30962 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 32012 30978 gene locus_tag LOCUS_15070 32012 30978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 32926 32030 gene locus_tag LOCUS_15080 32926 32030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 33087 33665 gene locus_tag LOCUS_15090 33087 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170923.1 protein_id gnl|my_center|LOCUS_15090 33794 34090 gene locus_tag LOCUS_15100 33794 34090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 34611 34156 gene locus_tag LOCUS_15110 34611 34156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 36401 34773 gene locus_tag LOCUS_15120 36401 34773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986453.1 protein_id gnl|my_center|LOCUS_15120 37117 36431 gene locus_tag LOCUS_15130 37117 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 37208 38323 gene locus_tag LOCUS_15140 37208 38323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_15140 38453 38854 gene locus_tag LOCUS_15150 38453 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 39067 39780 gene locus_tag LOCUS_15160 39067 39780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 39886 40944 gene locus_tag LOCUS_15170 39886 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 42760 41015 gene locus_tag LOCUS_15180 42760 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 43058 44308 gene locus_tag LOCUS_15190 gene rocD 43058 44308 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_15190 47012 44406 gene locus_tag LOCUS_15200 47012 44406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 47358 49706 gene locus_tag LOCUS_15210 47358 49706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 50146 50862 gene locus_tag LOCUS_15220 50146 50862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 52393 51347 gene locus_tag LOCUS_15230 52393 51347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_15230 53462 52386 gene locus_tag LOCUS_15240 53462 52386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 53982 54560 gene locus_tag LOCUS_15250 53982 54560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 54714 55178 gene locus_tag LOCUS_15260 54714 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 55403 56875 gene locus_tag LOCUS_15270 gene murE 55403 56875 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_15270 56945 57358 gene locus_tag LOCUS_15280 56945 57358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 58023 57379 gene locus_tag LOCUS_15290 58023 57379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 58190 58609 gene locus_tag LOCUS_15300 58190 58609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 58673 59275 gene locus_tag LOCUS_15310 58673 59275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 59929 59393 gene locus_tag LOCUS_15320 gene hslV 59929 59393 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 protein_id gnl|my_center|LOCUS_15320 60767 60003 gene locus_tag LOCUS_15330 gene lptB 60767 60003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_15330 61232 60879 gene locus_tag LOCUS_15340 61232 60879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 61623 61249 gene locus_tag LOCUS_15350 61623 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 62487 61663 gene locus_tag LOCUS_15360 62487 61663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 63192 62614 gene locus_tag LOCUS_15370 gene gmhA 63192 62614 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_15370 64146 63208 gene locus_tag LOCUS_15380 64146 63208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 64286 65017 gene locus_tag LOCUS_15390 64286 65017 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_15390 65210 65443 gene locus_tag LOCUS_15400 65210 65443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 65522 66739 gene locus_tag LOCUS_15410 65522 66739 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_15410 69128 66795 gene locus_tag LOCUS_15420 69128 66795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 70368 69427 gene locus_tag LOCUS_15430 70368 69427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 70951 70577 gene locus_tag LOCUS_15440 70951 70577 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_15440 71299 72156 gene locus_tag LOCUS_15450 71299 72156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 72159 72767 gene locus_tag LOCUS_15460 72159 72767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 72794 73246 gene locus_tag LOCUS_15470 72794 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 73319 73858 gene locus_tag LOCUS_15480 73319 73858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 73961 75361 gene locus_tag LOCUS_15490 gene fumC 73961 75361 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_15490 75542 76477 gene locus_tag LOCUS_15500 75542 76477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 76607 77884 gene locus_tag LOCUS_15510 gene lysC 76607 77884 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_15510 78283 77942 gene locus_tag LOCUS_15520 78283 77942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 78520 78284 gene locus_tag LOCUS_15530 78520 78284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_15530 78666 79400 gene locus_tag LOCUS_15540 78666 79400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 79543 79836 gene locus_tag LOCUS_15550 79543 79836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 80382 81545 gene locus_tag LOCUS_15560 80382 81545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 81726 82433 gene locus_tag LOCUS_15570 81726 82433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 82676 83602 gene locus_tag LOCUS_15580 gene prsA 82676 83602 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_15580 85040 83937 gene locus_tag LOCUS_15590 85040 83937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_15590 85700 85125 gene locus_tag LOCUS_15600 85700 85125 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_15600 89371 85847 gene locus_tag LOCUS_15610 89371 85847 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_15610 90623 89460 gene locus_tag LOCUS_15620 90623 89460 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_15620 92114 90774 gene locus_tag LOCUS_15630 92114 90774 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_15630 92939 92244 gene locus_tag LOCUS_15640 92939 92244 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_15640 94750 93887 gene locus_tag LOCUS_15650 94750 93887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 95241 95582 gene locus_tag LOCUS_15660 95241 95582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 95937 95731 gene locus_tag LOCUS_15670 95937 95731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 95994 96263 gene locus_tag LOCUS_15680 95994 96263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence017 958 227 gene locus_tag LOCUS_15690 958 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1722 955 gene locus_tag LOCUS_15700 1722 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2131 1730 gene locus_tag LOCUS_15710 2131 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2338 2138 gene locus_tag LOCUS_15720 2338 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4078 2396 gene locus_tag LOCUS_15730 4078 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_15730 4689 5735 gene locus_tag LOCUS_15740 4689 5735 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_15740 7427 5901 gene locus_tag LOCUS_15750 7427 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7631 8998 gene locus_tag LOCUS_15760 7631 8998 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_15760 9177 10061 gene locus_tag LOCUS_15770 gene dapF 9177 10061 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_15770 10112 12202 gene locus_tag LOCUS_15780 10112 12202 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_15780 12391 12936 gene locus_tag LOCUS_15790 12391 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12998 13768 gene locus_tag LOCUS_15800 12998 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 14107 14616 gene locus_tag LOCUS_15810 14107 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 15627 14653 gene locus_tag LOCUS_15820 15627 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 16800 15898 gene locus_tag LOCUS_15830 16800 15898 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_15830 17279 18730 gene locus_tag LOCUS_15840 17279 18730 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_15840 19821 18871 gene locus_tag LOCUS_15850 19821 18871 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_15850 20022 21143 gene locus_tag LOCUS_15860 20022 21143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_15860 22196 21270 gene locus_tag LOCUS_15870 22196 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 23777 22302 gene locus_tag LOCUS_15880 gene proS 23777 22302 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_15880 24673 24200 gene locus_tag LOCUS_15890 24673 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 25225 24833 gene locus_tag LOCUS_15900 25225 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 25528 25367 gene locus_tag LOCUS_15910 25528 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 25813 26937 gene locus_tag LOCUS_15920 25813 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 28198 27053 gene locus_tag LOCUS_15930 gene hisB 28198 27053 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_15930 28501 29697 gene locus_tag LOCUS_15940 28501 29697 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_15940 29816 31201 gene locus_tag LOCUS_15950 29816 31201 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_15950 31772 31242 gene locus_tag LOCUS_15960 gene folK 31772 31242 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_15960 33332 31878 gene locus_tag LOCUS_15970 33332 31878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 33818 35182 gene locus_tag LOCUS_15980 33818 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 35316 36200 gene locus_tag LOCUS_15990 35316 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 36978 36520 gene locus_tag LOCUS_16000 gene tadA 36978 36520 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 protein_id gnl|my_center|LOCUS_16000 37315 38028 gene locus_tag LOCUS_16010 37315 38028 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_16010 38152 38448 gene locus_tag LOCUS_16020 38152 38448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 38718 43343 gene locus_tag LOCUS_16030 38718 43343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 44164 43436 gene locus_tag LOCUS_16040 44164 43436 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_16040 44966 44703 gene locus_tag LOCUS_16050 44966 44703 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_16050 46234 45110 gene locus_tag LOCUS_16060 46234 45110 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_16060 46720 46505 gene locus_tag LOCUS_16070 46720 46505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 47939 47013 gene locus_tag LOCUS_16080 47939 47013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 48109 49326 gene locus_tag LOCUS_16090 48109 49326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_16090 49630 49460 gene locus_tag LOCUS_16100 49630 49460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 50088 49645 gene locus_tag LOCUS_16110 50088 49645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 50441 51517 gene locus_tag LOCUS_16120 50441 51517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517778.1 protein_id gnl|my_center|LOCUS_16120 51692 52120 gene locus_tag LOCUS_16130 51692 52120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 52136 55768 gene locus_tag LOCUS_16140 52136 55768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 55792 56211 gene locus_tag LOCUS_16150 55792 56211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 56215 56640 gene locus_tag LOCUS_16160 56215 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 58809 56653 gene locus_tag LOCUS_16170 58809 56653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 59737 59213 gene locus_tag LOCUS_16180 59737 59213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 60680 60069 gene locus_tag LOCUS_16190 60680 60069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 61070 61327 gene locus_tag LOCUS_16200 61070 61327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 63677 61317 gene locus_tag LOCUS_16210 63677 61317 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_16210 63949 64266 gene locus_tag LOCUS_16220 63949 64266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 64694 66229 gene locus_tag LOCUS_16230 64694 66229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 66377 66856 gene locus_tag LOCUS_16240 66377 66856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 67057 68187 gene locus_tag LOCUS_16250 67057 68187 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7H0 protein_id gnl|my_center|LOCUS_16250 68884 69807 gene locus_tag LOCUS_16260 gene rsgA 68884 69807 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_16260 70368 69835 gene locus_tag LOCUS_16270 70368 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 72354 70489 gene locus_tag LOCUS_16280 72354 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 74186 72483 gene locus_tag LOCUS_16290 74186 72483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 74573 76594 gene locus_tag LOCUS_16300 74573 76594 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405148.1 protein_id gnl|my_center|LOCUS_16300 76612 77355 gene locus_tag LOCUS_16310 76612 77355 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_16310 79507 77444 gene locus_tag LOCUS_16320 79507 77444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 80981 79743 gene locus_tag LOCUS_16330 80981 79743 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_16330 82913 81114 gene locus_tag LOCUS_16340 82913 81114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 83383 84468 gene locus_tag LOCUS_16350 83383 84468 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405523.1 protein_id gnl|my_center|LOCUS_16350 84518 84865 gene locus_tag LOCUS_16360 84518 84865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 84914 85723 gene locus_tag LOCUS_16370 84914 85723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 85841 88291 gene locus_tag LOCUS_16380 85841 88291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 89171 88653 gene locus_tag LOCUS_16390 89171 88653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 89417 90397 gene locus_tag LOCUS_16400 89417 90397 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 protein_id gnl|my_center|LOCUS_16400 90842 90432 gene locus_tag LOCUS_16410 90842 90432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 91775 91029 gene locus_tag LOCUS_16420 gene phbB 91775 91029 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 protein_id gnl|my_center|LOCUS_16420 92382 94667 gene locus_tag LOCUS_16430 92382 94667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence018 388 1368 gene locus_tag LOCUS_16440 388 1368 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_16440 1969 1469 gene locus_tag LOCUS_16450 1969 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2305 2796 gene locus_tag LOCUS_16460 2305 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2884 5760 gene locus_tag LOCUS_16470 2884 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5769 6263 gene locus_tag LOCUS_16480 gene ndhJ 5769 6263 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC1 protein_id gnl|my_center|LOCUS_16480 7023 6286 gene locus_tag LOCUS_16490 7023 6286 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_16490 7607 7032 gene locus_tag LOCUS_16500 7607 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_16500 8207 7677 gene locus_tag LOCUS_16510 8207 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 11080 8654 gene locus_tag LOCUS_16520 11080 8654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_16520 11553 12209 gene locus_tag LOCUS_16530 gene trpF 11553 12209 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD7 protein_id gnl|my_center|LOCUS_16530 12788 12273 gene locus_tag LOCUS_16540 12788 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 14533 12932 gene locus_tag LOCUS_16550 14533 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 15319 14555 gene locus_tag LOCUS_16560 15319 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 15300 15452 gene locus_tag LOCUS_16570 15300 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 16039 15479 gene locus_tag LOCUS_16580 16039 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 15963 16130 gene locus_tag LOCUS_16590 15963 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 17004 16390 gene locus_tag LOCUS_16600 17004 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 18483 17014 gene locus_tag LOCUS_16610 18483 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 19080 18505 gene locus_tag LOCUS_16620 19080 18505 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_16620 19802 19200 gene locus_tag LOCUS_16630 19802 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 20333 19932 gene locus_tag LOCUS_16640 20333 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 20564 21907 gene locus_tag LOCUS_16650 gene purB 20564 21907 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_16650 22195 23460 gene locus_tag LOCUS_16660 22195 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 23608 24120 gene locus_tag LOCUS_16670 23608 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 24408 24746 gene locus_tag LOCUS_16680 gene ytxJ 24408 24746 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_16680 24874 26013 gene locus_tag LOCUS_16690 24874 26013 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_16690 27389 26361 gene locus_tag LOCUS_16700 27389 26361 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_16700 28985 27465 gene locus_tag LOCUS_16710 28985 27465 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_16710 29993 29142 gene locus_tag LOCUS_16720 29993 29142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 32556 30547 gene locus_tag LOCUS_16730 32556 30547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 33272 34681 gene locus_tag LOCUS_16740 33272 34681 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_16740 35430 34969 gene locus_tag LOCUS_16750 35430 34969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 35683 36450 gene locus_tag LOCUS_16760 35683 36450 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_16760 36956 36498 gene locus_tag LOCUS_16770 36956 36498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 38050 37046 gene locus_tag LOCUS_16780 38050 37046 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_16780 38298 40082 gene locus_tag LOCUS_16790 38298 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 40823 40164 gene locus_tag LOCUS_16800 gene pdxH 40823 40164 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_16800 41107 41862 gene locus_tag LOCUS_16810 41107 41862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_16810 42095 42598 gene locus_tag LOCUS_16820 42095 42598 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_16820 43182 42661 gene locus_tag LOCUS_16830 43182 42661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 43551 47237 gene locus_tag LOCUS_16840 43551 47237 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_16840 51794 47325 gene locus_tag LOCUS_16850 51794 47325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 53033 51960 gene locus_tag LOCUS_16860 53033 51960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 53537 53079 gene locus_tag LOCUS_16870 53537 53079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 55084 54101 gene locus_tag LOCUS_16880 55084 54101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 55367 56590 gene locus_tag LOCUS_16890 55367 56590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 56651 56998 gene locus_tag LOCUS_16900 56651 56998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 57929 57447 gene locus_tag LOCUS_16910 57929 57447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 58687 57947 gene locus_tag LOCUS_16920 58687 57947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_16920 59097 58699 gene locus_tag LOCUS_16930 59097 58699 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_16930 60578 59328 gene locus_tag LOCUS_16940 60578 59328 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_16940 61321 60710 gene locus_tag LOCUS_16950 61321 60710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 61473 62837 gene locus_tag LOCUS_16960 61473 62837 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_16960 64069 62975 gene locus_tag LOCUS_16970 64069 62975 CDS product CepA family class A extended-spectrum beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_16970 64221 66473 gene locus_tag LOCUS_16980 64221 66473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 66570 67397 gene locus_tag LOCUS_16990 66570 67397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 67403 69451 gene locus_tag LOCUS_17000 67403 69451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 70243 69488 gene locus_tag LOCUS_17010 70243 69488 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_17010 72057 70306 gene locus_tag LOCUS_17020 72057 70306 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_17020 73180 72164 gene locus_tag LOCUS_17030 73180 72164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 73382 74110 gene locus_tag LOCUS_17040 gene gldF 73382 74110 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_17040 74170 74691 gene locus_tag LOCUS_17050 74170 74691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 74743 75027 gene locus_tag LOCUS_17060 74743 75027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 75304 79209 gene locus_tag LOCUS_17070 75304 79209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 protein_id gnl|my_center|LOCUS_17070 79332 80285 gene locus_tag LOCUS_17080 79332 80285 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_17080 80838 80425 gene locus_tag LOCUS_17090 gene yqiW 80838 80425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_17090 81290 80916 gene locus_tag LOCUS_17100 81290 80916 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_17100 81769 81341 gene locus_tag LOCUS_17110 gene sufE 81769 81341 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_17110 81986 82309 gene locus_tag LOCUS_17120 81986 82309 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_17120 82412 82774 gene locus_tag LOCUS_17130 82412 82774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 82873 83949 gene locus_tag LOCUS_17140 82873 83949 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886668.1 protein_id gnl|my_center|LOCUS_17140 87158 84060 gene locus_tag LOCUS_17150 87158 84060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 87472 88767 gene locus_tag LOCUS_17160 87472 88767 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_17160 89040 88819 gene locus_tag LOCUS_17170 89040 88819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence019 1256 861 gene locus_tag LOCUS_17180 1256 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2858 1398 gene locus_tag LOCUS_17190 gene glcD 2858 1398 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_17190 3234 4031 gene locus_tag LOCUS_17200 3234 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4893 4060 gene locus_tag LOCUS_17210 4893 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4876 5862 gene locus_tag LOCUS_17220 gene mauG 4876 5862 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_17220 6192 5893 gene locus_tag LOCUS_17230 6192 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11584 6344 gene locus_tag LOCUS_17240 11584 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 11820 14012 gene locus_tag LOCUS_17250 11820 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 14743 14018 gene locus_tag LOCUS_17260 14743 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15260 15018 gene locus_tag LOCUS_17270 15260 15018 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H1 protein_id gnl|my_center|LOCUS_17270 15603 15923 gene locus_tag LOCUS_17280 15603 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 16093 18030 gene locus_tag LOCUS_17290 gene pepN 16093 18030 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_17290 18754 18377 gene locus_tag LOCUS_17300 18754 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 20248 19037 gene locus_tag LOCUS_17310 20248 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_17310 20999 20655 gene locus_tag LOCUS_17320 gene rplT 20999 20655 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_17320 21388 21191 gene locus_tag LOCUS_17330 gene rpmI 21388 21191 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_17330 22107 21673 gene locus_tag LOCUS_17340 22107 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 22826 22990 gene locus_tag LOCUS_17350 22826 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 22997 23485 gene locus_tag LOCUS_17360 22997 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 27099 23509 gene locus_tag LOCUS_17370 27099 23509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_17370 28023 27154 gene locus_tag LOCUS_17380 28023 27154 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_17380 28270 29469 gene locus_tag LOCUS_17390 28270 29469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 29551 30270 gene locus_tag LOCUS_17400 29551 30270 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_17400 31068 30607 gene locus_tag LOCUS_17410 31068 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 31278 31565 gene locus_tag LOCUS_17420 31278 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 31608 31913 gene locus_tag LOCUS_17430 31608 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 32073 33698 gene locus_tag LOCUS_17440 32073 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 34150 34920 gene locus_tag LOCUS_17450 34150 34920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 35168 36451 gene locus_tag LOCUS_17460 35168 36451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 36522 37364 gene locus_tag LOCUS_17470 36522 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 37430 38131 gene locus_tag LOCUS_17480 37430 38131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 38212 39471 gene locus_tag LOCUS_17490 38212 39471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 39719 41329 gene locus_tag LOCUS_17500 39719 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 41529 41398 gene locus_tag LOCUS_17510 41529 41398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 41884 42996 gene locus_tag LOCUS_17520 41884 42996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 46657 43235 gene locus_tag LOCUS_17530 46657 43235 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_17530 47983 46853 gene locus_tag LOCUS_17540 47983 46853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 48180 48106 gene locus_tag LOCUS_t00180 48180 48106 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48432 48881 gene locus_tag LOCUS_17550 gene bcp-1 48432 48881 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_17550 49007 49651 gene locus_tag LOCUS_17560 49007 49651 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_17560 49669 50058 gene locus_tag LOCUS_17570 49669 50058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 50207 51589 gene locus_tag LOCUS_17580 gene rtcB 50207 51589 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_17580 51869 52903 gene locus_tag LOCUS_17590 51869 52903 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_17590 53454 53062 gene locus_tag LOCUS_17600 53454 53062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_17600 54138 53545 gene locus_tag LOCUS_17610 54138 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_17610 54565 55215 gene locus_tag LOCUS_17620 54565 55215 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL4 protein_id gnl|my_center|LOCUS_17620 55387 56835 gene locus_tag LOCUS_17630 gene mnmE 55387 56835 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_17630 57484 56924 gene locus_tag LOCUS_17640 57484 56924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 58128 57586 gene locus_tag LOCUS_17650 58128 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 58416 58787 gene locus_tag LOCUS_17660 58416 58787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 58920 60740 gene locus_tag LOCUS_17670 58920 60740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 63690 61711 gene locus_tag LOCUS_17680 63690 61711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 64329 65861 gene locus_tag LOCUS_17690 64329 65861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 66447 65926 gene locus_tag LOCUS_17700 66447 65926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 66453 66779 gene locus_tag LOCUS_17710 66453 66779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 68208 66889 gene locus_tag LOCUS_17720 gene natB 68208 66889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_17720 68562 69626 gene locus_tag LOCUS_17730 68562 69626 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_17730 71333 69909 gene locus_tag LOCUS_17740 71333 69909 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_17740 71748 71666 gene locus_tag LOCUS_t00190 71748 71666 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72951 72091 gene locus_tag LOCUS_17750 72951 72091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 73680 73069 gene locus_tag LOCUS_17760 73680 73069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 74766 73813 gene locus_tag LOCUS_17770 74766 73813 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_17770 75059 75814 gene locus_tag LOCUS_17780 75059 75814 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_17780 75974 78406 gene locus_tag LOCUS_17790 75974 78406 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_17790 78723 79286 gene locus_tag LOCUS_17800 78723 79286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 79452 79727 gene locus_tag LOCUS_17810 79452 79727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 80959 79670 gene locus_tag LOCUS_17820 gene metK 80959 79670 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T6 protein_id gnl|my_center|LOCUS_17820 83444 81480 gene locus_tag LOCUS_17830 83444 81480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 83877 83545 gene locus_tag LOCUS_17840 83877 83545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence020 2417 579 gene locus_tag LOCUS_17850 2417 579 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_17850 3165 2692 gene locus_tag LOCUS_17860 3165 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3624 5411 gene locus_tag LOCUS_17870 gene argS 3624 5411 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_17870 5554 6969 gene locus_tag LOCUS_17880 5554 6969 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_17880 7063 7467 gene locus_tag LOCUS_17890 7063 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8464 7559 gene locus_tag LOCUS_17900 8464 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 9647 8625 gene locus_tag LOCUS_17910 9647 8625 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5W3 protein_id gnl|my_center|LOCUS_17910 9943 11019 gene locus_tag LOCUS_17920 gene fni 9943 11019 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_17920 11621 11082 gene locus_tag LOCUS_17930 11621 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 12203 13579 gene locus_tag LOCUS_17940 12203 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 13649 14179 gene locus_tag LOCUS_17950 gene nuoB 13649 14179 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_17950 14280 14789 gene locus_tag LOCUS_17960 14280 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 15060 15545 gene locus_tag LOCUS_17970 15060 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 17349 15676 gene locus_tag LOCUS_17980 17349 15676 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_17980 18351 17665 gene locus_tag LOCUS_17990 18351 17665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_17990 18605 19801 gene locus_tag LOCUS_18000 gene kbl 18605 19801 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_18000 20119 20658 gene locus_tag LOCUS_18010 20119 20658 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_18010 21065 23500 gene locus_tag LOCUS_18020 21065 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 23964 24824 gene locus_tag LOCUS_18030 23964 24824 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_18030 24952 25227 gene locus_tag LOCUS_18040 gene nuoK 24952 25227 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB6 protein_id gnl|my_center|LOCUS_18040 25324 26601 gene locus_tag LOCUS_18050 gene gstcD 25324 26601 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_18050 26667 27239 gene locus_tag LOCUS_18060 26667 27239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_18060 28889 27354 gene locus_tag LOCUS_18070 28889 27354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 29487 29651 gene locus_tag LOCUS_18080 29487 29651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 30318 35660 gene locus_tag LOCUS_18090 30318 35660 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_18090 35907 37745 gene locus_tag LOCUS_18100 35907 37745 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_18100 37827 39740 gene locus_tag LOCUS_18110 37827 39740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 40189 41421 gene locus_tag LOCUS_18120 40189 41421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_18120 41644 41432 gene locus_tag LOCUS_18130 41644 41432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 42954 41701 gene locus_tag LOCUS_18140 42954 41701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 43280 42951 gene locus_tag LOCUS_18150 43280 42951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 44210 43461 gene locus_tag LOCUS_18160 44210 43461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 44668 47310 gene locus_tag LOCUS_18170 gene parC 44668 47310 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_18170 47462 48079 gene locus_tag LOCUS_18180 47462 48079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_18180 48079 48531 gene locus_tag LOCUS_18190 48079 48531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 49417 48599 gene locus_tag LOCUS_18200 49417 48599 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_18200 49612 50544 gene locus_tag LOCUS_18210 49612 50544 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_18210 50595 51272 gene locus_tag LOCUS_18220 gene sirR 50595 51272 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_18220 51571 52845 gene locus_tag LOCUS_18230 51571 52845 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_18230 52958 53281 gene locus_tag LOCUS_18240 52958 53281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 53599 54708 gene locus_tag LOCUS_18250 gene smf 53599 54708 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_18250 54897 55514 gene locus_tag LOCUS_18260 54897 55514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 55530 56051 gene locus_tag LOCUS_18270 55530 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 56038 56253 gene locus_tag LOCUS_18280 56038 56253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 56500 57912 gene locus_tag LOCUS_18290 gene trpE 56500 57912 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_18290 58149 58769 gene locus_tag LOCUS_18300 58149 58769 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803788.1 protein_id gnl|my_center|LOCUS_18300 58781 59380 gene locus_tag LOCUS_18310 58781 59380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 59384 60403 gene locus_tag LOCUS_18320 gene trpD 59384 60403 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_18320 60512 61309 gene locus_tag LOCUS_18330 gene trpC 60512 61309 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_18330 61536 63395 gene locus_tag LOCUS_18340 61536 63395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_18340 63404 64147 gene locus_tag LOCUS_18350 63404 64147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 64612 65448 gene locus_tag LOCUS_18360 64612 65448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 67339 65780 gene locus_tag LOCUS_18370 67339 65780 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_18370 67493 68236 gene locus_tag LOCUS_18380 67493 68236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 69944 68340 gene locus_tag LOCUS_18390 69944 68340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 70176 71447 gene locus_tag LOCUS_18400 70176 71447 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_18400 71665 71411 gene locus_tag LOCUS_18410 71665 71411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 73104 72028 gene locus_tag LOCUS_18420 73104 72028 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_18420 73832 73254 gene locus_tag LOCUS_18430 73832 73254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 74999 74034 gene locus_tag LOCUS_18440 74999 74034 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence021 1150 1575 gene locus_tag LOCUS_18450 gene rplP 1150 1575 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_18450 1636 1848 gene locus_tag LOCUS_18460 1636 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1883 2164 gene locus_tag LOCUS_18470 gene rpsQ 1883 2164 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q5 protein_id gnl|my_center|LOCUS_18470 2331 2699 gene locus_tag LOCUS_18480 gene rplN 2331 2699 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFE5 protein_id gnl|my_center|LOCUS_18480 2826 3167 gene locus_tag LOCUS_18490 gene rplX 2826 3167 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_18490 3171 3716 gene locus_tag LOCUS_18500 gene rplE 3171 3716 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_18500 3919 4206 gene locus_tag LOCUS_18510 gene rpsN 3919 4206 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIG9 protein_id gnl|my_center|LOCUS_18510 4318 4716 gene locus_tag LOCUS_18520 gene rpsH 4318 4716 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_18520 4863 5414 gene locus_tag LOCUS_18530 gene rplF 4863 5414 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_18530 5570 5926 gene locus_tag LOCUS_18540 gene rplR 5570 5926 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_18540 5950 6465 gene locus_tag LOCUS_18550 gene rpsE 5950 6465 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_18550 6591 6770 gene locus_tag LOCUS_18560 gene rpmD 6591 6770 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_18560 7058 7504 gene locus_tag LOCUS_18570 gene rplO 7058 7504 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_18570 7669 9003 gene locus_tag LOCUS_18580 gene secY 7669 9003 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_18580 9226 10014 gene locus_tag LOCUS_18590 gene map 9226 10014 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_18590 10048 10947 gene locus_tag LOCUS_18600 gene prmC 10048 10947 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_18600 11812 13728 gene locus_tag LOCUS_18610 11812 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 14107 18882 gene locus_tag LOCUS_18620 14107 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 19306 18971 gene locus_tag LOCUS_18630 19306 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 20226 21863 gene locus_tag LOCUS_18640 20226 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 23647 21947 gene locus_tag LOCUS_18650 23647 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_18650 25538 23967 gene locus_tag LOCUS_18660 25538 23967 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_18660 25739 27913 gene locus_tag LOCUS_18670 25739 27913 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_18670 28256 28011 gene locus_tag LOCUS_18680 28256 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 29130 28261 gene locus_tag LOCUS_18690 29130 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_18690 29903 29187 gene locus_tag LOCUS_18700 29903 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 31314 30037 gene locus_tag LOCUS_18710 31314 30037 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_18710 33164 31554 gene locus_tag LOCUS_18720 gene gldM 33164 31554 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_18720 34061 33252 gene locus_tag LOCUS_18730 gene gldL 34061 33252 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_18730 36101 35040 gene locus_tag LOCUS_18740 36101 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 37725 36700 gene locus_tag LOCUS_18750 37725 36700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 38313 38131 gene locus_tag LOCUS_18760 38313 38131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 39479 38505 gene locus_tag LOCUS_18770 39479 38505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 39624 40124 gene locus_tag LOCUS_18780 39624 40124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 40353 43445 gene locus_tag LOCUS_18790 40353 43445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 44827 43550 gene locus_tag LOCUS_18800 44827 43550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 45861 44974 gene locus_tag LOCUS_18810 gene xapG 45861 44974 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_18810 46724 47458 gene locus_tag LOCUS_18820 46724 47458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 47661 48695 gene locus_tag LOCUS_18830 47661 48695 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_18830 48864 49913 gene locus_tag LOCUS_18840 48864 49913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 50040 50939 gene locus_tag LOCUS_18850 gene lipA 50040 50939 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_18850 51069 51554 gene locus_tag LOCUS_18860 51069 51554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 51632 52252 gene locus_tag LOCUS_18870 51632 52252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_18870 52295 52780 gene locus_tag LOCUS_18880 52295 52780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 52812 53528 gene locus_tag LOCUS_18890 gene truB 52812 53528 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U2 protein_id gnl|my_center|LOCUS_18890 53625 55025 gene locus_tag LOCUS_18900 53625 55025 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZI7 protein_id gnl|my_center|LOCUS_18900 55701 55015 gene locus_tag LOCUS_18910 gene nlaIVR 55701 55015 CDS product type II restriction endonuclease NlaIV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217109.1 protein_id gnl|my_center|LOCUS_18910 56080 57840 gene locus_tag LOCUS_18920 gene menD 56080 57840 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_18920 58146 59303 gene locus_tag LOCUS_18930 58146 59303 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_18930 59422 59910 gene locus_tag LOCUS_18940 59422 59910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 60067 60915 gene locus_tag LOCUS_18950 60067 60915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 61144 61728 gene locus_tag LOCUS_18960 gene ruvA 61144 61728 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ9 protein_id gnl|my_center|LOCUS_18960 61900 62883 gene locus_tag LOCUS_18970 61900 62883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 63251 64549 gene locus_tag LOCUS_18980 63251 64549 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_18980 64706 66778 gene locus_tag LOCUS_18990 64706 66778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 67395 70508 gene locus_tag LOCUS_19000 67395 70508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 70705 72081 gene locus_tag LOCUS_19010 gene hisS 70705 72081 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_19010 >Feature sequence022 1660 197 gene locus_tag LOCUS_19020 1660 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2376 1699 gene locus_tag LOCUS_19030 gene sdhB 2376 1699 CDS product putative L-serine dehydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_270097.1 protein_id gnl|my_center|LOCUS_19030 4985 2517 gene locus_tag LOCUS_19040 4985 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5377 5030 gene locus_tag LOCUS_19050 5377 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 5995 5573 gene locus_tag LOCUS_19060 5995 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 8845 6122 gene locus_tag LOCUS_19070 8845 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 9370 8849 gene locus_tag LOCUS_19080 9370 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11557 9398 gene locus_tag LOCUS_19090 11557 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 12132 11782 gene locus_tag LOCUS_19100 12132 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_19100 12991 12182 gene locus_tag LOCUS_19110 gene bamD 12991 12182 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_19110 13680 13249 gene locus_tag LOCUS_19120 13680 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 14139 13861 gene locus_tag LOCUS_19130 14139 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 14621 14172 gene locus_tag LOCUS_19140 14621 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 14971 16278 gene locus_tag LOCUS_19150 gene der 14971 16278 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_19150 16448 18016 gene locus_tag LOCUS_19160 gene pccB 16448 18016 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_19160 18228 18479 gene locus_tag LOCUS_19170 18228 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 18620 19066 gene locus_tag LOCUS_19180 18620 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 19098 21320 gene locus_tag LOCUS_19190 19098 21320 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_19190 22021 21350 gene locus_tag LOCUS_19200 22021 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 22839 22093 gene locus_tag LOCUS_19210 22839 22093 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_19210 35491 23027 gene locus_tag LOCUS_19220 35491 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 36089 35865 gene locus_tag LOCUS_19230 36089 35865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 36216 36491 gene locus_tag LOCUS_19240 36216 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 36790 36551 gene locus_tag LOCUS_19250 36790 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 37013 37996 gene locus_tag LOCUS_19260 37013 37996 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_19260 38419 41298 gene locus_tag LOCUS_19270 38419 41298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_19270 41647 44826 gene locus_tag LOCUS_19280 41647 44826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_19280 44938 46314 gene locus_tag LOCUS_19290 44938 46314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_19290 46311 46910 gene locus_tag LOCUS_19300 46311 46910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 47858 46914 gene locus_tag LOCUS_19310 47858 46914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121591.1 protein_id gnl|my_center|LOCUS_19310 47968 48486 gene locus_tag LOCUS_19320 47968 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 48618 49310 gene locus_tag LOCUS_19330 48618 49310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 49448 50314 gene locus_tag LOCUS_19340 49448 50314 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 protein_id gnl|my_center|LOCUS_19340 51545 50382 gene locus_tag LOCUS_19350 51545 50382 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787502.1 protein_id gnl|my_center|LOCUS_19350 52978 51791 gene locus_tag LOCUS_19360 52978 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 56366 53151 gene locus_tag LOCUS_19370 56366 53151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 56891 56511 gene locus_tag LOCUS_19380 56891 56511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 58056 57121 gene locus_tag LOCUS_19390 58056 57121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016250.1 protein_id gnl|my_center|LOCUS_19390 58227 58901 gene locus_tag LOCUS_19400 58227 58901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 58917 59570 gene locus_tag LOCUS_19410 58917 59570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 60018 59572 gene locus_tag LOCUS_19420 60018 59572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 60923 60042 gene locus_tag LOCUS_19430 60923 60042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 61282 60923 gene locus_tag LOCUS_19440 61282 60923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 61815 61366 gene locus_tag LOCUS_19450 61815 61366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 62402 61830 gene locus_tag LOCUS_19460 62402 61830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 62751 62407 gene locus_tag LOCUS_19470 62751 62407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 63404 62754 gene locus_tag LOCUS_19480 63404 62754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 63688 63440 gene locus_tag LOCUS_19490 63688 63440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 64457 63909 gene locus_tag LOCUS_19500 64457 63909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 66157 65015 gene locus_tag LOCUS_19510 66157 65015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 67592 66207 gene locus_tag LOCUS_19520 67592 66207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 68042 67689 gene locus_tag LOCUS_19530 68042 67689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 68642 68103 gene locus_tag LOCUS_19540 68642 68103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 69004 69621 gene locus_tag LOCUS_19550 69004 69621 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481634.1 protein_id gnl|my_center|LOCUS_19550 69693 70517 gene locus_tag LOCUS_19560 69693 70517 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_19560 71122 70571 gene locus_tag LOCUS_19570 71122 70571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 71378 71109 gene locus_tag LOCUS_19580 71378 71109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence023 415 1842 gene locus_tag LOCUS_19590 415 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2719 1847 gene locus_tag LOCUS_19600 2719 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 3639 2716 gene locus_tag LOCUS_19610 3639 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4539 3655 gene locus_tag LOCUS_19620 4539 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5460 4546 gene locus_tag LOCUS_19630 5460 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5546 6172 gene locus_tag LOCUS_19640 5546 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_19640 7131 6220 gene locus_tag LOCUS_19650 7131 6220 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_19650 7397 7840 gene locus_tag LOCUS_19660 7397 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 7995 9020 gene locus_tag LOCUS_19670 gene atpB 7995 9020 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_19670 9295 9561 gene locus_tag LOCUS_19680 9295 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 9758 10276 gene locus_tag LOCUS_19690 gene atpF 9758 10276 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S434 protein_id gnl|my_center|LOCUS_19690 10387 10923 gene locus_tag LOCUS_19700 gene atpH 10387 10923 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_19700 11082 12674 gene locus_tag LOCUS_19710 gene atpA 11082 12674 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_19710 13020 13877 gene locus_tag LOCUS_19720 gene atpG 13020 13877 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_19720 13977 14366 gene locus_tag LOCUS_19730 gene crcB 13977 14366 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_19730 14505 15296 gene locus_tag LOCUS_19740 14505 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 16153 15293 gene locus_tag LOCUS_19750 16153 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 17405 16317 gene locus_tag LOCUS_19760 17405 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 17686 18252 gene locus_tag LOCUS_19770 17686 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 18497 18300 gene locus_tag LOCUS_19780 18497 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 18910 21024 gene locus_tag LOCUS_19790 18910 21024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_19790 22747 21194 gene locus_tag LOCUS_19800 22747 21194 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_19800 23087 23635 gene locus_tag LOCUS_19810 23087 23635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 23817 24569 gene locus_tag LOCUS_19820 23817 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 28073 24651 gene locus_tag LOCUS_19830 gene porU 28073 24651 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_19830 28348 28956 gene locus_tag LOCUS_19840 28348 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 29599 29018 gene locus_tag LOCUS_19850 29599 29018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 30293 29772 gene locus_tag LOCUS_19860 30293 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 31516 30524 gene locus_tag LOCUS_19870 gene rpoA 31516 30524 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_19870 32238 31633 gene locus_tag LOCUS_19880 gene rpsD 32238 31633 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN4 protein_id gnl|my_center|LOCUS_19880 33247 32855 gene locus_tag LOCUS_19890 gene rpsK 33247 32855 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 protein_id gnl|my_center|LOCUS_19890 33745 33377 gene locus_tag LOCUS_19900 gene rpsM 33745 33377 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_19900 34281 34063 gene locus_tag LOCUS_19910 gene infA 34281 34063 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN0 protein_id gnl|my_center|LOCUS_19910 34953 34591 gene locus_tag LOCUS_19920 34953 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 35452 35036 gene locus_tag LOCUS_19930 35452 35036 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_19930 35611 36165 gene locus_tag LOCUS_19940 35611 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 36255 36788 gene locus_tag LOCUS_19950 gene kdsC 36255 36788 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_19950 37006 40404 gene locus_tag LOCUS_19960 37006 40404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 40813 41445 gene locus_tag LOCUS_19970 gene ctaE 40813 41445 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_19970 43091 41847 gene locus_tag LOCUS_19980 43091 41847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 44646 43318 gene locus_tag LOCUS_19990 44646 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 45777 44707 gene locus_tag LOCUS_20000 gene metX 45777 44707 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_20000 47147 45903 gene locus_tag LOCUS_20010 gene cysN 47147 45903 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_20010 48125 47229 gene locus_tag LOCUS_20020 gene cysD 48125 47229 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_20020 48909 48202 gene locus_tag LOCUS_20030 gene cysH 48909 48202 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_20030 50509 48986 gene locus_tag LOCUS_20040 50509 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 52480 50834 gene locus_tag LOCUS_20050 gene cysI 52480 50834 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_20050 54379 52625 gene locus_tag LOCUS_20060 gene cysJ 54379 52625 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX4 protein_id gnl|my_center|LOCUS_20060 55208 54369 gene locus_tag LOCUS_20070 55208 54369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 55934 55473 gene locus_tag LOCUS_20080 55934 55473 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_20080 57379 56054 gene locus_tag LOCUS_20090 gene cysD 57379 56054 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_20090 58305 59693 gene locus_tag LOCUS_20100 58305 59693 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_20100 59951 61885 gene locus_tag LOCUS_20110 59951 61885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 61976 62512 gene locus_tag LOCUS_20120 61976 62512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 62714 64090 gene locus_tag LOCUS_20130 gene murD 62714 64090 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_20130 64110 65228 gene locus_tag LOCUS_20140 64110 65228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence024 1553 219 gene locus_tag LOCUS_20150 gene ftsA 1553 219 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_20150 2398 1628 gene locus_tag LOCUS_20160 2398 1628 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_20160 3246 2620 gene locus_tag LOCUS_20170 3246 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3914 3387 gene locus_tag LOCUS_20180 3914 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4505 3990 gene locus_tag LOCUS_20190 4505 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7512 4891 gene locus_tag LOCUS_20200 gene bamA 7512 4891 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_20200 8484 7666 gene locus_tag LOCUS_20210 8484 7666 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_20210 10158 9070 gene locus_tag LOCUS_20220 10158 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 12020 10425 gene locus_tag LOCUS_20230 12020 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_20230 12516 12591 gene locus_tag LOCUS_t00200 12516 12591 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12647 12722 gene locus_tag LOCUS_t00210 12647 12722 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12801 13478 gene locus_tag LOCUS_20240 gene ybbC 12801 13478 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_20240 17601 13567 gene locus_tag LOCUS_20250 17601 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 22201 18167 gene locus_tag LOCUS_20260 22201 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 22895 22404 gene locus_tag LOCUS_20270 22895 22404 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_20270 23123 24331 gene locus_tag LOCUS_20280 23123 24331 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_20280 24735 26174 gene locus_tag LOCUS_20290 24735 26174 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_20290 26287 26898 gene locus_tag LOCUS_20300 26287 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_20300 27226 28107 gene locus_tag LOCUS_20310 gene hemC 27226 28107 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_20310 28132 28653 gene locus_tag LOCUS_20320 gene haaO 28132 28653 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_20320 28856 29155 gene locus_tag LOCUS_20330 28856 29155 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787472.1 protein_id gnl|my_center|LOCUS_20330 29438 30067 gene locus_tag LOCUS_20340 29438 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 30667 30155 gene locus_tag LOCUS_20350 30667 30155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 31364 30960 gene locus_tag LOCUS_20360 31364 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963066.1 protein_id gnl|my_center|LOCUS_20360 31572 31321 gene locus_tag LOCUS_20370 31572 31321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 32489 31821 gene locus_tag LOCUS_20380 32489 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 33395 32589 gene locus_tag LOCUS_20390 gene trpA 33395 32589 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_20390 33806 36007 gene locus_tag LOCUS_20400 33806 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 36523 36110 gene locus_tag LOCUS_20410 36523 36110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 37664 36648 gene locus_tag LOCUS_20420 gene pheS 37664 36648 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_20420 40437 37777 gene locus_tag LOCUS_20430 40437 37777 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_20430 42939 40687 gene locus_tag LOCUS_20440 42939 40687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 46508 43203 gene locus_tag LOCUS_20450 46508 43203 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_20450 47470 46724 gene locus_tag LOCUS_20460 47470 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 48027 49526 gene locus_tag LOCUS_20470 48027 49526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 51884 49608 gene locus_tag LOCUS_20480 51884 49608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 52143 53108 gene locus_tag LOCUS_20490 52143 53108 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_20490 53536 54132 gene locus_tag LOCUS_20500 53536 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 55148 55222 gene locus_tag LOCUS_t00220 55148 55222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55955 55257 gene locus_tag LOCUS_20510 55955 55257 CDS product fluoroquinolones export permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJB3 protein_id gnl|my_center|LOCUS_20510 56663 55977 gene locus_tag LOCUS_20520 56663 55977 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258570.1 protein_id gnl|my_center|LOCUS_20520 57590 56679 gene locus_tag LOCUS_20530 57590 56679 CDS product putative ABC transporter antibiotic-transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702595.1 protein_id gnl|my_center|LOCUS_20530 58523 57912 gene locus_tag LOCUS_20540 58523 57912 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 protein_id gnl|my_center|LOCUS_20540 59281 58640 gene locus_tag LOCUS_20550 59281 58640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 59763 59344 gene locus_tag LOCUS_20560 59763 59344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 60508 59864 gene locus_tag LOCUS_20570 60508 59864 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_20570 62221 60872 gene locus_tag LOCUS_20580 62221 60872 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_20580 62449 63723 gene locus_tag LOCUS_20590 62449 63723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 63983 63789 gene locus_tag LOCUS_20600 63983 63789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 64222 65034 gene locus_tag LOCUS_20610 64222 65034 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_20610 65044 65961 gene locus_tag LOCUS_20620 65044 65961 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence025 1512 331 gene locus_tag LOCUS_20630 gene hisC 1512 331 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_20630 1730 2332 gene locus_tag LOCUS_20640 gene rnhB 1730 2332 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_20640 2526 2906 gene locus_tag LOCUS_20650 2526 2906 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_20650 8281 3062 gene locus_tag LOCUS_20660 8281 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8692 9807 gene locus_tag LOCUS_20670 8692 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 10464 10015 gene locus_tag LOCUS_20680 10464 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 10499 10672 gene locus_tag LOCUS_20690 10499 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 11118 10711 gene locus_tag LOCUS_20700 11118 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 13514 11370 gene locus_tag LOCUS_20710 13514 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 13756 15339 gene locus_tag LOCUS_20720 13756 15339 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_20720 16325 15366 gene locus_tag LOCUS_20730 16325 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 19700 16341 gene locus_tag LOCUS_20740 19700 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 20275 22704 gene locus_tag LOCUS_20750 gene mutS2 20275 22704 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_20750 25294 22772 gene locus_tag LOCUS_20760 25294 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 25655 26728 gene locus_tag LOCUS_20770 gene paaE 25655 26728 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_20770 27921 27085 gene locus_tag LOCUS_20780 gene srtN 27921 27085 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_20780 28003 29094 gene locus_tag LOCUS_20790 28003 29094 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_20790 29799 29248 gene locus_tag LOCUS_20800 gene kptA 29799 29248 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R5N7 protein_id gnl|my_center|LOCUS_20800 30187 31230 gene locus_tag LOCUS_20810 30187 31230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 31430 32551 gene locus_tag LOCUS_20820 31430 32551 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z38 protein_id gnl|my_center|LOCUS_20820 33166 32702 gene locus_tag LOCUS_20830 gene yuxK 33166 32702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_20830 33348 33551 gene locus_tag LOCUS_20840 33348 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 34282 33845 gene locus_tag LOCUS_20850 34282 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 35567 34311 gene locus_tag LOCUS_20860 35567 34311 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_20860 35686 36165 gene locus_tag LOCUS_20870 35686 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 36224 36955 gene locus_tag LOCUS_20880 36224 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963374.1 protein_id gnl|my_center|LOCUS_20880 37800 36970 gene locus_tag LOCUS_20890 37800 36970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 37921 38922 gene locus_tag LOCUS_20900 37921 38922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 40825 38990 gene locus_tag LOCUS_20910 40825 38990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 41860 40829 gene locus_tag LOCUS_20920 41860 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 42159 42536 gene locus_tag LOCUS_20930 gene gcvH 42159 42536 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N36 protein_id gnl|my_center|LOCUS_20930 44451 42652 gene locus_tag LOCUS_20940 44451 42652 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_20940 44661 45356 gene locus_tag LOCUS_20950 44661 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 46014 45424 gene locus_tag LOCUS_20960 46014 45424 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_20960 46140 46955 gene locus_tag LOCUS_20970 46140 46955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 47269 49719 gene locus_tag LOCUS_20980 47269 49719 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_20980 49865 50362 gene locus_tag LOCUS_20990 49865 50362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 50366 50884 gene locus_tag LOCUS_21000 50366 50884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 50915 51325 gene locus_tag LOCUS_21010 50915 51325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 51543 52880 gene locus_tag LOCUS_21020 gene ffh 51543 52880 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_21020 53659 52985 gene locus_tag LOCUS_21030 53659 52985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 53851 54618 gene locus_tag LOCUS_21040 53851 54618 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_21040 54704 55303 gene locus_tag LOCUS_21050 54704 55303 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_21050 55398 55979 gene locus_tag LOCUS_21060 55398 55979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114232.1 protein_id gnl|my_center|LOCUS_21060 58101 56083 gene locus_tag LOCUS_21070 58101 56083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 58933 58211 gene locus_tag LOCUS_21080 58933 58211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 60001 59225 gene locus_tag LOCUS_21090 gene pcbD 60001 59225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_21090 61795 60692 gene locus_tag LOCUS_21100 61795 60692 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_21100 63328 62027 gene locus_tag LOCUS_21110 gene hemL 63328 62027 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_21110 63524 64225 gene locus_tag LOCUS_21120 63524 64225 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_21120 64323 64610 gene locus_tag LOCUS_21130 64323 64610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 64635 65021 gene locus_tag LOCUS_21140 64635 65021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 65025 65972 gene locus_tag LOCUS_21150 65025 65972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence026 507 343 gene locus_tag LOCUS_21160 507 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 734 597 gene locus_tag LOCUS_21170 734 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1300 1163 gene locus_tag LOCUS_21180 1300 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1575 1423 gene locus_tag LOCUS_21190 1575 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2953 1856 gene locus_tag LOCUS_21200 gene hppD 2953 1856 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_21200 3756 2998 gene locus_tag LOCUS_21210 3756 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4942 4058 gene locus_tag LOCUS_21220 4942 4058 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_21220 6600 5545 gene locus_tag LOCUS_21230 6600 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 10971 6739 gene locus_tag LOCUS_21240 10971 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 11387 12088 gene locus_tag LOCUS_21250 11387 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 12137 12832 gene locus_tag LOCUS_21260 12137 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 13107 14615 gene locus_tag LOCUS_21270 13107 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 15545 14667 gene locus_tag LOCUS_21280 gene hisG 15545 14667 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_21280 16300 15824 gene locus_tag LOCUS_21290 16300 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 16510 18006 gene locus_tag LOCUS_21300 gene gatB 16510 18006 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_21300 18065 18403 gene locus_tag LOCUS_21310 18065 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 18524 19036 gene locus_tag LOCUS_21320 18524 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 19667 19266 gene locus_tag LOCUS_21330 19667 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 20123 20695 gene locus_tag LOCUS_21340 gene yhgD 20123 20695 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 protein_id gnl|my_center|LOCUS_21340 20807 21628 gene locus_tag LOCUS_21350 20807 21628 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_21350 24273 21793 gene locus_tag LOCUS_21360 24273 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703527.1 protein_id gnl|my_center|LOCUS_21360 24509 26146 gene locus_tag LOCUS_21370 24509 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 26258 26830 gene locus_tag LOCUS_21380 26258 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 26837 27295 gene locus_tag LOCUS_21390 gene vapC 26837 27295 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_21390 27907 27302 gene locus_tag LOCUS_21400 27907 27302 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_21400 27994 28680 gene locus_tag LOCUS_21410 27994 28680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_21410 29592 28957 gene locus_tag LOCUS_21420 29592 28957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 30161 29619 gene locus_tag LOCUS_21430 30161 29619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 30826 30269 gene locus_tag LOCUS_21440 30826 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 31000 31983 gene locus_tag LOCUS_21450 31000 31983 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_21450 32410 32781 gene locus_tag LOCUS_21460 32410 32781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 32945 33784 gene locus_tag LOCUS_21470 32945 33784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 34603 33965 gene locus_tag LOCUS_21480 34603 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 35091 36158 gene locus_tag LOCUS_21490 35091 36158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 36311 37303 gene locus_tag LOCUS_21500 36311 37303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 38474 37308 gene locus_tag LOCUS_21510 38474 37308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 38793 39173 gene locus_tag LOCUS_21520 38793 39173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 39209 40135 gene locus_tag LOCUS_21530 gene kcnb2 39209 40135 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_21530 40389 41225 gene locus_tag LOCUS_21540 gene cheR 40389 41225 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_21540 41340 41939 gene locus_tag LOCUS_21550 gene cheB2 41340 41939 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_21550 41991 42779 gene locus_tag LOCUS_21560 41991 42779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 42922 46329 gene locus_tag LOCUS_21570 42922 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 46686 47270 gene locus_tag LOCUS_21580 46686 47270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_21580 47369 47731 gene locus_tag LOCUS_21590 47369 47731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 48077 51382 gene locus_tag LOCUS_21600 48077 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 51525 52517 gene locus_tag LOCUS_21610 51525 52517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 52939 53370 gene locus_tag LOCUS_21620 52939 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 53535 54185 gene locus_tag LOCUS_21630 53535 54185 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_21630 54248 54766 gene locus_tag LOCUS_21640 54248 54766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 54974 56299 gene locus_tag LOCUS_21650 54974 56299 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_21650 56464 56898 gene locus_tag LOCUS_21660 56464 56898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 57250 61263 gene locus_tag LOCUS_21670 57250 61263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 62398 61271 gene locus_tag LOCUS_21680 62398 61271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 62754 64031 gene locus_tag LOCUS_21690 gene eno2 62754 64031 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_21690 64970 64095 gene locus_tag LOCUS_21700 64970 64095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence027 1493 171 gene locus_tag LOCUS_21710 gene ahcY 1493 171 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_21710 3022 1799 gene locus_tag LOCUS_21720 gene bioF 3022 1799 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_21720 3668 3189 gene locus_tag LOCUS_21730 3668 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_21730 5107 3869 gene locus_tag LOCUS_21740 gene pgk 5107 3869 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_21740 5972 9271 gene locus_tag LOCUS_21750 5972 9271 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_21750 9367 10704 gene locus_tag LOCUS_21760 9367 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 11479 11552 gene locus_tag LOCUS_t00230 11479 11552 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11784 11969 gene locus_tag LOCUS_21770 gene secE 11784 11969 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ1 protein_id gnl|my_center|LOCUS_21770 12036 12617 gene locus_tag LOCUS_21780 gene nusG 12036 12617 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_21780 12955 13404 gene locus_tag LOCUS_21790 gene rplK 12955 13404 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_21790 13503 14201 gene locus_tag LOCUS_21800 gene rplA 13503 14201 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_21800 14230 14763 gene locus_tag LOCUS_21810 14230 14763 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_21810 15104 15478 gene locus_tag LOCUS_21820 gene rplL 15104 15478 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_21820 15631 16269 gene locus_tag LOCUS_21830 15631 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 16386 17108 gene locus_tag LOCUS_21840 16386 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_21840 17412 18227 gene locus_tag LOCUS_21850 17412 18227 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_21850 19005 18319 gene locus_tag LOCUS_21860 19005 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 21288 19057 gene locus_tag LOCUS_21870 21288 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 21671 22090 gene locus_tag LOCUS_21880 gene ndk 21671 22090 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_21880 22670 22218 gene locus_tag LOCUS_21890 22670 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 24378 22792 gene locus_tag LOCUS_21900 24378 22792 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_21900 24982 25563 gene locus_tag LOCUS_21910 24982 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 27124 25985 gene locus_tag LOCUS_21920 27124 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 28374 27259 gene locus_tag LOCUS_21930 28374 27259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 29059 28637 gene locus_tag LOCUS_21940 29059 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 29631 29092 gene locus_tag LOCUS_21950 29631 29092 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_21950 30809 29757 gene locus_tag LOCUS_21960 30809 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_21960 32486 30933 gene locus_tag LOCUS_21970 gene guaB 32486 30933 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_21970 32762 33610 gene locus_tag LOCUS_21980 gene ftsX 32762 33610 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_21980 33968 35635 gene locus_tag LOCUS_21990 33968 35635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 36548 35658 gene locus_tag LOCUS_22000 36548 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 37189 37974 gene locus_tag LOCUS_22010 37189 37974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_22010 37988 38653 gene locus_tag LOCUS_22020 37988 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 38988 40157 gene locus_tag LOCUS_22030 38988 40157 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_22030 40409 40621 gene locus_tag LOCUS_22040 40409 40621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 40611 40979 gene locus_tag LOCUS_22050 40611 40979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_22050 41252 42538 gene locus_tag LOCUS_22060 gene yeiM 41252 42538 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_22060 42792 44312 gene locus_tag LOCUS_22070 42792 44312 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107966.1 protein_id gnl|my_center|LOCUS_22070 45203 46195 gene locus_tag LOCUS_22080 45203 46195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 47811 46810 gene locus_tag LOCUS_22090 47811 46810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 49783 48011 gene locus_tag LOCUS_22100 49783 48011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 50038 50538 gene locus_tag LOCUS_22110 50038 50538 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_22110 50535 51767 gene locus_tag LOCUS_22120 gene ald 50535 51767 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_22120 51926 52765 gene locus_tag LOCUS_22130 51926 52765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_22130 52846 53553 gene locus_tag LOCUS_22140 52846 53553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 53563 54147 gene locus_tag LOCUS_22150 53563 54147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 54550 54137 gene locus_tag LOCUS_22160 54550 54137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 55325 54555 gene locus_tag LOCUS_22170 55325 54555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 56000 55584 gene locus_tag LOCUS_22180 56000 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 57387 56275 gene locus_tag LOCUS_22190 gene apbE 57387 56275 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44550 protein_id gnl|my_center|LOCUS_22190 57611 58255 gene locus_tag LOCUS_22200 57611 58255 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_22200 59109 58369 gene locus_tag LOCUS_22210 59109 58369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_22210 60789 59212 gene locus_tag LOCUS_22220 60789 59212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_22220 61020 60841 gene locus_tag LOCUS_22230 61020 60841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 61228 61004 gene locus_tag LOCUS_22240 61228 61004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 61826 62182 gene locus_tag LOCUS_22250 61826 62182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 63325 62267 gene locus_tag LOCUS_22260 gene galE 63325 62267 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_22260 64452 63511 gene locus_tag LOCUS_22270 gene mdh 64452 63511 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_22270 64630 65358 gene locus_tag LOCUS_22280 64630 65358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence028 1566 2798 gene locus_tag LOCUS_22290 1566 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3052 3951 gene locus_tag LOCUS_22300 gene lgt 3052 3951 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_22300 4096 4917 gene locus_tag LOCUS_22310 gene dinD 4096 4917 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_22310 4930 5295 gene locus_tag LOCUS_22320 4930 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 6498 5308 gene locus_tag LOCUS_22330 6498 5308 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_22330 6977 7591 gene locus_tag LOCUS_22340 6977 7591 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_22340 7688 8674 gene locus_tag LOCUS_22350 7688 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8655 9707 gene locus_tag LOCUS_22360 8655 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 10011 10604 gene locus_tag LOCUS_22370 10011 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 11304 10759 gene locus_tag LOCUS_22380 11304 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 11456 12469 gene locus_tag LOCUS_22390 11456 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 12550 13317 gene locus_tag LOCUS_22400 12550 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 14133 13363 gene locus_tag LOCUS_22410 14133 13363 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_22410 15288 14170 gene locus_tag LOCUS_22420 15288 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16381 15494 gene locus_tag LOCUS_22430 gene sucD 16381 15494 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_22430 17696 24814 gene locus_tag LOCUS_22440 17696 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 25204 25713 gene locus_tag LOCUS_22450 25204 25713 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_22450 26987 25950 gene locus_tag LOCUS_22460 26987 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_22460 27276 29525 gene locus_tag LOCUS_22470 gene katG 27276 29525 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C4 protein_id gnl|my_center|LOCUS_22470 29905 29621 gene locus_tag LOCUS_22480 29905 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 30576 29947 gene locus_tag LOCUS_22490 30576 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 32161 30866 gene locus_tag LOCUS_22500 gene rsmB 32161 30866 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_22500 33826 32312 gene locus_tag LOCUS_22510 gene accC 33826 32312 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_22510 34160 35059 gene locus_tag LOCUS_22520 34160 35059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 35124 36092 gene locus_tag LOCUS_22530 gene pfkA 35124 36092 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_22530 36485 37969 gene locus_tag LOCUS_22540 36485 37969 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_22540 38920 38096 gene locus_tag LOCUS_22550 38920 38096 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_22550 39330 43250 gene locus_tag LOCUS_22560 39330 43250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 43484 45874 gene locus_tag LOCUS_22570 43484 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 46101 46400 gene locus_tag LOCUS_22580 46101 46400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 46719 47741 gene locus_tag LOCUS_22590 46719 47741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 48034 48900 gene locus_tag LOCUS_22600 48034 48900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 48967 52014 gene locus_tag LOCUS_22610 gene sbcC 48967 52014 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FK1 protein_id gnl|my_center|LOCUS_22610 53327 52068 gene locus_tag LOCUS_22620 53327 52068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_22620 53782 53471 gene locus_tag LOCUS_22630 53782 53471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 54147 53824 gene locus_tag LOCUS_22640 54147 53824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 54596 55414 gene locus_tag LOCUS_22650 54596 55414 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_22650 55580 56224 gene locus_tag LOCUS_22660 55580 56224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 56344 57177 gene locus_tag LOCUS_22670 56344 57177 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_22670 58225 57308 gene locus_tag LOCUS_22680 58225 57308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 59181 58642 gene locus_tag LOCUS_22690 59181 58642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_22690 60230 59232 gene locus_tag LOCUS_22700 gene argK 60230 59232 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_22700 60543 61760 gene locus_tag LOCUS_22710 60543 61760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 62180 63133 gene locus_tag LOCUS_22720 62180 63133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence029 2158 845 gene locus_tag LOCUS_22730 2158 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_22730 2387 3031 gene locus_tag LOCUS_22740 2387 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 8650 3158 gene locus_tag LOCUS_22750 8650 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 9000 9464 gene locus_tag LOCUS_22760 9000 9464 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_22760 12299 9708 gene locus_tag LOCUS_22770 12299 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 12609 13208 gene locus_tag LOCUS_22780 12609 13208 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_22780 13373 14269 gene locus_tag LOCUS_22790 13373 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_22790 15145 14318 gene locus_tag LOCUS_22800 15145 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 15556 15161 gene locus_tag LOCUS_22810 15556 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 16517 15633 gene locus_tag LOCUS_22820 16517 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_22820 17461 16703 gene locus_tag LOCUS_22830 17461 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 18272 17823 gene locus_tag LOCUS_22840 18272 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 18253 18432 gene locus_tag LOCUS_22850 18253 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 18976 19983 gene locus_tag LOCUS_22860 gene queA 18976 19983 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_22860 20135 20512 gene locus_tag LOCUS_22870 20135 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 20554 21411 gene locus_tag LOCUS_22880 20554 21411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 22592 21459 gene locus_tag LOCUS_22890 gene ydjI 22592 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537911.1 protein_id gnl|my_center|LOCUS_22890 23650 23036 gene locus_tag LOCUS_22900 23650 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 26134 23945 gene locus_tag LOCUS_22910 26134 23945 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_22910 27473 26535 gene locus_tag LOCUS_22920 27473 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 28121 27489 gene locus_tag LOCUS_22930 28121 27489 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_22930 29020 28178 gene locus_tag LOCUS_22940 29020 28178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_22940 29679 29065 gene locus_tag LOCUS_22950 29679 29065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 30951 29719 gene locus_tag LOCUS_22960 30951 29719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 31948 31073 gene locus_tag LOCUS_22970 31948 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 32743 32198 gene locus_tag LOCUS_22980 32743 32198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 33228 34208 gene locus_tag LOCUS_22990 33228 34208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 34286 35542 gene locus_tag LOCUS_23000 34286 35542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 36173 35565 gene locus_tag LOCUS_23010 36173 35565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 36412 38643 gene locus_tag LOCUS_23020 36412 38643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 38879 40636 gene locus_tag LOCUS_23030 gene lysS 38879 40636 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_23030 40924 41499 gene locus_tag LOCUS_23040 40924 41499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 41696 43543 gene locus_tag LOCUS_23050 41696 43543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 43638 44330 gene locus_tag LOCUS_23060 43638 44330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 45370 44384 gene locus_tag LOCUS_23070 45370 44384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 46681 45437 gene locus_tag LOCUS_23080 gene nhaP 46681 45437 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_23080 47049 47930 gene locus_tag LOCUS_23090 47049 47930 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_23090 48382 47966 gene locus_tag LOCUS_23100 48382 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 48485 49735 gene locus_tag LOCUS_23110 gene argD 48485 49735 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_23110 49867 51306 gene locus_tag LOCUS_23120 49867 51306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 51372 52430 gene locus_tag LOCUS_23130 51372 52430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 52953 52621 gene locus_tag LOCUS_23140 gene clpS 52953 52621 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_23140 53178 54038 gene locus_tag LOCUS_23150 53178 54038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 54051 54278 gene locus_tag LOCUS_23160 54051 54278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 54310 54711 gene locus_tag LOCUS_23170 54310 54711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 54867 55448 gene locus_tag LOCUS_23180 54867 55448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 55679 58096 gene locus_tag LOCUS_23190 55679 58096 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_23190 58347 59525 gene locus_tag LOCUS_23200 58347 59525 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_23200 60221 59619 gene locus_tag LOCUS_23210 60221 59619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 60363 61262 gene locus_tag LOCUS_23220 60363 61262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 61278 62222 gene locus_tag LOCUS_23230 61278 62222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence030 6428 6883 gene locus_tag LOCUS_23240 6428 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 7120 8301 gene locus_tag LOCUS_23250 gene celE 7120 8301 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_23250 8742 8446 gene locus_tag LOCUS_23260 gene gatC 8742 8446 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S325 protein_id gnl|my_center|LOCUS_23260 10684 8864 gene locus_tag LOCUS_23270 10684 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 10961 11728 gene locus_tag LOCUS_23280 10961 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 13650 11800 gene locus_tag LOCUS_23290 13650 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 14824 14357 gene locus_tag LOCUS_23300 14824 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 15035 16195 gene locus_tag LOCUS_23310 gene fjo29 15035 16195 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_23310 16300 17130 gene locus_tag LOCUS_23320 16300 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 17139 18497 gene locus_tag LOCUS_23330 17139 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 18574 18762 gene locus_tag LOCUS_23340 18574 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 19188 21473 gene locus_tag LOCUS_23350 19188 21473 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_23350 21611 22345 gene locus_tag LOCUS_23360 21611 22345 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_23360 23823 22525 gene locus_tag LOCUS_23370 23823 22525 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_23370 24928 24020 gene locus_tag LOCUS_23380 24928 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 25758 25072 gene locus_tag LOCUS_23390 25758 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 26183 26025 gene locus_tag LOCUS_23400 26183 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 26465 27457 gene locus_tag LOCUS_23410 26465 27457 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_23410 27473 27652 gene locus_tag LOCUS_23420 27473 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 27750 28988 gene locus_tag LOCUS_23430 gene putA 27750 28988 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_23430 29918 29055 gene locus_tag LOCUS_23440 29918 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 30122 30877 gene locus_tag LOCUS_23450 30122 30877 CDS product urease-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066605.1 protein_id gnl|my_center|LOCUS_23450 31860 33422 gene locus_tag LOCUS_23460 gene pcd 31860 33422 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_23460 33850 33509 gene locus_tag LOCUS_23470 33850 33509 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_23470 34513 33893 gene locus_tag LOCUS_23480 34513 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 35963 34548 gene locus_tag LOCUS_23490 35963 34548 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_23490 36872 36174 gene locus_tag LOCUS_23500 36872 36174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 37230 38585 gene locus_tag LOCUS_23510 37230 38585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 38646 38900 gene locus_tag LOCUS_23520 38646 38900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 39147 42899 gene locus_tag LOCUS_23530 39147 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 42928 43302 gene locus_tag LOCUS_23540 42928 43302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 43791 43318 gene locus_tag LOCUS_23550 43791 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 44806 43811 gene locus_tag LOCUS_23560 44806 43811 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_23560 45020 45832 gene locus_tag LOCUS_23570 gene rsmA 45020 45832 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_23570 48042 45853 gene locus_tag LOCUS_23580 48042 45853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 48371 48781 gene locus_tag LOCUS_23590 48371 48781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_23590 50686 48968 gene locus_tag LOCUS_23600 50686 48968 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_23600 51915 51103 gene locus_tag LOCUS_23610 gene folE1 51915 51103 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_23610 52285 51878 gene locus_tag LOCUS_23620 gene ygcM 52285 51878 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_23620 52662 53276 gene locus_tag LOCUS_23630 52662 53276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 53350 54825 gene locus_tag LOCUS_23640 53350 54825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_23640 54818 55522 gene locus_tag LOCUS_23650 54818 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 55673 57622 gene locus_tag LOCUS_23660 55673 57622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 57687 57911 gene locus_tag LOCUS_23670 57687 57911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_23670 57913 58245 gene locus_tag LOCUS_23680 57913 58245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_23680 58824 59162 gene locus_tag LOCUS_23690 58824 59162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 59325 59882 gene locus_tag LOCUS_23700 59325 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 61931 59928 gene locus_tag LOCUS_23710 61931 59928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence031 173 835 gene locus_tag LOCUS_23720 173 835 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_23720 1004 1996 gene locus_tag LOCUS_23730 gene obg 1004 1996 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_23730 3330 2062 gene locus_tag LOCUS_23740 3330 2062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_23740 4357 6501 gene locus_tag LOCUS_23750 4357 6501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_23750 7045 6680 gene locus_tag LOCUS_23760 7045 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 7628 7065 gene locus_tag LOCUS_23770 7628 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_23770 8062 7634 gene locus_tag LOCUS_23780 8062 7634 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_23780 8582 8064 gene locus_tag LOCUS_23790 8582 8064 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_23790 9117 8692 gene locus_tag LOCUS_23800 9117 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 9292 10272 gene locus_tag LOCUS_23810 9292 10272 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_23810 10846 10316 gene locus_tag LOCUS_23820 10846 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 11242 10877 gene locus_tag LOCUS_23830 11242 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_23830 11394 11831 gene locus_tag LOCUS_23840 11394 11831 CDS product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_23840 12941 11928 gene locus_tag LOCUS_23850 gene asd 12941 11928 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_23850 16809 13162 gene locus_tag LOCUS_23860 16809 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 17427 17164 gene locus_tag LOCUS_23870 17427 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 17832 18746 gene locus_tag LOCUS_23880 gene rnz 17832 18746 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZN1 protein_id gnl|my_center|LOCUS_23880 18786 19577 gene locus_tag LOCUS_23890 18786 19577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_23890 19662 20447 gene locus_tag LOCUS_23900 19662 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 22417 20519 gene locus_tag LOCUS_23910 22417 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206337.1 protein_id gnl|my_center|LOCUS_23910 26354 22602 gene locus_tag LOCUS_23920 26354 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_23920 27018 26371 gene locus_tag LOCUS_23930 27018 26371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 28493 27024 gene locus_tag LOCUS_23940 28493 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 29571 28558 gene locus_tag LOCUS_23950 29571 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_23950 29744 32416 gene locus_tag LOCUS_23960 29744 32416 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_23960 36565 32546 gene locus_tag LOCUS_23970 36565 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 37484 36768 gene locus_tag LOCUS_23980 37484 36768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 37957 37619 gene locus_tag LOCUS_23990 37957 37619 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_23990 39359 38001 gene locus_tag LOCUS_24000 gene fjo17 39359 38001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_24000 40399 39560 gene locus_tag LOCUS_24010 40399 39560 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE15 protein_id gnl|my_center|LOCUS_24010 40570 41973 gene locus_tag LOCUS_24020 40570 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 42092 43834 gene locus_tag LOCUS_24030 42092 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 43928 44827 gene locus_tag LOCUS_24040 43928 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 44957 46672 gene locus_tag LOCUS_24050 gene pruA 44957 46672 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_24050 46926 49079 gene locus_tag LOCUS_24060 46926 49079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 49459 50331 gene locus_tag LOCUS_24070 49459 50331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 51075 50815 gene locus_tag LOCUS_24080 51075 50815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence032 188 868 gene locus_tag LOCUS_24090 188 868 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_24090 876 2174 gene locus_tag LOCUS_24100 876 2174 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_24100 2261 3685 gene locus_tag LOCUS_24110 2261 3685 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786864.1 protein_id gnl|my_center|LOCUS_24110 3782 5272 gene locus_tag LOCUS_24120 gene miaB 3782 5272 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_24120 6696 5362 gene locus_tag LOCUS_24130 6696 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7068 7889 gene locus_tag LOCUS_24140 7068 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7909 8781 gene locus_tag LOCUS_24150 7909 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_24150 8784 9515 gene locus_tag LOCUS_24160 8784 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9662 10423 gene locus_tag LOCUS_24170 9662 10423 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_24170 10973 10464 gene locus_tag LOCUS_24180 10973 10464 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_24180 11566 11132 gene locus_tag LOCUS_24190 11566 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 11771 12115 gene locus_tag LOCUS_24200 11771 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 13453 12128 gene locus_tag LOCUS_24210 13453 12128 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_24210 13724 14104 gene locus_tag LOCUS_24220 13724 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963525.1 protein_id gnl|my_center|LOCUS_24220 14432 14920 gene locus_tag LOCUS_24230 14432 14920 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_24230 15702 15139 gene locus_tag LOCUS_24240 15702 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 16727 15879 gene locus_tag LOCUS_24250 gene yaaA 16727 15879 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_24250 16952 17722 gene locus_tag LOCUS_24260 gene tpiA 16952 17722 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_24260 18141 21332 gene locus_tag LOCUS_24270 18141 21332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 21495 22163 gene locus_tag LOCUS_24280 21495 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_24280 22338 24803 gene locus_tag LOCUS_24290 22338 24803 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_24290 24958 25626 gene locus_tag LOCUS_24300 24958 25626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 28261 25745 gene locus_tag LOCUS_24310 28261 25745 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_24310 28914 29750 gene locus_tag LOCUS_24320 28914 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 29890 30630 gene locus_tag LOCUS_24330 29890 30630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 32546 30921 gene locus_tag LOCUS_24340 32546 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 32818 33960 gene locus_tag LOCUS_24350 32818 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 34073 34621 gene locus_tag LOCUS_24360 34073 34621 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_24360 34637 36130 gene locus_tag LOCUS_24370 34637 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 36642 36229 gene locus_tag LOCUS_24380 36642 36229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 37072 38262 gene locus_tag LOCUS_24390 37072 38262 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_24390 38377 39270 gene locus_tag LOCUS_24400 gene nadK 38377 39270 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_24400 40431 40216 gene locus_tag LOCUS_24410 40431 40216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 40802 41314 gene locus_tag LOCUS_24420 40802 41314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 44288 41337 gene locus_tag LOCUS_24430 44288 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 44660 45352 gene locus_tag LOCUS_24440 gene clpP 44660 45352 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_24440 46050 45454 gene locus_tag LOCUS_24450 46050 45454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_24450 46151 46666 gene locus_tag LOCUS_24460 46151 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 46863 49406 gene locus_tag LOCUS_24470 gene fecA 46863 49406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_24470 49890 49480 gene locus_tag LOCUS_24480 49890 49480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 50340 50101 gene locus_tag LOCUS_24490 50340 50101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 50954 50508 gene locus_tag LOCUS_24500 50954 50508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 51204 54143 gene locus_tag LOCUS_24510 51204 54143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_24510 54458 56713 gene locus_tag LOCUS_24520 54458 56713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 57340 56705 gene locus_tag LOCUS_24530 57340 56705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 57485 58033 gene locus_tag LOCUS_24540 57485 58033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 58487 58278 gene locus_tag LOCUS_24550 58487 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence033 330 791 gene locus_tag LOCUS_24560 330 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1104 2261 gene locus_tag LOCUS_24570 1104 2261 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_24570 3368 2535 gene locus_tag LOCUS_24580 3368 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3569 3862 gene locus_tag LOCUS_24590 3569 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3926 4192 gene locus_tag LOCUS_24600 3926 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4310 4579 gene locus_tag LOCUS_24610 4310 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 5382 4666 gene locus_tag LOCUS_24620 5382 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6129 5404 gene locus_tag LOCUS_24630 6129 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705544.1 protein_id gnl|my_center|LOCUS_24630 7241 6138 gene locus_tag LOCUS_24640 7241 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 9003 8089 gene locus_tag LOCUS_24650 9003 8089 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_24650 11408 9549 gene locus_tag LOCUS_24660 11408 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 12384 11494 gene locus_tag LOCUS_24670 12384 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 12872 12609 gene locus_tag LOCUS_24680 12872 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13075 12869 gene locus_tag LOCUS_24690 13075 12869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 13292 13044 gene locus_tag LOCUS_24700 13292 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 13498 13926 gene locus_tag LOCUS_24710 13498 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 15625 14135 gene locus_tag LOCUS_24720 15625 14135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_24720 15958 16046 gene locus_tag LOCUS_t00240 15958 16046 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16511 17341 gene locus_tag LOCUS_24730 16511 17341 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_24730 17508 18035 gene locus_tag LOCUS_24740 17508 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 18045 18629 gene locus_tag LOCUS_24750 18045 18629 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_24750 18753 19211 gene locus_tag LOCUS_24760 18753 19211 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_24760 19323 19769 gene locus_tag LOCUS_24770 19323 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 19809 20351 gene locus_tag LOCUS_24780 19809 20351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 22898 20352 gene locus_tag LOCUS_24790 gene priA 22898 20352 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_24790 23978 24490 gene locus_tag LOCUS_24800 23978 24490 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_24800 24680 25576 gene locus_tag LOCUS_24810 gene crtB 24680 25576 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_24810 26270 25872 gene locus_tag LOCUS_24820 26270 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_24820 26865 26299 gene locus_tag LOCUS_24830 26865 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_24830 30525 26929 gene locus_tag LOCUS_24840 30525 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 31054 30602 gene locus_tag LOCUS_24850 31054 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 32831 31239 gene locus_tag LOCUS_24860 32831 31239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 33066 33530 gene locus_tag LOCUS_24870 33066 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 35060 33648 gene locus_tag LOCUS_24880 35060 33648 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_24880 36305 35445 gene locus_tag LOCUS_24890 36305 35445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 36785 36447 gene locus_tag LOCUS_24900 36785 36447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 38351 36933 gene locus_tag LOCUS_24910 38351 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 38544 39311 gene locus_tag LOCUS_24920 gene pssA 38544 39311 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_24920 39387 42746 gene locus_tag LOCUS_24930 39387 42746 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_24930 45045 42955 gene locus_tag LOCUS_24940 gene pepO 45045 42955 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_24940 45910 45284 gene locus_tag LOCUS_24950 45910 45284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 48265 46178 gene locus_tag LOCUS_24960 48265 46178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 49314 48346 gene locus_tag LOCUS_24970 49314 48346 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_24970 49702 50241 gene locus_tag LOCUS_24980 49702 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 50336 51037 gene locus_tag LOCUS_24990 50336 51037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 51384 52349 gene locus_tag LOCUS_25000 51384 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 52382 53341 gene locus_tag LOCUS_25010 52382 53341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 55844 53409 gene locus_tag LOCUS_25020 55844 53409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 57368 55986 gene locus_tag LOCUS_25030 57368 55986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 58333 57503 gene locus_tag LOCUS_25040 58333 57503 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence034 4251 5576 gene locus_tag LOCUS_25050 gene amt 4251 5576 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH08 protein_id gnl|my_center|LOCUS_25050 7766 6003 gene locus_tag LOCUS_25060 7766 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 9066 7888 gene locus_tag LOCUS_25070 9066 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 10154 9282 gene locus_tag LOCUS_25080 gene glpQ 10154 9282 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_25080 10659 11738 gene locus_tag LOCUS_25090 10659 11738 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_25090 12019 11735 gene locus_tag LOCUS_25100 12019 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13598 12081 gene locus_tag LOCUS_25110 gene rpoN 13598 12081 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_25110 13960 14871 gene locus_tag LOCUS_25120 13960 14871 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_25120 14961 16184 gene locus_tag LOCUS_25130 14961 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 16540 17538 gene locus_tag LOCUS_25140 16540 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 18975 17989 gene locus_tag LOCUS_25150 18975 17989 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_25150 19654 19115 gene locus_tag LOCUS_25160 19654 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 19938 21671 gene locus_tag LOCUS_25170 19938 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 23552 21837 gene locus_tag LOCUS_25180 23552 21837 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_25180 23890 23660 gene locus_tag LOCUS_25190 23890 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 25005 24682 gene locus_tag LOCUS_25200 25005 24682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 25421 26593 gene locus_tag LOCUS_25210 25421 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 27255 29756 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccactttcaaata 33487 29750 gene locus_tag LOCUS_25220 33487 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 34776 33946 gene locus_tag LOCUS_25230 34776 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 35952 34804 gene locus_tag LOCUS_25240 35952 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 36842 36066 gene locus_tag LOCUS_25250 36842 36066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 38641 37274 gene locus_tag LOCUS_25260 38641 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 39955 38729 gene locus_tag LOCUS_25270 39955 38729 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202365.1 protein_id gnl|my_center|LOCUS_25270 40255 39968 gene locus_tag LOCUS_25280 40255 39968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 40417 40989 gene locus_tag LOCUS_25290 40417 40989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 41406 41332 gene locus_tag LOCUS_t00250 41406 41332 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41658 41584 gene locus_tag LOCUS_t00260 41658 41584 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42125 43042 gene locus_tag LOCUS_25300 42125 43042 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_25300 43127 46753 gene locus_tag LOCUS_25310 43127 46753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_25310 46818 47060 gene locus_tag LOCUS_25320 46818 47060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 48036 47107 gene locus_tag LOCUS_25330 gene prs 48036 47107 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHM2 protein_id gnl|my_center|LOCUS_25330 48817 48221 gene locus_tag LOCUS_25340 48817 48221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 49630 48962 gene locus_tag LOCUS_25350 49630 48962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 50447 49623 gene locus_tag LOCUS_25360 50447 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 52975 50495 gene locus_tag LOCUS_25370 52975 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 54298 53099 gene locus_tag LOCUS_25380 54298 53099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_25380 55216 54437 gene locus_tag LOCUS_25390 55216 54437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 55570 57519 gene locus_tag LOCUS_25400 55570 57519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence035 205 894 gene locus_tag LOCUS_25410 205 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_25410 1221 3755 gene locus_tag LOCUS_25420 gene clpC 1221 3755 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_25420 5054 3849 gene locus_tag LOCUS_25430 5054 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5164 5562 gene locus_tag LOCUS_25440 5164 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963501.1 protein_id gnl|my_center|LOCUS_25440 7635 5641 gene locus_tag LOCUS_25450 7635 5641 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_25450 8199 8885 gene locus_tag LOCUS_25460 8199 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 8908 9840 gene locus_tag LOCUS_25470 8908 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10077 10580 gene locus_tag LOCUS_25480 10077 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 11646 10582 gene locus_tag LOCUS_25490 11646 10582 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_25490 12441 11755 gene locus_tag LOCUS_25500 12441 11755 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_25500 13456 12572 gene locus_tag LOCUS_25510 13456 12572 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_25510 13631 14518 gene locus_tag LOCUS_25520 13631 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142578.1 protein_id gnl|my_center|LOCUS_25520 14630 15514 gene locus_tag LOCUS_25530 14630 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 15732 16517 gene locus_tag LOCUS_25540 15732 16517 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_25540 17743 17027 gene locus_tag LOCUS_25550 17743 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 18997 18062 gene locus_tag LOCUS_25560 gene hemF 18997 18062 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_25560 19307 20326 gene locus_tag LOCUS_25570 gene fjo19 19307 20326 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_25570 20459 21433 gene locus_tag LOCUS_25580 20459 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 21482 22474 gene locus_tag LOCUS_25590 21482 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 22656 23132 gene locus_tag LOCUS_25600 22656 23132 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMC5 protein_id gnl|my_center|LOCUS_25600 23197 23706 gene locus_tag LOCUS_25610 23197 23706 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLT0 protein_id gnl|my_center|LOCUS_25610 24309 28097 gene locus_tag LOCUS_25620 gene rpoB 24309 28097 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_25620 28285 30261 gene locus_tag LOCUS_25630 28285 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 30266 31423 gene locus_tag LOCUS_25640 gene mcrC 30266 31423 CDS product 5-methylcytosine-specific restriction system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 protein_id gnl|my_center|LOCUS_25640 31502 31786 gene locus_tag LOCUS_25650 31502 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 31790 32527 gene locus_tag LOCUS_25660 31790 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 32914 32537 gene locus_tag LOCUS_25670 32914 32537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 33169 34194 gene locus_tag LOCUS_25680 gene ruvB 33169 34194 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M0 protein_id gnl|my_center|LOCUS_25680 34204 34539 gene locus_tag LOCUS_25690 34204 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 34621 35943 gene locus_tag LOCUS_25700 34621 35943 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_25700 37142 36210 gene locus_tag LOCUS_25710 gene pyrB 37142 36210 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_25710 37445 38323 gene locus_tag LOCUS_25720 37445 38323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 39283 38417 gene locus_tag LOCUS_25730 39283 38417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 40030 39395 gene locus_tag LOCUS_25740 40030 39395 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_25740 42257 40200 gene locus_tag LOCUS_25750 gene rho 42257 40200 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RC3 protein_id gnl|my_center|LOCUS_25750 43214 42873 gene locus_tag LOCUS_25760 43214 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_25760 43752 43270 gene locus_tag LOCUS_25770 43752 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 44348 43884 gene locus_tag LOCUS_25780 44348 43884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 44524 44700 gene locus_tag LOCUS_25790 44524 44700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 44895 46637 gene locus_tag LOCUS_25800 44895 46637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 46651 47367 gene locus_tag LOCUS_25810 46651 47367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 48059 47436 gene locus_tag LOCUS_25820 48059 47436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 49458 48391 gene locus_tag LOCUS_25830 49458 48391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 49648 50220 gene locus_tag LOCUS_25840 49648 50220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 50691 52226 gene locus_tag LOCUS_25850 gene leuB 50691 52226 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_25850 54682 52379 gene locus_tag LOCUS_25860 gene pepN 54682 52379 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_25860 55275 55027 gene locus_tag LOCUS_25870 55275 55027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence036 5337 151 gene locus_tag LOCUS_25880 5337 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 5905 6960 gene locus_tag LOCUS_25890 5905 6960 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWL5 protein_id gnl|my_center|LOCUS_25890 8111 7041 gene locus_tag LOCUS_25900 gene aroC 8111 7041 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_25900 8770 8123 gene locus_tag LOCUS_25910 8770 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 9627 8815 gene locus_tag LOCUS_25920 9627 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11576 9684 gene locus_tag LOCUS_25930 11576 9684 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_25930 11945 12457 gene locus_tag LOCUS_25940 11945 12457 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_25940 14224 12806 gene locus_tag LOCUS_25950 14224 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 14952 18017 gene locus_tag LOCUS_25960 14952 18017 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_25960 18207 18425 gene locus_tag LOCUS_25970 18207 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 19092 18427 gene locus_tag LOCUS_25980 19092 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 19976 19134 gene locus_tag LOCUS_25990 19976 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 20148 20663 gene locus_tag LOCUS_26000 20148 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 20726 23230 gene locus_tag LOCUS_26010 20726 23230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_26010 23824 24954 gene locus_tag LOCUS_26020 23824 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 24970 25770 gene locus_tag LOCUS_26030 24970 25770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 25980 26915 gene locus_tag LOCUS_26040 gene fjo11 25980 26915 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_26040 28601 27579 gene locus_tag LOCUS_26050 28601 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 30057 28609 gene locus_tag LOCUS_26060 30057 28609 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_26060 30250 31542 gene locus_tag LOCUS_26070 gene pyrC2 30250 31542 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_26070 32266 31544 gene locus_tag LOCUS_26080 32266 31544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_26080 33160 32561 gene locus_tag LOCUS_26090 33160 32561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 33830 33261 gene locus_tag LOCUS_26100 33830 33261 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_26100 34511 33900 gene locus_tag LOCUS_26110 34511 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 34930 34676 gene locus_tag LOCUS_26120 34930 34676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 36064 35267 gene locus_tag LOCUS_26130 36064 35267 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_26130 36930 36382 gene locus_tag LOCUS_26140 36930 36382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 37172 38140 gene locus_tag LOCUS_26150 37172 38140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 38248 39012 gene locus_tag LOCUS_26160 38248 39012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 39029 39805 gene locus_tag LOCUS_26170 39029 39805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 39809 40576 gene locus_tag LOCUS_26180 39809 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 40589 41347 gene locus_tag LOCUS_26190 40589 41347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 41360 42619 gene locus_tag LOCUS_26200 41360 42619 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_26200 43148 42690 gene locus_tag LOCUS_26210 43148 42690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 43712 43248 gene locus_tag LOCUS_26220 43712 43248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 44172 46433 gene locus_tag LOCUS_26230 44172 46433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 49037 46605 gene locus_tag LOCUS_26240 49037 46605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_26240 49953 49273 gene locus_tag LOCUS_26250 49953 49273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 50817 50101 gene locus_tag LOCUS_26260 50817 50101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 51592 50807 gene locus_tag LOCUS_26270 51592 50807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 52904 51918 gene locus_tag LOCUS_26280 gene fbp 52904 51918 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 protein_id gnl|my_center|LOCUS_26280 54844 53474 gene locus_tag LOCUS_26290 54844 53474 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946384.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence037 1323 280 gene locus_tag LOCUS_26300 1323 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_26300 2100 1522 gene locus_tag LOCUS_26310 2100 1522 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_26310 2764 2192 gene locus_tag LOCUS_26320 2764 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2757 2951 gene locus_tag LOCUS_26330 2757 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3051 3896 gene locus_tag LOCUS_26340 3051 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4425 3898 gene locus_tag LOCUS_26350 4425 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 5835 4900 gene locus_tag LOCUS_26360 5835 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388632.1 protein_id gnl|my_center|LOCUS_26360 7400 6180 gene locus_tag LOCUS_26370 7400 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8371 8925 gene locus_tag LOCUS_26380 8371 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 9215 9003 gene locus_tag LOCUS_26390 9215 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 9490 10404 gene locus_tag LOCUS_26400 9490 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 10644 13967 gene locus_tag LOCUS_26410 10644 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 14421 14612 gene locus_tag LOCUS_26420 14421 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 14756 14941 gene locus_tag LOCUS_26430 14756 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 15225 15383 gene locus_tag LOCUS_26440 15225 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 15625 16515 gene locus_tag LOCUS_26450 gene dapA 15625 16515 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_26450 17369 18133 gene locus_tag LOCUS_26460 17369 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_26460 19058 18153 gene locus_tag LOCUS_26470 gene lpxH 19058 18153 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_26470 19566 19186 gene locus_tag LOCUS_26480 19566 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 20048 20476 gene locus_tag LOCUS_26490 20048 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 21133 20591 gene locus_tag LOCUS_26500 21133 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 21746 21324 gene locus_tag LOCUS_26510 21746 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 21952 23118 gene locus_tag LOCUS_26520 gene purK 21952 23118 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_26520 23612 23184 gene locus_tag LOCUS_26530 23612 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 25447 23795 gene locus_tag LOCUS_26540 25447 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 26900 25563 gene locus_tag LOCUS_26550 26900 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 27004 27867 gene locus_tag LOCUS_26560 27004 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 28033 28584 gene locus_tag LOCUS_26570 gene def 28033 28584 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_26570 29428 28640 gene locus_tag LOCUS_26580 29428 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 30887 29577 gene locus_tag LOCUS_26590 30887 29577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 31268 31195 gene locus_tag LOCUS_t00270 31268 31195 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31865 32455 gene locus_tag LOCUS_26600 31865 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 32683 33843 gene locus_tag LOCUS_26610 32683 33843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 34168 36168 gene locus_tag LOCUS_26620 34168 36168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 36651 36331 gene locus_tag LOCUS_26630 36651 36331 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_26630 37666 36755 gene locus_tag LOCUS_26640 37666 36755 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_26640 38420 37809 gene locus_tag LOCUS_26650 38420 37809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 39553 38630 gene locus_tag LOCUS_26660 gene fmt 39553 38630 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_26660 39842 39672 gene locus_tag LOCUS_26670 39842 39672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 40321 39857 gene locus_tag LOCUS_26680 40321 39857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 40999 40325 gene locus_tag LOCUS_26690 40999 40325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_26690 41902 41153 gene locus_tag LOCUS_26700 41902 41153 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_26700 43023 41974 gene locus_tag LOCUS_26710 43023 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 43669 43079 gene locus_tag LOCUS_26720 43669 43079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 43975 44646 gene locus_tag LOCUS_26730 gene psd 43975 44646 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_26730 44835 45452 gene locus_tag LOCUS_26740 44835 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 45609 46259 gene locus_tag LOCUS_26750 45609 46259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 46920 46336 gene locus_tag LOCUS_26760 46920 46336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 50525 47070 gene locus_tag LOCUS_26770 50525 47070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 51231 51956 gene locus_tag LOCUS_26780 gene menG 51231 51956 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_26780 51960 52817 gene locus_tag LOCUS_26790 51960 52817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 53075 53713 gene locus_tag LOCUS_26800 53075 53713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence038 1083 139 gene locus_tag LOCUS_26810 1083 139 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_26810 2107 1376 gene locus_tag LOCUS_26820 2107 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3508 2120 gene locus_tag LOCUS_26830 3508 2120 CDS product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_26830 3848 3774 gene locus_tag LOCUS_t00280 3848 3774 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4564 4217 gene locus_tag LOCUS_26840 4564 4217 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_26840 4921 5961 gene locus_tag LOCUS_26850 gene menC 4921 5961 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_26850 6592 6029 gene locus_tag LOCUS_26860 6592 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_26860 7409 6738 gene locus_tag LOCUS_26870 7409 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 8513 7569 gene locus_tag LOCUS_26880 8513 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 9902 8697 gene locus_tag LOCUS_26890 9902 8697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931892.1 protein_id gnl|my_center|LOCUS_26890 10060 10785 gene locus_tag LOCUS_26900 10060 10785 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_26900 11336 10782 gene locus_tag LOCUS_26910 11336 10782 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_26910 12095 11466 gene locus_tag LOCUS_26920 12095 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 12297 12215 gene locus_tag LOCUS_t00290 12297 12215 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12938 12411 gene locus_tag LOCUS_26930 12938 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 13377 13793 gene locus_tag LOCUS_26940 13377 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 15528 13801 gene locus_tag LOCUS_26950 15528 13801 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_26950 15778 16164 gene locus_tag LOCUS_26960 15778 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 16633 20823 gene locus_tag LOCUS_26970 16633 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 20887 21492 gene locus_tag LOCUS_26980 20887 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 21489 21869 gene locus_tag LOCUS_26990 21489 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 21911 22270 gene locus_tag LOCUS_27000 21911 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 22838 22272 gene locus_tag LOCUS_27010 22838 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 22870 24105 gene locus_tag LOCUS_27020 22870 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 25035 24184 gene locus_tag LOCUS_27030 25035 24184 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108184.1 protein_id gnl|my_center|LOCUS_27030 25381 25755 gene locus_tag LOCUS_27040 gene rsfS 25381 25755 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_27040 25789 26289 gene locus_tag LOCUS_27050 25789 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 26518 28557 gene locus_tag LOCUS_27060 gene ftsH 26518 28557 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_27060 29997 28768 gene locus_tag LOCUS_27070 29997 28768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_27070 30480 32441 gene locus_tag LOCUS_27080 30480 32441 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_27080 34256 33477 gene locus_tag LOCUS_27090 34256 33477 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_27090 36393 34405 gene locus_tag LOCUS_27100 36393 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 36613 37986 gene locus_tag LOCUS_27110 36613 37986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 38319 39608 gene locus_tag LOCUS_27120 38319 39608 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_27120 39748 41229 gene locus_tag LOCUS_27130 39748 41229 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_27130 41421 41831 gene locus_tag LOCUS_27140 gene osmC 41421 41831 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_27140 41999 42712 gene locus_tag LOCUS_27150 gene aat 41999 42712 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 protein_id gnl|my_center|LOCUS_27150 42790 43965 gene locus_tag LOCUS_27160 42790 43965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 44125 45318 gene locus_tag LOCUS_27170 44125 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 45380 46267 gene locus_tag LOCUS_27180 45380 46267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 46295 47011 gene locus_tag LOCUS_27190 46295 47011 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_27190 47122 49083 gene locus_tag LOCUS_27200 47122 49083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 49128 49547 gene locus_tag LOCUS_27210 49128 49547 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_27210 49994 49677 gene locus_tag LOCUS_27220 49994 49677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 50383 51741 gene locus_tag LOCUS_27230 50383 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 51915 52106 gene locus_tag LOCUS_27240 51915 52106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 52252 53505 gene locus_tag LOCUS_27250 gene wbpO 52252 53505 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence039 1811 741 gene locus_tag LOCUS_27260 1811 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2234 3034 gene locus_tag LOCUS_27270 2234 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 5207 3042 gene locus_tag LOCUS_27280 5207 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 7532 5412 gene locus_tag LOCUS_27290 7532 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 7740 8507 gene locus_tag LOCUS_27300 7740 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 8536 9309 gene locus_tag LOCUS_27310 8536 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 11355 9373 gene locus_tag LOCUS_27320 11355 9373 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_27320 14274 11632 gene locus_tag LOCUS_27330 14274 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 14553 16025 gene locus_tag LOCUS_27340 14553 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018490.1 protein_id gnl|my_center|LOCUS_27340 16227 16036 gene locus_tag LOCUS_27350 16227 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 16264 16617 gene locus_tag LOCUS_27360 16264 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 16949 17797 gene locus_tag LOCUS_27370 16949 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 17863 18930 gene locus_tag LOCUS_27380 17863 18930 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_27380 19075 19929 gene locus_tag LOCUS_27390 19075 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_27390 20000 22057 gene locus_tag LOCUS_27400 20000 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 22174 22332 gene locus_tag LOCUS_27410 22174 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 22425 23372 gene locus_tag LOCUS_27420 22425 23372 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203357.1 protein_id gnl|my_center|LOCUS_27420 24911 23427 gene locus_tag LOCUS_27430 24911 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 26384 24954 gene locus_tag LOCUS_27440 26384 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 26639 27514 gene locus_tag LOCUS_27450 26639 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 28073 27618 gene locus_tag LOCUS_27460 28073 27618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 28994 28302 gene locus_tag LOCUS_27470 28994 28302 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_27470 29306 29007 gene locus_tag LOCUS_27480 gene pspE 29306 29007 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187969.1 protein_id gnl|my_center|LOCUS_27480 30328 29534 gene locus_tag LOCUS_27490 30328 29534 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_27490 31872 30487 gene locus_tag LOCUS_27500 31872 30487 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_27500 33225 32266 gene locus_tag LOCUS_27510 gene ftsY 33225 32266 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_27510 33700 33542 gene locus_tag LOCUS_27520 33700 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 33992 33804 gene locus_tag LOCUS_27530 gene rpmG 33992 33804 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_27530 34416 34150 gene locus_tag LOCUS_27540 gene rpmB 34416 34150 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_27540 36302 34878 gene locus_tag LOCUS_27550 36302 34878 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1C6 protein_id gnl|my_center|LOCUS_27550 36782 36396 gene locus_tag LOCUS_27560 36782 36396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 38039 37038 gene locus_tag LOCUS_27570 gene tsaD 38039 37038 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_27570 38183 39151 gene locus_tag LOCUS_27580 38183 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 39397 41640 gene locus_tag LOCUS_27590 39397 41640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 42916 41813 gene locus_tag LOCUS_27600 42916 41813 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964071.1 protein_id gnl|my_center|LOCUS_27600 43191 43763 gene locus_tag LOCUS_27610 gene ftnA 43191 43763 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_27610 43844 44779 gene locus_tag LOCUS_27620 43844 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 45231 45623 gene locus_tag LOCUS_27630 45231 45623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 45651 45884 gene locus_tag LOCUS_27640 45651 45884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 45953 51385 gene locus_tag LOCUS_27650 45953 51385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence040 1094 165 gene locus_tag LOCUS_27660 gene rimK 1094 165 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_27660 1525 1091 gene locus_tag LOCUS_27670 1525 1091 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_27670 1658 2665 gene locus_tag LOCUS_27680 1658 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_27680 3488 2691 gene locus_tag LOCUS_27690 3488 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3506 4666 gene locus_tag LOCUS_27700 3506 4666 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_27700 4865 5578 gene locus_tag LOCUS_27710 4865 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 6058 5627 gene locus_tag LOCUS_27720 6058 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6395 6135 gene locus_tag LOCUS_27730 6395 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 7266 6595 gene locus_tag LOCUS_27740 7266 6595 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_27740 8459 8680 gene locus_tag LOCUS_27750 8459 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_27750 8770 9801 gene locus_tag LOCUS_27760 gene hemE 8770 9801 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_27760 10428 9886 gene locus_tag LOCUS_27770 10428 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 18652 10952 gene locus_tag LOCUS_27780 18652 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 19036 18665 gene locus_tag LOCUS_27790 19036 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 19701 21968 gene locus_tag LOCUS_27800 19701 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 24735 22471 gene locus_tag LOCUS_27810 24735 22471 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_27810 25665 24976 gene locus_tag LOCUS_27820 25665 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 26764 25685 gene locus_tag LOCUS_27830 26764 25685 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_27830 27239 29083 gene locus_tag LOCUS_27840 gene uvrC 27239 29083 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_27840 30866 29202 gene locus_tag LOCUS_27850 30866 29202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 31932 30940 gene locus_tag LOCUS_27860 31932 30940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 32586 31972 gene locus_tag LOCUS_27870 32586 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 34945 32750 gene locus_tag LOCUS_27880 34945 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 35253 34969 gene locus_tag LOCUS_27890 35253 34969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 35585 36568 gene locus_tag LOCUS_27900 35585 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 36713 39937 gene locus_tag LOCUS_27910 36713 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 40427 42166 gene locus_tag LOCUS_27920 40427 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 42358 43167 gene locus_tag LOCUS_27930 42358 43167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 43448 43603 gene locus_tag LOCUS_27940 43448 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 44508 44173 gene locus_tag LOCUS_27950 44508 44173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 45510 45091 gene locus_tag LOCUS_27960 45510 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 45647 45507 gene locus_tag LOCUS_27970 45647 45507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 46323 45736 gene locus_tag LOCUS_27980 46323 45736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_27980 47275 46751 gene locus_tag LOCUS_27990 gene paiA 47275 46751 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_27990 47896 47300 gene locus_tag LOCUS_28000 47896 47300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence041 397 128 gene locus_tag LOCUS_28010 397 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 496 2454 gene locus_tag LOCUS_28020 496 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2632 3087 gene locus_tag LOCUS_28030 2632 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3198 3767 gene locus_tag LOCUS_28040 3198 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3871 4164 gene locus_tag LOCUS_28050 3871 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4233 5522 gene locus_tag LOCUS_28060 gene glyA 4233 5522 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_28060 5584 6222 gene locus_tag LOCUS_28070 5584 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 6775 6230 gene locus_tag LOCUS_28080 6775 6230 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_28080 7410 6913 gene locus_tag LOCUS_28090 7410 6913 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_28090 8266 8721 gene locus_tag LOCUS_28100 8266 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 9009 10202 gene locus_tag LOCUS_28110 9009 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_28110 10297 15306 gene locus_tag LOCUS_28120 10297 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 15466 16326 gene locus_tag LOCUS_28130 15466 16326 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266331.1 protein_id gnl|my_center|LOCUS_28130 17640 16444 gene locus_tag LOCUS_28140 17640 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 17959 19320 gene locus_tag LOCUS_28150 gene hemA 17959 19320 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_28150 20795 19476 gene locus_tag LOCUS_28160 20795 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 20974 21600 gene locus_tag LOCUS_28170 20974 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 21714 22163 gene locus_tag LOCUS_28180 21714 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 22649 22245 gene locus_tag LOCUS_28190 22649 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 23473 22853 gene locus_tag LOCUS_28200 23473 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 24248 23601 gene locus_tag LOCUS_28210 24248 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 24591 25268 gene locus_tag LOCUS_28220 gene scpB 24591 25268 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G4 protein_id gnl|my_center|LOCUS_28220 25404 26594 gene locus_tag LOCUS_28230 25404 26594 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P23 protein_id gnl|my_center|LOCUS_28230 27312 26881 gene locus_tag LOCUS_28240 27312 26881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 27731 27339 gene locus_tag LOCUS_28250 27731 27339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 28271 27762 gene locus_tag LOCUS_28260 28271 27762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 30599 28467 gene locus_tag LOCUS_28270 gene metG 30599 28467 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3M1 protein_id gnl|my_center|LOCUS_28270 30949 31299 gene locus_tag LOCUS_28280 30949 31299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 31575 31925 gene locus_tag LOCUS_28290 31575 31925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 32652 32443 gene locus_tag LOCUS_28300 32652 32443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 33561 33088 gene locus_tag LOCUS_28310 33561 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 34344 33835 gene locus_tag LOCUS_28320 34344 33835 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_28320 34977 34414 gene locus_tag LOCUS_28330 34977 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_28330 36475 35054 gene locus_tag LOCUS_28340 36475 35054 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_28340 38102 36933 gene locus_tag LOCUS_28350 38102 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 39370 38252 gene locus_tag LOCUS_28360 39370 38252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 39547 40599 gene locus_tag LOCUS_28370 39547 40599 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_28370 40741 41259 gene locus_tag LOCUS_28380 40741 41259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 41545 43932 gene locus_tag LOCUS_28390 41545 43932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 44106 45032 gene locus_tag LOCUS_28400 44106 45032 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_28400 45112 46077 gene locus_tag LOCUS_28410 45112 46077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_28410 46163 46984 gene locus_tag LOCUS_28420 gene hmuV 46163 46984 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_28420 47532 47002 gene locus_tag LOCUS_28430 47532 47002 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence042 488 1531 gene locus_tag LOCUS_28440 488 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1806 2948 gene locus_tag LOCUS_28450 1806 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3274 3972 gene locus_tag LOCUS_28460 3274 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 5038 4115 gene locus_tag LOCUS_28470 5038 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 5213 11554 gene locus_tag LOCUS_28480 5213 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 13007 11931 gene locus_tag LOCUS_28490 13007 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_28490 14975 13113 gene locus_tag LOCUS_28500 gene msbA 14975 13113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_28500 15285 16985 gene locus_tag LOCUS_28510 gene pafA 15285 16985 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_28510 17347 23439 gene locus_tag LOCUS_28520 17347 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 24056 23577 gene locus_tag LOCUS_28530 24056 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 25327 24098 gene locus_tag LOCUS_28540 25327 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 25689 28058 gene locus_tag LOCUS_28550 25689 28058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 28853 28143 gene locus_tag LOCUS_28560 28853 28143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 29216 28884 gene locus_tag LOCUS_28570 gene csaA 29216 28884 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_28570 29749 29360 gene locus_tag LOCUS_28580 29749 29360 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_28580 30342 29866 gene locus_tag LOCUS_28590 gene greA 30342 29866 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_28590 31291 30611 gene locus_tag LOCUS_28600 31291 30611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 32925 31669 gene locus_tag LOCUS_28610 32925 31669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_28610 34005 33031 gene locus_tag LOCUS_28620 34005 33031 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_28620 34327 34046 gene locus_tag LOCUS_28630 34327 34046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 35211 34582 gene locus_tag LOCUS_28640 35211 34582 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_28640 35617 36072 gene locus_tag LOCUS_28650 35617 36072 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_28650 36676 36224 gene locus_tag LOCUS_28660 36676 36224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_28660 36948 37229 gene locus_tag LOCUS_28670 36948 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 37434 38243 gene locus_tag LOCUS_28680 37434 38243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 39057 46388 gene locus_tag LOCUS_28690 39057 46388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 46456 46701 gene locus_tag LOCUS_28700 46456 46701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence043 679 134 gene locus_tag LOCUS_28710 679 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_28710 2184 883 gene locus_tag LOCUS_28720 2184 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2600 3337 gene locus_tag LOCUS_28730 2600 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3964 3416 gene locus_tag LOCUS_28740 3964 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 4281 3967 gene locus_tag LOCUS_28750 4281 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 4945 4250 gene locus_tag LOCUS_28760 4945 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 5221 7764 gene locus_tag LOCUS_28770 5221 7764 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_28770 7840 8307 gene locus_tag LOCUS_28780 7840 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 8426 8998 gene locus_tag LOCUS_28790 8426 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 9071 9766 gene locus_tag LOCUS_28800 9071 9766 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_28800 9819 10400 gene locus_tag LOCUS_28810 9819 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_28810 10522 14091 gene locus_tag LOCUS_28820 10522 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 14383 15441 gene locus_tag LOCUS_28830 14383 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 16440 15712 gene locus_tag LOCUS_28840 16440 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 16957 20430 gene locus_tag LOCUS_28850 16957 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 20566 21144 gene locus_tag LOCUS_28860 20566 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 22476 21778 gene locus_tag LOCUS_28870 22476 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 22579 22833 gene locus_tag LOCUS_28880 22579 22833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 23376 22882 gene locus_tag LOCUS_28890 23376 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 24786 23461 gene locus_tag LOCUS_28900 gene phrB1 24786 23461 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_28900 25371 24862 gene locus_tag LOCUS_28910 25371 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 26435 25398 gene locus_tag LOCUS_28920 26435 25398 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201655.1 protein_id gnl|my_center|LOCUS_28920 26871 26449 gene locus_tag LOCUS_28930 26871 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_28930 27700 26885 gene locus_tag LOCUS_28940 27700 26885 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_28940 28482 27907 gene locus_tag LOCUS_28950 28482 27907 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_28950 28925 32146 gene locus_tag LOCUS_28960 28925 32146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 36467 32460 gene locus_tag LOCUS_28970 36467 32460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 36715 37905 gene locus_tag LOCUS_28980 36715 37905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 38509 38012 gene locus_tag LOCUS_28990 38509 38012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 40972 38696 gene locus_tag LOCUS_29000 40972 38696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_29000 41314 41541 gene locus_tag LOCUS_29010 41314 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 41789 42826 gene locus_tag LOCUS_29020 41789 42826 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_29020 43024 44322 gene locus_tag LOCUS_29030 43024 44322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 44843 44400 gene locus_tag LOCUS_29040 gene rplI 44843 44400 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_29040 45160 44903 gene locus_tag LOCUS_29050 gene rpsR 45160 44903 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH8 protein_id gnl|my_center|LOCUS_29050 45721 45338 gene locus_tag LOCUS_29060 gene rpsF 45721 45338 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_29060 45955 46515 gene locus_tag LOCUS_29070 45955 46515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence044 603 1445 gene locus_tag LOCUS_29080 603 1445 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 protein_id gnl|my_center|LOCUS_29080 2000 2404 gene locus_tag LOCUS_29090 2000 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2629 3189 gene locus_tag LOCUS_29100 gene hpt 2629 3189 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_29100 3367 4047 gene locus_tag LOCUS_29110 3367 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 6340 4124 gene locus_tag LOCUS_29120 6340 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 6806 8149 gene locus_tag LOCUS_29130 6806 8149 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_29130 8755 8396 gene locus_tag LOCUS_29140 8755 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 10061 8883 gene locus_tag LOCUS_29150 10061 8883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_29150 11932 10406 gene locus_tag LOCUS_29160 11932 10406 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_29160 13628 12120 gene locus_tag LOCUS_29170 13628 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 14125 15327 gene locus_tag LOCUS_29180 14125 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 15760 17109 gene locus_tag LOCUS_29190 15760 17109 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_29190 17514 17188 gene locus_tag LOCUS_29200 17514 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 18926 17577 gene locus_tag LOCUS_29210 18926 17577 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_29210 20565 19072 gene locus_tag LOCUS_29220 20565 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_29220 21237 20662 gene locus_tag LOCUS_29230 21237 20662 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_29230 23101 21344 gene locus_tag LOCUS_29240 23101 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 23705 23214 gene locus_tag LOCUS_29250 gene coaD 23705 23214 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_29250 24502 23726 gene locus_tag LOCUS_29260 24502 23726 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_29260 24612 25085 gene locus_tag LOCUS_29270 24612 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_29270 25640 25152 gene locus_tag LOCUS_29280 25640 25152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 26423 25869 gene locus_tag LOCUS_29290 26423 25869 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_29290 27565 26498 gene locus_tag LOCUS_29300 27565 26498 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_29300 28744 27644 gene locus_tag LOCUS_29310 28744 27644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 29427 28816 gene locus_tag LOCUS_29320 29427 28816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 29974 29474 gene locus_tag LOCUS_29330 29974 29474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 30529 30095 gene locus_tag LOCUS_29340 30529 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 31314 30586 gene locus_tag LOCUS_29350 31314 30586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_29350 32532 31498 gene locus_tag LOCUS_29360 32532 31498 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HBH6 protein_id gnl|my_center|LOCUS_29360 33558 32662 gene locus_tag LOCUS_29370 33558 32662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 36000 33709 gene locus_tag LOCUS_29380 36000 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 36346 38757 gene locus_tag LOCUS_29390 36346 38757 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_29390 38899 39699 gene locus_tag LOCUS_29400 38899 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 40067 40720 gene locus_tag LOCUS_29410 40067 40720 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_29410 41938 40841 gene locus_tag LOCUS_29420 gene ychF 41938 40841 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_29420 42251 43558 gene locus_tag LOCUS_29430 42251 43558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 44944 43844 gene locus_tag LOCUS_29440 44944 43844 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_29440 46118 45042 gene locus_tag LOCUS_29450 46118 45042 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence045 147 518 gene locus_tag LOCUS_29460 147 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1580 522 gene locus_tag LOCUS_29470 1580 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2403 1723 gene locus_tag LOCUS_29480 gene queE 2403 1723 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_29480 2955 4115 gene locus_tag LOCUS_29490 2955 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5909 4221 gene locus_tag LOCUS_29500 5909 4221 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_29500 6842 5973 gene locus_tag LOCUS_29510 gene glsA 6842 5973 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_29510 7326 6982 gene locus_tag LOCUS_29520 7326 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 7483 7773 gene locus_tag LOCUS_29530 7483 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_29530 9075 8332 gene locus_tag LOCUS_29540 9075 8332 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_29540 9343 9900 gene locus_tag LOCUS_29550 9343 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 10099 10887 gene locus_tag LOCUS_29560 gene troB 10099 10887 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_29560 11391 11026 gene locus_tag LOCUS_29570 11391 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 11808 11623 gene locus_tag LOCUS_29580 11808 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 13593 11842 gene locus_tag LOCUS_29590 13593 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_29590 14873 13878 gene locus_tag LOCUS_29600 14873 13878 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_29600 15567 15100 gene locus_tag LOCUS_29610 gene dut 15567 15100 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_29610 16082 16810 gene locus_tag LOCUS_29620 16082 16810 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_29620 16922 17668 gene locus_tag LOCUS_29630 gene sau96I-like 16922 17668 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_29630 17672 18892 gene locus_tag LOCUS_29640 17672 18892 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_29640 18905 19522 gene locus_tag LOCUS_29650 18905 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_29650 20260 19544 gene locus_tag LOCUS_29660 20260 19544 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_29660 20474 21829 gene locus_tag LOCUS_29670 gene gdhA 20474 21829 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_29670 22404 21907 gene locus_tag LOCUS_29680 22404 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 23105 22488 gene locus_tag LOCUS_29690 23105 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 23947 23129 gene locus_tag LOCUS_29700 gene dinD 23947 23129 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_29700 25069 24056 gene locus_tag LOCUS_29710 25069 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 25282 26445 gene locus_tag LOCUS_29720 gene mutY 25282 26445 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_29720 26556 27047 gene locus_tag LOCUS_29730 26556 27047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 27071 28468 gene locus_tag LOCUS_29740 27071 28468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 28610 29167 gene locus_tag LOCUS_29750 28610 29167 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_29750 30613 29402 gene locus_tag LOCUS_29760 30613 29402 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_29760 30892 31491 gene locus_tag LOCUS_29770 gene recR 30892 31491 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_29770 32012 31500 gene locus_tag LOCUS_29780 32012 31500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 33101 32172 gene locus_tag LOCUS_29790 33101 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 33779 33378 gene locus_tag LOCUS_29800 33779 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 34682 34035 gene locus_tag LOCUS_29810 gene rpe 34682 34035 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_29810 36777 34774 gene locus_tag LOCUS_29820 36777 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 38504 36903 gene locus_tag LOCUS_29830 gene rny 38504 36903 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_29830 40560 39298 gene locus_tag LOCUS_29840 40560 39298 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 protein_id gnl|my_center|LOCUS_29840 40871 40695 gene locus_tag LOCUS_29850 40871 40695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 41328 40882 gene locus_tag LOCUS_29860 41328 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 41916 41542 gene locus_tag LOCUS_29870 41916 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 42654 42121 gene locus_tag LOCUS_29880 42654 42121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_29880 44685 42772 gene locus_tag LOCUS_29890 44685 42772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 44875 46335 gene locus_tag LOCUS_29900 44875 46335 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence046 1888 536 gene locus_tag LOCUS_29910 1888 536 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_29910 3739 2570 gene locus_tag LOCUS_29920 3739 2570 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_29920 4431 3895 gene locus_tag LOCUS_29930 4431 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 4843 4475 gene locus_tag LOCUS_29940 4843 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 5355 6629 gene locus_tag LOCUS_29950 5355 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 7168 6908 gene locus_tag LOCUS_29960 gene purS 7168 6908 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_29960 7965 8447 gene locus_tag LOCUS_29970 7965 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 11455 8525 gene locus_tag LOCUS_29980 11455 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 12427 11573 gene locus_tag LOCUS_29990 gene mntD 12427 11573 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_29990 12601 12900 gene locus_tag LOCUS_30000 12601 12900 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_30000 13268 12969 gene locus_tag LOCUS_30010 13268 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 13294 13461 gene locus_tag LOCUS_30020 13294 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 14056 13640 gene locus_tag LOCUS_30030 14056 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_30030 15300 14506 gene locus_tag LOCUS_30040 15300 14506 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_30040 17429 15336 gene locus_tag LOCUS_30050 17429 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 19892 17628 gene locus_tag LOCUS_30060 19892 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 21154 20039 gene locus_tag LOCUS_30070 21154 20039 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_30070 24746 21267 gene locus_tag LOCUS_30080 24746 21267 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 protein_id gnl|my_center|LOCUS_30080 25498 26997 gene locus_tag LOCUS_30090 25498 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 27274 28353 gene locus_tag LOCUS_30100 gene phbC 27274 28353 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_30100 29282 28521 gene locus_tag LOCUS_30110 29282 28521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 30216 29272 gene locus_tag LOCUS_30120 30216 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 30589 31902 gene locus_tag LOCUS_30130 gene fabZ 30589 31902 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_30130 33235 32003 gene locus_tag LOCUS_30140 33235 32003 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_30140 34039 33242 gene locus_tag LOCUS_30150 34039 33242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 35825 34098 gene locus_tag LOCUS_30160 35825 34098 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_30160 36361 37830 gene locus_tag LOCUS_30170 gene asnS 36361 37830 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_30170 37973 39298 gene locus_tag LOCUS_30180 37973 39298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 39764 40615 gene locus_tag LOCUS_30190 39764 40615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 40728 41567 gene locus_tag LOCUS_30200 gene yfbL 40728 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306461.1 protein_id gnl|my_center|LOCUS_30200 42894 41659 gene locus_tag LOCUS_30210 42894 41659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 43477 44487 gene locus_tag LOCUS_30220 43477 44487 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_30220 45003 44554 gene locus_tag LOCUS_30230 45003 44554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 45529 45116 gene locus_tag LOCUS_30240 45529 45116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence047 6483 5722 gene locus_tag LOCUS_30250 6483 5722 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 protein_id gnl|my_center|LOCUS_30250 6955 7386 gene locus_tag LOCUS_30260 6955 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 8463 7471 gene locus_tag LOCUS_30270 8463 7471 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_30270 10303 8603 gene locus_tag LOCUS_30280 10303 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 11438 10425 gene locus_tag LOCUS_30290 11438 10425 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_30290 12089 15214 gene locus_tag LOCUS_30300 12089 15214 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_30300 15421 16875 gene locus_tag LOCUS_30310 15421 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 16967 17788 gene locus_tag LOCUS_30320 16967 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 17879 18778 gene locus_tag LOCUS_30330 gene yeeZ 17879 18778 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_30330 19031 19207 gene locus_tag LOCUS_30340 19031 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 19468 21006 gene locus_tag LOCUS_30350 19468 21006 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_30350 21376 22050 gene locus_tag LOCUS_30360 21376 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 23936 22206 gene locus_tag LOCUS_30370 23936 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 24193 24121 gene locus_tag LOCUS_t00300 24193 24121 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24737 24249 gene locus_tag LOCUS_30380 24737 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 26308 24998 gene locus_tag LOCUS_30390 26308 24998 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_30390 27684 26686 gene locus_tag LOCUS_30400 27684 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_30400 27683 28687 gene locus_tag LOCUS_30410 27683 28687 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_30410 29611 28778 gene locus_tag LOCUS_30420 29611 28778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 30368 29631 gene locus_tag LOCUS_30430 30368 29631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 31880 30438 gene locus_tag LOCUS_30440 31880 30438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 33976 31910 gene locus_tag LOCUS_30450 33976 31910 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_30450 35013 34126 gene locus_tag LOCUS_30460 35013 34126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 35314 36576 gene locus_tag LOCUS_30470 35314 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 37377 36586 gene locus_tag LOCUS_30480 37377 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 38671 37367 gene locus_tag LOCUS_30490 38671 37367 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_30490 40261 38756 gene locus_tag LOCUS_30500 40261 38756 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_30500 40890 40381 gene locus_tag LOCUS_30510 40890 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence048 2062 1427 gene locus_tag LOCUS_30520 2062 1427 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_30520 2266 2718 gene locus_tag LOCUS_30530 2266 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 4131 2806 gene locus_tag LOCUS_30540 4131 2806 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_30540 6030 4390 gene locus_tag LOCUS_30550 6030 4390 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GR0 protein_id gnl|my_center|LOCUS_30550 7036 11601 gene locus_tag LOCUS_30560 7036 11601 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882068.1 protein_id gnl|my_center|LOCUS_30560 11779 13284 gene locus_tag LOCUS_30570 gene gltD 11779 13284 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_30570 13365 14534 gene locus_tag LOCUS_30580 13365 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 14569 15288 gene locus_tag LOCUS_30590 14569 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 16401 15292 gene locus_tag LOCUS_30600 16401 15292 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_30600 17014 16511 gene locus_tag LOCUS_30610 17014 16511 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_30610 17444 18046 gene locus_tag LOCUS_30620 17444 18046 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_30620 18126 19109 gene locus_tag LOCUS_30630 18126 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 19156 20208 gene locus_tag LOCUS_30640 19156 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_30640 20453 22183 gene locus_tag LOCUS_30650 20453 22183 CDS product sodium/hydrogen exchanger family/TrkA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_30650 22473 23090 gene locus_tag LOCUS_30660 22473 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 23080 23706 gene locus_tag LOCUS_30670 23080 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 23708 24355 gene locus_tag LOCUS_30680 gene coaE 23708 24355 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E081 protein_id gnl|my_center|LOCUS_30680 25428 24442 gene locus_tag LOCUS_30690 25428 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 27901 26015 gene locus_tag LOCUS_30700 27901 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 28055 29323 gene locus_tag LOCUS_30710 28055 29323 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_30710 29341 29760 gene locus_tag LOCUS_30720 29341 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 30015 31496 gene locus_tag LOCUS_30730 30015 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 32058 31630 gene locus_tag LOCUS_30740 32058 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 32585 32064 gene locus_tag LOCUS_30750 32585 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 33328 32585 gene locus_tag LOCUS_30760 33328 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 35098 33410 gene locus_tag LOCUS_30770 35098 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 39131 35295 gene locus_tag LOCUS_30780 39131 35295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 40751 39282 gene locus_tag LOCUS_30790 40751 39282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence049 618 202 gene locus_tag LOCUS_30800 618 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 999 664 gene locus_tag LOCUS_30810 999 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1920 1240 gene locus_tag LOCUS_30820 1920 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2095 2919 gene locus_tag LOCUS_30830 2095 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3497 3877 gene locus_tag LOCUS_30840 3497 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 4112 7231 gene locus_tag LOCUS_30850 4112 7231 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_30850 8235 7525 gene locus_tag LOCUS_30860 8235 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 8925 8245 gene locus_tag LOCUS_30870 8925 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 9724 8939 gene locus_tag LOCUS_30880 9724 8939 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_30880 11436 9898 gene locus_tag LOCUS_30890 11436 9898 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_30890 12195 11605 gene locus_tag LOCUS_30900 12195 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_30900 12752 12270 gene locus_tag LOCUS_30910 12752 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 13014 13379 gene locus_tag LOCUS_30920 13014 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 14580 13387 gene locus_tag LOCUS_30930 14580 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 15343 14660 gene locus_tag LOCUS_30940 15343 14660 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_30940 15609 16739 gene locus_tag LOCUS_30950 gene tgt 15609 16739 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_30950 16752 17597 gene locus_tag LOCUS_30960 16752 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 17626 18204 gene locus_tag LOCUS_30970 17626 18204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 19125 18340 gene locus_tag LOCUS_30980 19125 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 20412 19345 gene locus_tag LOCUS_30990 20412 19345 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_30990 20695 21453 gene locus_tag LOCUS_31000 gene cobS 20695 21453 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_31000 21580 24447 gene locus_tag LOCUS_31010 21580 24447 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_31010 25045 24518 gene locus_tag LOCUS_31020 25045 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 25993 28626 gene locus_tag LOCUS_31030 gene alaS 25993 28626 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_31030 29167 29550 gene locus_tag LOCUS_31040 29167 29550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 30425 29604 gene locus_tag LOCUS_31050 30425 29604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 30535 31305 gene locus_tag LOCUS_31060 30535 31305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 31997 31362 gene locus_tag LOCUS_31070 gene tdk 31997 31362 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_31070 33087 32143 gene locus_tag LOCUS_31080 33087 32143 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_31080 34559 33198 gene locus_tag LOCUS_31090 gene dacB 34559 33198 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261249.1 protein_id gnl|my_center|LOCUS_31090 34684 35094 gene locus_tag LOCUS_31100 34684 35094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 35818 35261 gene locus_tag LOCUS_31110 35818 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 36631 35951 gene locus_tag LOCUS_31120 gene msrA 36631 35951 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_31120 37988 37050 gene locus_tag LOCUS_31130 37988 37050 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_31130 38988 38089 gene locus_tag LOCUS_31140 38988 38089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 39200 39673 gene locus_tag LOCUS_31150 39200 39673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 39695 40330 gene locus_tag LOCUS_31160 gene gpmA 39695 40330 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence050 711 304 gene locus_tag LOCUS_31170 711 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2317 947 gene locus_tag LOCUS_31180 2317 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2565 3317 gene locus_tag LOCUS_31190 2565 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3339 3779 gene locus_tag LOCUS_31200 3339 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3792 4097 gene locus_tag LOCUS_31210 3792 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4208 4744 gene locus_tag LOCUS_31220 4208 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 4749 5015 gene locus_tag LOCUS_31230 4749 5015 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_31230 6787 5156 gene locus_tag LOCUS_31240 gene ndhD 6787 5156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_31240 7468 6935 gene locus_tag LOCUS_31250 7468 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 7759 8076 gene locus_tag LOCUS_31260 7759 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 8341 10095 gene locus_tag LOCUS_31270 8341 10095 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_31270 10233 10817 gene locus_tag LOCUS_31280 10233 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 11338 10820 gene locus_tag LOCUS_31290 11338 10820 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_31290 11816 11400 gene locus_tag LOCUS_31300 11816 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 12110 12640 gene locus_tag LOCUS_31310 12110 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 12783 14219 gene locus_tag LOCUS_31320 12783 14219 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_31320 15230 15736 gene locus_tag LOCUS_31330 15230 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 15766 16236 gene locus_tag LOCUS_31340 15766 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 16734 16339 gene locus_tag LOCUS_31350 16734 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 17061 17516 gene locus_tag LOCUS_31360 gene dtd 17061 17516 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_31360 17768 19138 gene locus_tag LOCUS_31370 17768 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 19113 20453 gene locus_tag LOCUS_31380 19113 20453 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_31380 20970 20521 gene locus_tag LOCUS_31390 20970 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 21021 21617 gene locus_tag LOCUS_31400 21021 21617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 21673 22122 gene locus_tag LOCUS_31410 21673 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_31410 22125 22859 gene locus_tag LOCUS_31420 22125 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 24669 22936 gene locus_tag LOCUS_31430 24669 22936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_31430 24908 25636 gene locus_tag LOCUS_31440 24908 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 25816 27558 gene locus_tag LOCUS_31450 25816 27558 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_31450 27571 28230 gene locus_tag LOCUS_31460 27571 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 28237 29736 gene locus_tag LOCUS_31470 28237 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 29888 31201 gene locus_tag LOCUS_31480 29888 31201 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_31480 31982 32314 gene locus_tag LOCUS_31490 31982 32314 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_31490 32465 33388 gene locus_tag LOCUS_31500 32465 33388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 34177 35772 gene locus_tag LOCUS_31510 34177 35772 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_31510 36077 38266 gene locus_tag LOCUS_31520 36077 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 38272 38964 gene locus_tag LOCUS_31530 38272 38964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 40158 39055 gene locus_tag LOCUS_31540 40158 39055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence051 4578 2044 gene locus_tag LOCUS_31550 4578 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 5479 4682 gene locus_tag LOCUS_31560 5479 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 6246 5485 gene locus_tag LOCUS_31570 6246 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 7198 6236 gene locus_tag LOCUS_31580 7198 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 8192 7284 gene locus_tag LOCUS_31590 gene yeiH 8192 7284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263101.1 protein_id gnl|my_center|LOCUS_31590 10830 8410 gene locus_tag LOCUS_31600 10830 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 12907 11006 gene locus_tag LOCUS_31610 12907 11006 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_31610 14232 13087 gene locus_tag LOCUS_31620 14232 13087 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_31620 15187 14453 gene locus_tag LOCUS_31630 15187 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_31630 16033 15215 gene locus_tag LOCUS_31640 16033 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 16408 18120 gene locus_tag LOCUS_31650 16408 18120 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_31650 18625 18209 gene locus_tag LOCUS_31660 18625 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 19125 18709 gene locus_tag LOCUS_31670 19125 18709 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_31670 19535 20452 gene locus_tag LOCUS_31680 gene gldB 19535 20452 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_31680 22717 20501 gene locus_tag LOCUS_31690 22717 20501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_31690 23092 23298 gene locus_tag LOCUS_31700 23092 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 23386 25239 gene locus_tag LOCUS_31710 23386 25239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 25919 25380 gene locus_tag LOCUS_31720 25919 25380 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_31720 26258 28087 gene locus_tag LOCUS_31730 26258 28087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 28382 28963 gene locus_tag LOCUS_31740 gene miaE 28382 28963 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_31740 28973 29575 gene locus_tag LOCUS_31750 28973 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 31238 29628 gene locus_tag LOCUS_31760 31238 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 33740 31326 gene locus_tag LOCUS_31770 33740 31326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_31770 35094 33934 gene locus_tag LOCUS_31780 gene alr 35094 33934 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_31780 >Feature sequence052 196 1662 gene locus_tag LOCUS_31790 196 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3083 1755 gene locus_tag LOCUS_31800 gene murA 3083 1755 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_31800 3438 3785 gene locus_tag LOCUS_31810 3438 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3845 5149 gene locus_tag LOCUS_31820 3845 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_31820 5183 5488 gene locus_tag LOCUS_31830 5183 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 9646 5564 gene locus_tag LOCUS_31840 9646 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 9872 11785 gene locus_tag LOCUS_31850 9872 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 14779 11942 gene locus_tag LOCUS_31860 gene sucA 14779 11942 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_31860 15135 17270 gene locus_tag LOCUS_31870 15135 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 17562 17377 gene locus_tag LOCUS_31880 17562 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 19708 17744 gene locus_tag LOCUS_31890 19708 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 20705 20031 gene locus_tag LOCUS_31900 20705 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 21725 21030 gene locus_tag LOCUS_31910 21725 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 21907 23322 gene locus_tag LOCUS_31920 gene rhlE 21907 23322 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_31920 25873 23807 gene locus_tag LOCUS_31930 25873 23807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 26377 25913 gene locus_tag LOCUS_31940 26377 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 27022 26486 gene locus_tag LOCUS_31950 27022 26486 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_31950 27875 27261 gene locus_tag LOCUS_31960 27875 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 31175 28062 gene locus_tag LOCUS_31970 31175 28062 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_31970 32327 31263 gene locus_tag LOCUS_31980 32327 31263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 32856 32533 gene locus_tag LOCUS_31990 32856 32533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 35692 33044 gene locus_tag LOCUS_32000 35692 33044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 36058 37386 gene locus_tag LOCUS_32010 gene mvaA 36058 37386 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_32010 37508 38440 gene locus_tag LOCUS_32020 37508 38440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_32020 39655 38561 gene locus_tag LOCUS_32030 39655 38561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence053 75 404 gene locus_tag LOCUS_32040 75 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 974 426 gene locus_tag LOCUS_32050 974 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 1951 1001 gene locus_tag LOCUS_32060 1951 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3415 2264 gene locus_tag LOCUS_32070 gene aroB 3415 2264 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_32070 5981 3858 gene locus_tag LOCUS_32080 5981 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 7488 6235 gene locus_tag LOCUS_32090 7488 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 7853 8938 gene locus_tag LOCUS_32100 7853 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9000 9275 gene locus_tag LOCUS_32110 9000 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_32110 9918 9583 gene locus_tag LOCUS_32120 9918 9583 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_32120 10213 9911 gene locus_tag LOCUS_32130 10213 9911 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_32130 14335 10334 gene locus_tag LOCUS_32140 14335 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 18615 14578 gene locus_tag LOCUS_32150 18615 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 18993 19442 gene locus_tag LOCUS_32160 18993 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 19785 21272 gene locus_tag LOCUS_32170 19785 21272 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_32170 21426 22403 gene locus_tag LOCUS_32180 gene trxB1 21426 22403 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_32180 23087 22482 gene locus_tag LOCUS_32190 23087 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 23383 23595 gene locus_tag LOCUS_32200 23383 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 25230 23602 gene locus_tag LOCUS_32210 25230 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 27392 25302 gene locus_tag LOCUS_32220 27392 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 27959 28201 gene locus_tag LOCUS_32230 27959 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 28494 29462 gene locus_tag LOCUS_32240 28494 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_32240 29465 29689 gene locus_tag LOCUS_32250 29465 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 29697 30710 gene locus_tag LOCUS_32260 29697 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 30874 32337 gene locus_tag LOCUS_32270 30874 32337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 32350 34542 gene locus_tag LOCUS_32280 32350 34542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_32280 34548 35825 gene locus_tag LOCUS_32290 34548 35825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 35942 37264 gene locus_tag LOCUS_32300 gene rimO 35942 37264 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_32300 37376 37447 gene locus_tag LOCUS_t00310 37376 37447 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 37673 38851 gene locus_tag LOCUS_32310 37673 38851 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776823.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence054 158 643 gene locus_tag LOCUS_32320 158 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 727 1476 gene locus_tag LOCUS_32330 727 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1572 3464 gene locus_tag LOCUS_32340 1572 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3583 4203 gene locus_tag LOCUS_32350 3583 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 6059 4218 gene locus_tag LOCUS_32360 6059 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 6177 7457 gene locus_tag LOCUS_32370 6177 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7763 8563 gene locus_tag LOCUS_32380 7763 8563 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_32380 8719 9522 gene locus_tag LOCUS_32390 8719 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 9735 10934 gene locus_tag LOCUS_32400 9735 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 11600 11190 gene locus_tag LOCUS_32410 11600 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 11666 12034 gene locus_tag LOCUS_32420 11666 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 12525 15215 gene locus_tag LOCUS_32430 gene gyrA 12525 15215 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_32430 15372 16580 gene locus_tag LOCUS_32440 15372 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 17380 18048 gene locus_tag LOCUS_32450 17380 18048 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_32450 18274 19311 gene locus_tag LOCUS_32460 gene murB 18274 19311 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_32460 21079 19430 gene locus_tag LOCUS_32470 gene speE2 21079 19430 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 protein_id gnl|my_center|LOCUS_32470 21316 24354 gene locus_tag LOCUS_32480 21316 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 24555 25232 gene locus_tag LOCUS_32490 24555 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 26888 25326 gene locus_tag LOCUS_32500 26888 25326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 28613 27033 gene locus_tag LOCUS_32510 28613 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 29987 28803 gene locus_tag LOCUS_32520 gene fjo30 29987 28803 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_32520 31171 30041 gene locus_tag LOCUS_32530 31171 30041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 31855 31316 gene locus_tag LOCUS_32540 31855 31316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_32540 32478 31969 gene locus_tag LOCUS_32550 32478 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 33635 32700 gene locus_tag LOCUS_32560 33635 32700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 34516 33878 gene locus_tag LOCUS_32570 34516 33878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 35314 34517 gene locus_tag LOCUS_32580 35314 34517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 36216 35365 gene locus_tag LOCUS_32590 36216 35365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 36843 36358 gene locus_tag LOCUS_32600 36843 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 37401 36877 gene locus_tag LOCUS_32610 37401 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 38558 37452 gene locus_tag LOCUS_32620 gene holB 38558 37452 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_32620 38739 39191 gene locus_tag LOCUS_32630 38739 39191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence055 264 1043 gene locus_tag LOCUS_32640 264 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1130 1648 gene locus_tag LOCUS_32650 gene ribH 1130 1648 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_32650 1875 4178 gene locus_tag LOCUS_32660 1875 4178 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_32660 4927 4274 gene locus_tag LOCUS_32670 4927 4274 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_32670 5110 5892 gene locus_tag LOCUS_32680 5110 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 8341 6320 gene locus_tag LOCUS_32690 8341 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765626.1 protein_id gnl|my_center|LOCUS_32690 8691 9149 gene locus_tag LOCUS_32700 8691 9149 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_32700 9723 9232 gene locus_tag LOCUS_32710 9723 9232 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_32710 12020 9738 gene locus_tag LOCUS_32720 12020 9738 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_32720 12568 12161 gene locus_tag LOCUS_32730 12568 12161 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L0 protein_id gnl|my_center|LOCUS_32730 14402 12831 gene locus_tag LOCUS_32740 14402 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 14837 15256 gene locus_tag LOCUS_32750 14837 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 16355 15549 gene locus_tag LOCUS_32760 16355 15549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_32760 16587 17729 gene locus_tag LOCUS_32770 16587 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 17999 18313 gene locus_tag LOCUS_32780 17999 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 18379 19215 gene locus_tag LOCUS_32790 18379 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 19514 19188 gene locus_tag LOCUS_32800 19514 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 20381 19617 gene locus_tag LOCUS_32810 20381 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 20865 20470 gene locus_tag LOCUS_32820 20865 20470 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_32820 21218 22075 gene locus_tag LOCUS_32830 gene dinD 21218 22075 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_32830 22332 26567 gene locus_tag LOCUS_32840 22332 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 26711 28327 gene locus_tag LOCUS_32850 26711 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 28369 29190 gene locus_tag LOCUS_32860 28369 29190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 29480 31027 gene locus_tag LOCUS_32870 29480 31027 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202267.1 protein_id gnl|my_center|LOCUS_32870 32914 31037 gene locus_tag LOCUS_32880 32914 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 34351 33080 gene locus_tag LOCUS_32890 gene hisD 34351 33080 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_32890 35692 34490 gene locus_tag LOCUS_32900 35692 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_32900 37157 35736 gene locus_tag LOCUS_32910 37157 35736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_32910 37568 37263 gene locus_tag LOCUS_32920 37568 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence056 428 1264 gene locus_tag LOCUS_32930 gene surE 428 1264 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_32930 2720 1416 gene locus_tag LOCUS_32940 2720 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3472 4248 gene locus_tag LOCUS_32950 3472 4248 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_32950 4528 6315 gene locus_tag LOCUS_32960 4528 6315 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_32960 6495 7334 gene locus_tag LOCUS_32970 6495 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 7541 7936 gene locus_tag LOCUS_32980 7541 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 8395 8138 gene locus_tag LOCUS_32990 8395 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 8277 9977 gene locus_tag LOCUS_33000 gene pyrG 8277 9977 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_33000 10022 10597 gene locus_tag LOCUS_33010 10022 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_33010 10601 10804 gene locus_tag LOCUS_33020 10601 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 10884 12722 gene locus_tag LOCUS_33030 gene yidC 10884 12722 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_33030 12763 12930 gene locus_tag LOCUS_33040 12763 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 18404 12903 gene locus_tag LOCUS_33050 18404 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 19727 18993 gene locus_tag LOCUS_33060 19727 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 22106 19800 gene locus_tag LOCUS_33070 22106 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 23300 22521 gene locus_tag LOCUS_33080 23300 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 23564 23878 gene locus_tag LOCUS_33090 23564 23878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_33090 23996 24487 gene locus_tag LOCUS_33100 23996 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 25427 24591 gene locus_tag LOCUS_33110 25427 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 25630 27069 gene locus_tag LOCUS_33120 25630 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 28238 27189 gene locus_tag LOCUS_33130 gene dcm 28238 27189 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D818 protein_id gnl|my_center|LOCUS_33130 29364 28426 gene locus_tag LOCUS_33140 29364 28426 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_33140 30087 29371 gene locus_tag LOCUS_33150 30087 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 30756 30139 gene locus_tag LOCUS_33160 30756 30139 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_33160 31618 30785 gene locus_tag LOCUS_33170 31618 30785 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_33170 31994 31641 gene locus_tag LOCUS_33180 31994 31641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 32666 32013 gene locus_tag LOCUS_33190 32666 32013 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085391.1 protein_id gnl|my_center|LOCUS_33190 33087 32677 gene locus_tag LOCUS_33200 gene osmC 33087 32677 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_33200 33968 33195 gene locus_tag LOCUS_33210 33968 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_33210 34891 34145 gene locus_tag LOCUS_33220 34891 34145 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089009.1 protein_id gnl|my_center|LOCUS_33220 35107 35445 gene locus_tag LOCUS_33230 35107 35445 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_33230 36532 35642 gene locus_tag LOCUS_33240 36532 35642 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_33240 37300 36578 gene locus_tag LOCUS_33250 gene rsmI 37300 36578 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_33250 >Feature sequence057 2242 380 gene locus_tag LOCUS_33260 2242 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4783 2507 gene locus_tag LOCUS_33270 4783 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 6261 4795 gene locus_tag LOCUS_33280 6261 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 7143 6352 gene locus_tag LOCUS_33290 7143 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 7580 8095 gene locus_tag LOCUS_33300 7580 8095 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461026.1 protein_id gnl|my_center|LOCUS_33300 8469 9869 gene locus_tag LOCUS_33310 8469 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_33310 9995 12841 gene locus_tag LOCUS_33320 9995 12841 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_33320 13693 14292 gene locus_tag LOCUS_33330 13693 14292 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_33330 15451 14552 gene locus_tag LOCUS_33340 15451 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932850.1 protein_id gnl|my_center|LOCUS_33340 16616 15666 gene locus_tag LOCUS_33350 16616 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 17082 17408 gene locus_tag LOCUS_33360 17082 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_33360 17633 18976 gene locus_tag LOCUS_33370 17633 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 19003 19545 gene locus_tag LOCUS_33380 19003 19545 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_33380 19550 20161 gene locus_tag LOCUS_33390 19550 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 20364 20522 gene locus_tag LOCUS_33400 20364 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 21685 20591 gene locus_tag LOCUS_33410 21685 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 21899 24052 gene locus_tag LOCUS_33420 21899 24052 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_33420 24439 25050 gene locus_tag LOCUS_33430 24439 25050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405233.1 protein_id gnl|my_center|LOCUS_33430 25047 25481 gene locus_tag LOCUS_33440 gene vapC 25047 25481 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_33440 28098 25621 gene locus_tag LOCUS_33450 gene wzc 28098 25621 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_33450 29031 28411 gene locus_tag LOCUS_33460 gene nqrE 29031 28411 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ3 protein_id gnl|my_center|LOCUS_33460 29791 29111 gene locus_tag LOCUS_33470 gene nqrD 29791 29111 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_33470 30669 29881 gene locus_tag LOCUS_33480 gene nqrC 30669 29881 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_33480 31864 30662 gene locus_tag LOCUS_33490 gene nqrB 31864 30662 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_33490 33366 32002 gene locus_tag LOCUS_33500 gene nqrA 33366 32002 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_33500 33990 34469 gene locus_tag LOCUS_33510 33990 34469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 protein_id gnl|my_center|LOCUS_33510 34641 35153 gene locus_tag LOCUS_33520 34641 35153 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497611.1 protein_id gnl|my_center|LOCUS_33520 35455 36036 gene locus_tag LOCUS_33530 gene adk 35455 36036 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_33530 37031 36249 gene locus_tag LOCUS_33540 37031 36249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence058 2385 214 gene locus_tag LOCUS_33550 2385 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2660 2944 gene locus_tag LOCUS_33560 2660 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3083 3274 gene locus_tag LOCUS_33570 3083 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3954 3424 gene locus_tag LOCUS_33580 3954 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4066 4941 gene locus_tag LOCUS_33590 gene rlmF 4066 4941 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_33590 5048 5236 gene locus_tag LOCUS_33600 5048 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 5431 7500 gene locus_tag LOCUS_33610 5431 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 8448 7510 gene locus_tag LOCUS_33620 8448 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 8750 8935 gene locus_tag LOCUS_33630 8750 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 10109 8961 gene locus_tag LOCUS_33640 10109 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 10902 10258 gene locus_tag LOCUS_33650 10902 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_33650 11787 10960 gene locus_tag LOCUS_33660 gene deoD 11787 10960 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_33660 12624 11860 gene locus_tag LOCUS_33670 12624 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 13659 12727 gene locus_tag LOCUS_33680 gene rsmH 13659 12727 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_33680 13780 14889 gene locus_tag LOCUS_33690 13780 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 25850 15255 gene locus_tag LOCUS_33700 25850 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 26975 26127 gene locus_tag LOCUS_33710 26975 26127 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008116.1 protein_id gnl|my_center|LOCUS_33710 27891 26995 gene locus_tag LOCUS_33720 27891 26995 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_33720 28407 28183 gene locus_tag LOCUS_33730 28407 28183 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_33730 28877 28434 gene locus_tag LOCUS_33740 28877 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 29218 32601 gene locus_tag LOCUS_33750 29218 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 35327 32817 gene locus_tag LOCUS_33760 gene topA 35327 32817 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_33760 >Feature sequence059 326 535 gene locus_tag LOCUS_33770 326 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2056 686 gene locus_tag LOCUS_33780 gene bfmBB 2056 686 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_33780 2341 2517 gene locus_tag LOCUS_33790 2341 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3042 2653 gene locus_tag LOCUS_33800 3042 2653 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_33800 3254 3039 gene locus_tag LOCUS_33810 3254 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3841 3389 gene locus_tag LOCUS_33820 3841 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_33820 4626 4018 gene locus_tag LOCUS_33830 gene trpG 4626 4018 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_33830 4951 6171 gene locus_tag LOCUS_33840 4951 6171 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_33840 6883 6164 gene locus_tag LOCUS_33850 gene lipB 6883 6164 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_33850 7949 6942 gene locus_tag LOCUS_33860 7949 6942 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_33860 9219 8146 gene locus_tag LOCUS_33870 9219 8146 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_33870 10086 9241 gene locus_tag LOCUS_33880 10086 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 11345 10236 gene locus_tag LOCUS_33890 gene wecE 11345 10236 CDS product erythromycin biosynthesis sensory transduction protein EryC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575178.1 protein_id gnl|my_center|LOCUS_33890 11752 11390 gene locus_tag LOCUS_33900 11752 11390 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_33900 12768 11740 gene locus_tag LOCUS_33910 12768 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 14557 12776 gene locus_tag LOCUS_33920 14557 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 15539 14646 gene locus_tag LOCUS_33930 15539 14646 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707824.1 protein_id gnl|my_center|LOCUS_33930 16275 15541 gene locus_tag LOCUS_33940 16275 15541 CDS product cephalosporin hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_33940 17134 16268 gene locus_tag LOCUS_33950 17134 16268 CDS product sugar nucleotide oxidoreductaseepimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976075.1 protein_id gnl|my_center|LOCUS_33950 17631 17134 gene locus_tag LOCUS_33960 17631 17134 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708954.1 protein_id gnl|my_center|LOCUS_33960 18868 17642 gene locus_tag LOCUS_33970 18868 17642 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_33970 19457 18876 gene locus_tag LOCUS_33980 19457 18876 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_33980 20521 19445 gene locus_tag LOCUS_33990 20521 19445 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487322.1 protein_id gnl|my_center|LOCUS_33990 21291 20512 gene locus_tag LOCUS_34000 21291 20512 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_34000 22571 21288 gene locus_tag LOCUS_34010 gene rfbB 22571 21288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_34010 23602 22652 gene locus_tag LOCUS_34020 23602 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 26752 23951 gene locus_tag LOCUS_34030 26752 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_34030 28624 27170 gene locus_tag LOCUS_34040 28624 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 30146 28980 gene locus_tag LOCUS_34050 30146 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 30781 31884 gene locus_tag LOCUS_34060 30781 31884 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_34060 32256 32343 gene locus_tag LOCUS_t00320 32256 32343 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32430 32505 gene locus_tag LOCUS_t00330 32430 32505 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32591 32665 gene locus_tag LOCUS_t00340 32591 32665 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32861 33316 gene locus_tag LOCUS_34070 32861 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence060 1325 441 gene locus_tag LOCUS_34080 1325 441 CDS product Ndr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_34080 1511 2143 gene locus_tag LOCUS_34090 1511 2143 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_34090 2544 3035 gene locus_tag LOCUS_34100 2544 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 3185 3634 gene locus_tag LOCUS_34110 3185 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3736 4170 gene locus_tag LOCUS_34120 3736 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 6446 4272 gene locus_tag LOCUS_34130 6446 4272 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_34130 7031 7708 gene locus_tag LOCUS_34140 7031 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 7718 8521 gene locus_tag LOCUS_34150 7718 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 8690 10642 gene locus_tag LOCUS_34160 8690 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 10898 11974 gene locus_tag LOCUS_34170 10898 11974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704685.1 protein_id gnl|my_center|LOCUS_34170 13460 12033 gene locus_tag LOCUS_34180 13460 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 13591 14649 gene locus_tag LOCUS_34190 13591 14649 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_34190 14820 15824 gene locus_tag LOCUS_34200 14820 15824 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_34200 15909 16766 gene locus_tag LOCUS_34210 15909 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 17808 17146 gene locus_tag LOCUS_34220 17808 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 19385 17988 gene locus_tag LOCUS_34230 19385 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109248.1 protein_id gnl|my_center|LOCUS_34230 19736 19452 gene locus_tag LOCUS_34240 19736 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 21122 19791 gene locus_tag LOCUS_34250 21122 19791 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_34250 21979 21179 gene locus_tag LOCUS_34260 gene yugF 21979 21179 CDS product putative hydrolase YugF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05235 protein_id gnl|my_center|LOCUS_34260 22764 22216 gene locus_tag LOCUS_34270 22764 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 23239 22916 gene locus_tag LOCUS_34280 23239 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_34280 23415 24806 gene locus_tag LOCUS_34290 23415 24806 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_34290 25011 26414 gene locus_tag LOCUS_34300 25011 26414 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_34300 26421 27350 gene locus_tag LOCUS_34310 26421 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 27367 27891 gene locus_tag LOCUS_34320 27367 27891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_34320 28165 31299 gene locus_tag LOCUS_34330 28165 31299 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_34330 31325 31678 gene locus_tag LOCUS_34340 31325 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence061 324 2741 gene locus_tag LOCUS_34350 324 2741 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_34350 2843 3064 gene locus_tag LOCUS_34360 2843 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3159 3929 gene locus_tag LOCUS_34370 3159 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 4050 6245 gene locus_tag LOCUS_34380 4050 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 7192 6434 gene locus_tag LOCUS_34390 gene truA 7192 6434 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_34390 7658 7428 gene locus_tag LOCUS_34400 7658 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 8385 7669 gene locus_tag LOCUS_34410 gene comB 8385 7669 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_34410 9471 8902 gene locus_tag LOCUS_34420 9471 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 10096 9704 gene locus_tag LOCUS_34430 10096 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 11202 10375 gene locus_tag LOCUS_34440 gene cobB 11202 10375 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Z6 protein_id gnl|my_center|LOCUS_34440 12261 11752 gene locus_tag LOCUS_34450 12261 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 12512 13042 gene locus_tag LOCUS_34460 12512 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 13790 13251 gene locus_tag LOCUS_34470 13790 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 14052 13978 gene locus_tag LOCUS_t00350 14052 13978 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14309 15637 gene locus_tag LOCUS_34480 14309 15637 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_34480 15647 17500 gene locus_tag LOCUS_34490 15647 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 17627 18940 gene locus_tag LOCUS_34500 17627 18940 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459224.1 protein_id gnl|my_center|LOCUS_34500 19164 21317 gene locus_tag LOCUS_34510 19164 21317 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_34510 24886 21470 gene locus_tag LOCUS_34520 gene secA 24886 21470 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_34520 25476 26921 gene locus_tag LOCUS_34530 25476 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 27149 28429 gene locus_tag LOCUS_34540 27149 28429 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_34540 28814 28527 gene locus_tag LOCUS_34550 28814 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 29303 28968 gene locus_tag LOCUS_34560 29303 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 29683 29611 gene locus_tag LOCUS_t00360 29683 29611 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29875 29803 gene locus_tag LOCUS_t00370 29875 29803 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 1149 484 gene locus_tag LOCUS_34570 1149 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 1762 1316 gene locus_tag LOCUS_34580 1762 1316 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_34580 2557 1925 gene locus_tag LOCUS_34590 2557 1925 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_34590 3040 2591 gene locus_tag LOCUS_34600 3040 2591 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_34600 3547 3053 gene locus_tag LOCUS_34610 3547 3053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_34610 4079 3651 gene locus_tag LOCUS_34620 4079 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 5813 4464 gene locus_tag LOCUS_34630 5813 4464 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 protein_id gnl|my_center|LOCUS_34630 6704 6003 gene locus_tag LOCUS_34640 6704 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6802 7836 gene locus_tag LOCUS_34650 6802 7836 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957722.1 protein_id gnl|my_center|LOCUS_34650 8028 10283 gene locus_tag LOCUS_34660 8028 10283 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107156.1 protein_id gnl|my_center|LOCUS_34660 10477 11097 gene locus_tag LOCUS_34670 10477 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 11149 11559 gene locus_tag LOCUS_34680 11149 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 11740 12078 gene locus_tag LOCUS_34690 11740 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 12300 15239 gene locus_tag LOCUS_34700 12300 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 15936 15340 gene locus_tag LOCUS_34710 15936 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 16125 17837 gene locus_tag LOCUS_34720 gene lnt 16125 17837 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_34720 17897 18832 gene locus_tag LOCUS_34730 gene menA 17897 18832 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLY7 protein_id gnl|my_center|LOCUS_34730 18921 20855 gene locus_tag LOCUS_34740 gene wbtH 18921 20855 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_34740 20986 21435 gene locus_tag LOCUS_34750 20986 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 21537 22433 gene locus_tag LOCUS_34760 21537 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_34760 22544 23905 gene locus_tag LOCUS_34770 22544 23905 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_34770 23994 24905 gene locus_tag LOCUS_34780 gene ykuF 23994 24905 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_34780 25069 25608 gene locus_tag LOCUS_34790 25069 25608 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_34790 26130 25690 gene locus_tag LOCUS_34800 26130 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 26679 26203 gene locus_tag LOCUS_34810 gene rnhA 26679 26203 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_34810 27056 28246 gene locus_tag LOCUS_34820 27056 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 28896 28258 gene locus_tag LOCUS_34830 gene satA 28896 28258 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_34830 28942 29952 gene locus_tag LOCUS_34840 28942 29952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence063 <1 1915 gene locus_tag LOCUS_34850 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459960.1:cell wall-binding protein 2243 7867 gene locus_tag LOCUS_34860 2243 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 9582 8053 gene locus_tag LOCUS_34870 gene opuD 9582 8053 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 protein_id gnl|my_center|LOCUS_34870 10002 14483 gene locus_tag LOCUS_34880 10002 14483 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_34880 14542 15090 gene locus_tag LOCUS_34890 14542 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 16251 15145 gene locus_tag LOCUS_34900 16251 15145 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_34900 17017 16640 gene locus_tag LOCUS_34910 17017 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 17176 17367 gene locus_tag LOCUS_34920 17176 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 17637 18371 gene locus_tag LOCUS_34930 17637 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 18891 19607 gene locus_tag LOCUS_34940 18891 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 21147 19753 gene locus_tag LOCUS_34950 21147 19753 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_34950 21690 22151 gene locus_tag LOCUS_34960 21690 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 22321 22596 gene locus_tag LOCUS_34970 22321 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_34970 22604 23527 gene locus_tag LOCUS_34980 22604 23527 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097180.1 protein_id gnl|my_center|LOCUS_34980 23581 24537 gene locus_tag LOCUS_34990 gene queG 23581 24537 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_34990 24917 24720 gene locus_tag LOCUS_35000 24917 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 25400 26767 gene locus_tag LOCUS_35010 25400 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 26870 27796 gene locus_tag LOCUS_35020 26870 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 28142 27798 gene locus_tag LOCUS_35030 28142 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 28823 28245 gene locus_tag LOCUS_35040 28823 28245 CDS product exosortase/archaeosortase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403397.1 protein_id gnl|my_center|LOCUS_35040 29110 28901 gene locus_tag LOCUS_35050 29110 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence064 810 118 gene locus_tag LOCUS_35060 810 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3419 951 gene locus_tag LOCUS_35070 3419 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3762 3520 gene locus_tag LOCUS_35080 3762 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 4441 3926 gene locus_tag LOCUS_35090 4441 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_35090 4856 5056 gene locus_tag LOCUS_35100 4856 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 5100 5477 gene locus_tag LOCUS_35110 5100 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5465 5875 gene locus_tag LOCUS_35120 5465 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35120 9365 6051 gene locus_tag LOCUS_35130 9365 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 10612 11451 gene locus_tag LOCUS_35140 gene dinD 10612 11451 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_35140 11707 12414 gene locus_tag LOCUS_35150 11707 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 12428 12703 gene locus_tag LOCUS_35160 12428 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 13239 13096 gene locus_tag LOCUS_35170 13239 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 13495 13914 gene locus_tag LOCUS_35180 13495 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 13978 14595 gene locus_tag LOCUS_35190 13978 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 14823 14975 gene locus_tag LOCUS_35200 14823 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35200 15027 15407 gene locus_tag LOCUS_35210 15027 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 16170 15625 gene locus_tag LOCUS_35220 16170 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 16655 16197 gene locus_tag LOCUS_35230 16655 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259362.1 protein_id gnl|my_center|LOCUS_35230 17316 16681 gene locus_tag LOCUS_35240 17316 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 19189 17390 gene locus_tag LOCUS_35250 19189 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 21533 19473 gene locus_tag LOCUS_35260 21533 19473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_35260 22808 21546 gene locus_tag LOCUS_35270 22808 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 26825 22899 gene locus_tag LOCUS_35280 26825 22899 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_35280 27410 26955 gene locus_tag LOCUS_35290 27410 26955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 28645 27569 gene locus_tag LOCUS_35300 28645 27569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 29284 28865 gene locus_tag LOCUS_35310 29284 28865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence065 591 1259 gene locus_tag LOCUS_35320 gene arsC 591 1259 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_35320 1361 1867 gene locus_tag LOCUS_35330 1361 1867 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461026.1 protein_id gnl|my_center|LOCUS_35330 2501 1881 gene locus_tag LOCUS_35340 2501 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3961 2636 gene locus_tag LOCUS_35350 gene aroA 3961 2636 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_35350 4404 5093 gene locus_tag LOCUS_35360 4404 5093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_35360 5256 6008 gene locus_tag LOCUS_35370 5256 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 6207 7535 gene locus_tag LOCUS_35380 gene tyrS 6207 7535 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_35380 8441 7599 gene locus_tag LOCUS_35390 8441 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 9466 8471 gene locus_tag LOCUS_35400 9466 8471 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028385.1 protein_id gnl|my_center|LOCUS_35400 10517 9516 gene locus_tag LOCUS_35410 10517 9516 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_35410 10694 11686 gene locus_tag LOCUS_35420 gene prfB 10694 11686 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_35420 12948 11911 gene locus_tag LOCUS_35430 12948 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_35430 13599 12958 gene locus_tag LOCUS_35440 gene cynT 13599 12958 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_35440 14084 16114 gene locus_tag LOCUS_35450 gene uvrB 14084 16114 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_35450 16232 18622 gene locus_tag LOCUS_35460 16232 18622 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_35460 19423 18656 gene locus_tag LOCUS_35470 19423 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 20258 19413 gene locus_tag LOCUS_35480 20258 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 22038 20530 gene locus_tag LOCUS_35490 22038 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_35490 23234 22113 gene locus_tag LOCUS_35500 23234 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 24111 23458 gene locus_tag LOCUS_35510 gene atoA 24111 23458 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_35510 24914 24219 gene locus_tag LOCUS_35520 gene atoD 24914 24219 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_35520 25344 25781 gene locus_tag LOCUS_35530 25344 25781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 25839 26837 gene locus_tag LOCUS_35540 gene hemB 25839 26837 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_35540 26903 27541 gene locus_tag LOCUS_35550 26903 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 <29387 27618 gene locus_tag LOCUS_35560 <29387 27618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962195.1:adhesin SprC >Feature sequence066 939 184 gene locus_tag LOCUS_35570 939 184 CDS product guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876603.1 protein_id gnl|my_center|LOCUS_35570 1375 929 gene locus_tag LOCUS_35580 1375 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1900 1418 gene locus_tag LOCUS_35590 1900 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2399 1983 gene locus_tag LOCUS_35600 2399 1983 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_35600 3201 2458 gene locus_tag LOCUS_35610 3201 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5066 3369 gene locus_tag LOCUS_35620 5066 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 5358 6851 gene locus_tag LOCUS_35630 5358 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 7212 8603 gene locus_tag LOCUS_35640 7212 8603 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_35640 8691 9233 gene locus_tag LOCUS_35650 8691 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 9781 9464 gene locus_tag LOCUS_35660 9781 9464 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_35660 10180 10776 gene locus_tag LOCUS_35670 10180 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 10981 11901 gene locus_tag LOCUS_35680 gene natA 10981 11901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_35680 12257 12973 gene locus_tag LOCUS_35690 gene pcm 12257 12973 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_35690 13813 13328 gene locus_tag LOCUS_35700 13813 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 14475 13849 gene locus_tag LOCUS_35710 14475 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_35710 15962 15051 gene locus_tag LOCUS_35720 15962 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 16804 15965 gene locus_tag LOCUS_35730 16804 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 17145 16951 gene locus_tag LOCUS_35740 17145 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 17414 17157 gene locus_tag LOCUS_35750 17414 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 17648 17427 gene locus_tag LOCUS_35760 17648 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 17892 17725 gene locus_tag LOCUS_35770 17892 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 17870 19594 gene locus_tag LOCUS_35780 17870 19594 CDS product dynamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_35780 20205 20558 gene locus_tag LOCUS_35790 20205 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 20634 20840 gene locus_tag LOCUS_35800 20634 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 24301 21011 gene locus_tag LOCUS_35810 24301 21011 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_35810 25260 24391 gene locus_tag LOCUS_35820 25260 24391 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_35820 25475 26266 gene locus_tag LOCUS_35830 25475 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 26263 26961 gene locus_tag LOCUS_35840 26263 26961 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_35840 27513 27334 gene locus_tag LOCUS_35850 27513 27334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 28356 27862 gene locus_tag LOCUS_35860 28356 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35860 28835 28422 gene locus_tag LOCUS_35870 28835 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35870 >Feature sequence067 506 120 gene locus_tag LOCUS_35880 506 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1516 530 gene locus_tag LOCUS_35890 gene lplA2 1516 530 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A5 protein_id gnl|my_center|LOCUS_35890 2344 1535 gene locus_tag LOCUS_35900 2344 1535 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_35900 4858 2645 gene locus_tag LOCUS_35910 4858 2645 CDS product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963485.1 protein_id gnl|my_center|LOCUS_35910 5734 5300 gene locus_tag LOCUS_35920 5734 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 8728 5765 gene locus_tag LOCUS_35930 8728 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_35930 9115 12480 gene locus_tag LOCUS_35940 9115 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 13756 13058 gene locus_tag LOCUS_35950 13756 13058 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_35950 14063 14788 gene locus_tag LOCUS_35960 gene pdxJ 14063 14788 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_35960 15065 14850 gene locus_tag LOCUS_35970 15065 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 15722 15201 gene locus_tag LOCUS_35980 15722 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_35980 17075 15768 gene locus_tag LOCUS_35990 17075 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 18439 17141 gene locus_tag LOCUS_36000 gene pepP 18439 17141 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_36000 19352 18585 gene locus_tag LOCUS_36010 19352 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_36010 19963 19364 gene locus_tag LOCUS_36020 19963 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 20621 20052 gene locus_tag LOCUS_36030 20621 20052 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_36030 20793 21842 gene locus_tag LOCUS_36040 20793 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 22170 23045 gene locus_tag LOCUS_36050 22170 23045 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_36050 23549 23133 gene locus_tag LOCUS_36060 23549 23133 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_36060 25038 23536 gene locus_tag LOCUS_36070 25038 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 28099 25190 gene locus_tag LOCUS_36080 28099 25190 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_36080 28240 28602 gene locus_tag LOCUS_36090 28240 28602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence068 246 109 gene locus_tag LOCUS_36100 246 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 804 478 gene locus_tag LOCUS_36110 804 478 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_36110 875 1111 gene locus_tag LOCUS_36120 875 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 1873 1151 gene locus_tag LOCUS_36130 1873 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2136 2750 gene locus_tag LOCUS_36140 2136 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3241 2768 gene locus_tag LOCUS_36150 3241 2768 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_36150 3397 4221 gene locus_tag LOCUS_36160 3397 4221 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_36160 4327 4986 gene locus_tag LOCUS_36170 4327 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4992 5732 gene locus_tag LOCUS_36180 4992 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 6346 5741 gene locus_tag LOCUS_36190 6346 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 6713 6483 gene locus_tag LOCUS_36200 6713 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 7204 6695 gene locus_tag LOCUS_36210 7204 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 10452 7417 gene locus_tag LOCUS_36220 10452 7417 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_36220 11317 10592 gene locus_tag LOCUS_36230 11317 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 11527 12435 gene locus_tag LOCUS_36240 11527 12435 CDS product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_36240 12520 13074 gene locus_tag LOCUS_36250 12520 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 13197 13799 gene locus_tag LOCUS_36260 13197 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 13854 14279 gene locus_tag LOCUS_36270 13854 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 14371 14850 gene locus_tag LOCUS_36280 14371 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 17552 14910 gene locus_tag LOCUS_36290 17552 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 18431 17607 gene locus_tag LOCUS_36300 18431 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 19719 18547 gene locus_tag LOCUS_36310 19719 18547 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_36310 20001 19738 gene locus_tag LOCUS_36320 20001 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 20724 20026 gene locus_tag LOCUS_36330 20724 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 21545 20862 gene locus_tag LOCUS_36340 gene pyrE 21545 20862 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y668 protein_id gnl|my_center|LOCUS_36340 22124 21756 gene locus_tag LOCUS_36350 22124 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 22887 22561 gene locus_tag LOCUS_36360 22887 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 23071 22871 gene locus_tag LOCUS_36370 23071 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 24037 23420 gene locus_tag LOCUS_36380 24037 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 24723 24067 gene locus_tag LOCUS_36390 24723 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 25947 24826 gene locus_tag LOCUS_36400 gene ansA 25947 24826 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_36400 26892 26119 gene locus_tag LOCUS_36410 gene tatD 26892 26119 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_36410 27554 26979 gene locus_tag LOCUS_36420 27554 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 28233 28158 gene locus_tag LOCUS_t00380 28233 28158 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 359 1069 gene locus_tag LOCUS_36430 359 1069 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_36430 1072 1365 gene locus_tag LOCUS_36440 1072 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 2656 1451 gene locus_tag LOCUS_36450 gene recF 2656 1451 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_36450 3045 2704 gene locus_tag LOCUS_36460 3045 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_36460 3117 3392 gene locus_tag LOCUS_36470 3117 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3394 3561 gene locus_tag LOCUS_36480 3394 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 7870 3860 gene locus_tag LOCUS_36490 7870 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 8813 8037 gene locus_tag LOCUS_36500 gene plsC 8813 8037 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_36500 10143 9040 gene locus_tag LOCUS_36510 gene irpA 10143 9040 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_36510 10379 11227 gene locus_tag LOCUS_36520 10379 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 11243 12070 gene locus_tag LOCUS_36530 11243 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 12075 12920 gene locus_tag LOCUS_36540 12075 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 13890 13309 gene locus_tag LOCUS_36550 gene rplY 13890 13309 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_36550 14633 14926 gene locus_tag LOCUS_36560 14633 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 15367 15095 gene locus_tag LOCUS_36570 15367 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 15419 18103 gene locus_tag LOCUS_36580 15419 18103 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_36580 18466 18924 gene locus_tag LOCUS_36590 gene crtZ 18466 18924 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_36590 19272 18925 gene locus_tag LOCUS_36600 19272 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 19882 21246 gene locus_tag LOCUS_36610 gene hemG 19882 21246 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881319.1 protein_id gnl|my_center|LOCUS_36610 21426 22391 gene locus_tag LOCUS_36620 21426 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 22402 23289 gene locus_tag LOCUS_36630 22402 23289 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_36630 24695 23379 gene locus_tag LOCUS_36640 24695 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 26472 24832 gene locus_tag LOCUS_36650 26472 24832 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943382.1 protein_id gnl|my_center|LOCUS_36650 27131 26643 gene locus_tag LOCUS_36660 27131 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 27332 28009 gene locus_tag LOCUS_36670 27332 28009 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence070 437 961 gene locus_tag LOCUS_36680 437 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1190 1648 gene locus_tag LOCUS_36690 gene purE 1190 1648 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_36690 2900 1713 gene locus_tag LOCUS_36700 2900 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3569 3363 gene locus_tag LOCUS_36710 3569 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 3457 4344 gene locus_tag LOCUS_36720 3457 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4783 6627 gene locus_tag LOCUS_36730 4783 6627 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_36730 7911 7432 gene locus_tag LOCUS_36740 7911 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_36740 8546 9712 gene locus_tag LOCUS_36750 gene menE 8546 9712 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_36750 9999 9715 gene locus_tag LOCUS_36760 9999 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 10041 10574 gene locus_tag LOCUS_36770 10041 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 10608 10886 gene locus_tag LOCUS_36780 10608 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 11539 10901 gene locus_tag LOCUS_36790 11539 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 12273 11695 gene locus_tag LOCUS_36800 12273 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 13019 12354 gene locus_tag LOCUS_36810 13019 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 13627 13016 gene locus_tag LOCUS_36820 13627 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 15815 13602 gene locus_tag LOCUS_36830 15815 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 16251 15889 gene locus_tag LOCUS_36840 16251 15889 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_36840 17977 16310 gene locus_tag LOCUS_36850 17977 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 19782 18121 gene locus_tag LOCUS_36860 19782 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 20750 19974 gene locus_tag LOCUS_36870 20750 19974 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_36870 21887 21006 gene locus_tag LOCUS_36880 21887 21006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789684.1 protein_id gnl|my_center|LOCUS_36880 23715 22003 gene locus_tag LOCUS_36890 gene pdhC 23715 22003 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_36890 24207 24292 gene locus_tag LOCUS_t00390 24207 24292 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24470 27766 gene locus_tag LOCUS_36900 24470 27766 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence071 <1 3477 gene locus_tag LOCUS_36910 <1 3477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558138.1:PAS domain-containing sensor histidine kinase 3588 8927 gene locus_tag LOCUS_36920 3588 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 10668 9106 gene locus_tag LOCUS_36930 gene sucB 10668 9106 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_36930 10966 11301 gene locus_tag LOCUS_36940 gene gldC 10966 11301 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_36940 11370 13475 gene locus_tag LOCUS_36950 11370 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 13687 13511 gene locus_tag LOCUS_36960 13687 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 14025 15218 gene locus_tag LOCUS_36970 14025 15218 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 protein_id gnl|my_center|LOCUS_36970 15597 15283 gene locus_tag LOCUS_36980 15597 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 16774 15719 gene locus_tag LOCUS_36990 16774 15719 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963396.1 protein_id gnl|my_center|LOCUS_36990 16926 17252 gene locus_tag LOCUS_37000 16926 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 17442 18053 gene locus_tag LOCUS_37010 17442 18053 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_37010 18148 19008 gene locus_tag LOCUS_37020 18148 19008 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_37020 19119 19925 gene locus_tag LOCUS_37030 19119 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964178.1 protein_id gnl|my_center|LOCUS_37030 20234 23320 gene locus_tag LOCUS_37040 20234 23320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 23383 24402 gene locus_tag LOCUS_37050 23383 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 24817 25782 gene locus_tag LOCUS_37060 24817 25782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225285.1 protein_id gnl|my_center|LOCUS_37060 26239 26030 gene locus_tag LOCUS_37070 26239 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence072 211 741 gene locus_tag LOCUS_37080 211 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_37080 1168 935 gene locus_tag LOCUS_37090 1168 935 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67303 protein_id gnl|my_center|LOCUS_37090 1495 1914 gene locus_tag LOCUS_37100 1495 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 2001 3269 gene locus_tag LOCUS_37110 gene queA 2001 3269 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_37110 7043 3270 gene locus_tag LOCUS_37120 7043 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 8259 7228 gene locus_tag LOCUS_37130 8259 7228 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_37130 9895 8498 gene locus_tag LOCUS_37140 gene hslU 9895 8498 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_37140 10200 11366 gene locus_tag LOCUS_37150 10200 11366 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_37150 11398 12432 gene locus_tag LOCUS_37160 11398 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 12413 12730 gene locus_tag LOCUS_37170 12413 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 13065 14651 gene locus_tag LOCUS_37180 13065 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 15763 14723 gene locus_tag LOCUS_37190 15763 14723 CDS product type II restriction endonuclease HaeII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 protein_id gnl|my_center|LOCUS_37190 16721 15729 gene locus_tag LOCUS_37200 16721 15729 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_37200 18929 16800 gene locus_tag LOCUS_37210 gene ftsI 18929 16800 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_37210 19344 18973 gene locus_tag LOCUS_37220 19344 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 20007 19519 gene locus_tag LOCUS_37230 20007 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 22796 20091 gene locus_tag LOCUS_37240 22796 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 23183 23680 gene locus_tag LOCUS_37250 23183 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 24403 23735 gene locus_tag LOCUS_37260 24403 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_37260 24499 24777 gene locus_tag LOCUS_37270 24499 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 26051 24852 gene locus_tag LOCUS_37280 26051 24852 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence073 325 1557 gene locus_tag LOCUS_37290 325 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1568 1948 gene locus_tag LOCUS_37300 1568 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 1976 2371 gene locus_tag LOCUS_37310 1976 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 2498 2863 gene locus_tag LOCUS_37320 2498 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3852 2992 gene locus_tag LOCUS_37330 3852 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4544 3930 gene locus_tag LOCUS_37340 4544 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 6788 4671 gene locus_tag LOCUS_37350 6788 4671 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_37350 7357 6923 gene locus_tag LOCUS_37360 7357 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 7738 7361 gene locus_tag LOCUS_37370 7738 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 8477 7920 gene locus_tag LOCUS_37380 8477 7920 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_37380 8793 9470 gene locus_tag LOCUS_37390 8793 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 10928 9582 gene locus_tag LOCUS_37400 10928 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 11314 11144 gene locus_tag LOCUS_37410 11314 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 11851 11657 gene locus_tag LOCUS_37420 11851 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 12046 13767 gene locus_tag LOCUS_37430 gene ade 12046 13767 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_37430 13857 14936 gene locus_tag LOCUS_37440 13857 14936 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_37440 15206 15133 gene locus_tag LOCUS_t00400 15206 15133 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22025 15432 gene locus_tag LOCUS_37450 22025 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 22415 22684 gene locus_tag LOCUS_37460 22415 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 22702 23121 gene locus_tag LOCUS_37470 22702 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 24701 23130 gene locus_tag LOCUS_37480 24701 23130 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_37480 24855 25187 gene locus_tag LOCUS_37490 24855 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 25978 25727 gene locus_tag LOCUS_37500 25978 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence074 757 98 gene locus_tag LOCUS_37510 757 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 2359 842 gene locus_tag LOCUS_37520 2359 842 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946245.1 protein_id gnl|my_center|LOCUS_37520 3406 2465 gene locus_tag LOCUS_37530 3406 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 4399 3821 gene locus_tag LOCUS_37540 4399 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 4437 5474 gene locus_tag LOCUS_37550 4437 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 5621 6367 gene locus_tag LOCUS_37560 5621 6367 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_37560 6481 6792 gene locus_tag LOCUS_37570 6481 6792 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203069.1 protein_id gnl|my_center|LOCUS_37570 6800 7111 gene locus_tag LOCUS_37580 6800 7111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_37580 7703 7317 gene locus_tag LOCUS_37590 gene vapC 7703 7317 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_37590 7921 7697 gene locus_tag LOCUS_37600 7921 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 8146 11556 gene locus_tag LOCUS_37610 8146 11556 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8W3 protein_id gnl|my_center|LOCUS_37610 11731 12666 gene locus_tag LOCUS_37620 11731 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 13031 14011 gene locus_tag LOCUS_37630 13031 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 15781 14105 gene locus_tag LOCUS_37640 15781 14105 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_37640 16550 16023 gene locus_tag LOCUS_37650 gene pyrR2 16550 16023 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_37650 16869 16615 gene locus_tag LOCUS_37660 16869 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 17204 18013 gene locus_tag LOCUS_37670 17204 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 18103 18822 gene locus_tag LOCUS_37680 18103 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 19028 20110 gene locus_tag LOCUS_37690 19028 20110 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_37690 21031 20228 gene locus_tag LOCUS_37700 21031 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 22629 21142 gene locus_tag LOCUS_37710 gene gatA 22629 21142 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_37710 23065 22835 gene locus_tag LOCUS_37720 23065 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 24564 23233 gene locus_tag LOCUS_37730 24564 23233 CDS product glycosyl transferase group 1/2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546575.1 protein_id gnl|my_center|LOCUS_37730 25685 24783 gene locus_tag LOCUS_37740 25685 24783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 25744 25896 gene locus_tag LOCUS_37750 25744 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 >Feature sequence075 3619 311 gene locus_tag LOCUS_37760 3619 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4372 3845 gene locus_tag LOCUS_37770 4372 3845 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQA5 protein_id gnl|my_center|LOCUS_37770 4670 4470 gene locus_tag LOCUS_37780 4670 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 4923 5093 gene locus_tag LOCUS_37790 4923 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 5093 5737 gene locus_tag LOCUS_37800 5093 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_37800 5959 6252 gene locus_tag LOCUS_37810 5959 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 6588 7307 gene locus_tag LOCUS_37820 6588 7307 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_37820 8127 7393 gene locus_tag LOCUS_37830 8127 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 8296 9222 gene locus_tag LOCUS_37840 8296 9222 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_37840 11447 10005 gene locus_tag LOCUS_37850 11447 10005 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_37850 14677 11591 gene locus_tag LOCUS_37860 14677 11591 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_37860 16051 14990 gene locus_tag LOCUS_37870 16051 14990 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_37870 16674 16288 gene locus_tag LOCUS_37880 16674 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 17072 17677 gene locus_tag LOCUS_37890 17072 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 18470 17784 gene locus_tag LOCUS_37900 gene upp 18470 17784 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_37900 18749 18967 gene locus_tag LOCUS_37910 18749 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_37910 19546 20820 gene locus_tag LOCUS_37920 19546 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 21115 21894 gene locus_tag LOCUS_37930 gene thyA 21115 21894 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_37930 22088 21909 gene locus_tag LOCUS_37940 22088 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 22234 24768 gene locus_tag LOCUS_37950 gene lon 22234 24768 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_37950 24875 25489 gene locus_tag LOCUS_37960 gene hisH 24875 25489 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_37960 >Feature sequence076 491 135 gene locus_tag LOCUS_37970 491 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 1128 556 gene locus_tag LOCUS_37980 1128 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 1571 1134 gene locus_tag LOCUS_37990 1571 1134 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_37990 1883 2440 gene locus_tag LOCUS_38000 gene frr 1883 2440 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_38000 2570 3010 gene locus_tag LOCUS_38010 2570 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 3412 3017 gene locus_tag LOCUS_38020 gene folQ 3412 3017 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N3P4 protein_id gnl|my_center|LOCUS_38020 3606 6839 gene locus_tag LOCUS_38030 3606 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 6947 7255 gene locus_tag LOCUS_38040 6947 7255 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022421.1 protein_id gnl|my_center|LOCUS_38040 8135 7356 gene locus_tag LOCUS_38050 8135 7356 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_38050 9267 8512 gene locus_tag LOCUS_38060 9267 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 9920 9336 gene locus_tag LOCUS_38070 9920 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 10131 9910 gene locus_tag LOCUS_38080 10131 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 12378 10198 gene locus_tag LOCUS_38090 gene mcm3 12378 10198 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_38090 12804 13229 gene locus_tag LOCUS_38100 12804 13229 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_38100 13393 14019 gene locus_tag LOCUS_38110 13393 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 14268 14341 gene locus_tag LOCUS_t00410 14268 14341 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14548 15000 gene locus_tag LOCUS_38120 14548 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 17407 15578 gene locus_tag LOCUS_38130 17407 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 18032 17445 gene locus_tag LOCUS_38140 18032 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 20026 18200 gene locus_tag LOCUS_38150 20026 18200 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_38150 21046 20384 gene locus_tag LOCUS_38160 21046 20384 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_38160 21229 22146 gene locus_tag LOCUS_38170 21229 22146 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_38170 22288 23358 gene locus_tag LOCUS_38180 22288 23358 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265972.1 protein_id gnl|my_center|LOCUS_38180 23370 23741 gene locus_tag LOCUS_38190 23370 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 23943 24260 gene locus_tag LOCUS_38200 23943 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 24267 24752 gene locus_tag LOCUS_38210 24267 24752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence077 <1 3561 gene locus_tag LOCUS_38220 <1 3561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256980.1:hyalin 3746 4096 gene locus_tag LOCUS_38230 3746 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38230 4224 4505 gene locus_tag LOCUS_38240 4224 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 4559 5284 gene locus_tag LOCUS_38250 4559 5284 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_38250 5392 6378 gene locus_tag LOCUS_38260 5392 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 7354 6578 gene locus_tag LOCUS_38270 gene crt 7354 6578 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_38270 8294 7653 gene locus_tag LOCUS_38280 8294 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 8705 11653 gene locus_tag LOCUS_38290 8705 11653 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_38290 11750 12328 gene locus_tag LOCUS_38300 11750 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 12423 13424 gene locus_tag LOCUS_38310 12423 13424 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_38310 13691 14113 gene locus_tag LOCUS_38320 gene rbfA 13691 14113 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFT0 protein_id gnl|my_center|LOCUS_38320 14397 16226 gene locus_tag LOCUS_38330 14397 16226 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_38330 16712 16365 gene locus_tag LOCUS_38340 gene panD 16712 16365 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_38340 17789 16926 gene locus_tag LOCUS_38350 gene panC 17789 16926 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_38350 18338 19417 gene locus_tag LOCUS_38360 18338 19417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_38360 19451 20143 gene locus_tag LOCUS_38370 19451 20143 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_38370 20276 20797 gene locus_tag LOCUS_38380 20276 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 22952 20979 gene locus_tag LOCUS_38390 22952 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence078 3615 598 gene locus_tag LOCUS_38400 3615 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3966 4745 gene locus_tag LOCUS_38410 3966 4745 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_38410 5031 5429 gene locus_tag LOCUS_38420 5031 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 5537 8749 gene locus_tag LOCUS_38430 5537 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 9183 8755 gene locus_tag LOCUS_38440 9183 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 9864 9208 gene locus_tag LOCUS_38450 9864 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 10071 11615 gene locus_tag LOCUS_38460 gene gltX 10071 11615 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_38460 14404 11714 gene locus_tag LOCUS_38470 14404 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 16162 14879 gene locus_tag LOCUS_38480 gene mntC 16162 14879 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_38480 16358 17131 gene locus_tag LOCUS_38490 16358 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 17204 17626 gene locus_tag LOCUS_38500 17204 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 17754 18038 gene locus_tag LOCUS_38510 17754 18038 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_38510 19200 18091 gene locus_tag LOCUS_38520 gene mauG 19200 18091 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_38520 19805 20515 gene locus_tag LOCUS_38530 19805 20515 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_38530 20664 24392 gene locus_tag LOCUS_38540 gene metH 20664 24392 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_38540 >Feature sequence079 1864 713 gene locus_tag LOCUS_38550 1864 713 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_38550 2131 2056 gene locus_tag LOCUS_t00420 2131 2056 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2428 3603 gene locus_tag LOCUS_38560 2428 3603 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_38560 3713 6934 gene locus_tag LOCUS_38570 3713 6934 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_38570 7851 7045 gene locus_tag LOCUS_38580 7851 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 8761 7940 gene locus_tag LOCUS_38590 8761 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 10120 9398 gene locus_tag LOCUS_38600 10120 9398 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_38600 12435 10387 gene locus_tag LOCUS_38610 12435 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 13175 14128 gene locus_tag LOCUS_38620 gene accA 13175 14128 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_38620 14217 14732 gene locus_tag LOCUS_38630 14217 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 15390 14812 gene locus_tag LOCUS_38640 15390 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 16723 15482 gene locus_tag LOCUS_38650 16723 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 17104 16751 gene locus_tag LOCUS_38660 17104 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 18134 17199 gene locus_tag LOCUS_38670 gene era 18134 17199 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV2 protein_id gnl|my_center|LOCUS_38670 18354 18427 gene locus_tag LOCUS_t00430 18354 18427 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18699 19397 gene locus_tag LOCUS_38680 gene phoP 18699 19397 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_38680 19419 20597 gene locus_tag LOCUS_38690 gene phoR 19419 20597 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_38690 24054 21241 gene locus_tag LOCUS_38700 gene carB 24054 21241 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_38700 >Feature sequence080 290 856 gene locus_tag LOCUS_38710 290 856 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_38710 2032 875 gene locus_tag LOCUS_38720 2032 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 2187 2846 gene locus_tag LOCUS_38730 2187 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_38730 3244 4578 gene locus_tag LOCUS_38740 3244 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 4830 5798 gene locus_tag LOCUS_38750 4830 5798 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 protein_id gnl|my_center|LOCUS_38750 6225 6965 gene locus_tag LOCUS_38760 6225 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 8017 7319 gene locus_tag LOCUS_38770 8017 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 8399 8851 gene locus_tag LOCUS_38780 8399 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 9221 13561 gene locus_tag LOCUS_38790 gene rpoC 9221 13561 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_38790 13909 14919 gene locus_tag LOCUS_38800 13909 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 15137 18034 gene locus_tag LOCUS_38810 15137 18034 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_38810 22036 18134 gene locus_tag LOCUS_38820 22036 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 22315 23985 gene locus_tag LOCUS_38830 gene hutU 22315 23985 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 protein_id gnl|my_center|LOCUS_38830 24040 24270 gene locus_tag LOCUS_38840 24040 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence081 6112 4544 gene locus_tag LOCUS_38850 gene guaA 6112 4544 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_38850 7717 6350 gene locus_tag LOCUS_38860 7717 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 9118 7745 gene locus_tag LOCUS_38870 9118 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 9251 11113 gene locus_tag LOCUS_38880 gene nolO 9251 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_38880 11198 11347 gene locus_tag LOCUS_38890 11198 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_38890 11411 11773 gene locus_tag LOCUS_38900 11411 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 12069 13673 gene locus_tag LOCUS_38910 12069 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 13883 14296 gene locus_tag LOCUS_38920 13883 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 14946 14353 gene locus_tag LOCUS_38930 14946 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 15477 16838 gene locus_tag LOCUS_38940 15477 16838 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_38940 16962 17603 gene locus_tag LOCUS_38950 16962 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 17695 18840 gene locus_tag LOCUS_38960 17695 18840 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_38960 18876 19862 gene locus_tag LOCUS_38970 18876 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 19944 20291 gene locus_tag LOCUS_38980 19944 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 20548 20363 gene locus_tag LOCUS_38990 20548 20363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 22444 20633 gene locus_tag LOCUS_39000 22444 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 23857 22703 gene locus_tag LOCUS_39010 23857 22703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence082 945 22 gene locus_tag LOCUS_39020 945 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 1192 986 gene locus_tag LOCUS_39030 1192 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1822 3111 gene locus_tag LOCUS_39040 1822 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3639 16769 gene locus_tag LOCUS_39050 3639 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 17279 18058 gene locus_tag LOCUS_39060 17279 18058 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_39060 18271 20205 gene locus_tag LOCUS_39070 gene sdhA 18271 20205 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_39070 20274 21044 gene locus_tag LOCUS_39080 gene sdhB 20274 21044 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_39080 21244 21690 gene locus_tag LOCUS_39090 21244 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 21696 22208 gene locus_tag LOCUS_39100 21696 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 22987 22286 gene locus_tag LOCUS_39110 22987 22286 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence083 2272 416 gene locus_tag LOCUS_39120 2272 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4473 2692 gene locus_tag LOCUS_39130 4473 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 4923 5192 gene locus_tag LOCUS_39140 4923 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 6324 5287 gene locus_tag LOCUS_39150 6324 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 6909 7088 gene locus_tag LOCUS_39160 6909 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 7182 9371 gene locus_tag LOCUS_39170 gene ccoN/ccoO 7182 9371 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_39170 9703 9924 gene locus_tag LOCUS_39180 9703 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 9905 10807 gene locus_tag LOCUS_39190 gene ccoP 9905 10807 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_39190 10951 12405 gene locus_tag LOCUS_39200 gene ccoG 10951 12405 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_39200 12521 13021 gene locus_tag LOCUS_39210 gene ccoH 12521 13021 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_39210 13118 14383 gene locus_tag LOCUS_39220 gene hemA 13118 14383 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_39220 14464 15135 gene locus_tag LOCUS_39230 14464 15135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_39230 15137 15928 gene locus_tag LOCUS_39240 15137 15928 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_39240 16953 15973 gene locus_tag LOCUS_39250 16953 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 17971 17039 gene locus_tag LOCUS_39260 17971 17039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_39260 18361 19599 gene locus_tag LOCUS_39270 18361 19599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20321 19695 gene locus_tag LOCUS_39280 20321 19695 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_39280 20956 20423 gene locus_tag LOCUS_39290 20956 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 21231 22280 gene locus_tag LOCUS_39300 21231 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence084 2355 400 gene locus_tag LOCUS_39310 gene ctaD 2355 400 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_39310 3465 2452 gene locus_tag LOCUS_39320 3465 2452 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066648.1 protein_id gnl|my_center|LOCUS_39320 5142 3889 gene locus_tag LOCUS_39330 gene actF 5142 3889 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_39330 6093 5386 gene locus_tag LOCUS_39340 6093 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 6763 6134 gene locus_tag LOCUS_39350 6763 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 8264 6861 gene locus_tag LOCUS_39360 gene actC 8264 6861 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_39360 11918 8463 gene locus_tag LOCUS_39370 11918 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 13211 11949 gene locus_tag LOCUS_39380 gene actA 13211 11949 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_39380 14028 14183 gene locus_tag LOCUS_39390 14028 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 14457 15320 gene locus_tag LOCUS_39400 14457 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 15307 16068 gene locus_tag LOCUS_39410 15307 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 17291 16158 gene locus_tag LOCUS_39420 17291 16158 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_39420 19200 17326 gene locus_tag LOCUS_39430 19200 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 20347 19448 gene locus_tag LOCUS_39440 20347 19448 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_39440 21223 20591 gene locus_tag LOCUS_39450 21223 20591 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022718.1 protein_id gnl|my_center|LOCUS_39450 21648 22259 gene locus_tag LOCUS_39460 21648 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence085 1485 211 gene locus_tag LOCUS_39470 gene serS 1485 211 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_39470 2363 1752 gene locus_tag LOCUS_39480 2363 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 3136 2453 gene locus_tag LOCUS_39490 3136 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 5012 3174 gene locus_tag LOCUS_39500 5012 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 6345 5185 gene locus_tag LOCUS_39510 6345 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 6732 7424 gene locus_tag LOCUS_39520 gene recO 6732 7424 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM7 protein_id gnl|my_center|LOCUS_39520 7602 8618 gene locus_tag LOCUS_39530 7602 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 8655 9164 gene locus_tag LOCUS_39540 8655 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 9284 9517 gene locus_tag LOCUS_39550 9284 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 9495 9968 gene locus_tag LOCUS_39560 9495 9968 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_39560 10572 10060 gene locus_tag LOCUS_39570 10572 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 12489 11710 gene locus_tag LOCUS_39580 12489 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 13089 12556 gene locus_tag LOCUS_39590 13089 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 15001 13367 gene locus_tag LOCUS_39600 15001 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108991.1 protein_id gnl|my_center|LOCUS_39600 15603 16775 gene locus_tag LOCUS_39610 15603 16775 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_39610 17711 17268 gene locus_tag LOCUS_39620 17711 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_39620 20454 17770 gene locus_tag LOCUS_39630 gene valS 20454 17770 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_39630 21708 20866 gene locus_tag LOCUS_39640 21708 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 22029 21871 gene locus_tag LOCUS_39650 22029 21871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 >Feature sequence086 1350 256 gene locus_tag LOCUS_39660 gene vdh 1350 256 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_39660 2051 2827 gene locus_tag LOCUS_39670 2051 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2824 3576 gene locus_tag LOCUS_39680 2824 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 3591 4469 gene locus_tag LOCUS_39690 3591 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4550 5221 gene locus_tag LOCUS_39700 4550 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 5304 6377 gene locus_tag LOCUS_39710 5304 6377 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_39710 6867 7571 gene locus_tag LOCUS_39720 6867 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 8878 7700 gene locus_tag LOCUS_39730 8878 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_39730 9198 10388 gene locus_tag LOCUS_39740 9198 10388 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_39740 11864 10857 gene locus_tag LOCUS_39750 11864 10857 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_39750 14900 11916 gene locus_tag LOCUS_39760 14900 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 16372 15107 gene locus_tag LOCUS_39770 16372 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 17271 16435 gene locus_tag LOCUS_39780 17271 16435 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_39780 18443 17403 gene locus_tag LOCUS_39790 18443 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 19664 18858 gene locus_tag LOCUS_39800 19664 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 20300 21805 gene locus_tag LOCUS_39810 20300 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence087 406 741 gene locus_tag LOCUS_39820 406 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 2607 1042 gene locus_tag LOCUS_39830 2607 1042 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_39830 2990 4807 gene locus_tag LOCUS_39840 2990 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_39840 4871 5707 gene locus_tag LOCUS_39850 4871 5707 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_39850 5686 8208 gene locus_tag LOCUS_39860 5686 8208 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947391.1 protein_id gnl|my_center|LOCUS_39860 11330 8205 gene locus_tag LOCUS_39870 11330 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 13031 11529 gene locus_tag LOCUS_39880 gene glyS 13031 11529 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_39880 13383 16547 gene locus_tag LOCUS_39890 13383 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 16719 17300 gene locus_tag LOCUS_39900 16719 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39900 17567 17851 gene locus_tag LOCUS_39910 17567 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39910 18362 17924 gene locus_tag LOCUS_tm00010 18362 17924 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18913 18554 gene locus_tag LOCUS_39920 18913 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 19112 20302 gene locus_tag LOCUS_39930 gene porY 19112 20302 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_39930 20892 20314 gene locus_tag LOCUS_39940 20892 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 21062 21742 gene locus_tag LOCUS_39950 21062 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence088 71 535 gene locus_tag LOCUS_39960 71 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 625 3510 gene locus_tag LOCUS_39970 625 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4107 3628 gene locus_tag LOCUS_39980 4107 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 9628 4319 gene locus_tag LOCUS_39990 9628 4319 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_39990 10527 9985 gene locus_tag LOCUS_40000 10527 9985 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_40000 11419 10880 gene locus_tag LOCUS_40010 11419 10880 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_40010 12465 11779 gene locus_tag LOCUS_40020 12465 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 12955 12626 gene locus_tag LOCUS_40030 12955 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 13931 13095 gene locus_tag LOCUS_40040 gene folP 13931 13095 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_40040 15236 14214 gene locus_tag LOCUS_40050 15236 14214 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_40050 15635 20422 gene locus_tag LOCUS_40060 15635 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 20812 21645 gene locus_tag LOCUS_40070 20812 21645 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_40070 >Feature sequence089 113 676 gene locus_tag LOCUS_40080 113 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 681 1313 gene locus_tag LOCUS_40090 681 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 1596 6819 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatccttattataatgga 6999 7826 gene locus_tag LOCUS_40100 6999 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 8076 8423 gene locus_tag LOCUS_40110 8076 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 8590 8994 gene locus_tag LOCUS_40120 8590 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 9179 9919 gene locus_tag LOCUS_40130 9179 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 10067 12541 gene locus_tag LOCUS_40140 10067 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 12549 13022 gene locus_tag LOCUS_40150 12549 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 13068 13787 gene locus_tag LOCUS_40160 13068 13787 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_40160 13791 14795 gene locus_tag LOCUS_40170 gene csm4 13791 14795 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_40170 14821 15963 gene locus_tag LOCUS_40180 gene csm5 14821 15963 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_40180 15976 18552 gene locus_tag LOCUS_40190 15976 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 18592 19722 gene locus_tag LOCUS_40200 18592 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_40200 19726 20115 gene locus_tag LOCUS_40210 19726 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_40210 20610 20344 gene locus_tag LOCUS_40220 20610 20344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence090 272 1939 gene locus_tag LOCUS_40230 272 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2086 2589 gene locus_tag LOCUS_40240 2086 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2586 3098 gene locus_tag LOCUS_40250 2586 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 3129 3443 gene locus_tag LOCUS_40260 3129 3443 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_40260 3456 3653 gene locus_tag LOCUS_40270 3456 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40270 3647 3919 gene locus_tag LOCUS_40280 3647 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 4019 4207 gene locus_tag LOCUS_40290 4019 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4892 4407 gene locus_tag LOCUS_40300 4892 4407 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q8 protein_id gnl|my_center|LOCUS_40300 5447 5040 gene locus_tag LOCUS_40310 5447 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 5531 6850 gene locus_tag LOCUS_40320 5531 6850 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_40320 7726 6899 gene locus_tag LOCUS_40330 7726 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 8032 8307 gene locus_tag LOCUS_40340 8032 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 8452 9711 gene locus_tag LOCUS_40350 8452 9711 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_40350 10839 9766 gene locus_tag LOCUS_40360 10839 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 10965 11633 gene locus_tag LOCUS_40370 10965 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_40370 13559 11637 gene locus_tag LOCUS_40380 13559 11637 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_40380 14419 13622 gene locus_tag LOCUS_40390 14419 13622 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_40390 14615 15415 gene locus_tag LOCUS_40400 14615 15415 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_40400 16150 15596 gene locus_tag LOCUS_40410 gene ruvC 16150 15596 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_40410 16248 17258 gene locus_tag LOCUS_40420 16248 17258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 17665 17261 gene locus_tag LOCUS_40430 17665 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40430 17989 17753 gene locus_tag LOCUS_40440 17989 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 18516 17989 gene locus_tag LOCUS_40450 gene aroK 18516 17989 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_40450 19059 18550 gene locus_tag LOCUS_40460 19059 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 20347 19241 gene locus_tag LOCUS_40470 20347 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence091 808 392 gene locus_tag LOCUS_40480 808 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 3932 954 gene locus_tag LOCUS_40490 3932 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4156 4491 gene locus_tag LOCUS_40500 4156 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 7287 4495 gene locus_tag LOCUS_40510 7287 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 8414 7386 gene locus_tag LOCUS_40520 8414 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 8963 10906 gene locus_tag LOCUS_40530 8963 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 11047 11847 gene locus_tag LOCUS_40540 11047 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 13237 12035 gene locus_tag LOCUS_40550 13237 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 13611 13219 gene locus_tag LOCUS_40560 13611 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 14295 15530 gene locus_tag LOCUS_40570 14295 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 15779 17224 gene locus_tag LOCUS_40580 15779 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 17274 17807 gene locus_tag LOCUS_40590 17274 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 17812 18507 gene locus_tag LOCUS_40600 17812 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 19083 19316 gene locus_tag LOCUS_40610 19083 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 >Feature sequence092 220 1008 gene locus_tag LOCUS_40620 220 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_40620 998 1381 gene locus_tag LOCUS_40630 998 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_40630 2269 1439 gene locus_tag LOCUS_40640 2269 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 3207 2278 gene locus_tag LOCUS_40650 gene thrB 3207 2278 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_40650 5937 3445 gene locus_tag LOCUS_40660 gene thrA 5937 3445 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_40660 6784 6356 gene locus_tag LOCUS_40670 6784 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 7723 7313 gene locus_tag LOCUS_40680 7723 7313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_40680 9466 7952 gene locus_tag LOCUS_40690 9466 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 9930 10337 gene locus_tag LOCUS_40700 9930 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 11047 10403 gene locus_tag LOCUS_40710 11047 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 11744 11187 gene locus_tag LOCUS_40720 gene yisZ 11744 11187 CDS product putative adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06735 protein_id gnl|my_center|LOCUS_40720 12024 12980 gene locus_tag LOCUS_40730 gene metF 12024 12980 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_40730 14877 13330 gene locus_tag LOCUS_40740 gene rprX 14877 13330 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_40740 15695 15198 gene locus_tag LOCUS_40750 15695 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 17003 15750 gene locus_tag LOCUS_40760 17003 15750 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_40760 18098 17340 gene locus_tag LOCUS_40770 gene scpA 18098 17340 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_40770 18702 18463 gene locus_tag LOCUS_40780 18702 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 19555 18875 gene locus_tag LOCUS_40790 19555 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence093 1347 286 gene locus_tag LOCUS_40800 1347 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1860 1471 gene locus_tag LOCUS_40810 1860 1471 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_40810 2604 1930 gene locus_tag LOCUS_40820 2604 1930 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_40820 4239 2899 gene locus_tag LOCUS_40830 4239 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4970 4512 gene locus_tag LOCUS_40840 4970 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 5595 5017 gene locus_tag LOCUS_40850 5595 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 6050 6601 gene locus_tag LOCUS_40860 6050 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 6881 9256 gene locus_tag LOCUS_40870 6881 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_40870 11994 9391 gene locus_tag LOCUS_40880 11994 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 12274 14070 gene locus_tag LOCUS_40890 gene lepA 12274 14070 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_40890 15567 14464 gene locus_tag LOCUS_40900 15567 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 16375 15749 gene locus_tag LOCUS_40910 16375 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 17485 16505 gene locus_tag LOCUS_40920 gene pdhB 17485 16505 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_40920 18464 17781 gene locus_tag LOCUS_40930 18464 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 18685 18482 gene locus_tag LOCUS_40940 18685 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence094 801 130 gene locus_tag LOCUS_40950 801 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 1049 798 gene locus_tag LOCUS_40960 1049 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 2748 1093 gene locus_tag LOCUS_40970 gene recN 2748 1093 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_40970 3281 4930 gene locus_tag LOCUS_40980 3281 4930 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_40980 8902 5069 gene locus_tag LOCUS_40990 8902 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 9347 10144 gene locus_tag LOCUS_41000 gene murQ 9347 10144 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_41000 11063 10278 gene locus_tag LOCUS_41010 gene aroE 11063 10278 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_41010 11972 11316 gene locus_tag LOCUS_41020 gene tal 11972 11316 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_41020 12226 12651 gene locus_tag LOCUS_41030 12226 12651 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_41030 13004 13786 gene locus_tag LOCUS_41040 13004 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 14018 14323 gene locus_tag LOCUS_41050 14018 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_41050 14444 15718 gene locus_tag LOCUS_41060 14444 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_41060 15797 16423 gene locus_tag LOCUS_41070 15797 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 16541 17794 gene locus_tag LOCUS_41080 gene hflX 16541 17794 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 protein_id gnl|my_center|LOCUS_41080 >Feature sequence095 299 895 gene locus_tag LOCUS_41090 299 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 1062 1586 gene locus_tag LOCUS_41100 1062 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 4530 1792 gene locus_tag LOCUS_41110 4530 1792 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254117.1 protein_id gnl|my_center|LOCUS_41110 5257 4679 gene locus_tag LOCUS_41120 5257 4679 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_41120 6580 5435 gene locus_tag LOCUS_41130 6580 5435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_41130 7163 6675 gene locus_tag LOCUS_41140 7163 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 8578 7607 gene locus_tag LOCUS_41150 8578 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 9056 8715 gene locus_tag LOCUS_41160 9056 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 9466 9233 gene locus_tag LOCUS_41170 9466 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 10968 9490 gene locus_tag LOCUS_41180 10968 9490 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_41180 11584 11063 gene locus_tag LOCUS_41190 11584 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 12746 11616 gene locus_tag LOCUS_41200 12746 11616 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_41200 17030 12909 gene locus_tag LOCUS_41210 17030 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 17574 18200 gene locus_tag LOCUS_41220 17574 18200 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_41220 >Feature sequence096 291 1079 gene locus_tag LOCUS_41230 291 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 1231 2787 gene locus_tag LOCUS_41240 1231 2787 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_41240 3609 3052 gene locus_tag LOCUS_41250 3609 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_41250 4663 3719 gene locus_tag LOCUS_41260 4663 3719 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_41260 5290 4736 gene locus_tag LOCUS_41270 5290 4736 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_41270 6849 5749 gene locus_tag LOCUS_41280 6849 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_41280 7468 7890 gene locus_tag LOCUS_41290 7468 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 7923 8735 gene locus_tag LOCUS_41300 7923 8735 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_41300 8832 9806 gene locus_tag LOCUS_41310 8832 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 10175 10537 gene locus_tag LOCUS_41320 10175 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 10819 12477 gene locus_tag LOCUS_41330 10819 12477 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_41330 13477 12866 gene locus_tag LOCUS_41340 13477 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 13602 15287 gene locus_tag LOCUS_41350 13602 15287 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_41350 15709 15500 gene locus_tag LOCUS_41360 15709 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 16091 17038 gene locus_tag LOCUS_41370 16091 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 17125 17505 gene locus_tag LOCUS_41380 17125 17505 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence097 113 676 gene locus_tag LOCUS_41390 113 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 681 1313 gene locus_tag LOCUS_41400 681 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 1485 1826 gene locus_tag LOCUS_41410 1485 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 2083 4092 gene locus_tag LOCUS_41420 2083 4092 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_41420 4374 5963 gene locus_tag LOCUS_41430 gene hsdM 4374 5963 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_41430 5963 6451 gene locus_tag LOCUS_41440 5963 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 6439 7641 gene locus_tag LOCUS_41450 gene hsdS 6439 7641 CDS product HsdS specificity protein of type I restriction-modification system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068836.1 protein_id gnl|my_center|LOCUS_41450 7713 8237 gene locus_tag LOCUS_41460 7713 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8279 8695 gene locus_tag LOCUS_41470 8279 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 8685 9158 gene locus_tag LOCUS_41480 8685 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 9187 12009 gene locus_tag LOCUS_41490 gene hsdR 9187 12009 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_41490 12239 12943 gene locus_tag LOCUS_41500 12239 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 12940 15030 gene locus_tag LOCUS_41510 12940 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 15030 16739 gene locus_tag LOCUS_41520 15030 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 17164 16898 gene locus_tag LOCUS_41530 17164 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 >Feature sequence098 138 653 gene locus_tag LOCUS_41540 138 653 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_41540 2065 656 gene locus_tag LOCUS_41550 2065 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 2759 2469 gene locus_tag LOCUS_41560 2759 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 8351 2838 gene locus_tag LOCUS_41570 8351 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 8724 10469 gene locus_tag LOCUS_41580 8724 10469 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_41580 10867 10559 gene locus_tag LOCUS_41590 10867 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 12283 10883 gene locus_tag LOCUS_41600 12283 10883 CDS product L-gulonolactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025189.1 protein_id gnl|my_center|LOCUS_41600 12603 15692 gene locus_tag LOCUS_41610 12603 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 15905 16429 gene locus_tag LOCUS_41620 15905 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence099 727 143 gene locus_tag LOCUS_41630 727 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 1853 744 gene locus_tag LOCUS_41640 1853 744 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_41640 2111 2689 gene locus_tag LOCUS_41650 2111 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 2764 3558 gene locus_tag LOCUS_41660 2764 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3753 4640 gene locus_tag LOCUS_41670 gene tatC 3753 4640 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_41670 5027 6031 gene locus_tag LOCUS_41680 gene fabH3 5027 6031 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_41680 6161 6523 gene locus_tag LOCUS_41690 6161 6523 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_41690 6732 7703 gene locus_tag LOCUS_41700 6732 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 7942 9168 gene locus_tag LOCUS_41710 7942 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 9190 9393 gene locus_tag LOCUS_41720 9190 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 9870 11072 gene locus_tag LOCUS_41730 9870 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 12355 11243 gene locus_tag LOCUS_41740 12355 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 14128 12440 gene locus_tag LOCUS_41750 14128 12440 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 protein_id gnl|my_center|LOCUS_41750 14328 15494 gene locus_tag LOCUS_41760 14328 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 >Feature sequence100 374 1570 gene locus_tag LOCUS_41770 gene nuoD 374 1570 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_41770 1710 1991 gene locus_tag LOCUS_41780 1710 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 3539 2448 gene locus_tag LOCUS_41790 3539 2448 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_41790 4424 3933 gene locus_tag LOCUS_41800 4424 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 5061 4582 gene locus_tag LOCUS_41810 5061 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_41810 5666 5163 gene locus_tag LOCUS_41820 5666 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 6277 5690 gene locus_tag LOCUS_41830 6277 5690 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_41830 6777 7403 gene locus_tag LOCUS_41840 6777 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 7563 8075 gene locus_tag LOCUS_41850 7563 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 8176 9123 gene locus_tag LOCUS_41860 8176 9123 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_41860 9772 9260 gene locus_tag LOCUS_41870 9772 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 10284 9814 gene locus_tag LOCUS_41880 10284 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 14661 10795 gene locus_tag LOCUS_41890 14661 10795 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence101 152 586 gene locus_tag LOCUS_41900 152 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 680 1267 gene locus_tag LOCUS_41910 680 1267 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403562.1 protein_id gnl|my_center|LOCUS_41910 1615 2373 gene locus_tag LOCUS_41920 1615 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 2752 2492 gene locus_tag LOCUS_41930 2752 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2822 4438 gene locus_tag LOCUS_41940 2822 4438 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 protein_id gnl|my_center|LOCUS_41940 5171 4581 gene locus_tag LOCUS_41950 5171 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 7507 5819 gene locus_tag LOCUS_41960 gene ggt 7507 5819 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_41960 7889 8467 gene locus_tag LOCUS_41970 7889 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 8515 8919 gene locus_tag LOCUS_41980 8515 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 9748 9257 gene locus_tag LOCUS_41990 9748 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 10197 11573 gene locus_tag LOCUS_42000 10197 11573 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_42000 11809 12045 gene locus_tag LOCUS_42010 11809 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 12133 13317 gene locus_tag LOCUS_42020 gene carA 12133 13317 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_42020 13500 14621 gene locus_tag LOCUS_42030 gene dnaN 13500 14621 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_42030 >Feature sequence102 5624 5409 gene locus_tag LOCUS_42040 5624 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 7766 5847 gene locus_tag LOCUS_42050 7766 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 9350 7932 gene locus_tag LOCUS_42060 9350 7932 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_42060 12060 9529 gene locus_tag LOCUS_42070 12060 9529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_42070 12314 12760 gene locus_tag LOCUS_42080 12314 12760 CDS product rifampin ADP-ribosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_42080 12859 14226 gene locus_tag LOCUS_42090 gene hemN 12859 14226 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_42090 14501 14283 gene locus_tag LOCUS_42100 14501 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 >Feature sequence103 588 364 gene locus_tag LOCUS_42110 588 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 1097 585 gene locus_tag LOCUS_42120 1097 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1423 2262 gene locus_tag LOCUS_42130 1423 2262 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_42130 2308 6120 gene locus_tag LOCUS_42140 2308 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 6718 6128 gene locus_tag LOCUS_42150 6718 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_42150 7559 6741 gene locus_tag LOCUS_42160 7559 6741 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_42160 7473 9530 gene locus_tag LOCUS_42170 7473 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_42170 11396 11779 gene locus_tag LOCUS_42180 11396 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 11958 14000 gene locus_tag LOCUS_42190 11958 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 14013 14474 gene locus_tag LOCUS_42200 14013 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence104 988 545 gene locus_tag LOCUS_42210 988 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 1339 3282 gene locus_tag LOCUS_42220 1339 3282 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203287.1 protein_id gnl|my_center|LOCUS_42220 5248 3323 gene locus_tag LOCUS_42230 5248 3323 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107506.1 protein_id gnl|my_center|LOCUS_42230 5544 6209 gene locus_tag LOCUS_42240 gene udk 5544 6209 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSB2 protein_id gnl|my_center|LOCUS_42240 6240 6932 gene locus_tag LOCUS_42250 6240 6932 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393255.1 protein_id gnl|my_center|LOCUS_42250 7061 7612 gene locus_tag LOCUS_42260 7061 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 7726 8955 gene locus_tag LOCUS_42270 gene ribBA 7726 8955 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_42270 10309 9095 gene locus_tag LOCUS_42280 gene sucC 10309 9095 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_42280 10838 10491 gene locus_tag LOCUS_42290 gene fdx1 10838 10491 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_42290 10908 11453 gene locus_tag LOCUS_42300 gene guaA 10908 11453 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_42300 11930 11511 gene locus_tag LOCUS_42310 11930 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 12987 12037 gene locus_tag LOCUS_42320 gene pfs 12987 12037 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H96 protein_id gnl|my_center|LOCUS_42320 13295 14032 gene locus_tag LOCUS_42330 13295 14032 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_42330 >Feature sequence105 2767 491 gene locus_tag LOCUS_42340 gene acnA 2767 491 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_42340 4034 3099 gene locus_tag LOCUS_42350 4034 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 5064 4054 gene locus_tag LOCUS_42360 5064 4054 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1I7 protein_id gnl|my_center|LOCUS_42360 7404 5671 gene locus_tag LOCUS_42370 7404 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 9529 7637 gene locus_tag LOCUS_42380 9529 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 10292 9906 gene locus_tag LOCUS_42390 10292 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 10985 11251 gene locus_tag LOCUS_42400 gene rpsT 10985 11251 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_42400 11383 13308 gene locus_tag LOCUS_42410 gene dxs 11383 13308 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_42410 >Feature sequence106 1080 211 gene locus_tag LOCUS_42420 1080 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_42420 1373 2143 gene locus_tag LOCUS_42430 1373 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 2170 2973 gene locus_tag LOCUS_42440 2170 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4711 2960 gene locus_tag LOCUS_42450 4711 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 5823 4789 gene locus_tag LOCUS_42460 5823 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 6411 8603 gene locus_tag LOCUS_42470 6411 8603 CDS product prolyl tripeptidyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201860.1 protein_id gnl|my_center|LOCUS_42470 9108 8635 gene locus_tag LOCUS_42480 9108 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 9338 9111 gene locus_tag LOCUS_42490 9338 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 9465 9767 gene locus_tag LOCUS_42500 9465 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 9778 10074 gene locus_tag LOCUS_42510 9778 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 12609 10141 gene locus_tag LOCUS_42520 12609 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence107 565 176 gene locus_tag LOCUS_42530 565 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 1066 635 gene locus_tag LOCUS_42540 1066 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 2277 1066 gene locus_tag LOCUS_42550 2277 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 3697 2381 gene locus_tag LOCUS_42560 3697 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 5089 4187 gene locus_tag LOCUS_42570 5089 4187 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_42570 6288 5299 gene locus_tag LOCUS_42580 6288 5299 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_42580 7203 6343 gene locus_tag LOCUS_42590 7203 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 8362 7391 gene locus_tag LOCUS_42600 gene tktC 8362 7391 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_42600 9293 8622 gene locus_tag LOCUS_42610 9293 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 9880 9440 gene locus_tag LOCUS_42620 9880 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 10018 10446 gene locus_tag LOCUS_42630 10018 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 10446 10850 gene locus_tag LOCUS_42640 10446 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 10854 11465 gene locus_tag LOCUS_42650 10854 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 12384 11479 gene locus_tag LOCUS_42660 12384 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 12867 12400 gene locus_tag LOCUS_42670 12867 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence108 421 1701 gene locus_tag LOCUS_42680 421 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 1868 2191 gene locus_tag LOCUS_42690 1868 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 2475 3932 gene locus_tag LOCUS_42700 gene ycf24 2475 3932 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_42700 4605 4018 gene locus_tag LOCUS_42710 4605 4018 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_42710 6134 4914 gene locus_tag LOCUS_42720 gene mraY 6134 4914 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_42720 7370 6579 gene locus_tag LOCUS_42730 7370 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 8053 9033 gene locus_tag LOCUS_42740 8053 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 9184 9969 gene locus_tag LOCUS_42750 9184 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 10154 11560 gene locus_tag LOCUS_42760 10154 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 11589 12848 gene locus_tag LOCUS_42770 11589 12848 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_42770 >Feature sequence109 <1 1309 gene locus_tag LOCUS_42780 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962354.1:T9SS C-terminal target domain-containing protein 2304 1396 gene locus_tag LOCUS_42790 2304 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_42790 2949 2437 gene locus_tag LOCUS_42800 2949 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 3528 4061 gene locus_tag LOCUS_42810 3528 4061 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_42810 5816 4212 gene locus_tag LOCUS_42820 5816 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 6447 7526 gene locus_tag LOCUS_42830 gene rlmN 6447 7526 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_42830 7773 8309 gene locus_tag LOCUS_42840 7773 8309 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855621.1 protein_id gnl|my_center|LOCUS_42840 8593 9090 gene locus_tag LOCUS_42850 8593 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_42850 9143 10246 gene locus_tag LOCUS_42860 9143 10246 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_42860 11733 10348 gene locus_tag LOCUS_42870 11733 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 12398 11952 gene locus_tag LOCUS_42880 12398 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 12934 12539 gene locus_tag LOCUS_42890 12934 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence110 1407 355 gene locus_tag LOCUS_42900 gene hemH 1407 355 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_42900 1778 2884 gene locus_tag LOCUS_42910 1778 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 2896 3582 gene locus_tag LOCUS_42920 2896 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 4573 3635 gene locus_tag LOCUS_42930 4573 3635 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_42930 5918 4773 gene locus_tag LOCUS_42940 5918 4773 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_42940 6731 8098 gene locus_tag LOCUS_42950 6731 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 8823 8197 gene locus_tag LOCUS_42960 8823 8197 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_42960 9360 8944 gene locus_tag LOCUS_42970 9360 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 9794 9868 gene locus_tag LOCUS_t00440 9794 9868 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10948 9974 gene locus_tag LOCUS_42980 10948 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 11165 11497 gene locus_tag LOCUS_42990 11165 11497 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_42990 11594 12520 gene locus_tag LOCUS_43000 gene arsM 11594 12520 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence111 172 771 gene locus_tag LOCUS_43010 172 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 792 1562 gene locus_tag LOCUS_43020 792 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 1691 2962 gene locus_tag LOCUS_43030 gene fahA 1691 2962 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_43030 3138 6332 gene locus_tag LOCUS_43040 3138 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 6448 7191 gene locus_tag LOCUS_43050 6448 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence112 234 1004 gene locus_tag LOCUS_43060 234 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_43060 2817 1063 gene locus_tag LOCUS_43070 2817 1063 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_43070 3202 3375 gene locus_tag LOCUS_43080 3202 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 3406 4566 gene locus_tag LOCUS_43090 3406 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5421 4645 gene locus_tag LOCUS_43100 5421 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 6603 5545 gene locus_tag LOCUS_43110 6603 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 8089 6929 gene locus_tag LOCUS_43120 8089 6929 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_43120 8477 8277 gene locus_tag LOCUS_43130 8477 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 10542 8848 gene locus_tag LOCUS_43140 gene fhs 10542 8848 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U80 protein_id gnl|my_center|LOCUS_43140 10857 12038 gene locus_tag LOCUS_43150 10857 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 >Feature sequence113 320 1960 gene locus_tag LOCUS_43160 320 1960 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_43160 3491 2088 gene locus_tag LOCUS_43170 3491 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_43170 3747 6035 gene locus_tag LOCUS_43180 3747 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 6120 6707 gene locus_tag LOCUS_43190 6120 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_43190 6784 7689 gene locus_tag LOCUS_43200 gene corA 6784 7689 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT7 protein_id gnl|my_center|LOCUS_43200 7753 8043 gene locus_tag LOCUS_43210 7753 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 8809 8057 gene locus_tag LOCUS_43220 gene pcrB 8809 8057 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_43220 9035 10468 gene locus_tag LOCUS_43230 gene pykA 9035 10468 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_43230 10629 11105 gene locus_tag LOCUS_43240 10629 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence114 1307 516 gene locus_tag LOCUS_43250 1307 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 2558 1479 gene locus_tag LOCUS_43260 2558 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 6046 2648 gene locus_tag LOCUS_43270 gene icmF 6046 2648 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_43270 6435 8105 gene locus_tag LOCUS_43280 6435 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 8866 8594 gene locus_tag LOCUS_43290 gene rpmA 8866 8594 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR3 protein_id gnl|my_center|LOCUS_43290 9282 8971 gene locus_tag LOCUS_43300 9282 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 9752 11083 gene locus_tag LOCUS_43310 gene gltA 9752 11083 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_43310 >Feature sequence115 188 781 gene locus_tag LOCUS_43320 188 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 841 1773 gene locus_tag LOCUS_43330 841 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4967 1860 gene locus_tag LOCUS_43340 4967 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_43340 5286 5762 gene locus_tag LOCUS_43350 5286 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 6310 7041 gene locus_tag LOCUS_43360 6310 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 7010 8482 gene locus_tag LOCUS_43370 7010 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 9558 8668 gene locus_tag LOCUS_43380 9558 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 10151 10612 gene locus_tag LOCUS_43390 gene smpB 10151 10612 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_43390 >Feature sequence116 164 595 gene locus_tag LOCUS_43400 164 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 793 1524 gene locus_tag LOCUS_43410 gene etfB 793 1524 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_43410 1854 2810 gene locus_tag LOCUS_43420 gene etfA 1854 2810 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_43420 3710 3189 gene locus_tag LOCUS_43430 3710 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 4204 3968 gene locus_tag LOCUS_43440 4204 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4517 4783 gene locus_tag LOCUS_43450 4517 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5260 5030 gene locus_tag LOCUS_43460 5260 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 5446 8829 gene locus_tag LOCUS_43470 5446 8829 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_43470 8941 9333 gene locus_tag LOCUS_43480 8941 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 9685 10095 gene locus_tag LOCUS_43490 9685 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence117 269 1000 gene locus_tag LOCUS_43500 269 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 1995 1132 gene locus_tag LOCUS_43510 gene uppP 1995 1132 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_43510 2225 3103 gene locus_tag LOCUS_43520 2225 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_43520 3413 3715 gene locus_tag LOCUS_43530 3413 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 4273 3893 gene locus_tag LOCUS_43540 4273 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 4356 4652 gene locus_tag LOCUS_43550 4356 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 4805 7360 gene locus_tag LOCUS_43560 gene mur/alr 4805 7360 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_43560 7474 8094 gene locus_tag LOCUS_43570 7474 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 8106 8687 gene locus_tag LOCUS_43580 8106 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 8841 9743 gene locus_tag LOCUS_43590 8841 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064924.1 protein_id gnl|my_center|LOCUS_43590 >Feature sequence118 2526 5219 gene locus_tag LOCUS_43600 2526 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 5610 9347 gene locus_tag LOCUS_43610 5610 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 9515 9700 gene locus_tag LOCUS_43620 9515 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence119 449 1987 gene locus_tag LOCUS_43630 gene nuoN 449 1987 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIM2 protein_id gnl|my_center|LOCUS_43630 4090 2168 gene locus_tag LOCUS_43640 4090 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 5127 4396 gene locus_tag LOCUS_43650 5127 4396 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_43650 6414 5344 gene locus_tag LOCUS_43660 6414 5344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 protein_id gnl|my_center|LOCUS_43660 7036 6563 gene locus_tag LOCUS_43670 7036 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 7765 7082 gene locus_tag LOCUS_43680 7765 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 7962 8789 gene locus_tag LOCUS_43690 7962 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_43690 8921 9511 gene locus_tag LOCUS_43700 8921 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence120 466 1695 gene locus_tag LOCUS_43710 466 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 1829 2572 gene locus_tag LOCUS_43720 1829 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 2871 2716 gene locus_tag LOCUS_43730 2871 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 4422 3400 gene locus_tag LOCUS_43740 4422 3400 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_43740 5375 4554 gene locus_tag LOCUS_43750 5375 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 6312 5449 gene locus_tag LOCUS_43760 6312 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 8262 6427 gene locus_tag LOCUS_43770 8262 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_43770 >Feature sequence121 335 204 gene locus_tag LOCUS_43780 335 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 1624 419 gene locus_tag LOCUS_43790 1624 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 3580 2240 gene locus_tag LOCUS_43800 3580 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 4114 5187 gene locus_tag LOCUS_43810 gene ilvK 4114 5187 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_43810 5278 5691 gene locus_tag LOCUS_43820 5278 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 5789 6439 gene locus_tag LOCUS_43830 5789 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 6537 8141 gene locus_tag LOCUS_43840 6537 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_43840 >Feature sequence122 1236 325 gene locus_tag LOCUS_43850 1236 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 1930 1304 gene locus_tag LOCUS_43860 1930 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 3969 1996 gene locus_tag LOCUS_43870 gene purF 3969 1996 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_43870 4983 4117 gene locus_tag LOCUS_43880 4983 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 5576 5151 gene locus_tag LOCUS_43890 5576 5151 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_43890 5706 6083 gene locus_tag LOCUS_43900 gene yjgA 5706 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_43900 6276 8204 gene locus_tag LOCUS_43910 6276 8204 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_43910 >Feature sequence123 313 140 gene locus_tag LOCUS_43920 313 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 1190 330 gene locus_tag LOCUS_43930 1190 330 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_43930 3903 1396 gene locus_tag LOCUS_43940 3903 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 4356 4430 gene locus_tag LOCUS_t00450 4356 4430 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4716 5432 gene locus_tag LOCUS_43950 4716 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43950 5408 5860 gene locus_tag LOCUS_43960 5408 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43960 6672 6334 gene locus_tag LOCUS_43970 6672 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 7111 6629 gene locus_tag LOCUS_43980 7111 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 7439 7152 gene locus_tag LOCUS_43990 7439 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 7611 7390 gene locus_tag LOCUS_44000 7611 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence124 3182 2415 gene locus_tag LOCUS_44010 3182 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 3464 4006 gene locus_tag LOCUS_44020 3464 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 4859 4026 gene locus_tag LOCUS_44030 4859 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 6093 4927 gene locus_tag LOCUS_44040 gene mccB 6093 4927 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05394 protein_id gnl|my_center|LOCUS_44040 6317 7183 gene locus_tag LOCUS_44050 6317 7183 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_44050 7791 7297 gene locus_tag LOCUS_44060 7791 7297 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_44060 >Feature sequence125 530 1399 gene locus_tag LOCUS_44070 gene tktA 530 1399 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_44070 1749 1973 gene locus_tag LOCUS_44080 1749 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3067 2561 gene locus_tag LOCUS_44090 3067 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 3791 4135 gene locus_tag LOCUS_44100 3791 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 5085 4381 gene locus_tag LOCUS_44110 gene fabG 5085 4381 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_44110 7318 5276 gene locus_tag LOCUS_44120 7318 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 >Feature sequence126 1522 1995 gene locus_tag LOCUS_44130 1522 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 2826 2236 gene locus_tag LOCUS_44140 2826 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 3529 2996 gene locus_tag LOCUS_44150 3529 2996 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_44150 4392 3859 gene locus_tag LOCUS_44160 4392 3859 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_44160 5453 4653 gene locus_tag LOCUS_44170 5453 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence127 2740 1373 gene locus_tag LOCUS_44180 2740 1373 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 protein_id gnl|my_center|LOCUS_44180 3140 5833 gene locus_tag LOCUS_44190 3140 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 6412 5990 gene locus_tag LOCUS_44200 6412 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 >Feature sequence128 685 128 gene locus_tag LOCUS_44210 685 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 2498 708 gene locus_tag LOCUS_44220 2498 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 2838 4046 gene locus_tag LOCUS_44230 2838 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_44230 4133 5755 gene locus_tag LOCUS_44240 4133 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 >Feature sequence129 441 88 gene locus_tag LOCUS_44250 441 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 2893 1082 gene locus_tag LOCUS_44260 gene typA 2893 1082 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_44260 3719 3791 gene locus_tag LOCUS_t00460 3719 3791 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3866 3938 gene locus_tag LOCUS_t00470 3866 3938 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4077 4901 gene locus_tag LOCUS_44270 4077 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 5186 4902 gene locus_tag LOCUS_44280 5186 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence130 1301 171 gene locus_tag LOCUS_44290 1301 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_44290 1924 1352 gene locus_tag LOCUS_44300 1924 1352 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_44300 4178 2148 gene locus_tag LOCUS_44310 gene ligA 4178 2148 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_44310 4724 4278 gene locus_tag LOCUS_44320 4724 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 >Feature sequence131 3177 2206 gene locus_tag LOCUS_44330 3177 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 4179 3400 gene locus_tag LOCUS_44340 4179 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_44340 >Feature sequence132 802 329 gene locus_tag LOCUS_44350 802 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 3091 1259 gene locus_tag LOCUS_44360 3091 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 4394 3435 gene locus_tag LOCUS_44370 4394 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 5116 4634 gene locus_tag LOCUS_44380 5116 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence133 188 631 gene locus_tag LOCUS_44390 188 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 1631 681 gene locus_tag LOCUS_44400 1631 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 2492 1809 gene locus_tag LOCUS_44410 2492 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 2730 3350 gene locus_tag LOCUS_44420 2730 3350 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_44420 3443 4645 gene locus_tag LOCUS_44430 3443 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence134 5152 4757 gene locus_tag LOCUS_44440 5152 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence135 1472 198 gene locus_tag LOCUS_44450 1472 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_44450 2563 1856 gene locus_tag LOCUS_44460 2563 1856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_44460 4397 2736 gene locus_tag LOCUS_44470 4397 2736 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_44470 >Feature sequence136 149 442 gene locus_tag LOCUS_44480 149 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 663 1775 gene locus_tag LOCUS_44490 gene gmd 663 1775 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_44490 1965 3506 gene locus_tag LOCUS_44500 1965 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3516 4571 gene locus_tag LOCUS_44510 gene fcl 3516 4571 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VA9 protein_id gnl|my_center|LOCUS_44510 >Feature sequence137 900 2549 gene locus_tag LOCUS_44520 900 2549 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 protein_id gnl|my_center|LOCUS_44520 2643 3197 gene locus_tag LOCUS_44530 2643 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_44530 3711 3202 gene locus_tag LOCUS_44540 3711 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_44540 >Feature sequence138 391 1644 gene locus_tag LOCUS_44550 391 1644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_44550 2002 3501 gene locus_tag LOCUS_44560 gene hutH1 2002 3501 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_44560 >Feature sequence139 782 210 gene locus_tag LOCUS_44570 782 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 1245 1835 gene locus_tag LOCUS_44580 1245 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 3064 2105 gene locus_tag LOCUS_44590 3064 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 >Feature sequence140 449 1123 gene locus_tag LOCUS_44600 449 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 1131 1520 gene locus_tag LOCUS_44610 1131 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 1631 2218 gene locus_tag LOCUS_44620 1631 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 2877 2314 gene locus_tag LOCUS_44630 2877 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 >Feature sequence141 <1 3043 gene locus_tag LOCUS_44640 <1 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence142 132 743 gene locus_tag LOCUS_44650 132 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 682 1140 gene locus_tag LOCUS_44660 682 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 1539 1739 gene locus_tag LOCUS_44670 1539 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence143 784 92 gene locus_tag LOCUS_44680 784 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 1153 2700 gene locus_tag LOCUS_44690 1153 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 >Feature sequence144 747 205 gene locus_tag LOCUS_44700 gene rmlC 747 205 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_44700 843 1895 gene locus_tag LOCUS_44710 843 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence145 >Feature sequence146 808 1746 gene locus_tag LOCUS_44720 808 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence147 1732 59 gene locus_tag LOCUS_44730 1732 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 >Feature sequence148 1717 59 gene locus_tag LOCUS_44740 1717 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 >Feature sequence149 438 1109 gene locus_tag LOCUS_44750 438 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 1117 1506 gene locus_tag LOCUS_44760 1117 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 >Feature sequence150 294 524 gene locus_tag LOCUS_44770 294 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 528 794 gene locus_tag LOCUS_44780 528 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 781 1275 gene locus_tag LOCUS_44790 781 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 1269 1544 gene locus_tag LOCUS_44800 1269 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 >Feature sequence151 294 524 gene locus_tag LOCUS_44810 294 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 528 794 gene locus_tag LOCUS_44820 528 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 781 1275 gene locus_tag LOCUS_44830 781 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 1269 1541 gene locus_tag LOCUS_44840 1269 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840