>Feature sequence001 <1 4131 gene locus_tag LOCUS_00010 <1 4131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268805.1:RHS repeat-associated core domain-containing protein 4131 4535 gene locus_tag LOCUS_00020 4131 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4558 4956 gene locus_tag LOCUS_00030 4558 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6089 5220 gene locus_tag LOCUS_00040 6089 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6719 6156 gene locus_tag LOCUS_00050 6719 6156 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_00050 9319 6716 gene locus_tag LOCUS_00060 9319 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9550 13155 gene locus_tag LOCUS_00070 9550 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 13175 15385 gene locus_tag LOCUS_00080 13175 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15508 17058 gene locus_tag LOCUS_00090 15508 17058 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_00090 17318 21406 gene locus_tag LOCUS_00100 17318 21406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 21467 21808 gene locus_tag LOCUS_00110 21467 21808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 24382 21977 gene locus_tag LOCUS_00120 24382 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 24960 24382 gene locus_tag LOCUS_00130 24960 24382 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_00130 25346 26356 gene locus_tag LOCUS_00140 25346 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 28370 26424 gene locus_tag LOCUS_00150 28370 26424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 29189 28488 gene locus_tag LOCUS_00160 29189 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 29624 29226 gene locus_tag LOCUS_00170 29624 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 30784 29945 gene locus_tag LOCUS_00180 30784 29945 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_00180 30945 31412 gene locus_tag LOCUS_00190 30945 31412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 31520 31915 gene locus_tag LOCUS_00200 31520 31915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 32439 32239 gene locus_tag LOCUS_00210 32439 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_00210 34773 32581 gene locus_tag LOCUS_00220 gene katG 34773 32581 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_00220 35352 34921 gene locus_tag LOCUS_00230 35352 34921 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_00230 36255 35425 gene locus_tag LOCUS_00240 gene mscS 36255 35425 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_00240 37936 36485 gene locus_tag LOCUS_00250 37936 36485 CDS product metallo-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_00250 39690 37933 gene locus_tag LOCUS_00260 39690 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 40377 49049 gene locus_tag LOCUS_00270 40377 49049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 49046 60901 gene locus_tag LOCUS_00280 49046 60901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 60894 75371 gene locus_tag LOCUS_00290 60894 75371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 75386 80041 gene locus_tag LOCUS_00300 75386 80041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 80054 81085 gene locus_tag LOCUS_00310 80054 81085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_00310 81104 86524 gene locus_tag LOCUS_00320 gene ambE 81104 86524 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895606.1 protein_id gnl|my_center|LOCUS_00320 86588 88189 gene locus_tag LOCUS_00330 86588 88189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551694.1 protein_id gnl|my_center|LOCUS_00330 88270 95946 gene locus_tag LOCUS_00340 88270 95946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 95955 108995 gene locus_tag LOCUS_00350 95955 108995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 108988 110721 gene locus_tag LOCUS_00360 108988 110721 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_00360 110718 119888 gene locus_tag LOCUS_00370 110718 119888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 119937 121004 gene locus_tag LOCUS_00380 gene ambD 119937 121004 CDS product protein AmbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_00380 121058 129118 gene locus_tag LOCUS_00390 121058 129118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 129153 131591 gene locus_tag LOCUS_00400 129153 131591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00400 131612 133327 gene locus_tag LOCUS_00410 131612 133327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_00410 133324 134721 gene locus_tag LOCUS_00420 133324 134721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 134743 137055 gene locus_tag LOCUS_00430 134743 137055 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_00430 138444 137086 gene locus_tag LOCUS_00440 138444 137086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 140033 138525 gene locus_tag LOCUS_00450 140033 138525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 140178 142616 gene locus_tag LOCUS_00460 140178 142616 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_00460 142756 142950 gene locus_tag LOCUS_00470 142756 142950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 143174 145336 gene locus_tag LOCUS_00480 143174 145336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 146917 145409 gene locus_tag LOCUS_00490 146917 145409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 147476 147144 gene locus_tag LOCUS_00500 147476 147144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 147730 149403 gene locus_tag LOCUS_00510 147730 149403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 149400 151520 gene locus_tag LOCUS_00520 149400 151520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 154336 152675 gene locus_tag LOCUS_00530 154336 152675 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_00530 155171 154383 gene locus_tag LOCUS_00540 155171 154383 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_00540 155465 156136 gene locus_tag LOCUS_00550 155465 156136 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546325.1 protein_id gnl|my_center|LOCUS_00550 156133 157467 gene locus_tag LOCUS_00560 156133 157467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 157480 160146 gene locus_tag LOCUS_00570 157480 160146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 161192 160149 gene locus_tag LOCUS_00580 161192 160149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 163816 161297 gene locus_tag LOCUS_00590 163816 161297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_00590 166600 164105 gene locus_tag LOCUS_00600 166600 164105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 166837 168975 gene locus_tag LOCUS_00610 166837 168975 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_00610 170075 168987 gene locus_tag LOCUS_00620 170075 168987 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 protein_id gnl|my_center|LOCUS_00620 172431 170212 gene locus_tag LOCUS_00630 172431 170212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071387.1 protein_id gnl|my_center|LOCUS_00630 173766 172525 gene locus_tag LOCUS_00640 173766 172525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919394.1 protein_id gnl|my_center|LOCUS_00640 175199 173763 gene locus_tag LOCUS_00650 175199 173763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_00650 175951 175196 gene locus_tag LOCUS_00660 gene drrA 175951 175196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038800.1 protein_id gnl|my_center|LOCUS_00660 176251 179148 gene locus_tag LOCUS_00670 176251 179148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 179418 180830 gene locus_tag LOCUS_00680 179418 180830 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082772.1 protein_id gnl|my_center|LOCUS_00680 181138 185115 gene locus_tag LOCUS_00690 181138 185115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 187786 185099 gene locus_tag LOCUS_00700 187786 185099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 188030 191254 gene locus_tag LOCUS_00710 188030 191254 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_00710 193602 191434 gene locus_tag LOCUS_00720 gene dcp 193602 191434 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_00720 193941 194612 gene locus_tag LOCUS_00730 193941 194612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268625.1 protein_id gnl|my_center|LOCUS_00730 194609 196057 gene locus_tag LOCUS_00740 194609 196057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 196054 197016 gene locus_tag LOCUS_00750 196054 197016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 197424 197017 gene locus_tag LOCUS_00760 gene fur 197424 197017 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_00760 197689 198924 gene locus_tag LOCUS_00770 197689 198924 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_00770 199581 199021 gene locus_tag LOCUS_00780 199581 199021 CDS product tryptophan repressor-binding protein (wrbA) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877850.1 protein_id gnl|my_center|LOCUS_00780 199597 199794 gene locus_tag LOCUS_00790 199597 199794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 199781 202318 gene locus_tag LOCUS_00800 199781 202318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 202315 202887 gene locus_tag LOCUS_00810 202315 202887 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_00810 203575 202892 gene locus_tag LOCUS_00820 gene ycaC 203575 202892 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043290.1 protein_id gnl|my_center|LOCUS_00820 205249 203699 gene locus_tag LOCUS_00830 205249 203699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089705.1 protein_id gnl|my_center|LOCUS_00830 206967 205261 gene locus_tag LOCUS_00840 206967 205261 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 protein_id gnl|my_center|LOCUS_00840 208787 206997 gene locus_tag LOCUS_00850 gene aepA 208787 206997 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_00850 209007 210107 gene locus_tag LOCUS_00860 209007 210107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 210246 211133 gene locus_tag LOCUS_00870 210246 211133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 211130 212812 gene locus_tag LOCUS_00880 211130 212812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 212926 212702 gene locus_tag LOCUS_00890 212926 212702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 213502 213011 gene locus_tag LOCUS_00900 213502 213011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 216155 213687 gene locus_tag LOCUS_00910 216155 213687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 216649 217836 gene locus_tag LOCUS_00920 216649 217836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_00920 217994 221284 gene locus_tag LOCUS_00930 217994 221284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00930 222810 221563 gene locus_tag LOCUS_00940 222810 221563 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_00940 223355 223017 gene locus_tag LOCUS_00950 223355 223017 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_00950 226080 223639 gene locus_tag LOCUS_00960 226080 223639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_00960 226774 226370 gene locus_tag LOCUS_00970 226774 226370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 229581 227122 gene locus_tag LOCUS_00980 229581 227122 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_00980 230822 229683 gene locus_tag LOCUS_00990 230822 229683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 231144 233444 gene locus_tag LOCUS_01000 231144 233444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 233441 234322 gene locus_tag LOCUS_01010 233441 234322 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_01010 234309 235280 gene locus_tag LOCUS_01020 234309 235280 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_01020 235294 236229 gene locus_tag LOCUS_01030 235294 236229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 236226 236951 gene locus_tag LOCUS_01040 236226 236951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_01040 236948 237823 gene locus_tag LOCUS_01050 236948 237823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_01050 237904 244338 gene locus_tag LOCUS_01060 237904 244338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 245725 244388 gene locus_tag LOCUS_01070 245725 244388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104878.1 protein_id gnl|my_center|LOCUS_01070 247104 246085 gene locus_tag LOCUS_01080 247104 246085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 248991 247690 gene locus_tag LOCUS_01090 248991 247690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 250269 249268 gene locus_tag LOCUS_01100 gene oruR 250269 249268 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_01100 250551 253160 gene locus_tag LOCUS_01110 250551 253160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039895.1 protein_id gnl|my_center|LOCUS_01110 256047 253240 gene locus_tag LOCUS_01120 256047 253240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 256552 258954 gene locus_tag LOCUS_01130 256552 258954 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_01130 259014 260207 gene locus_tag LOCUS_01140 259014 260207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_01140 260600 260190 gene locus_tag LOCUS_01150 260600 260190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 260916 260698 gene locus_tag LOCUS_01160 260916 260698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 260798 263221 gene locus_tag LOCUS_01170 260798 263221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_01170 263291 264334 gene locus_tag LOCUS_01180 263291 264334 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124037.1 protein_id gnl|my_center|LOCUS_01180 266936 264600 gene locus_tag LOCUS_01190 266936 264600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 267185 267583 gene locus_tag LOCUS_01200 267185 267583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 267805 268242 gene locus_tag LOCUS_01210 267805 268242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 268252 268836 gene locus_tag LOCUS_01220 gene rpoE 268252 268836 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_01220 268833 269228 gene locus_tag LOCUS_01230 268833 269228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 269320 269949 gene locus_tag LOCUS_01240 269320 269949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 protein_id gnl|my_center|LOCUS_01240 270233 270736 gene locus_tag LOCUS_01250 270233 270736 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 protein_id gnl|my_center|LOCUS_01250 270729 272903 gene locus_tag LOCUS_01260 270729 272903 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_01260 277298 275493 gene locus_tag LOCUS_01270 277298 275493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 277840 277505 gene locus_tag LOCUS_01280 277840 277505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 281559 278401 gene locus_tag LOCUS_01290 281559 278401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 281792 281574 gene locus_tag LOCUS_01300 281792 281574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 283868 283569 gene locus_tag LOCUS_01310 283868 283569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 286547 284961 gene locus_tag LOCUS_01320 286547 284961 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_01320 288166 286568 gene locus_tag LOCUS_01330 288166 286568 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_01330 288535 289740 gene locus_tag LOCUS_01340 288535 289740 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_01340 289745 291712 gene locus_tag LOCUS_01350 289745 291712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 292331 291765 gene locus_tag LOCUS_01360 292331 291765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 293089 292496 gene locus_tag LOCUS_01370 293089 292496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 293989 293165 gene locus_tag LOCUS_01380 293989 293165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 294154 295803 gene locus_tag LOCUS_01390 294154 295803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 295820 296476 gene locus_tag LOCUS_01400 gene queE 295820 296476 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_01400 296530 297117 gene locus_tag LOCUS_01410 296530 297117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_01410 298701 297172 gene locus_tag LOCUS_01420 298701 297172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01420 299257 298742 gene locus_tag LOCUS_01430 299257 298742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 299425 299652 gene locus_tag LOCUS_01440 299425 299652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 299649 300065 gene locus_tag LOCUS_01450 gene vapc26 299649 300065 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2L6 protein_id gnl|my_center|LOCUS_01450 302706 300082 gene locus_tag LOCUS_01460 302706 300082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_01460 303050 302718 gene locus_tag LOCUS_01470 303050 302718 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_01470 303328 304560 gene locus_tag LOCUS_01480 303328 304560 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 protein_id gnl|my_center|LOCUS_01480 304557 305513 gene locus_tag LOCUS_01490 304557 305513 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_01490 305837 305658 gene locus_tag LOCUS_01500 305837 305658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 305775 307097 gene locus_tag LOCUS_01510 305775 307097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 307200 309029 gene locus_tag LOCUS_01520 307200 309029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 311227 309026 gene locus_tag LOCUS_01530 311227 309026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 311824 311264 gene locus_tag LOCUS_01540 311824 311264 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_01540 312035 315535 gene locus_tag LOCUS_01550 312035 315535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 316405 315578 gene locus_tag LOCUS_01560 gene cobB 316405 315578 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIH7 protein_id gnl|my_center|LOCUS_01560 317478 316435 gene locus_tag LOCUS_01570 317478 316435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 319045 317615 gene locus_tag LOCUS_01580 319045 317615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 319141 320073 gene locus_tag LOCUS_01590 319141 320073 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704931.1 protein_id gnl|my_center|LOCUS_01590 321596 320070 gene locus_tag LOCUS_01600 321596 320070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 322728 321589 gene locus_tag LOCUS_01610 322728 321589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF27 protein_id gnl|my_center|LOCUS_01610 323368 322736 gene locus_tag LOCUS_01620 323368 322736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 323541 324284 gene locus_tag LOCUS_01630 323541 324284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 324309 325538 gene locus_tag LOCUS_01640 324309 325538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 329584 325469 gene locus_tag LOCUS_01650 329584 325469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 329969 329682 gene locus_tag LOCUS_01660 329969 329682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 331147 329966 gene locus_tag LOCUS_01670 331147 329966 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3E3 protein_id gnl|my_center|LOCUS_01670 331658 332914 gene locus_tag LOCUS_01680 331658 332914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974563.1 protein_id gnl|my_center|LOCUS_01680 332988 334016 gene locus_tag LOCUS_01690 332988 334016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 334013 336208 gene locus_tag LOCUS_01700 334013 336208 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_01700 337512 336229 gene locus_tag LOCUS_01710 337512 336229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 337784 338881 gene locus_tag LOCUS_01720 337784 338881 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_01720 339475 338912 gene locus_tag LOCUS_01730 339475 338912 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_01730 342326 339576 gene locus_tag LOCUS_01740 342326 339576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 343461 342319 gene locus_tag LOCUS_01750 343461 342319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 344423 343560 gene locus_tag LOCUS_01760 344423 343560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 346254 344437 gene locus_tag LOCUS_01770 346254 344437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 347215 346259 gene locus_tag LOCUS_01780 347215 346259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 348231 347212 gene locus_tag LOCUS_01790 gene batB 348231 347212 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_01790 349261 348242 gene locus_tag LOCUS_01800 349261 348242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 350544 349258 gene locus_tag LOCUS_01810 350544 349258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 351482 350541 gene locus_tag LOCUS_01820 351482 350541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_01820 352610 351606 gene locus_tag LOCUS_01830 352610 351606 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_01830 352914 353717 gene locus_tag LOCUS_01840 gene rsmA 352914 353717 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM60 protein_id gnl|my_center|LOCUS_01840 353730 354065 gene locus_tag LOCUS_01850 353730 354065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 354072 354956 gene locus_tag LOCUS_01860 354072 354956 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence002 1423 227 gene locus_tag LOCUS_01870 1423 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1692 1510 gene locus_tag LOCUS_01880 1692 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3189 1711 gene locus_tag LOCUS_01890 3189 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3595 4377 gene locus_tag LOCUS_01900 3595 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 6830 4434 gene locus_tag LOCUS_01910 6830 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_01910 8877 6832 gene locus_tag LOCUS_01920 8877 6832 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 protein_id gnl|my_center|LOCUS_01920 8986 10734 gene locus_tag LOCUS_01930 8986 10734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_01930 11036 11353 gene locus_tag LOCUS_01940 11036 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 12039 11365 gene locus_tag LOCUS_01950 12039 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 13055 12036 gene locus_tag LOCUS_01960 13055 12036 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_01960 15369 13213 gene locus_tag LOCUS_01970 15369 13213 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_01970 17477 15366 gene locus_tag LOCUS_01980 17477 15366 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_01980 17682 19217 gene locus_tag LOCUS_01990 17682 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 20898 19222 gene locus_tag LOCUS_02000 20898 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 21063 21992 gene locus_tag LOCUS_02010 21063 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 22134 23624 gene locus_tag LOCUS_02020 22134 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 24055 23669 gene locus_tag LOCUS_02030 24055 23669 CDS product cinnamoyl ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896562.1 protein_id gnl|my_center|LOCUS_02030 24177 25142 gene locus_tag LOCUS_02040 24177 25142 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_02040 25598 25143 gene locus_tag LOCUS_02050 gene ytoQ 25598 25143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_02050 25741 25657 gene locus_tag LOCUS_t00010 25741 25657 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25870 26301 gene locus_tag LOCUS_02060 25870 26301 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_02060 27997 26351 gene locus_tag LOCUS_02070 27997 26351 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_02070 29582 28125 gene locus_tag LOCUS_02080 29582 28125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 31665 29602 gene locus_tag LOCUS_02090 31665 29602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 32105 31650 gene locus_tag LOCUS_02100 32105 31650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 33689 32499 gene locus_tag LOCUS_02110 33689 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 35686 33677 gene locus_tag LOCUS_02120 35686 33677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 36573 35683 gene locus_tag LOCUS_02130 gene natA 36573 35683 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_02130 37857 36577 gene locus_tag LOCUS_02140 37857 36577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 38008 38862 gene locus_tag LOCUS_02150 38008 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 38868 42185 gene locus_tag LOCUS_02160 38868 42185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 42374 43864 gene locus_tag LOCUS_02170 gene crtI 42374 43864 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_02170 43864 45408 gene locus_tag LOCUS_02180 43864 45408 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123505.1 protein_id gnl|my_center|LOCUS_02180 45405 46400 gene locus_tag LOCUS_02190 45405 46400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 46397 47551 gene locus_tag LOCUS_02200 46397 47551 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123502.1 protein_id gnl|my_center|LOCUS_02200 47580 48503 gene locus_tag LOCUS_02210 47580 48503 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123324.1 protein_id gnl|my_center|LOCUS_02210 48500 49651 gene locus_tag LOCUS_02220 48500 49651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_02220 49648 50217 gene locus_tag LOCUS_02230 49648 50217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 52006 50564 gene locus_tag LOCUS_02240 52006 50564 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 protein_id gnl|my_center|LOCUS_02240 52347 53021 gene locus_tag LOCUS_02250 gene colR 52347 53021 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_02250 53021 54370 gene locus_tag LOCUS_02260 53021 54370 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_02260 55773 54598 gene locus_tag LOCUS_02270 55773 54598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_02270 56050 58209 gene locus_tag LOCUS_02280 56050 58209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 58276 58446 gene locus_tag LOCUS_02290 58276 58446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 60168 58657 gene locus_tag LOCUS_02300 60168 58657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 60791 60165 gene locus_tag LOCUS_02310 60791 60165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 61295 60954 gene locus_tag LOCUS_02320 61295 60954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 62141 61734 gene locus_tag LOCUS_02330 62141 61734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 63292 62138 gene locus_tag LOCUS_02340 63292 62138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_02340 64344 63289 gene locus_tag LOCUS_02350 64344 63289 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_02350 64694 64344 gene locus_tag LOCUS_02360 64694 64344 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_02360 65761 64919 gene locus_tag LOCUS_02370 65761 64919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 66621 65758 gene locus_tag LOCUS_02380 66621 65758 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_02380 66862 67734 gene locus_tag LOCUS_02390 66862 67734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_02390 67814 68920 gene locus_tag LOCUS_02400 67814 68920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 70039 68924 gene locus_tag LOCUS_02410 70039 68924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 70392 71492 gene locus_tag LOCUS_02420 gene gcvT 70392 71492 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_02420 71579 71965 gene locus_tag LOCUS_02430 gene gcvH 71579 71965 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_02430 71973 72386 gene locus_tag LOCUS_02440 71973 72386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 75878 72396 gene locus_tag LOCUS_02450 75878 72396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 77059 75875 gene locus_tag LOCUS_02460 77059 75875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 77234 77998 gene locus_tag LOCUS_02470 77234 77998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 77995 78804 gene locus_tag LOCUS_02480 77995 78804 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_02480 78801 79922 gene locus_tag LOCUS_02490 gene corA 78801 79922 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_02490 80895 79984 gene locus_tag LOCUS_02500 80895 79984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 81411 80908 gene locus_tag LOCUS_02510 81411 80908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 82021 81395 gene locus_tag LOCUS_02520 gene nadD 82021 81395 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE64 protein_id gnl|my_center|LOCUS_02520 83117 82029 gene locus_tag LOCUS_02530 83117 82029 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_02530 83538 83281 gene locus_tag LOCUS_02540 gene rpmA 83538 83281 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_02540 83869 83561 gene locus_tag LOCUS_02550 gene rplU 83869 83561 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV02 protein_id gnl|my_center|LOCUS_02550 84601 84104 gene locus_tag LOCUS_02560 84601 84104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 85517 84687 gene locus_tag LOCUS_02570 gene czcD 85517 84687 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_02570 86172 85840 gene locus_tag LOCUS_02580 86172 85840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 86945 86433 gene locus_tag LOCUS_02590 86945 86433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 87029 87460 gene locus_tag LOCUS_02600 87029 87460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 88020 87613 gene locus_tag LOCUS_02610 88020 87613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 88479 89726 gene locus_tag LOCUS_02620 88479 89726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 89921 89846 gene locus_tag LOCUS_t00020 89921 89846 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 91346 90003 gene locus_tag LOCUS_02630 gene purA 91346 90003 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG93 protein_id gnl|my_center|LOCUS_02630 91632 92456 gene locus_tag LOCUS_02640 91632 92456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 92456 93763 gene locus_tag LOCUS_02650 gene hemA 92456 93763 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_02650 93760 94695 gene locus_tag LOCUS_02660 gene hemC 93760 94695 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS3 protein_id gnl|my_center|LOCUS_02660 94725 95459 gene locus_tag LOCUS_02670 94725 95459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 96796 95462 gene locus_tag LOCUS_02680 96796 95462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 97865 96864 gene locus_tag LOCUS_02690 97865 96864 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_02690 98083 98646 gene locus_tag LOCUS_02700 gene efp 98083 98646 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_02700 98639 99646 gene locus_tag LOCUS_02710 gene epmA 98639 99646 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 protein_id gnl|my_center|LOCUS_02710 99688 101172 gene locus_tag LOCUS_02720 99688 101172 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_02720 101496 102938 gene locus_tag LOCUS_02730 101496 102938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_02730 103038 103925 gene locus_tag LOCUS_02740 103038 103925 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_02740 104820 103993 gene locus_tag LOCUS_02750 104820 103993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 105149 105880 gene locus_tag LOCUS_02760 105149 105880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 108045 105898 gene locus_tag LOCUS_02770 108045 105898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 109115 108078 gene locus_tag LOCUS_02780 109115 108078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 109239 113966 gene locus_tag LOCUS_02790 109239 113966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 114330 114632 gene locus_tag LOCUS_02800 114330 114632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 114629 115687 gene locus_tag LOCUS_02810 gene ahbD 114629 115687 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_02810 115904 120469 gene locus_tag LOCUS_02820 115904 120469 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_02820 120518 121537 gene locus_tag LOCUS_02830 gene troA 120518 121537 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_02830 121534 122352 gene locus_tag LOCUS_02840 121534 122352 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_02840 122352 123632 gene locus_tag LOCUS_02850 gene mntB 122352 123632 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_02850 123703 124776 gene locus_tag LOCUS_02860 123703 124776 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_02860 125800 124727 gene locus_tag LOCUS_02870 125800 124727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_02870 125778 126863 gene locus_tag LOCUS_02880 125778 126863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203634.1 protein_id gnl|my_center|LOCUS_02880 128772 126820 gene locus_tag LOCUS_02890 128772 126820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 128851 131490 gene locus_tag LOCUS_02900 128851 131490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_02900 131754 132854 gene locus_tag LOCUS_02910 131754 132854 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_02910 134223 132862 gene locus_tag LOCUS_02920 134223 132862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 135925 134327 gene locus_tag LOCUS_02930 135925 134327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 136444 136010 gene locus_tag LOCUS_02940 136444 136010 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_02940 136728 136441 gene locus_tag LOCUS_02950 136728 136441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141708.1 protein_id gnl|my_center|LOCUS_02950 137307 136798 gene locus_tag LOCUS_02960 137307 136798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 139631 137340 gene locus_tag LOCUS_02970 139631 137340 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_02970 140360 139785 gene locus_tag LOCUS_02980 140360 139785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 140491 141357 gene locus_tag LOCUS_02990 140491 141357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_02990 142923 141394 gene locus_tag LOCUS_03000 gene hutH 142923 141394 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF87 protein_id gnl|my_center|LOCUS_03000 144612 142927 gene locus_tag LOCUS_03010 gene hutU 144612 142927 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV4 protein_id gnl|my_center|LOCUS_03010 146113 145154 gene locus_tag LOCUS_03020 gene mmuM 146113 145154 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258939.1 protein_id gnl|my_center|LOCUS_03020 146131 146919 gene locus_tag LOCUS_03030 146131 146919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 146912 148156 gene locus_tag LOCUS_03040 146912 148156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 148153 149721 gene locus_tag LOCUS_03050 148153 149721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 149735 150190 gene locus_tag LOCUS_03060 149735 150190 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882L6 protein_id gnl|my_center|LOCUS_03060 150260 151099 gene locus_tag LOCUS_03070 150260 151099 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_03070 151925 151077 gene locus_tag LOCUS_03080 151925 151077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 152040 153485 gene locus_tag LOCUS_03090 152040 153485 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_03090 153625 156765 gene locus_tag LOCUS_03100 153625 156765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 156801 157493 gene locus_tag LOCUS_03110 156801 157493 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706997.1 protein_id gnl|my_center|LOCUS_03110 157490 158758 gene locus_tag LOCUS_03120 157490 158758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 161472 158842 gene locus_tag LOCUS_03130 gene bfeA 161472 158842 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_03130 163359 161872 gene locus_tag LOCUS_03140 163359 161872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 167610 163435 gene locus_tag LOCUS_03150 167610 163435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 169403 167613 gene locus_tag LOCUS_03160 169403 167613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 170591 169410 gene locus_tag LOCUS_03170 170591 169410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 171257 170631 gene locus_tag LOCUS_03180 171257 170631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 171448 172212 gene locus_tag LOCUS_03190 171448 172212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 173068 172463 gene locus_tag LOCUS_03200 173068 172463 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265774.1 protein_id gnl|my_center|LOCUS_03200 173793 173065 gene locus_tag LOCUS_03210 173793 173065 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120235.1 protein_id gnl|my_center|LOCUS_03210 173937 175364 gene locus_tag LOCUS_03220 173937 175364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 177014 175392 gene locus_tag LOCUS_03230 177014 175392 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_03230 177127 178215 gene locus_tag LOCUS_03240 177127 178215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_03240 179237 178461 gene locus_tag LOCUS_03250 179237 178461 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_03250 179530 183216 gene locus_tag LOCUS_03260 179530 183216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 184344 183268 gene locus_tag LOCUS_03270 gene rsgA 184344 183268 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_03270 184931 186694 gene locus_tag LOCUS_03280 184931 186694 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_03280 186711 188066 gene locus_tag LOCUS_03290 186711 188066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 188675 188941 gene locus_tag LOCUS_03300 188675 188941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 188976 189491 gene locus_tag LOCUS_03310 188976 189491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_03310 189503 189967 gene locus_tag LOCUS_03320 189503 189967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 191573 190023 gene locus_tag LOCUS_03330 191573 190023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 193768 191918 gene locus_tag LOCUS_03340 193768 191918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 195072 193879 gene locus_tag LOCUS_03350 195072 193879 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259610.1 protein_id gnl|my_center|LOCUS_03350 196255 195089 gene locus_tag LOCUS_03360 196255 195089 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250684.1 protein_id gnl|my_center|LOCUS_03360 198000 196252 gene locus_tag LOCUS_03370 198000 196252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 199106 198006 gene locus_tag LOCUS_03380 199106 198006 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_03380 200983 199112 gene locus_tag LOCUS_03390 gene asnB 200983 199112 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_03390 200916 202181 gene locus_tag LOCUS_03400 200916 202181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 202178 203404 gene locus_tag LOCUS_03410 202178 203404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 203687 204604 gene locus_tag LOCUS_03420 203687 204604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 204609 205481 gene locus_tag LOCUS_03430 204609 205481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 205478 206320 gene locus_tag LOCUS_03440 gene ubiG 205478 206320 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_03440 206458 207903 gene locus_tag LOCUS_03450 206458 207903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 208029 209096 gene locus_tag LOCUS_03460 208029 209096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 209353 209099 gene locus_tag LOCUS_03470 209353 209099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 209907 209605 gene locus_tag LOCUS_03480 209907 209605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 210163 212694 gene locus_tag LOCUS_03490 210163 212694 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_03490 212701 213894 gene locus_tag LOCUS_03500 212701 213894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 213978 215909 gene locus_tag LOCUS_03510 213978 215909 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z74 protein_id gnl|my_center|LOCUS_03510 216032 217537 gene locus_tag LOCUS_03520 216032 217537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 217575 218198 gene locus_tag LOCUS_03530 217575 218198 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_03530 218195 220939 gene locus_tag LOCUS_03540 218195 220939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 221058 221615 gene locus_tag LOCUS_03550 221058 221615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 221778 222059 gene locus_tag LOCUS_03560 221778 222059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 222208 223518 gene locus_tag LOCUS_03570 222208 223518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 224133 224041 gene locus_tag LOCUS_t00030 224133 224041 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 224665 224291 gene locus_tag LOCUS_03580 224665 224291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 226612 224720 gene locus_tag LOCUS_03590 gene selB 226612 224720 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_03590 228971 226626 gene locus_tag LOCUS_03600 228971 226626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 231199 228992 gene locus_tag LOCUS_03610 231199 228992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 233680 231206 gene locus_tag LOCUS_03620 233680 231206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 235129 233765 gene locus_tag LOCUS_03630 235129 233765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 236775 235204 gene locus_tag LOCUS_03640 236775 235204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_03640 237148 238422 gene locus_tag LOCUS_03650 237148 238422 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_03650 240881 238482 gene locus_tag LOCUS_03660 240881 238482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 240953 241192 gene locus_tag LOCUS_03670 240953 241192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 241203 242465 gene locus_tag LOCUS_03680 241203 242465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 242739 243332 gene locus_tag LOCUS_03690 242739 243332 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_03690 243329 243805 gene locus_tag LOCUS_03700 243329 243805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 243802 244125 gene locus_tag LOCUS_03710 243802 244125 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_03710 246753 244483 gene locus_tag LOCUS_03720 246753 244483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 248969 246972 gene locus_tag LOCUS_03730 248969 246972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 251006 249192 gene locus_tag LOCUS_03740 251006 249192 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03740 252571 251003 gene locus_tag LOCUS_03750 252571 251003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 252632 254452 gene locus_tag LOCUS_03760 252632 254452 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_03760 254462 256555 gene locus_tag LOCUS_03770 254462 256555 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405118.1 protein_id gnl|my_center|LOCUS_03770 257026 256685 gene locus_tag LOCUS_03780 257026 256685 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C35 protein_id gnl|my_center|LOCUS_03780 257356 259113 gene locus_tag LOCUS_03790 257356 259113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 260398 259496 gene locus_tag LOCUS_03800 260398 259496 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_03800 260456 261577 gene locus_tag LOCUS_03810 260456 261577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 266363 261645 gene locus_tag LOCUS_03820 266363 261645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 267548 266559 gene locus_tag LOCUS_03830 267548 266559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 267837 271175 gene locus_tag LOCUS_03840 267837 271175 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_03840 274018 271172 gene locus_tag LOCUS_03850 274018 271172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 274865 274236 gene locus_tag LOCUS_03860 274865 274236 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_03860 274918 275865 gene locus_tag LOCUS_03870 274918 275865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_03870 277004 275862 gene locus_tag LOCUS_03880 277004 275862 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870170.1 protein_id gnl|my_center|LOCUS_03880 277276 278514 gene locus_tag LOCUS_03890 277276 278514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_03890 279228 278521 gene locus_tag LOCUS_03900 279228 278521 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923472.1 protein_id gnl|my_center|LOCUS_03900 279410 282082 gene locus_tag LOCUS_03910 gene aceE 279410 282082 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_03910 282106 283464 gene locus_tag LOCUS_03920 282106 283464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 284496 283486 gene locus_tag LOCUS_03930 284496 283486 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_03930 285881 284496 gene locus_tag LOCUS_03940 285881 284496 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_03940 286077 286916 gene locus_tag LOCUS_03950 286077 286916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 286930 287679 gene locus_tag LOCUS_03960 286930 287679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405187.1 protein_id gnl|my_center|LOCUS_03960 287676 289319 gene locus_tag LOCUS_03970 gene yehZ 287676 289319 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_03970 289341 293201 gene locus_tag LOCUS_03980 289341 293201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 293256 294173 gene locus_tag LOCUS_03990 293256 294173 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_03990 294170 294970 gene locus_tag LOCUS_04000 gene oppC 294170 294970 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_04000 295483 294971 gene locus_tag LOCUS_04010 295483 294971 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_04010 295827 296699 gene locus_tag LOCUS_04020 295827 296699 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_04020 296847 298808 gene locus_tag LOCUS_04030 gene cmfA 296847 298808 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_04030 298885 300459 gene locus_tag LOCUS_04040 298885 300459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 300456 300695 gene locus_tag LOCUS_04050 300456 300695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_04050 300655 300918 gene locus_tag LOCUS_04060 300655 300918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933583.1 protein_id gnl|my_center|LOCUS_04060 301327 300944 gene locus_tag LOCUS_04070 301327 300944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 303330 301360 gene locus_tag LOCUS_04080 303330 301360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 303528 304202 gene locus_tag LOCUS_04090 303528 304202 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_04090 305686 304199 gene locus_tag LOCUS_04100 305686 304199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 305861 307537 gene locus_tag LOCUS_04110 gene aceB 305861 307537 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706619.1 protein_id gnl|my_center|LOCUS_04110 307617 308906 gene locus_tag LOCUS_04120 307617 308906 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_04120 309813 308971 gene locus_tag LOCUS_04130 309813 308971 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531939.1 protein_id gnl|my_center|LOCUS_04130 310192 309863 gene locus_tag LOCUS_04140 310192 309863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 310418 310176 gene locus_tag LOCUS_04150 310418 310176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 312567 310456 gene locus_tag LOCUS_04160 312567 310456 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_04160 312682 313434 gene locus_tag LOCUS_04170 312682 313434 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_04170 313491 316739 gene locus_tag LOCUS_04180 313491 316739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_04180 316775 317641 gene locus_tag LOCUS_04190 316775 317641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 317676 317816 gene locus_tag LOCUS_04200 317676 317816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 319031 318087 gene locus_tag LOCUS_04210 319031 318087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 319363 319016 gene locus_tag LOCUS_04220 319363 319016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 319523 320803 gene locus_tag LOCUS_04230 319523 320803 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 protein_id gnl|my_center|LOCUS_04230 322059 321007 gene locus_tag LOCUS_04240 322059 321007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 322289 322582 gene locus_tag LOCUS_04250 322289 322582 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_04250 322597 322950 gene locus_tag LOCUS_04260 322597 322950 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_04260 322947 324248 gene locus_tag LOCUS_04270 322947 324248 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_04270 324545 327742 gene locus_tag LOCUS_04280 324545 327742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 327903 329651 gene locus_tag LOCUS_04290 327903 329651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 330743 329724 gene locus_tag LOCUS_04300 330743 329724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 332755 331073 gene locus_tag LOCUS_04310 332755 331073 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_04310 333107 334933 gene locus_tag LOCUS_04320 333107 334933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 335243 336100 gene locus_tag LOCUS_04330 335243 336100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_04330 336124 337380 gene locus_tag LOCUS_04340 336124 337380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 337717 337526 gene locus_tag LOCUS_04350 337717 337526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 337787 338479 gene locus_tag LOCUS_04360 337787 338479 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_04360 339081 339668 gene locus_tag LOCUS_04370 339081 339668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 339668 340390 gene locus_tag LOCUS_04380 339668 340390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 340458 341879 gene locus_tag LOCUS_04390 340458 341879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 341887 342390 gene locus_tag LOCUS_04400 341887 342390 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_04400 343591 342410 gene locus_tag LOCUS_04410 343591 342410 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_04410 344433 343645 gene locus_tag LOCUS_04420 344433 343645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 345754 344519 gene locus_tag LOCUS_04430 345754 344519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence003 1588 800 gene locus_tag LOCUS_04440 1588 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2315 1977 gene locus_tag LOCUS_04450 2315 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3039 2341 gene locus_tag LOCUS_04460 3039 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6273 3643 gene locus_tag LOCUS_04470 gene clpB 6273 3643 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM12 protein_id gnl|my_center|LOCUS_04470 7327 6380 gene locus_tag LOCUS_04480 7327 6380 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_04480 7488 8741 gene locus_tag LOCUS_04490 7488 8741 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_04490 9036 11138 gene locus_tag LOCUS_04500 9036 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11369 12655 gene locus_tag LOCUS_04510 11369 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_04510 13240 17961 gene locus_tag LOCUS_04520 13240 17961 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_04520 19553 17982 gene locus_tag LOCUS_04530 19553 17982 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_04530 20055 19555 gene locus_tag LOCUS_04540 20055 19555 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_04540 21081 20137 gene locus_tag LOCUS_04550 21081 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 21515 21183 gene locus_tag LOCUS_04560 21515 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 21746 22642 gene locus_tag LOCUS_04570 21746 22642 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708064.1 protein_id gnl|my_center|LOCUS_04570 22639 23844 gene locus_tag LOCUS_04580 22639 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_04580 23943 24677 gene locus_tag LOCUS_04590 23943 24677 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259307.1 protein_id gnl|my_center|LOCUS_04590 24809 25681 gene locus_tag LOCUS_04600 24809 25681 CDS product carbon monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_04600 25685 26179 gene locus_tag LOCUS_04610 25685 26179 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_04610 26176 28611 gene locus_tag LOCUS_04620 26176 28611 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_04620 28726 29070 gene locus_tag LOCUS_04630 28726 29070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 29067 29567 gene locus_tag LOCUS_04640 29067 29567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 29583 30617 gene locus_tag LOCUS_04650 29583 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 31464 30625 gene locus_tag LOCUS_04660 31464 30625 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_04660 31533 32297 gene locus_tag LOCUS_04670 31533 32297 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_04670 32400 33545 gene locus_tag LOCUS_04680 gene pntA 32400 33545 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_04680 33542 33829 gene locus_tag LOCUS_04690 33542 33829 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_04690 33826 35256 gene locus_tag LOCUS_04700 33826 35256 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H2 protein_id gnl|my_center|LOCUS_04700 35253 36323 gene locus_tag LOCUS_04710 35253 36323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_04710 36333 36917 gene locus_tag LOCUS_04720 36333 36917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 36914 38629 gene locus_tag LOCUS_04730 36914 38629 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969826.1 protein_id gnl|my_center|LOCUS_04730 38718 39368 gene locus_tag LOCUS_04740 38718 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 39450 41663 gene locus_tag LOCUS_04750 gene relA 39450 41663 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_04750 41703 42935 gene locus_tag LOCUS_04760 41703 42935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 43019 43948 gene locus_tag LOCUS_04770 43019 43948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 44794 43979 gene locus_tag LOCUS_04780 44794 43979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_04780 45780 44809 gene locus_tag LOCUS_04790 45780 44809 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_04790 46021 46389 gene locus_tag LOCUS_04800 46021 46389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 46523 47503 gene locus_tag LOCUS_04810 46523 47503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 47615 48388 gene locus_tag LOCUS_04820 47615 48388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 48463 49236 gene locus_tag LOCUS_04830 48463 49236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 49808 50338 gene locus_tag LOCUS_04840 49808 50338 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_04840 50395 52983 gene locus_tag LOCUS_04850 50395 52983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 54421 53006 gene locus_tag LOCUS_04860 54421 53006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 55266 54622 gene locus_tag LOCUS_04870 55266 54622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 55977 55354 gene locus_tag LOCUS_04880 55977 55354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 56076 57836 gene locus_tag LOCUS_04890 56076 57836 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_04890 57908 58189 gene locus_tag LOCUS_04900 57908 58189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 58161 58649 gene locus_tag LOCUS_04910 58161 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 61198 58646 gene locus_tag LOCUS_04920 61198 58646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 61261 61782 gene locus_tag LOCUS_04930 61261 61782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 61779 63092 gene locus_tag LOCUS_04940 61779 63092 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_04940 63316 63095 gene locus_tag LOCUS_04950 63316 63095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 64563 63442 gene locus_tag LOCUS_04960 64563 63442 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_04960 64487 64666 gene locus_tag LOCUS_04970 64487 64666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 64802 65275 gene locus_tag LOCUS_04980 64802 65275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_04980 65341 66477 gene locus_tag LOCUS_04990 65341 66477 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_04990 67517 66612 gene locus_tag LOCUS_05000 67517 66612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 68304 67504 gene locus_tag LOCUS_05010 68304 67504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 69419 68379 gene locus_tag LOCUS_05020 69419 68379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 70614 69409 gene locus_tag LOCUS_05030 70614 69409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 70774 71817 gene locus_tag LOCUS_05040 70774 71817 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_05040 72435 72016 gene locus_tag LOCUS_05050 72435 72016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 76034 73041 gene locus_tag LOCUS_05060 76034 73041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_05060 76261 79644 gene locus_tag LOCUS_05070 76261 79644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 79789 80379 gene locus_tag LOCUS_05080 79789 80379 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_05080 80505 81266 gene locus_tag LOCUS_05090 80505 81266 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_05090 81348 81773 gene locus_tag LOCUS_05100 81348 81773 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531210.1 protein_id gnl|my_center|LOCUS_05100 82946 81783 gene locus_tag LOCUS_05110 82946 81783 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_05110 84002 83319 gene locus_tag LOCUS_05120 84002 83319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 84077 86095 gene locus_tag LOCUS_05130 84077 86095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 86549 86073 gene locus_tag LOCUS_05140 86549 86073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 86794 86546 gene locus_tag LOCUS_05150 86794 86546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 89450 86844 gene locus_tag LOCUS_05160 89450 86844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 89636 90601 gene locus_tag LOCUS_05170 gene yhaM 89636 90601 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_05170 90686 93022 gene locus_tag LOCUS_05180 90686 93022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 93291 93031 gene locus_tag LOCUS_05190 93291 93031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 93979 93605 gene locus_tag LOCUS_05200 93979 93605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 94080 95240 gene locus_tag LOCUS_05210 94080 95240 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_05210 95305 95592 gene locus_tag LOCUS_05220 95305 95592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 96885 96013 gene locus_tag LOCUS_05230 96885 96013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 98789 96888 gene locus_tag LOCUS_05240 98789 96888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 99718 98780 gene locus_tag LOCUS_05250 99718 98780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 99871 101013 gene locus_tag LOCUS_05260 99871 101013 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_05260 101081 102424 gene locus_tag LOCUS_05270 101081 102424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 102892 102596 gene locus_tag LOCUS_05280 102892 102596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 105352 103025 gene locus_tag LOCUS_05290 105352 103025 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NC2 protein_id gnl|my_center|LOCUS_05290 107569 105362 gene locus_tag LOCUS_05300 107569 105362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 107762 108136 gene locus_tag LOCUS_05310 107762 108136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 108971 108183 gene locus_tag LOCUS_05320 108971 108183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 110244 109639 gene locus_tag LOCUS_05330 110244 109639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 110643 112832 gene locus_tag LOCUS_05340 110643 112832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 112838 114850 gene locus_tag LOCUS_05350 112838 114850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 115015 115212 gene locus_tag LOCUS_05360 115015 115212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 115270 116094 gene locus_tag LOCUS_05370 115270 116094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 118820 116091 gene locus_tag LOCUS_05380 118820 116091 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_05380 119859 118930 gene locus_tag LOCUS_05390 119859 118930 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_05390 121738 119876 gene locus_tag LOCUS_05400 121738 119876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_05400 124662 121858 gene locus_tag LOCUS_05410 124662 121858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 126586 125594 gene locus_tag LOCUS_05420 126586 125594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 126966 126583 gene locus_tag LOCUS_05430 126966 126583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 127189 127818 gene locus_tag LOCUS_05440 127189 127818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 127815 128276 gene locus_tag LOCUS_05450 127815 128276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 128321 129205 gene locus_tag LOCUS_05460 128321 129205 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919958.1 protein_id gnl|my_center|LOCUS_05460 129849 129343 gene locus_tag LOCUS_05470 gene purE 129849 129343 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_05470 131399 130044 gene locus_tag LOCUS_05480 131399 130044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268797.1 protein_id gnl|my_center|LOCUS_05480 132434 131421 gene locus_tag LOCUS_05490 132434 131421 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_05490 133552 132431 gene locus_tag LOCUS_05500 133552 132431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 134217 133564 gene locus_tag LOCUS_05510 134217 133564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 135056 134223 gene locus_tag LOCUS_05520 135056 134223 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_05520 135453 135316 gene locus_tag LOCUS_05530 135453 135316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 138744 135847 gene locus_tag LOCUS_05540 138744 135847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 139187 139044 gene locus_tag LOCUS_05550 139187 139044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 139470 140771 gene locus_tag LOCUS_05560 gene aroC 139470 140771 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_05560 140791 142869 gene locus_tag LOCUS_05570 140791 142869 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_05570 143155 143418 gene locus_tag LOCUS_05580 143155 143418 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_05580 143831 143475 gene locus_tag LOCUS_05590 143831 143475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_05590 143914 146286 gene locus_tag LOCUS_05600 gene glnS 143914 146286 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_05600 146291 148480 gene locus_tag LOCUS_05610 146291 148480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 149710 148505 gene locus_tag LOCUS_05620 149710 148505 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_05620 150998 149967 gene locus_tag LOCUS_05630 150998 149967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 151920 151009 gene locus_tag LOCUS_05640 151920 151009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 153074 151914 gene locus_tag LOCUS_05650 153074 151914 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_05650 154049 153264 gene locus_tag LOCUS_05660 154049 153264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 154814 154092 gene locus_tag LOCUS_05670 154814 154092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 155562 154873 gene locus_tag LOCUS_05680 155562 154873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 156574 155570 gene locus_tag LOCUS_05690 156574 155570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_05690 157499 156576 gene locus_tag LOCUS_05700 157499 156576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 158527 157496 gene locus_tag LOCUS_05710 158527 157496 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_05710 161684 158484 gene locus_tag LOCUS_05720 161684 158484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 162075 161845 gene locus_tag LOCUS_05730 162075 161845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 163580 162072 gene locus_tag LOCUS_05740 gene xseA 163580 162072 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_05740 164379 163840 gene locus_tag LOCUS_05750 164379 163840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 164645 164911 gene locus_tag LOCUS_05760 164645 164911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 164895 165332 gene locus_tag LOCUS_05770 164895 165332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 166558 165341 gene locus_tag LOCUS_05780 166558 165341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_05780 168071 166626 gene locus_tag LOCUS_05790 168071 166626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 168906 168061 gene locus_tag LOCUS_05800 168906 168061 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_05800 169362 168976 gene locus_tag LOCUS_05810 169362 168976 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_05810 169601 169359 gene locus_tag LOCUS_05820 169601 169359 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_05820 171256 169682 gene locus_tag LOCUS_05830 171256 169682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 171770 171294 gene locus_tag LOCUS_05840 171770 171294 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_05840 172338 171817 gene locus_tag LOCUS_05850 172338 171817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_05850 172790 172392 gene locus_tag LOCUS_05860 172790 172392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 174594 172891 gene locus_tag LOCUS_05870 174594 172891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 174773 175192 gene locus_tag LOCUS_05880 174773 175192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 175298 176233 gene locus_tag LOCUS_05890 gene folD 175298 176233 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7C5 protein_id gnl|my_center|LOCUS_05890 176235 176825 gene locus_tag LOCUS_05900 gene coaE 176235 176825 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_05900 176822 179722 gene locus_tag LOCUS_05910 176822 179722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 179734 181119 gene locus_tag LOCUS_05920 179734 181119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 181207 181680 gene locus_tag LOCUS_05930 181207 181680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 181661 182896 gene locus_tag LOCUS_05940 181661 182896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 185091 182881 gene locus_tag LOCUS_05950 185091 182881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 185850 188084 gene locus_tag LOCUS_05960 185850 188084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 188155 188868 gene locus_tag LOCUS_05970 188155 188868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 189734 189012 gene locus_tag LOCUS_05980 189734 189012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 190012 190554 gene locus_tag LOCUS_05990 190012 190554 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_05990 191026 190580 gene locus_tag LOCUS_06000 191026 190580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 192260 191028 gene locus_tag LOCUS_06010 gene apgM 192260 191028 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM27 protein_id gnl|my_center|LOCUS_06010 192743 192324 gene locus_tag LOCUS_06020 192743 192324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 193542 192790 gene locus_tag LOCUS_06030 gene trmJ 193542 192790 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D44 protein_id gnl|my_center|LOCUS_06030 195439 193562 gene locus_tag LOCUS_06040 195439 193562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 195770 196429 gene locus_tag LOCUS_06050 195770 196429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 196445 197719 gene locus_tag LOCUS_06060 196445 197719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 201260 198531 gene locus_tag LOCUS_06070 201260 198531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 203236 201260 gene locus_tag LOCUS_06080 203236 201260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 203402 204277 gene locus_tag LOCUS_06090 203402 204277 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399938.1 protein_id gnl|my_center|LOCUS_06090 204365 204853 gene locus_tag LOCUS_06100 gene ppiB 204365 204853 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_06100 205930 205070 gene locus_tag LOCUS_06110 205930 205070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 207033 205927 gene locus_tag LOCUS_06120 207033 205927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 208441 207023 gene locus_tag LOCUS_06130 gene hslU 208441 207023 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66574 protein_id gnl|my_center|LOCUS_06130 208982 208446 gene locus_tag LOCUS_06140 gene hslV 208982 208446 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ1 protein_id gnl|my_center|LOCUS_06140 209952 208999 gene locus_tag LOCUS_06150 gene xerC 209952 208999 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW0 protein_id gnl|my_center|LOCUS_06150 210332 209967 gene locus_tag LOCUS_06160 210332 209967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 210895 210329 gene locus_tag LOCUS_06170 210895 210329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_06170 212447 211080 gene locus_tag LOCUS_06180 gene trmFO 212447 211080 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_06180 214309 212546 gene locus_tag LOCUS_06190 214309 212546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 216752 214518 gene locus_tag LOCUS_06200 216752 214518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 218291 216756 gene locus_tag LOCUS_06210 gene cafA 218291 216756 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_06210 219442 218321 gene locus_tag LOCUS_06220 gene rodA 219442 218321 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_06220 221303 219414 gene locus_tag LOCUS_06230 gene mrdA 221303 219414 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06230 222089 221568 gene locus_tag LOCUS_06240 222089 221568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 223075 222086 gene locus_tag LOCUS_06250 223075 222086 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL21 protein_id gnl|my_center|LOCUS_06250 224110 223085 gene locus_tag LOCUS_06260 gene mreB-1 224110 223085 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_06260 225746 224304 gene locus_tag LOCUS_06270 225746 224304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 225933 227885 gene locus_tag LOCUS_06280 225933 227885 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_06280 227994 228599 gene locus_tag LOCUS_06290 gene ruvA 227994 228599 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_06290 230352 228988 gene locus_tag LOCUS_06300 230352 228988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 230439 231509 gene locus_tag LOCUS_06310 230439 231509 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_06310 231727 233076 gene locus_tag LOCUS_06320 231727 233076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 233106 233576 gene locus_tag LOCUS_06330 gene folA 233106 233576 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FW84 protein_id gnl|my_center|LOCUS_06330 233722 235287 gene locus_tag LOCUS_06340 233722 235287 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 235329 236336 gene locus_tag LOCUS_06350 235329 236336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 236352 236705 gene locus_tag LOCUS_06360 236352 236705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 237121 237300 gene locus_tag LOCUS_06370 237121 237300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 237973 238341 gene locus_tag LOCUS_06380 237973 238341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 240501 238684 gene locus_tag LOCUS_06390 gene typA 240501 238684 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403243.1 protein_id gnl|my_center|LOCUS_06390 241415 240660 gene locus_tag LOCUS_06400 241415 240660 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_06400 242434 241412 gene locus_tag LOCUS_06410 242434 241412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 242608 243378 gene locus_tag LOCUS_06420 242608 243378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_06420 243463 244515 gene locus_tag LOCUS_06430 gene fni 243463 244515 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD5 protein_id gnl|my_center|LOCUS_06430 244564 245898 gene locus_tag LOCUS_06440 244564 245898 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_06440 245895 247004 gene locus_tag LOCUS_06450 245895 247004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 246994 248013 gene locus_tag LOCUS_06460 gene mvaD 246994 248013 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_06460 248010 248846 gene locus_tag LOCUS_06470 248010 248846 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_06470 248867 249781 gene locus_tag LOCUS_06480 248867 249781 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_06480 250082 251833 gene locus_tag LOCUS_06490 250082 251833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 253186 251867 gene locus_tag LOCUS_06500 gene proA 253186 251867 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_06500 254461 253250 gene locus_tag LOCUS_06510 gene proB 254461 253250 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDI6 protein_id gnl|my_center|LOCUS_06510 255011 255418 gene locus_tag LOCUS_06520 255011 255418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 255862 255539 gene locus_tag LOCUS_06530 255862 255539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 255744 256004 gene locus_tag LOCUS_06540 255744 256004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 257950 256058 gene locus_tag LOCUS_06550 257950 256058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705308.1 protein_id gnl|my_center|LOCUS_06550 259298 258099 gene locus_tag LOCUS_06560 259298 258099 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728145.1 protein_id gnl|my_center|LOCUS_06560 260397 259288 gene locus_tag LOCUS_06570 gene tsaD 260397 259288 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C11 protein_id gnl|my_center|LOCUS_06570 260421 261695 gene locus_tag LOCUS_06580 gene hemY 260421 261695 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_06580 261692 262273 gene locus_tag LOCUS_06590 gene pdxH 261692 262273 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_06590 262515 263408 gene locus_tag LOCUS_06600 gene exo 262515 263408 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_06600 263847 264323 gene locus_tag LOCUS_06610 263847 264323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 264386 265432 gene locus_tag LOCUS_06620 264386 265432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 266458 265655 gene locus_tag LOCUS_06630 266458 265655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 267780 266458 gene locus_tag LOCUS_06640 267780 266458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 269109 267835 gene locus_tag LOCUS_06650 269109 267835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 269292 271076 gene locus_tag LOCUS_06660 269292 271076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 271077 273362 gene locus_tag LOCUS_06670 271077 273362 CDS product bifunctional hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_06670 273406 273639 gene locus_tag LOCUS_06680 273406 273639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 273626 273892 gene locus_tag LOCUS_06690 273626 273892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 273873 274466 gene locus_tag LOCUS_06700 gene pdxH 273873 274466 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ5 protein_id gnl|my_center|LOCUS_06700 274536 274763 gene locus_tag LOCUS_06710 274536 274763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 274760 275203 gene locus_tag LOCUS_06720 274760 275203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 275335 276034 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcctccgcacgggaggcgac >Feature sequence004 2066 315 gene locus_tag LOCUS_06730 2066 315 CDS product ubiquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405397.1 protein_id gnl|my_center|LOCUS_06730 5285 2109 gene locus_tag LOCUS_06740 5285 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 6053 5475 gene locus_tag LOCUS_06750 6053 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8058 6085 gene locus_tag LOCUS_06760 8058 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9792 8071 gene locus_tag LOCUS_06770 9792 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10759 9884 gene locus_tag LOCUS_06780 10759 9884 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_06780 10871 11065 gene locus_tag LOCUS_06790 10871 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 11156 11833 gene locus_tag LOCUS_06800 11156 11833 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAJ7 protein_id gnl|my_center|LOCUS_06800 11889 12803 gene locus_tag LOCUS_06810 11889 12803 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_06810 12886 14850 gene locus_tag LOCUS_06820 gene metG 12886 14850 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF2 protein_id gnl|my_center|LOCUS_06820 14902 15702 gene locus_tag LOCUS_06830 14902 15702 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_06830 15718 16050 gene locus_tag LOCUS_06840 15718 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 16590 16249 gene locus_tag LOCUS_06850 16590 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 21851 16602 gene locus_tag LOCUS_06860 21851 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 22436 26476 gene locus_tag LOCUS_06870 22436 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 26758 28749 gene locus_tag LOCUS_06880 26758 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 29710 28769 gene locus_tag LOCUS_06890 29710 28769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 29947 30993 gene locus_tag LOCUS_06900 29947 30993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 32779 31151 gene locus_tag LOCUS_06910 32779 31151 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_06910 34777 32852 gene locus_tag LOCUS_06920 34777 32852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36651 34774 gene locus_tag LOCUS_06930 36651 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 38249 36648 gene locus_tag LOCUS_06940 38249 36648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 39604 38249 gene locus_tag LOCUS_06950 39604 38249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 40956 39601 gene locus_tag LOCUS_06960 40956 39601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 41034 42269 gene locus_tag LOCUS_06970 41034 42269 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F23 protein_id gnl|my_center|LOCUS_06970 42618 42433 gene locus_tag LOCUS_06980 42618 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 42536 51163 gene locus_tag LOCUS_06990 42536 51163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 53672 51453 gene locus_tag LOCUS_07000 53672 51453 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_07000 54583 53678 gene locus_tag LOCUS_07010 54583 53678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 54693 55538 gene locus_tag LOCUS_07020 54693 55538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 57335 55560 gene locus_tag LOCUS_07030 57335 55560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 57745 57332 gene locus_tag LOCUS_07040 57745 57332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 58245 57742 gene locus_tag LOCUS_07050 58245 57742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 58464 58679 gene locus_tag LOCUS_07060 58464 58679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 58838 60883 gene locus_tag LOCUS_07070 58838 60883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 60946 61209 gene locus_tag LOCUS_07080 60946 61209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 61197 61565 gene locus_tag LOCUS_07090 61197 61565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 61552 62109 gene locus_tag LOCUS_07100 61552 62109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_07100 62118 65210 gene locus_tag LOCUS_07110 62118 65210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 65379 66515 gene locus_tag LOCUS_07120 65379 66515 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_07120 66512 68029 gene locus_tag LOCUS_07130 66512 68029 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936324.1 protein_id gnl|my_center|LOCUS_07130 68032 68937 gene locus_tag LOCUS_07140 68032 68937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 68930 69832 gene locus_tag LOCUS_07150 68930 69832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 71226 70063 gene locus_tag LOCUS_07160 71226 70063 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406228.1 protein_id gnl|my_center|LOCUS_07160 71368 73467 gene locus_tag LOCUS_07170 71368 73467 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_07170 74974 73700 gene locus_tag LOCUS_07180 74974 73700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 76646 75183 gene locus_tag LOCUS_07190 76646 75183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 77036 76650 gene locus_tag LOCUS_07200 77036 76650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 77820 77059 gene locus_tag LOCUS_07210 77820 77059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 78228 77824 gene locus_tag LOCUS_07220 78228 77824 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887143.1 protein_id gnl|my_center|LOCUS_07220 78488 78216 gene locus_tag LOCUS_07230 78488 78216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 79662 78535 gene locus_tag LOCUS_07240 gene tyrA 79662 78535 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QH8 protein_id gnl|my_center|LOCUS_07240 80684 79665 gene locus_tag LOCUS_07250 80684 79665 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_07250 81924 80689 gene locus_tag LOCUS_07260 81924 80689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 82110 83039 gene locus_tag LOCUS_07270 82110 83039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 84572 83058 gene locus_tag LOCUS_07280 84572 83058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 85249 84605 gene locus_tag LOCUS_07290 85249 84605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 85233 85391 gene locus_tag LOCUS_07300 85233 85391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 85815 85411 gene locus_tag LOCUS_07310 85815 85411 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_07310 85889 87127 gene locus_tag LOCUS_07320 85889 87127 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_07320 87172 88047 gene locus_tag LOCUS_07330 gene xerD 87172 88047 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJD6 protein_id gnl|my_center|LOCUS_07330 88434 89081 gene locus_tag LOCUS_07340 88434 89081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 89078 89566 gene locus_tag LOCUS_07350 89078 89566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_07350 89683 90072 gene locus_tag LOCUS_07360 89683 90072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 90780 91034 gene locus_tag LOCUS_07370 90780 91034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 92319 91051 gene locus_tag LOCUS_07380 92319 91051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 92519 93826 gene locus_tag LOCUS_07390 92519 93826 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 protein_id gnl|my_center|LOCUS_07390 93876 94367 gene locus_tag LOCUS_07400 93876 94367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_07400 94425 96914 gene locus_tag LOCUS_07410 94425 96914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 96955 99288 gene locus_tag LOCUS_07420 96955 99288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 99313 102156 gene locus_tag LOCUS_07430 99313 102156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 103086 102166 gene locus_tag LOCUS_07440 103086 102166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 105098 103212 gene locus_tag LOCUS_07450 105098 103212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 105492 107378 gene locus_tag LOCUS_07460 gene korA 105492 107378 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_07460 107382 108392 gene locus_tag LOCUS_07470 107382 108392 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_07470 108398 109168 gene locus_tag LOCUS_07480 108398 109168 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_07480 109724 109152 gene locus_tag LOCUS_07490 109724 109152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 111220 109733 gene locus_tag LOCUS_07500 111220 109733 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 protein_id gnl|my_center|LOCUS_07500 112132 111275 gene locus_tag LOCUS_07510 112132 111275 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731381.1 protein_id gnl|my_center|LOCUS_07510 113054 112221 gene locus_tag LOCUS_07520 113054 112221 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_07520 113111 113539 gene locus_tag LOCUS_07530 113111 113539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 113612 114127 gene locus_tag LOCUS_07540 113612 114127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 114141 114599 gene locus_tag LOCUS_07550 114141 114599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 114592 115374 gene locus_tag LOCUS_07560 114592 115374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 119723 115470 gene locus_tag LOCUS_07570 119723 115470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 120857 120180 gene locus_tag LOCUS_07580 120857 120180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_07580 123450 120889 gene locus_tag LOCUS_07590 123450 120889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 123588 124169 gene locus_tag LOCUS_07600 123588 124169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_07600 124670 124143 gene locus_tag LOCUS_07610 124670 124143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 126121 124940 gene locus_tag LOCUS_07620 126121 124940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123157.1 protein_id gnl|my_center|LOCUS_07620 126232 127665 gene locus_tag LOCUS_07630 gene rtcB 126232 127665 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_07630 127671 128012 gene locus_tag LOCUS_07640 127671 128012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 128012 128716 gene locus_tag LOCUS_07650 128012 128716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 128716 129897 gene locus_tag LOCUS_07660 128716 129897 CDS product 3-phenylpropionic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494988.1 protein_id gnl|my_center|LOCUS_07660 129964 132417 gene locus_tag LOCUS_07670 129964 132417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 132989 133690 gene locus_tag LOCUS_07680 132989 133690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 135612 133909 gene locus_tag LOCUS_07690 135612 133909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 136403 135597 gene locus_tag LOCUS_07700 136403 135597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_07700 137511 136396 gene locus_tag LOCUS_07710 137511 136396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 137769 139421 gene locus_tag LOCUS_07720 137769 139421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 139528 140145 gene locus_tag LOCUS_07730 139528 140145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 140342 140968 gene locus_tag LOCUS_07740 140342 140968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 140965 142110 gene locus_tag LOCUS_07750 gene ispB 140965 142110 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_07750 142122 142907 gene locus_tag LOCUS_07760 gene ubiE 142122 142907 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_07760 142904 144391 gene locus_tag LOCUS_07770 142904 144391 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_07770 144388 146211 gene locus_tag LOCUS_07780 gene menD 144388 146211 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23970 protein_id gnl|my_center|LOCUS_07780 146208 146954 gene locus_tag LOCUS_07790 gene menH 146208 146954 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_07790 146961 147248 gene locus_tag LOCUS_07800 146961 147248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_07800 147232 147504 gene locus_tag LOCUS_07810 147232 147504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 147645 149033 gene locus_tag LOCUS_07820 147645 149033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 149030 149809 gene locus_tag LOCUS_07830 149030 149809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 149878 153027 gene locus_tag LOCUS_07840 149878 153027 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072022.1 protein_id gnl|my_center|LOCUS_07840 153752 153024 gene locus_tag LOCUS_07850 153752 153024 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_07850 154039 156654 gene locus_tag LOCUS_07860 154039 156654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 156641 160150 gene locus_tag LOCUS_07870 156641 160150 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_07870 161533 160079 gene locus_tag LOCUS_07880 161533 160079 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_07880 163069 161582 gene locus_tag LOCUS_07890 163069 161582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 164170 163295 gene locus_tag LOCUS_07900 164170 163295 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_07900 164438 167437 gene locus_tag LOCUS_07910 164438 167437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 168865 167444 gene locus_tag LOCUS_07920 gene pilR 168865 167444 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_07920 170529 168862 gene locus_tag LOCUS_07930 gene pilS 170529 168862 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_07930 171880 170675 gene locus_tag LOCUS_07940 gene pilC 171880 170675 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_07940 173005 171884 gene locus_tag LOCUS_07950 gene pilT-4 173005 171884 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_07950 173134 175026 gene locus_tag LOCUS_07960 173134 175026 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_07960 175220 175537 gene locus_tag LOCUS_07970 175220 175537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 175596 176261 gene locus_tag LOCUS_07980 175596 176261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 176388 177233 gene locus_tag LOCUS_07990 176388 177233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 177628 179358 gene locus_tag LOCUS_08000 177628 179358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 180066 179650 gene locus_tag LOCUS_08010 gene vapC 180066 179650 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930F9 protein_id gnl|my_center|LOCUS_08010 180296 180063 gene locus_tag LOCUS_08020 180296 180063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 180183 180506 gene locus_tag LOCUS_08030 180183 180506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 181175 180390 gene locus_tag LOCUS_08040 181175 180390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 183427 181172 gene locus_tag LOCUS_08050 183427 181172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 185433 183610 gene locus_tag LOCUS_08060 185433 183610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 186893 185658 gene locus_tag LOCUS_08070 186893 185658 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 protein_id gnl|my_center|LOCUS_08070 187004 188050 gene locus_tag LOCUS_08080 187004 188050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635555.2 protein_id gnl|my_center|LOCUS_08080 188629 188051 gene locus_tag LOCUS_08090 188629 188051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 188814 188889 gene locus_tag LOCUS_t00040 188814 188889 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 188945 189565 gene locus_tag LOCUS_08100 188945 189565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 189562 190674 gene locus_tag LOCUS_08110 189562 190674 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_08110 191649 190666 gene locus_tag LOCUS_08120 191649 190666 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_08120 192221 191646 gene locus_tag LOCUS_08130 gene lspA 192221 191646 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_08130 192624 192223 gene locus_tag LOCUS_08140 gene acpS 192624 192223 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AT2 protein_id gnl|my_center|LOCUS_08140 193427 192657 gene locus_tag LOCUS_08150 gene thiE 193427 192657 CDS product putative thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61411 protein_id gnl|my_center|LOCUS_08150 193668 193393 gene locus_tag LOCUS_08160 193668 193393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 193961 194848 gene locus_tag LOCUS_08170 193961 194848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 194848 195360 gene locus_tag LOCUS_08180 gene def 194848 195360 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_08180 195413 196852 gene locus_tag LOCUS_08190 gene cysS 195413 196852 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F525 protein_id gnl|my_center|LOCUS_08190 196857 197246 gene locus_tag LOCUS_08200 196857 197246 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJT6 protein_id gnl|my_center|LOCUS_08200 197351 197425 gene locus_tag LOCUS_t00050 197351 197425 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 197547 197621 gene locus_tag LOCUS_t00060 197547 197621 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 197697 198458 gene locus_tag LOCUS_08210 197697 198458 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_08210 198496 199242 gene locus_tag LOCUS_08220 gene map 198496 199242 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UI28 protein_id gnl|my_center|LOCUS_08220 200751 199417 gene locus_tag LOCUS_08230 200751 199417 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_08230 202034 200751 gene locus_tag LOCUS_08240 gene tyrS 202034 200751 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_08240 202210 204834 gene locus_tag LOCUS_08250 202210 204834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 205893 204847 gene locus_tag LOCUS_08260 205893 204847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_08260 206059 207297 gene locus_tag LOCUS_08270 206059 207297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 208275 207367 gene locus_tag LOCUS_08280 208275 207367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 210127 208382 gene locus_tag LOCUS_08290 210127 208382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 210668 212047 gene locus_tag LOCUS_08300 210668 212047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_08300 212044 212580 gene locus_tag LOCUS_08310 212044 212580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 212577 214571 gene locus_tag LOCUS_08320 212577 214571 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 protein_id gnl|my_center|LOCUS_08320 216198 214693 gene locus_tag LOCUS_08330 gene ahcY 216198 214693 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_08330 217571 216537 gene locus_tag LOCUS_08340 217571 216537 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_08340 217715 218125 gene locus_tag LOCUS_08350 217715 218125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 218122 218697 gene locus_tag LOCUS_08360 218122 218697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 218694 219137 gene locus_tag LOCUS_08370 218694 219137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 219360 220223 gene locus_tag LOCUS_08380 219360 220223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 221358 220345 gene locus_tag LOCUS_08390 221358 220345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 221724 222824 gene locus_tag LOCUS_08400 221724 222824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 222902 224053 gene locus_tag LOCUS_08410 222902 224053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 224733 224050 gene locus_tag LOCUS_08420 224733 224050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_08420 225489 224797 gene locus_tag LOCUS_08430 225489 224797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_08430 226897 225644 gene locus_tag LOCUS_08440 226897 225644 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_08440 227681 227154 gene locus_tag LOCUS_08450 227681 227154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 227857 227576 gene locus_tag LOCUS_08460 227857 227576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 228184 228786 gene locus_tag LOCUS_08470 228184 228786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 228801 230051 gene locus_tag LOCUS_08480 228801 230051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 230083 230670 gene locus_tag LOCUS_08490 230083 230670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 230682 234524 gene locus_tag LOCUS_08500 230682 234524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 234637 235830 gene locus_tag LOCUS_08510 234637 235830 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_08510 235893 237290 gene locus_tag LOCUS_08520 235893 237290 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08520 237321 237536 gene locus_tag LOCUS_08530 237321 237536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 237573 237857 gene locus_tag LOCUS_08540 237573 237857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 240522 238111 gene locus_tag LOCUS_08550 240522 238111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 240702 241139 gene locus_tag LOCUS_08560 240702 241139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 242525 241143 gene locus_tag LOCUS_08570 242525 241143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 242590 242856 gene locus_tag LOCUS_08580 242590 242856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 242907 243842 gene locus_tag LOCUS_08590 242907 243842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 243832 244749 gene locus_tag LOCUS_08600 243832 244749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 244826 245410 gene locus_tag LOCUS_08610 244826 245410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 245567 245956 gene locus_tag LOCUS_08620 245567 245956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 246132 245986 gene locus_tag LOCUS_08630 246132 245986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 246163 246498 gene locus_tag LOCUS_08640 246163 246498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 246547 248340 gene locus_tag LOCUS_08650 246547 248340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08650 248757 248368 gene locus_tag LOCUS_08660 248757 248368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 248913 249590 gene locus_tag LOCUS_08670 248913 249590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 249680 250657 gene locus_tag LOCUS_08680 249680 250657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 250687 253011 gene locus_tag LOCUS_08690 250687 253011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 253128 254186 gene locus_tag LOCUS_08700 253128 254186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 254722 256179 gene locus_tag LOCUS_08710 254722 256179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 258011 256680 gene locus_tag LOCUS_08720 258011 256680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 259168 258848 gene locus_tag LOCUS_08730 259168 258848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 259484 259768 gene locus_tag LOCUS_08740 259484 259768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 260337 259777 gene locus_tag LOCUS_08750 260337 259777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 263534 260451 gene locus_tag LOCUS_08760 263534 260451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 264158 267136 gene locus_tag LOCUS_08770 264158 267136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence005 1781 3223 gene locus_tag LOCUS_08780 1781 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3610 5085 gene locus_tag LOCUS_08790 3610 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5443 6915 gene locus_tag LOCUS_08800 5443 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7058 8089 gene locus_tag LOCUS_08810 gene pta 7058 8089 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_08810 8086 9366 gene locus_tag LOCUS_08820 gene purD 8086 9366 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_08820 9537 10403 gene locus_tag LOCUS_08830 9537 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10426 10821 gene locus_tag LOCUS_08840 10426 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10818 11840 gene locus_tag LOCUS_08850 gene pdxA 10818 11840 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD4 protein_id gnl|my_center|LOCUS_08850 12003 13799 gene locus_tag LOCUS_08860 12003 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_08860 13839 15221 gene locus_tag LOCUS_08870 13839 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_08870 17005 15518 gene locus_tag LOCUS_08880 17005 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 17075 18082 gene locus_tag LOCUS_08890 17075 18082 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_08890 18210 22439 gene locus_tag LOCUS_08900 18210 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 22484 22783 gene locus_tag LOCUS_08910 22484 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 22895 23608 gene locus_tag LOCUS_08920 22895 23608 CDS product oxidoreductase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524799.1 protein_id gnl|my_center|LOCUS_08920 23649 24182 gene locus_tag LOCUS_08930 23649 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 24263 25699 gene locus_tag LOCUS_08940 24263 25699 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_08940 25675 26928 gene locus_tag LOCUS_08950 25675 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 26967 30872 gene locus_tag LOCUS_08960 26967 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 30874 31719 gene locus_tag LOCUS_08970 30874 31719 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_08970 33266 31698 gene locus_tag LOCUS_08980 33266 31698 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_08980 34738 33263 gene locus_tag LOCUS_08990 34738 33263 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_08990 36049 34748 gene locus_tag LOCUS_09000 36049 34748 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405047.1 protein_id gnl|my_center|LOCUS_09000 37302 36049 gene locus_tag LOCUS_09010 37302 36049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 38547 37402 gene locus_tag LOCUS_09020 38547 37402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 39500 38544 gene locus_tag LOCUS_09030 39500 38544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 39563 40369 gene locus_tag LOCUS_09040 39563 40369 CDS product photosystem I assembly BtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_09040 40385 41302 gene locus_tag LOCUS_09050 40385 41302 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250794.1 protein_id gnl|my_center|LOCUS_09050 41299 42180 gene locus_tag LOCUS_09060 gene tesB 41299 42180 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_09060 42564 42163 gene locus_tag LOCUS_09070 42564 42163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 44480 42564 gene locus_tag LOCUS_09080 44480 42564 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_09080 45556 44531 gene locus_tag LOCUS_09090 45556 44531 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C5 protein_id gnl|my_center|LOCUS_09090 45614 46495 gene locus_tag LOCUS_09100 45614 46495 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_09100 46593 47060 gene locus_tag LOCUS_09110 46593 47060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 47410 47075 gene locus_tag LOCUS_09120 47410 47075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 48084 47407 gene locus_tag LOCUS_09130 48084 47407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 protein_id gnl|my_center|LOCUS_09130 48842 48117 gene locus_tag LOCUS_09140 48842 48117 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970447.1 protein_id gnl|my_center|LOCUS_09140 50581 48875 gene locus_tag LOCUS_09150 50581 48875 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_09150 50868 50578 gene locus_tag LOCUS_09160 50868 50578 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_09160 50974 52635 gene locus_tag LOCUS_09170 50974 52635 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09170 54143 53085 gene locus_tag LOCUS_09180 54143 53085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 54490 55065 gene locus_tag LOCUS_09190 54490 55065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 55217 55477 gene locus_tag LOCUS_09200 55217 55477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 55477 55914 gene locus_tag LOCUS_09210 55477 55914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 57238 55925 gene locus_tag LOCUS_09220 57238 55925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 58545 57235 gene locus_tag LOCUS_09230 58545 57235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 58742 60295 gene locus_tag LOCUS_09240 58742 60295 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_09240 60405 60629 gene locus_tag LOCUS_09250 60405 60629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 60673 61113 gene locus_tag LOCUS_09260 gene rpiB 60673 61113 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_09260 61225 62478 gene locus_tag LOCUS_09270 gene glyA 61225 62478 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_09270 62489 63820 gene locus_tag LOCUS_09280 62489 63820 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028454.1 protein_id gnl|my_center|LOCUS_09280 64832 63828 gene locus_tag LOCUS_09290 64832 63828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 64931 66754 gene locus_tag LOCUS_09300 64931 66754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 68212 66764 gene locus_tag LOCUS_09310 68212 66764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 68322 70220 gene locus_tag LOCUS_09320 68322 70220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 70217 71536 gene locus_tag LOCUS_09330 70217 71536 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965623.1 protein_id gnl|my_center|LOCUS_09330 71533 72873 gene locus_tag LOCUS_09340 71533 72873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 72926 73153 gene locus_tag LOCUS_09350 72926 73153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142024.1 protein_id gnl|my_center|LOCUS_09350 73166 73519 gene locus_tag LOCUS_09360 73166 73519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391715.1 protein_id gnl|my_center|LOCUS_09360 76213 73565 gene locus_tag LOCUS_09370 76213 73565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636891.2 protein_id gnl|my_center|LOCUS_09370 77006 76269 gene locus_tag LOCUS_09380 77006 76269 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_09380 78652 77003 gene locus_tag LOCUS_09390 gene bshC 78652 77003 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P5 protein_id gnl|my_center|LOCUS_09390 79328 78597 gene locus_tag LOCUS_09400 79328 78597 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_09400 79413 80399 gene locus_tag LOCUS_09410 79413 80399 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_09410 80399 80872 gene locus_tag LOCUS_09420 80399 80872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 80960 81304 gene locus_tag LOCUS_tm00010 80960 81304 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 84932 81702 gene locus_tag LOCUS_09430 84932 81702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 87010 84929 gene locus_tag LOCUS_09440 87010 84929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 89246 87081 gene locus_tag LOCUS_09450 89246 87081 CDS product TonB-dependent heme/hemoglobin receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384209.1 protein_id gnl|my_center|LOCUS_09450 89514 89855 gene locus_tag LOCUS_09460 89514 89855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 90428 89811 gene locus_tag LOCUS_09470 90428 89811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 91381 90428 gene locus_tag LOCUS_09480 91381 90428 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_09480 93000 91378 gene locus_tag LOCUS_09490 93000 91378 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_09490 93911 93000 gene locus_tag LOCUS_09500 93911 93000 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 protein_id gnl|my_center|LOCUS_09500 94094 94489 gene locus_tag LOCUS_09510 94094 94489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 95226 94486 gene locus_tag LOCUS_09520 gene smuG1 95226 94486 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_09520 95382 95230 gene locus_tag LOCUS_09530 95382 95230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 95787 97136 gene locus_tag LOCUS_09540 95787 97136 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_09540 97136 98470 gene locus_tag LOCUS_09550 gene iscS 97136 98470 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_09550 98448 98963 gene locus_tag LOCUS_09560 gene gcvH 98448 98963 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0U9 protein_id gnl|my_center|LOCUS_09560 99166 100293 gene locus_tag LOCUS_09570 99166 100293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_09570 100290 100625 gene locus_tag LOCUS_09580 100290 100625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 100622 101464 gene locus_tag LOCUS_09590 100622 101464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 101502 103226 gene locus_tag LOCUS_09600 101502 103226 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_09600 103186 104070 gene locus_tag LOCUS_09610 103186 104070 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_09610 104067 106001 gene locus_tag LOCUS_09620 gene shc 104067 106001 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_09620 106264 105953 gene locus_tag LOCUS_09630 106264 105953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 106539 106264 gene locus_tag LOCUS_09640 106539 106264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 107389 106640 gene locus_tag LOCUS_09650 107389 106640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 108653 107427 gene locus_tag LOCUS_09660 108653 107427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 110439 108646 gene locus_tag LOCUS_09670 gene hsdM 110439 108646 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_09670 111747 110452 gene locus_tag LOCUS_09680 111747 110452 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_09680 111838 112980 gene locus_tag LOCUS_09690 gene metB 111838 112980 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_09690 114928 112982 gene locus_tag LOCUS_09700 114928 112982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 116852 115026 gene locus_tag LOCUS_09710 116852 115026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 117165 116872 gene locus_tag LOCUS_09720 117165 116872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_09720 117284 118681 gene locus_tag LOCUS_09730 117284 118681 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_09730 118698 119144 gene locus_tag LOCUS_09740 118698 119144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 119240 119611 gene locus_tag LOCUS_09750 119240 119611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 122058 119608 gene locus_tag LOCUS_09760 122058 119608 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_09760 123760 122201 gene locus_tag LOCUS_09770 123760 122201 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_09770 124075 126894 gene locus_tag LOCUS_09780 gene uvrA 124075 126894 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_09780 128065 126908 gene locus_tag LOCUS_09790 gene hemH 128065 126908 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R43 protein_id gnl|my_center|LOCUS_09790 128837 128187 gene locus_tag LOCUS_09800 gene ypmQ 128837 128187 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_09800 129773 128868 gene locus_tag LOCUS_09810 gene ctaB 129773 128868 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_09810 133105 129833 gene locus_tag LOCUS_09820 133105 129833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 134541 133171 gene locus_tag LOCUS_09830 134541 133171 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_09830 135094 134705 gene locus_tag LOCUS_09840 135094 134705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 135906 135106 gene locus_tag LOCUS_09850 135906 135106 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_09850 136305 136580 gene locus_tag LOCUS_09860 136305 136580 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_09860 136590 137753 gene locus_tag LOCUS_09870 136590 137753 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_09870 137804 138790 gene locus_tag LOCUS_09880 137804 138790 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404767.1 protein_id gnl|my_center|LOCUS_09880 140042 138993 gene locus_tag LOCUS_09890 140042 138993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 140794 140066 gene locus_tag LOCUS_09900 140794 140066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 143667 141046 gene locus_tag LOCUS_09910 gene hrpB 143667 141046 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_09910 143805 144233 gene locus_tag LOCUS_09920 143805 144233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 144217 144564 gene locus_tag LOCUS_09930 144217 144564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09930 144575 144943 gene locus_tag LOCUS_09940 144575 144943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 144927 146489 gene locus_tag LOCUS_09950 gene accC 144927 146489 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_09950 146480 147013 gene locus_tag LOCUS_09960 146480 147013 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868008.1 protein_id gnl|my_center|LOCUS_09960 147021 147350 gene locus_tag LOCUS_09970 147021 147350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 147347 147937 gene locus_tag LOCUS_09980 147347 147937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 147934 150339 gene locus_tag LOCUS_09990 147934 150339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_09990 150336 152645 gene locus_tag LOCUS_10000 150336 152645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 152680 154503 gene locus_tag LOCUS_10010 152680 154503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 154496 156079 gene locus_tag LOCUS_10020 154496 156079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_10020 157222 156086 gene locus_tag LOCUS_10030 157222 156086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 158583 157351 gene locus_tag LOCUS_10040 gene kbl 158583 157351 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J0 protein_id gnl|my_center|LOCUS_10040 159997 158714 gene locus_tag LOCUS_10050 gene yxaH 159997 158714 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_10050 160724 159990 gene locus_tag LOCUS_10060 160724 159990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 160952 161719 gene locus_tag LOCUS_10070 160952 161719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405233.1 protein_id gnl|my_center|LOCUS_10070 162056 162574 gene locus_tag LOCUS_10080 162056 162574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 163156 162593 gene locus_tag LOCUS_10090 163156 162593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 163538 164440 gene locus_tag LOCUS_10100 163538 164440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 164531 167827 gene locus_tag LOCUS_10110 164531 167827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10110 167858 168490 gene locus_tag LOCUS_10120 167858 168490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 168487 169437 gene locus_tag LOCUS_10130 168487 169437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 169434 172034 gene locus_tag LOCUS_10140 169434 172034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 174099 172054 gene locus_tag LOCUS_10150 174099 172054 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_10150 175011 174178 gene locus_tag LOCUS_10160 175011 174178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 175235 175630 gene locus_tag LOCUS_10170 175235 175630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 175623 176651 gene locus_tag LOCUS_10180 175623 176651 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_10180 176648 178684 gene locus_tag LOCUS_10190 176648 178684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 178684 180783 gene locus_tag LOCUS_10200 178684 180783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 182273 180786 gene locus_tag LOCUS_10210 gene panF 182273 180786 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_10210 182599 182273 gene locus_tag LOCUS_10220 182599 182273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 183965 182643 gene locus_tag LOCUS_10230 183965 182643 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_10230 185031 183973 gene locus_tag LOCUS_10240 185031 183973 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_10240 185149 185910 gene locus_tag LOCUS_10250 185149 185910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 186480 185935 gene locus_tag LOCUS_10260 186480 185935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 188558 186480 gene locus_tag LOCUS_10270 gene fusA 188558 186480 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_10270 188819 190756 gene locus_tag LOCUS_10280 188819 190756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 191645 190911 gene locus_tag LOCUS_10290 191645 190911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 192238 191642 gene locus_tag LOCUS_10300 192238 191642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 192433 193416 gene locus_tag LOCUS_10310 192433 193416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 196623 193534 gene locus_tag LOCUS_10320 196623 193534 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_10320 197696 196620 gene locus_tag LOCUS_10330 197696 196620 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_10330 197868 197777 gene locus_tag LOCUS_t00070 197868 197777 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 200562 197923 gene locus_tag LOCUS_10340 200562 197923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 200926 200600 gene locus_tag LOCUS_10350 200926 200600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 201234 201980 gene locus_tag LOCUS_10360 201234 201980 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_10360 203424 202021 gene locus_tag LOCUS_10370 203424 202021 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_10370 203445 205127 gene locus_tag LOCUS_10380 203445 205127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 206747 205197 gene locus_tag LOCUS_10390 206747 205197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 207404 206886 gene locus_tag LOCUS_10400 207404 206886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 207571 208434 gene locus_tag LOCUS_10410 207571 208434 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_10410 208538 211591 gene locus_tag LOCUS_10420 208538 211591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 212147 211692 gene locus_tag LOCUS_10430 212147 211692 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_10430 213674 212283 gene locus_tag LOCUS_10440 213674 212283 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_10440 214159 213761 gene locus_tag LOCUS_10450 214159 213761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 214560 214180 gene locus_tag LOCUS_10460 214560 214180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_10460 217337 214743 gene locus_tag LOCUS_10470 217337 214743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 217503 218546 gene locus_tag LOCUS_10480 217503 218546 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_10480 218600 219862 gene locus_tag LOCUS_10490 218600 219862 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_10490 219867 220739 gene locus_tag LOCUS_10500 219867 220739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_10500 221013 221876 gene locus_tag LOCUS_10510 221013 221876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 223349 221898 gene locus_tag LOCUS_10520 223349 221898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 225828 223366 gene locus_tag LOCUS_10530 gene thrA 225828 223366 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_10530 226108 226929 gene locus_tag LOCUS_10540 226108 226929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 227385 230318 gene locus_tag LOCUS_10550 227385 230318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 231498 230326 gene locus_tag LOCUS_10560 231498 230326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 232024 231608 gene locus_tag LOCUS_10570 232024 231608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 232172 233035 gene locus_tag LOCUS_10580 232172 233035 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_10580 233174 233028 gene locus_tag LOCUS_10590 233174 233028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 235789 233321 gene locus_tag LOCUS_10600 235789 233321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_10600 237693 236251 gene locus_tag LOCUS_10610 gene cls 237693 236251 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_10610 239927 237690 gene locus_tag LOCUS_10620 239927 237690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 240119 242155 gene locus_tag LOCUS_10630 240119 242155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 242263 243336 gene locus_tag LOCUS_10640 gene mtnA 242263 243336 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX9 protein_id gnl|my_center|LOCUS_10640 244416 243424 gene locus_tag LOCUS_10650 244416 243424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_10650 245324 244413 gene locus_tag LOCUS_10660 245324 244413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 246349 245321 gene locus_tag LOCUS_10670 246349 245321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_10670 247068 246352 gene locus_tag LOCUS_10680 247068 246352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 247793 247065 gene locus_tag LOCUS_10690 gene pcm 247793 247065 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_10690 248035 249429 gene locus_tag LOCUS_10700 248035 249429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 249450 250943 gene locus_tag LOCUS_10710 249450 250943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 250968 251579 gene locus_tag LOCUS_10720 250968 251579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence006 79 579 gene locus_tag LOCUS_10730 79 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 619 1113 gene locus_tag LOCUS_10740 619 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1576 1184 gene locus_tag LOCUS_10750 1576 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1822 2664 gene locus_tag LOCUS_10760 1822 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2817 3080 gene locus_tag LOCUS_10770 2817 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3197 3715 gene locus_tag LOCUS_10780 3197 3715 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMM5 protein_id gnl|my_center|LOCUS_10780 3915 4871 gene locus_tag LOCUS_10790 3915 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5066 9043 gene locus_tag LOCUS_10800 5066 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9158 10912 gene locus_tag LOCUS_10810 9158 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10988 11347 gene locus_tag LOCUS_10820 10988 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 11397 12530 gene locus_tag LOCUS_10830 11397 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13222 12650 gene locus_tag LOCUS_10840 13222 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13615 13241 gene locus_tag LOCUS_10850 13615 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 14486 13695 gene locus_tag LOCUS_10860 14486 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 15363 14461 gene locus_tag LOCUS_10870 15363 14461 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_10870 15724 18141 gene locus_tag LOCUS_10880 15724 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 19392 18271 gene locus_tag LOCUS_10890 19392 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19831 20262 gene locus_tag LOCUS_10900 19831 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 21339 20275 gene locus_tag LOCUS_10910 21339 20275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 21611 21817 gene locus_tag LOCUS_10920 21611 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 22524 21769 gene locus_tag LOCUS_10930 22524 21769 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_10930 23778 22534 gene locus_tag LOCUS_10940 23778 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 24878 23790 gene locus_tag LOCUS_10950 24878 23790 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_10950 25731 24952 gene locus_tag LOCUS_10960 25731 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 26422 25772 gene locus_tag LOCUS_10970 26422 25772 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_10970 26548 27768 gene locus_tag LOCUS_10980 26548 27768 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_10980 27762 28370 gene locus_tag LOCUS_10990 27762 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814926.1 protein_id gnl|my_center|LOCUS_10990 28373 29521 gene locus_tag LOCUS_11000 28373 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_11000 29568 30641 gene locus_tag LOCUS_11010 29568 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_11010 30625 31278 gene locus_tag LOCUS_11020 30625 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 31271 31456 gene locus_tag LOCUS_11030 31271 31456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 31575 32228 gene locus_tag LOCUS_11040 31575 32228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 32257 33573 gene locus_tag LOCUS_11050 32257 33573 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_11050 33570 34082 gene locus_tag LOCUS_11060 33570 34082 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_11060 35932 34634 gene locus_tag LOCUS_11070 35932 34634 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_11070 35991 37394 gene locus_tag LOCUS_11080 35991 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 37645 39777 gene locus_tag LOCUS_11090 gene ptrB 37645 39777 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_11090 39941 40729 gene locus_tag LOCUS_11100 39941 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 44123 40752 gene locus_tag LOCUS_11110 44123 40752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 44319 45236 gene locus_tag LOCUS_11120 44319 45236 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_11120 45375 46127 gene locus_tag LOCUS_11130 45375 46127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 46194 47153 gene locus_tag LOCUS_11140 46194 47153 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_11140 47150 49324 gene locus_tag LOCUS_11150 47150 49324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 50329 49670 gene locus_tag LOCUS_11160 50329 49670 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355137.1 protein_id gnl|my_center|LOCUS_11160 52132 50447 gene locus_tag LOCUS_11170 52132 50447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 52262 52969 gene locus_tag LOCUS_11180 52262 52969 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_11180 52974 53960 gene locus_tag LOCUS_11190 52974 53960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 59540 53949 gene locus_tag LOCUS_11200 59540 53949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 60202 59816 gene locus_tag LOCUS_11210 gene vapC 60202 59816 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVI2 protein_id gnl|my_center|LOCUS_11210 60422 60192 gene locus_tag LOCUS_11220 60422 60192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 61928 60522 gene locus_tag LOCUS_11230 61928 60522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 62829 61915 gene locus_tag LOCUS_11240 gene menA 62829 61915 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_11240 63454 62876 gene locus_tag LOCUS_11250 63454 62876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 63618 65132 gene locus_tag LOCUS_11260 gene dacB 63618 65132 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_11260 65185 66414 gene locus_tag LOCUS_11270 65185 66414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 66551 69598 gene locus_tag LOCUS_11280 66551 69598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 69585 70025 gene locus_tag LOCUS_11290 69585 70025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 70038 70370 gene locus_tag LOCUS_11300 70038 70370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 70373 71785 gene locus_tag LOCUS_11310 70373 71785 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_11310 72100 72321 gene locus_tag LOCUS_11320 72100 72321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 72987 72367 gene locus_tag LOCUS_11330 72987 72367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 74151 73165 gene locus_tag LOCUS_11340 74151 73165 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_11340 74804 74148 gene locus_tag LOCUS_11350 74804 74148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 75743 74817 gene locus_tag LOCUS_11360 75743 74817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 76320 75760 gene locus_tag LOCUS_11370 76320 75760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 77289 78203 gene locus_tag LOCUS_11380 77289 78203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 78287 82441 gene locus_tag LOCUS_11390 78287 82441 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_11390 82625 82864 gene locus_tag LOCUS_11400 82625 82864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 84211 82880 gene locus_tag LOCUS_11410 gene amaA 84211 82880 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_11410 84546 84208 gene locus_tag LOCUS_11420 84546 84208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 86898 84646 gene locus_tag LOCUS_11430 86898 84646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 87370 86975 gene locus_tag LOCUS_11440 87370 86975 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_11440 89754 87367 gene locus_tag LOCUS_11450 89754 87367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 89815 91497 gene locus_tag LOCUS_11460 89815 91497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 91602 94973 gene locus_tag LOCUS_11470 91602 94973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 97587 94924 gene locus_tag LOCUS_11480 97587 94924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 97710 98579 gene locus_tag LOCUS_11490 97710 98579 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887407.1 protein_id gnl|my_center|LOCUS_11490 101675 98574 gene locus_tag LOCUS_11500 101675 98574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 102177 105551 gene locus_tag LOCUS_11510 102177 105551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_11510 105548 105949 gene locus_tag LOCUS_11520 105548 105949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 106042 108603 gene locus_tag LOCUS_11530 gene rapA 106042 108603 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44781 protein_id gnl|my_center|LOCUS_11530 108634 109320 gene locus_tag LOCUS_11540 108634 109320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 110785 109349 gene locus_tag LOCUS_11550 110785 109349 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_11550 112440 110797 gene locus_tag LOCUS_11560 112440 110797 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_11560 112612 114048 gene locus_tag LOCUS_11570 112612 114048 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552128.1 protein_id gnl|my_center|LOCUS_11570 114218 117688 gene locus_tag LOCUS_11580 114218 117688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 119210 117702 gene locus_tag LOCUS_11590 119210 117702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 120037 119237 gene locus_tag LOCUS_11600 120037 119237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 122043 120316 gene locus_tag LOCUS_11610 122043 120316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 122394 125036 gene locus_tag LOCUS_11620 122394 125036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 125105 126478 gene locus_tag LOCUS_11630 125105 126478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 128683 126494 gene locus_tag LOCUS_11640 128683 126494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 130548 128803 gene locus_tag LOCUS_11650 130548 128803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 132523 130781 gene locus_tag LOCUS_11660 gene prpL 132523 130781 CDS product lysyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK6 protein_id gnl|my_center|LOCUS_11660 134506 132719 gene locus_tag LOCUS_11670 134506 132719 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_11670 134494 135321 gene locus_tag LOCUS_11680 134494 135321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 135656 136411 gene locus_tag LOCUS_11690 135656 136411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 136537 139458 gene locus_tag LOCUS_11700 136537 139458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 139478 140113 gene locus_tag LOCUS_11710 139478 140113 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_11710 140354 140154 gene locus_tag LOCUS_11720 140354 140154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_11720 141652 140522 gene locus_tag LOCUS_11730 141652 140522 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_11730 141674 142096 gene locus_tag LOCUS_11740 141674 142096 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_11740 142660 146847 gene locus_tag LOCUS_11750 142660 146847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 147046 147495 gene locus_tag LOCUS_11760 147046 147495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_11760 147579 148913 gene locus_tag LOCUS_11770 147579 148913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 150969 149122 gene locus_tag LOCUS_11780 150969 149122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 151225 153036 gene locus_tag LOCUS_11790 151225 153036 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRE5 protein_id gnl|my_center|LOCUS_11790 154774 153383 gene locus_tag LOCUS_11800 154774 153383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 154949 154782 gene locus_tag LOCUS_11810 154949 154782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 155265 156074 gene locus_tag LOCUS_11820 155265 156074 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_11820 156071 156907 gene locus_tag LOCUS_11830 156071 156907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 156909 159260 gene locus_tag LOCUS_11840 156909 159260 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_11840 159284 159874 gene locus_tag LOCUS_11850 159284 159874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 159876 160331 gene locus_tag LOCUS_11860 159876 160331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_11860 160533 160886 gene locus_tag LOCUS_11870 160533 160886 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_11870 161200 161124 gene locus_tag LOCUS_t00080 161200 161124 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 161296 161526 gene locus_tag LOCUS_11880 161296 161526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 161631 163328 gene locus_tag LOCUS_11890 161631 163328 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_11890 163363 163926 gene locus_tag LOCUS_11900 163363 163926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 163982 165244 gene locus_tag LOCUS_11910 163982 165244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 165882 165397 gene locus_tag LOCUS_11920 165882 165397 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_11920 167233 165884 gene locus_tag LOCUS_11930 gene rlmD 167233 165884 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR26 protein_id gnl|my_center|LOCUS_11930 168024 167191 gene locus_tag LOCUS_11940 168024 167191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 168702 168193 gene locus_tag LOCUS_11950 168702 168193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 169805 168741 gene locus_tag LOCUS_11960 169805 168741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_11960 170356 169979 gene locus_tag LOCUS_11970 170356 169979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 170617 172953 gene locus_tag LOCUS_11980 170617 172953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 173126 173383 gene locus_tag LOCUS_11990 173126 173383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 173373 173765 gene locus_tag LOCUS_12000 173373 173765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 173785 174990 gene locus_tag LOCUS_12010 173785 174990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 175002 175811 gene locus_tag LOCUS_12020 gene dnaC 175002 175811 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_12020 175861 178104 gene locus_tag LOCUS_12030 175861 178104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 178928 178113 gene locus_tag LOCUS_12040 178928 178113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 179873 178947 gene locus_tag LOCUS_12050 179873 178947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 181840 179957 gene locus_tag LOCUS_12060 181840 179957 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_12060 182699 182091 gene locus_tag LOCUS_12070 182699 182091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_12070 182776 183801 gene locus_tag LOCUS_12080 182776 183801 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731581.1 protein_id gnl|my_center|LOCUS_12080 183833 185680 gene locus_tag LOCUS_12090 183833 185680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_12090 185677 186687 gene locus_tag LOCUS_12100 185677 186687 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_12100 187140 187616 gene locus_tag LOCUS_12110 187140 187616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 187613 188377 gene locus_tag LOCUS_12120 187613 188377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 189399 188392 gene locus_tag LOCUS_12130 189399 188392 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974905.1 protein_id gnl|my_center|LOCUS_12130 190141 189392 gene locus_tag LOCUS_12140 gene lipB 190141 189392 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_12140 190913 190134 gene locus_tag LOCUS_12150 190913 190134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_12150 191035 191691 gene locus_tag LOCUS_12160 gene msrA 191035 191691 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_12160 191728 193155 gene locus_tag LOCUS_12170 191728 193155 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886765.1 protein_id gnl|my_center|LOCUS_12170 194405 193353 gene locus_tag LOCUS_12180 194405 193353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 194830 197745 gene locus_tag LOCUS_12190 gene uvrA 194830 197745 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_12190 197758 197982 gene locus_tag LOCUS_12200 197758 197982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12200 198796 198011 gene locus_tag LOCUS_12210 gene paaG 198796 198011 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_12210 199621 198815 gene locus_tag LOCUS_12220 199621 198815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 199859 199641 gene locus_tag LOCUS_12230 199859 199641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 200180 200647 gene locus_tag LOCUS_12240 200180 200647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 200956 201897 gene locus_tag LOCUS_12250 gene prsA 200956 201897 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_12250 201967 202599 gene locus_tag LOCUS_12260 gene rplY 201967 202599 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_12260 202599 203183 gene locus_tag LOCUS_12270 gene pth 202599 203183 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J96 protein_id gnl|my_center|LOCUS_12270 203251 205317 gene locus_tag LOCUS_12280 gene hppA1 203251 205317 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_12280 205490 205978 gene locus_tag LOCUS_12290 205490 205978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 205980 206210 gene locus_tag LOCUS_12300 gene rpsR 205980 206210 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ0 protein_id gnl|my_center|LOCUS_12300 206222 206680 gene locus_tag LOCUS_12310 gene rplI 206222 206680 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ9 protein_id gnl|my_center|LOCUS_12310 206700 207899 gene locus_tag LOCUS_12320 206700 207899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 207933 208886 gene locus_tag LOCUS_12330 207933 208886 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_12330 209583 208864 gene locus_tag LOCUS_12340 209583 208864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_12340 210031 209636 gene locus_tag LOCUS_12350 210031 209636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 211864 210146 gene locus_tag LOCUS_12360 211864 210146 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_12360 212957 212001 gene locus_tag LOCUS_12370 212957 212001 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_12370 213125 213283 gene locus_tag LOCUS_12380 213125 213283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 213362 213437 gene locus_tag LOCUS_t00090 213362 213437 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 215065 213416 gene locus_tag LOCUS_12390 215065 213416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730315.1 protein_id gnl|my_center|LOCUS_12390 215991 215425 gene locus_tag LOCUS_12400 215991 215425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 216859 216101 gene locus_tag LOCUS_12410 216859 216101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 219903 217102 gene locus_tag LOCUS_12420 219903 217102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 221625 219958 gene locus_tag LOCUS_12430 221625 219958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140644.1 protein_id gnl|my_center|LOCUS_12430 221794 225678 gene locus_tag LOCUS_12440 221794 225678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 225858 228287 gene locus_tag LOCUS_12450 225858 228287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_12450 228677 229651 gene locus_tag LOCUS_12460 228677 229651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 229765 230580 gene locus_tag LOCUS_12470 229765 230580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 230698 231150 gene locus_tag LOCUS_12480 230698 231150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 231147 232163 gene locus_tag LOCUS_12490 231147 232163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence007 2012 141 gene locus_tag LOCUS_12500 2012 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2160 3242 gene locus_tag LOCUS_12510 2160 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3250 3951 gene locus_tag LOCUS_12520 3250 3951 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_12520 3972 4811 gene locus_tag LOCUS_12530 3972 4811 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_12530 7531 5066 gene locus_tag LOCUS_12540 7531 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_12540 7714 8871 gene locus_tag LOCUS_12550 gene argE 7714 8871 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Y75 protein_id gnl|my_center|LOCUS_12550 9171 10484 gene locus_tag LOCUS_12560 gene hutF 9171 10484 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_12560 11933 10500 gene locus_tag LOCUS_12570 11933 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 12850 11930 gene locus_tag LOCUS_12580 12850 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 14290 12902 gene locus_tag LOCUS_12590 14290 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 14172 14516 gene locus_tag LOCUS_12600 14172 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 15481 14579 gene locus_tag LOCUS_12610 15481 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 16703 15576 gene locus_tag LOCUS_12620 16703 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 16726 17649 gene locus_tag LOCUS_12630 16726 17649 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_12630 17859 18959 gene locus_tag LOCUS_12640 gene ansA 17859 18959 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404454.1 protein_id gnl|my_center|LOCUS_12640 20803 19022 gene locus_tag LOCUS_12650 20803 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 21772 20921 gene locus_tag LOCUS_12660 21772 20921 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976165.1 protein_id gnl|my_center|LOCUS_12660 22641 21835 gene locus_tag LOCUS_12670 22641 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942018.1 protein_id gnl|my_center|LOCUS_12670 23279 22638 gene locus_tag LOCUS_12680 23279 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 23357 25165 gene locus_tag LOCUS_12690 23357 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 26517 25141 gene locus_tag LOCUS_12700 26517 25141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 26685 27053 gene locus_tag LOCUS_12710 26685 27053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 29041 27482 gene locus_tag LOCUS_12720 29041 27482 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_12720 29040 29210 gene locus_tag LOCUS_12730 29040 29210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 29223 29933 gene locus_tag LOCUS_12740 29223 29933 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809953.1 protein_id gnl|my_center|LOCUS_12740 30018 30656 gene locus_tag LOCUS_12750 30018 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 30864 33176 gene locus_tag LOCUS_12760 30864 33176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_12760 33370 34152 gene locus_tag LOCUS_12770 33370 34152 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_12770 34166 35167 gene locus_tag LOCUS_12780 gene fabH 34166 35167 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LU2 protein_id gnl|my_center|LOCUS_12780 35343 36377 gene locus_tag LOCUS_12790 35343 36377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 36624 38177 gene locus_tag LOCUS_12800 36624 38177 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083800.1 protein_id gnl|my_center|LOCUS_12800 38174 39031 gene locus_tag LOCUS_12810 gene pcaD 38174 39031 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_12810 39226 40731 gene locus_tag LOCUS_12820 39226 40731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 43052 40956 gene locus_tag LOCUS_12830 43052 40956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203076.1 protein_id gnl|my_center|LOCUS_12830 43291 43839 gene locus_tag LOCUS_12840 43291 43839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 43836 45308 gene locus_tag LOCUS_12850 43836 45308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 46537 45323 gene locus_tag LOCUS_12860 46537 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 47139 46534 gene locus_tag LOCUS_12870 47139 46534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 50003 47541 gene locus_tag LOCUS_12880 50003 47541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_12880 50185 52164 gene locus_tag LOCUS_12890 50185 52164 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_12890 56428 52301 gene locus_tag LOCUS_12900 56428 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 56644 57915 gene locus_tag LOCUS_12910 56644 57915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 58011 58202 gene locus_tag LOCUS_12920 58011 58202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 58206 58691 gene locus_tag LOCUS_12930 58206 58691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 60595 58682 gene locus_tag LOCUS_12940 60595 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 62572 60713 gene locus_tag LOCUS_12950 62572 60713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 62849 63700 gene locus_tag LOCUS_12960 62849 63700 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978272.1 protein_id gnl|my_center|LOCUS_12960 64489 63719 gene locus_tag LOCUS_12970 64489 63719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 64730 65395 gene locus_tag LOCUS_12980 64730 65395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 67734 65392 gene locus_tag LOCUS_12990 67734 65392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 68830 68162 gene locus_tag LOCUS_13000 68830 68162 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933742.1 protein_id gnl|my_center|LOCUS_13000 69683 68823 gene locus_tag LOCUS_13010 69683 68823 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_13010 69792 70094 gene locus_tag LOCUS_13020 69792 70094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 70055 70429 gene locus_tag LOCUS_13030 70055 70429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 70877 70446 gene locus_tag LOCUS_13040 70877 70446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 71791 70919 gene locus_tag LOCUS_13050 gene cutM 71791 70919 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_13050 74136 71788 gene locus_tag LOCUS_13060 74136 71788 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_13060 74636 74136 gene locus_tag LOCUS_13070 74636 74136 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807630.1 protein_id gnl|my_center|LOCUS_13070 74830 75261 gene locus_tag LOCUS_13080 74830 75261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 75258 75452 gene locus_tag LOCUS_13090 75258 75452 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_13090 76240 75458 gene locus_tag LOCUS_13100 76240 75458 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097194.1 protein_id gnl|my_center|LOCUS_13100 76386 76952 gene locus_tag LOCUS_13110 76386 76952 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_13110 77016 79466 gene locus_tag LOCUS_13120 77016 79466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 80655 79558 gene locus_tag LOCUS_13130 80655 79558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 82846 81092 gene locus_tag LOCUS_13140 82846 81092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 84134 82905 gene locus_tag LOCUS_13150 84134 82905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_13150 86220 84172 gene locus_tag LOCUS_13160 86220 84172 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_13160 86167 86502 gene locus_tag LOCUS_13170 86167 86502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 86499 88388 gene locus_tag LOCUS_13180 gene edd 86499 88388 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815954.1 protein_id gnl|my_center|LOCUS_13180 88414 89745 gene locus_tag LOCUS_13190 88414 89745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 89742 90551 gene locus_tag LOCUS_13200 89742 90551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 90581 91198 gene locus_tag LOCUS_13210 90581 91198 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695341.1 protein_id gnl|my_center|LOCUS_13210 91195 92655 gene locus_tag LOCUS_13220 gene zwf 91195 92655 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_13220 92655 93371 gene locus_tag LOCUS_13230 gene pgl 92655 93371 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_13230 93868 94233 gene locus_tag LOCUS_13240 93868 94233 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 protein_id gnl|my_center|LOCUS_13240 94432 96780 gene locus_tag LOCUS_13250 94432 96780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 96808 99150 gene locus_tag LOCUS_13260 96808 99150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 100049 99138 gene locus_tag LOCUS_13270 100049 99138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 100170 102206 gene locus_tag LOCUS_13280 100170 102206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 102299 104758 gene locus_tag LOCUS_13290 102299 104758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 104826 105881 gene locus_tag LOCUS_13300 104826 105881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 107878 105884 gene locus_tag LOCUS_13310 107878 105884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 109779 107875 gene locus_tag LOCUS_13320 109779 107875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 110259 110029 gene locus_tag LOCUS_13330 110259 110029 CDS product antibiotic synthesis protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_13330 110431 111636 gene locus_tag LOCUS_13340 110431 111636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_13340 111650 113422 gene locus_tag LOCUS_13350 111650 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 113394 114362 gene locus_tag LOCUS_13360 113394 114362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 114503 114994 gene locus_tag LOCUS_13370 114503 114994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_13370 114975 115454 gene locus_tag LOCUS_13380 114975 115454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 115787 116827 gene locus_tag LOCUS_13390 115787 116827 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_13390 116824 117561 gene locus_tag LOCUS_13400 116824 117561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_13400 117566 119167 gene locus_tag LOCUS_13410 117566 119167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_13410 119202 120755 gene locus_tag LOCUS_13420 119202 120755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 120786 121481 gene locus_tag LOCUS_13430 120786 121481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 121586 121978 gene locus_tag LOCUS_13440 121586 121978 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888710.1 protein_id gnl|my_center|LOCUS_13440 121982 124777 gene locus_tag LOCUS_13450 121982 124777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13450 124896 126911 gene locus_tag LOCUS_13460 124896 126911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 127063 128523 gene locus_tag LOCUS_13470 127063 128523 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_13470 128560 128715 gene locus_tag LOCUS_13480 128560 128715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 128936 130519 gene locus_tag LOCUS_13490 128936 130519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 130565 130924 gene locus_tag LOCUS_13500 130565 130924 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_13500 130924 131949 gene locus_tag LOCUS_13510 130924 131949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 132026 134194 gene locus_tag LOCUS_13520 132026 134194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 134204 135169 gene locus_tag LOCUS_13530 gene pilK 134204 135169 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_13530 135172 138126 gene locus_tag LOCUS_13540 135172 138126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 138123 139265 gene locus_tag LOCUS_13550 138123 139265 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_13550 139262 140266 gene locus_tag LOCUS_13560 139262 140266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 140295 141896 gene locus_tag LOCUS_13570 140295 141896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 142320 142799 gene locus_tag LOCUS_13580 142320 142799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 143575 143988 gene locus_tag LOCUS_13590 143575 143988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 144849 145367 gene locus_tag LOCUS_13600 144849 145367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_13600 146862 145636 gene locus_tag LOCUS_13610 146862 145636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_13610 147047 148963 gene locus_tag LOCUS_13620 147047 148963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 150197 149145 gene locus_tag LOCUS_13630 150197 149145 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_13630 150374 152359 gene locus_tag LOCUS_13640 150374 152359 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_13640 154049 152604 gene locus_tag LOCUS_13650 154049 152604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 157167 154222 gene locus_tag LOCUS_13660 157167 154222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 158561 157167 gene locus_tag LOCUS_13670 158561 157167 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_13670 158922 158548 gene locus_tag LOCUS_13680 158922 158548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933714.1 protein_id gnl|my_center|LOCUS_13680 160303 158915 gene locus_tag LOCUS_13690 160303 158915 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_13690 160589 161764 gene locus_tag LOCUS_13700 160589 161764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_13700 161803 166665 gene locus_tag LOCUS_13710 161803 166665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 168232 166673 gene locus_tag LOCUS_13720 168232 166673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 169374 168229 gene locus_tag LOCUS_13730 169374 168229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 169497 170648 gene locus_tag LOCUS_13740 gene pheA 169497 170648 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 protein_id gnl|my_center|LOCUS_13740 170679 172469 gene locus_tag LOCUS_13750 170679 172469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 172479 173414 gene locus_tag LOCUS_13760 172479 173414 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 protein_id gnl|my_center|LOCUS_13760 173506 174180 gene locus_tag LOCUS_13770 173506 174180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 174197 174397 gene locus_tag LOCUS_13780 174197 174397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 174456 174531 gene locus_tag LOCUS_t00100 174456 174531 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 174713 174799 gene locus_tag LOCUS_t00110 174713 174799 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 174933 176309 gene locus_tag LOCUS_13790 gene tig 174933 176309 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F314 protein_id gnl|my_center|LOCUS_13790 176311 176916 gene locus_tag LOCUS_13800 gene clpP 176311 176916 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNN2 protein_id gnl|my_center|LOCUS_13800 177016 178263 gene locus_tag LOCUS_13810 gene clpX 177016 178263 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_13810 178304 180721 gene locus_tag LOCUS_13820 gene lon-2 178304 180721 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_13820 181058 181657 gene locus_tag LOCUS_13830 gene engB 181058 181657 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E5 protein_id gnl|my_center|LOCUS_13830 181624 183225 gene locus_tag LOCUS_13840 gene rho 181624 183225 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_13840 183328 184650 gene locus_tag LOCUS_13850 183328 184650 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_13850 185983 184658 gene locus_tag LOCUS_13860 185983 184658 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_13860 186544 186155 gene locus_tag LOCUS_13870 186544 186155 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_13870 186765 186541 gene locus_tag LOCUS_13880 186765 186541 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_13880 186894 188873 gene locus_tag LOCUS_13890 186894 188873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 189770 188886 gene locus_tag LOCUS_13900 189770 188886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 191101 189767 gene locus_tag LOCUS_13910 191101 189767 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_13910 192208 191180 gene locus_tag LOCUS_13920 gene citC 192208 191180 CDS product isocitrate dehydrogenase, NAD-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_13920 193308 192226 gene locus_tag LOCUS_13930 193308 192226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 196657 193397 gene locus_tag LOCUS_13940 196657 193397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 197330 196662 gene locus_tag LOCUS_13950 gene rnhB 197330 196662 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU5 protein_id gnl|my_center|LOCUS_13950 197825 197481 gene locus_tag LOCUS_13960 gene rplS 197825 197481 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_13960 198716 197955 gene locus_tag LOCUS_13970 gene trmD 198716 197955 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_13970 199393 198698 gene locus_tag LOCUS_13980 199393 198698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 199766 199395 gene locus_tag LOCUS_13990 199766 199395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 200203 199763 gene locus_tag LOCUS_14000 200203 199763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 201272 200496 gene locus_tag LOCUS_14010 201272 200496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 202192 201269 gene locus_tag LOCUS_14020 202192 201269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 203538 202222 gene locus_tag LOCUS_14030 gene ftsY 203538 202222 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX0 protein_id gnl|my_center|LOCUS_14030 205108 203651 gene locus_tag LOCUS_14040 205108 203651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_14040 205288 206760 gene locus_tag LOCUS_14050 gene pykA 205288 206760 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT4 protein_id gnl|my_center|LOCUS_14050 209510 206772 gene locus_tag LOCUS_14060 209510 206772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 209654 210628 gene locus_tag LOCUS_14070 209654 210628 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_14070 211485 210646 gene locus_tag LOCUS_14080 211485 210646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 211641 213443 gene locus_tag LOCUS_14090 211641 213443 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_14090 215478 213808 gene locus_tag LOCUS_14100 215478 213808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 217595 216084 gene locus_tag LOCUS_14110 217595 216084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 218008 217616 gene locus_tag LOCUS_14120 218008 217616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 218247 218086 gene locus_tag LOCUS_14130 218247 218086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 221090 218286 gene locus_tag LOCUS_14140 221090 218286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 222280 221099 gene locus_tag LOCUS_14150 222280 221099 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 protein_id gnl|my_center|LOCUS_14150 222383 222733 gene locus_tag LOCUS_14160 222383 222733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence008 938 147 gene locus_tag LOCUS_14170 938 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1684 938 gene locus_tag LOCUS_14180 1684 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3490 1883 gene locus_tag LOCUS_14190 3490 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4168 3503 gene locus_tag LOCUS_14200 4168 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5352 4165 gene locus_tag LOCUS_14210 5352 4165 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 protein_id gnl|my_center|LOCUS_14210 6387 5371 gene locus_tag LOCUS_14220 gene bioB 6387 5371 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_14220 6493 7212 gene locus_tag LOCUS_14230 gene moaX 6493 7212 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MWY3 protein_id gnl|my_center|LOCUS_14230 8998 7205 gene locus_tag LOCUS_14240 8998 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9293 9781 gene locus_tag LOCUS_14250 gene mglB 9293 9781 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_14250 9823 10407 gene locus_tag LOCUS_14260 gene mglA 9823 10407 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_14260 10516 11139 gene locus_tag LOCUS_14270 10516 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 11240 12172 gene locus_tag LOCUS_14280 11240 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 12172 13563 gene locus_tag LOCUS_14290 gene glmU 12172 13563 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX6 protein_id gnl|my_center|LOCUS_14290 13637 15454 gene locus_tag LOCUS_14300 gene glmS 13637 15454 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_14300 16332 16102 gene locus_tag LOCUS_14310 16332 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 17177 18997 gene locus_tag LOCUS_14320 17177 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 20128 19253 gene locus_tag LOCUS_14330 20128 19253 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_14330 20371 21033 gene locus_tag LOCUS_14340 20371 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 21533 21246 gene locus_tag LOCUS_14350 21533 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_14350 22890 21526 gene locus_tag LOCUS_14360 22890 21526 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_14360 23690 22887 gene locus_tag LOCUS_14370 gene abcT3 23690 22887 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67182 protein_id gnl|my_center|LOCUS_14370 25042 23831 gene locus_tag LOCUS_14380 25042 23831 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_14380 25164 25472 gene locus_tag LOCUS_14390 25164 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 25713 25498 gene locus_tag LOCUS_14400 25713 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 26519 25746 gene locus_tag LOCUS_14410 26519 25746 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_14410 27106 26531 gene locus_tag LOCUS_14420 27106 26531 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ52 protein_id gnl|my_center|LOCUS_14420 27324 30077 gene locus_tag LOCUS_14430 27324 30077 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_14430 30418 30807 gene locus_tag LOCUS_14440 30418 30807 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ7 protein_id gnl|my_center|LOCUS_14440 31218 32681 gene locus_tag LOCUS_14450 31218 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 32693 33331 gene locus_tag LOCUS_14460 32693 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 33394 34677 gene locus_tag LOCUS_14470 gene serS 33394 34677 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FH6 protein_id gnl|my_center|LOCUS_14470 34707 34796 gene locus_tag LOCUS_t00120 34707 34796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34840 35424 gene locus_tag LOCUS_14480 34840 35424 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_14480 35531 37009 gene locus_tag LOCUS_14490 gene gltX 35531 37009 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_14490 37047 37120 gene locus_tag LOCUS_t00130 37047 37120 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37382 37131 gene locus_tag LOCUS_14500 37382 37131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 38209 37649 gene locus_tag LOCUS_14510 38209 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 38589 38206 gene locus_tag LOCUS_14520 38589 38206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 38886 40010 gene locus_tag LOCUS_14530 38886 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 40375 40007 gene locus_tag LOCUS_14540 40375 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 40583 40858 gene locus_tag LOCUS_14550 40583 40858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 40911 41117 gene locus_tag LOCUS_14560 40911 41117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 41121 41372 gene locus_tag LOCUS_14570 41121 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 41899 41522 gene locus_tag LOCUS_14580 41899 41522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 42462 41992 gene locus_tag LOCUS_14590 gene rlmH 42462 41992 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_14590 43033 42485 gene locus_tag LOCUS_14600 gene def 43033 42485 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T08 protein_id gnl|my_center|LOCUS_14600 43281 44648 gene locus_tag LOCUS_14610 gene manB 43281 44648 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_14610 45404 44739 gene locus_tag LOCUS_14620 45404 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 46993 45611 gene locus_tag LOCUS_14630 46993 45611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 48600 47131 gene locus_tag LOCUS_14640 48600 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 48950 50176 gene locus_tag LOCUS_14650 48950 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 50323 52050 gene locus_tag LOCUS_14660 50323 52050 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_14660 53544 52369 gene locus_tag LOCUS_14670 53544 52369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 55141 53567 gene locus_tag LOCUS_14680 gene secD 55141 53567 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_14680 55458 55138 gene locus_tag LOCUS_14690 gene yajC 55458 55138 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_14690 55923 55693 gene locus_tag LOCUS_14700 55923 55693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 56108 55902 gene locus_tag LOCUS_14710 56108 55902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 58872 56299 gene locus_tag LOCUS_14720 58872 56299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 59988 58885 gene locus_tag LOCUS_14730 gene tgt-2 59988 58885 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_14730 60833 59985 gene locus_tag LOCUS_14740 60833 59985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 61157 60870 gene locus_tag LOCUS_14750 61157 60870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 63871 61154 gene locus_tag LOCUS_14760 63871 61154 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_14760 64060 63932 gene locus_tag LOCUS_14770 64060 63932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 64135 65148 gene locus_tag LOCUS_14780 gene msrP 64135 65148 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEF2 protein_id gnl|my_center|LOCUS_14780 65712 65446 gene locus_tag LOCUS_14790 65712 65446 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_14790 67698 66043 gene locus_tag LOCUS_14800 gene groL 67698 66043 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_14800 68058 67768 gene locus_tag LOCUS_14810 gene groS5 68058 67768 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_14810 68416 70527 gene locus_tag LOCUS_14820 68416 70527 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140315.1 protein_id gnl|my_center|LOCUS_14820 72589 70628 gene locus_tag LOCUS_14830 72589 70628 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_14830 72863 72591 gene locus_tag LOCUS_14840 72863 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 73949 72903 gene locus_tag LOCUS_14850 73949 72903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 73998 75167 gene locus_tag LOCUS_14860 73998 75167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 75299 77116 gene locus_tag LOCUS_14870 75299 77116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 77225 77848 gene locus_tag LOCUS_14880 77225 77848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 78768 78073 gene locus_tag LOCUS_14890 78768 78073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 78768 81023 gene locus_tag LOCUS_14900 78768 81023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 81727 81032 gene locus_tag LOCUS_14910 81727 81032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 81929 83137 gene locus_tag LOCUS_14920 gene nhaA 81929 83137 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 protein_id gnl|my_center|LOCUS_14920 83210 83893 gene locus_tag LOCUS_14930 83210 83893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 84885 83929 gene locus_tag LOCUS_14940 84885 83929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 86017 84896 gene locus_tag LOCUS_14950 86017 84896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_14950 87237 86014 gene locus_tag LOCUS_14960 87237 86014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_14960 87373 89667 gene locus_tag LOCUS_14970 87373 89667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 89664 92084 gene locus_tag LOCUS_14980 89664 92084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 92074 93294 gene locus_tag LOCUS_14990 92074 93294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 93506 94045 gene locus_tag LOCUS_15000 93506 94045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 94205 95035 gene locus_tag LOCUS_15010 gene pilD 94205 95035 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_15010 95064 96824 gene locus_tag LOCUS_15020 95064 96824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 96964 97500 gene locus_tag LOCUS_15030 96964 97500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 97500 98165 gene locus_tag LOCUS_15040 97500 98165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 98176 99696 gene locus_tag LOCUS_15050 98176 99696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 99708 100463 gene locus_tag LOCUS_15060 99708 100463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 100597 106152 gene locus_tag LOCUS_15070 100597 106152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 106155 107081 gene locus_tag LOCUS_15080 106155 107081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 107262 112544 gene locus_tag LOCUS_15090 107262 112544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 113612 112617 gene locus_tag LOCUS_15100 113612 112617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 114579 113605 gene locus_tag LOCUS_15110 114579 113605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 115520 114576 gene locus_tag LOCUS_15120 115520 114576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 117760 115517 gene locus_tag LOCUS_15130 117760 115517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 119595 117757 gene locus_tag LOCUS_15140 119595 117757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 121633 119699 gene locus_tag LOCUS_15150 121633 119699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 123591 121912 gene locus_tag LOCUS_15160 123591 121912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_15160 126037 123632 gene locus_tag LOCUS_15170 126037 123632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_15170 135600 126115 gene locus_tag LOCUS_15180 135600 126115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 135508 136110 gene locus_tag LOCUS_15190 135508 136110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 141881 137166 gene locus_tag LOCUS_15200 141881 137166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15200 148873 141929 gene locus_tag LOCUS_15210 148873 141929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 157776 148873 gene locus_tag LOCUS_15220 157776 148873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 157846 158055 gene locus_tag LOCUS_15230 157846 158055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 158902 159756 gene locus_tag LOCUS_15240 158902 159756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 159829 160899 gene locus_tag LOCUS_15250 159829 160899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 160933 161364 gene locus_tag LOCUS_15260 160933 161364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 162151 162450 gene locus_tag LOCUS_15270 162151 162450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 163534 164010 gene locus_tag LOCUS_15280 163534 164010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 164068 164715 gene locus_tag LOCUS_15290 164068 164715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 165526 165744 gene locus_tag LOCUS_15300 165526 165744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 165835 166386 gene locus_tag LOCUS_15310 165835 166386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 166513 166986 gene locus_tag LOCUS_15320 166513 166986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 174850 166967 gene locus_tag LOCUS_15330 174850 166967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15330 175911 174847 gene locus_tag LOCUS_15340 175911 174847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_15340 184096 175955 gene locus_tag LOCUS_15350 184096 175955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 187449 184093 gene locus_tag LOCUS_15360 187449 184093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 192052 187478 gene locus_tag LOCUS_15370 192052 187478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 193800 192049 gene locus_tag LOCUS_15380 193800 192049 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_15380 195314 194178 gene locus_tag LOCUS_15390 195314 194178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 196319 195375 gene locus_tag LOCUS_15400 196319 195375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 196903 196346 gene locus_tag LOCUS_15410 196903 196346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 197513 196893 gene locus_tag LOCUS_15420 gene algU 197513 196893 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_15420 200227 197588 gene locus_tag LOCUS_15430 200227 197588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 203487 200929 gene locus_tag LOCUS_15440 203487 200929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 203621 204130 gene locus_tag LOCUS_15450 203621 204130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 204133 204345 gene locus_tag LOCUS_15460 204133 204345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence009 1170 460 gene locus_tag LOCUS_15470 1170 460 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_15470 1288 2277 gene locus_tag LOCUS_15480 1288 2277 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_15480 2274 3068 gene locus_tag LOCUS_15490 2274 3068 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 protein_id gnl|my_center|LOCUS_15490 3071 4912 gene locus_tag LOCUS_15500 3071 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4912 5685 gene locus_tag LOCUS_15510 4912 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5904 24950 gene locus_tag LOCUS_15520 5904 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 24985 31860 gene locus_tag LOCUS_15530 24985 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 31895 50194 gene locus_tag LOCUS_15540 31895 50194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 50221 57615 gene locus_tag LOCUS_15550 50221 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 60676 57632 gene locus_tag LOCUS_15560 60676 57632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 60925 63246 gene locus_tag LOCUS_15570 60925 63246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 63339 64868 gene locus_tag LOCUS_15580 63339 64868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 64893 66686 gene locus_tag LOCUS_15590 64893 66686 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_15590 67359 69134 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caatcccccgtagggtccacgttcgatttccac 70403 69366 gene locus_tag LOCUS_15600 70403 69366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 70725 70396 gene locus_tag LOCUS_15610 70725 70396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 71873 70722 gene locus_tag LOCUS_15620 71873 70722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 72285 71866 gene locus_tag LOCUS_15630 72285 71866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 73226 72273 gene locus_tag LOCUS_15640 73226 72273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_15640 74425 73226 gene locus_tag LOCUS_15650 74425 73226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 74901 74437 gene locus_tag LOCUS_15660 74901 74437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 76628 74904 gene locus_tag LOCUS_15670 76628 74904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 78166 76625 gene locus_tag LOCUS_15680 78166 76625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 80437 78452 gene locus_tag LOCUS_15690 80437 78452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 80934 80770 gene locus_tag LOCUS_15700 80934 80770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 84139 81068 gene locus_tag LOCUS_15710 84139 81068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 85011 84136 gene locus_tag LOCUS_15720 85011 84136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 85628 85008 gene locus_tag LOCUS_15730 85628 85008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 85719 86948 gene locus_tag LOCUS_15740 85719 86948 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258213.1 protein_id gnl|my_center|LOCUS_15740 86995 87192 gene locus_tag LOCUS_15750 86995 87192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 87189 87482 gene locus_tag LOCUS_15760 87189 87482 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_15760 90416 87489 gene locus_tag LOCUS_15770 90416 87489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 90664 91728 gene locus_tag LOCUS_15780 90664 91728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 91755 92672 gene locus_tag LOCUS_15790 91755 92672 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_15790 92719 92907 gene locus_tag LOCUS_15800 92719 92907 CDS product addiction module toxin, HicA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_15800 92904 93116 gene locus_tag LOCUS_15810 92904 93116 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_15810 94792 93131 gene locus_tag LOCUS_15820 94792 93131 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_15820 99929 94992 gene locus_tag LOCUS_15830 99929 94992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 100618 99962 gene locus_tag LOCUS_15840 100618 99962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 100949 102334 gene locus_tag LOCUS_15850 100949 102334 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_15850 102346 102693 gene locus_tag LOCUS_15860 102346 102693 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_15860 102722 104134 gene locus_tag LOCUS_15870 102722 104134 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_15870 104172 105473 gene locus_tag LOCUS_15880 104172 105473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_15880 105746 107503 gene locus_tag LOCUS_15890 105746 107503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 109358 107568 gene locus_tag LOCUS_15900 109358 107568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 109587 112112 gene locus_tag LOCUS_15910 109587 112112 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_15910 112094 114088 gene locus_tag LOCUS_15920 112094 114088 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_15920 114187 114984 gene locus_tag LOCUS_15930 114187 114984 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_15930 115282 116382 gene locus_tag LOCUS_15940 115282 116382 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_15940 116802 116398 gene locus_tag LOCUS_15950 116802 116398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 117029 116799 gene locus_tag LOCUS_15960 117029 116799 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_15960 118704 117055 gene locus_tag LOCUS_15970 118704 117055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 118796 120535 gene locus_tag LOCUS_15980 118796 120535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 120542 121210 gene locus_tag LOCUS_15990 gene copR 120542 121210 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_15990 121207 122463 gene locus_tag LOCUS_16000 121207 122463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 122567 124054 gene locus_tag LOCUS_16010 122567 124054 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_16010 124185 126035 gene locus_tag LOCUS_16020 124185 126035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 126075 126689 gene locus_tag LOCUS_16030 126075 126689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729277.1 protein_id gnl|my_center|LOCUS_16030 127320 126694 gene locus_tag LOCUS_16040 127320 126694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 127504 127340 gene locus_tag LOCUS_16050 127504 127340 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UIL0 protein_id gnl|my_center|LOCUS_16050 127715 131005 gene locus_tag LOCUS_16060 127715 131005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16060 131116 132597 gene locus_tag LOCUS_16070 131116 132597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 132587 135538 gene locus_tag LOCUS_16080 132587 135538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 137937 135616 gene locus_tag LOCUS_16090 137937 135616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 138388 139170 gene locus_tag LOCUS_16100 138388 139170 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_16100 139191 140177 gene locus_tag LOCUS_16110 139191 140177 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_16110 140174 140785 gene locus_tag LOCUS_16120 140174 140785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 141100 140822 gene locus_tag LOCUS_16130 141100 140822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 141478 141320 gene locus_tag LOCUS_16140 141478 141320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 144764 141759 gene locus_tag LOCUS_16150 144764 141759 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_16150 147006 144778 gene locus_tag LOCUS_16160 147006 144778 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_16160 148261 147029 gene locus_tag LOCUS_16170 148261 147029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 148383 149486 gene locus_tag LOCUS_16180 148383 149486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 149587 150978 gene locus_tag LOCUS_16190 149587 150978 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_16190 150988 152541 gene locus_tag LOCUS_16200 150988 152541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 152538 152969 gene locus_tag LOCUS_16210 152538 152969 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_16210 153017 153466 gene locus_tag LOCUS_16220 153017 153466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 153478 155154 gene locus_tag LOCUS_16230 153478 155154 CDS product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_16230 157625 155268 gene locus_tag LOCUS_16240 157625 155268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 158694 157642 gene locus_tag LOCUS_16250 158694 157642 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_16250 159893 158718 gene locus_tag LOCUS_16260 159893 158718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 161343 159886 gene locus_tag LOCUS_16270 161343 159886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 161933 161340 gene locus_tag LOCUS_16280 161933 161340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 162955 161915 gene locus_tag LOCUS_16290 162955 161915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 165525 163033 gene locus_tag LOCUS_16300 165525 163033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_16300 165845 167416 gene locus_tag LOCUS_16310 165845 167416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 167561 168559 gene locus_tag LOCUS_16320 gene moxR 167561 168559 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_16320 168559 169881 gene locus_tag LOCUS_16330 168559 169881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 169892 171808 gene locus_tag LOCUS_16340 169892 171808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 171991 175812 gene locus_tag LOCUS_16350 171991 175812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 175962 177320 gene locus_tag LOCUS_16360 175962 177320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 177342 178250 gene locus_tag LOCUS_16370 177342 178250 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_16370 178388 179971 gene locus_tag LOCUS_16380 178388 179971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 179973 181064 gene locus_tag LOCUS_16390 179973 181064 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_16390 181061 182854 gene locus_tag LOCUS_16400 181061 182854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 182851 183837 gene locus_tag LOCUS_16410 182851 183837 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_16410 183834 185333 gene locus_tag LOCUS_16420 183834 185333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_16420 185402 186274 gene locus_tag LOCUS_16430 185402 186274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 186274 188169 gene locus_tag LOCUS_16440 186274 188169 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259038.1 protein_id gnl|my_center|LOCUS_16440 188166 191243 gene locus_tag LOCUS_16450 188166 191243 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_16450 191363 192259 gene locus_tag LOCUS_16460 gene uppS 191363 192259 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_16460 193361 193071 gene locus_tag LOCUS_16470 193361 193071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 194028 196010 gene locus_tag LOCUS_16480 194028 196010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 196719 196192 gene locus_tag LOCUS_16490 196719 196192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 197036 196716 gene locus_tag LOCUS_16500 197036 196716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 197598 197068 gene locus_tag LOCUS_16510 197598 197068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 198019 197633 gene locus_tag LOCUS_16520 198019 197633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 200963 198417 gene locus_tag LOCUS_16530 200963 198417 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_16530 201697 200981 gene locus_tag LOCUS_16540 201697 200981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 201843 202187 gene locus_tag LOCUS_16550 201843 202187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003257809.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence010 494 174 gene locus_tag LOCUS_16560 494 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 812 1432 gene locus_tag LOCUS_16570 812 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1435 1842 gene locus_tag LOCUS_16580 1435 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2024 3643 gene locus_tag LOCUS_16590 2024 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_16590 5304 5089 gene locus_tag LOCUS_16600 5304 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5552 6133 gene locus_tag LOCUS_16610 5552 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6423 6992 gene locus_tag LOCUS_16620 6423 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6992 7576 gene locus_tag LOCUS_16630 6992 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 7937 8251 gene locus_tag LOCUS_16640 7937 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 10723 9146 gene locus_tag LOCUS_16650 10723 9146 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_16650 11322 10735 gene locus_tag LOCUS_16660 11322 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 11549 13111 gene locus_tag LOCUS_16670 gene ppx 11549 13111 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_16670 13506 14654 gene locus_tag LOCUS_16680 13506 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 16445 15048 gene locus_tag LOCUS_16690 16445 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120802.1 protein_id gnl|my_center|LOCUS_16690 17073 16570 gene locus_tag LOCUS_16700 17073 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_16700 17184 18488 gene locus_tag LOCUS_16710 17184 18488 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_16710 17526 17436 gene locus_tag LOCUS_t00140 17526 17436 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19291 18509 gene locus_tag LOCUS_16720 19291 18509 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_16720 19380 22934 gene locus_tag LOCUS_16730 19380 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 23018 24256 gene locus_tag LOCUS_16740 gene paaJ 23018 24256 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_16740 24471 25499 gene locus_tag LOCUS_16750 24471 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 28203 25480 gene locus_tag LOCUS_16760 28203 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 28691 28200 gene locus_tag LOCUS_16770 28691 28200 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_16770 28921 29733 gene locus_tag LOCUS_16780 28921 29733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 29876 30829 gene locus_tag LOCUS_16790 gene prs 29876 30829 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHU3 protein_id gnl|my_center|LOCUS_16790 32644 30842 gene locus_tag LOCUS_16800 32644 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 33828 32641 gene locus_tag LOCUS_16810 gene livJ 33828 32641 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837313.1 protein_id gnl|my_center|LOCUS_16810 34921 33818 gene locus_tag LOCUS_16820 34921 33818 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_16820 35701 35147 gene locus_tag LOCUS_16830 35701 35147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 35893 37800 gene locus_tag LOCUS_16840 35893 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 41647 37937 gene locus_tag LOCUS_16850 41647 37937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 42174 44555 gene locus_tag LOCUS_16860 42174 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_16860 46276 44855 gene locus_tag LOCUS_16870 46276 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 46628 47893 gene locus_tag LOCUS_16880 46628 47893 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_16880 47978 49591 gene locus_tag LOCUS_16890 47978 49591 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_16890 49612 51036 gene locus_tag LOCUS_16900 49612 51036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 51643 51194 gene locus_tag LOCUS_16910 51643 51194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 52089 51640 gene locus_tag LOCUS_16920 52089 51640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 52980 52699 gene locus_tag LOCUS_16930 52980 52699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 59833 52994 gene locus_tag LOCUS_16940 59833 52994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 60164 60931 gene locus_tag LOCUS_16950 60164 60931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 61050 63107 gene locus_tag LOCUS_16960 61050 63107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_16960 63490 69291 gene locus_tag LOCUS_16970 63490 69291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_16970 69602 69360 gene locus_tag LOCUS_16980 69602 69360 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_16980 102870 69628 gene locus_tag LOCUS_16990 102870 69628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 104189 104908 gene locus_tag LOCUS_17000 104189 104908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 105754 106575 gene locus_tag LOCUS_17010 105754 106575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 106594 106857 gene locus_tag LOCUS_17020 106594 106857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 107098 107391 gene locus_tag LOCUS_17030 107098 107391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 108331 108846 gene locus_tag LOCUS_17040 108331 108846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 109354 109572 gene locus_tag LOCUS_17050 109354 109572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 109714 110055 gene locus_tag LOCUS_17060 109714 110055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 110428 111525 gene locus_tag LOCUS_17070 110428 111525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 111622 111900 gene locus_tag LOCUS_17080 111622 111900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 111976 112389 gene locus_tag LOCUS_17090 111976 112389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 112382 112735 gene locus_tag LOCUS_17100 112382 112735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 113410 114012 gene locus_tag LOCUS_17110 113410 114012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 114319 114495 gene locus_tag LOCUS_17120 114319 114495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 117088 117363 gene locus_tag LOCUS_17130 117088 117363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 118708 119286 gene locus_tag LOCUS_17140 118708 119286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 119320 120015 gene locus_tag LOCUS_17150 119320 120015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 121421 121579 gene locus_tag LOCUS_17160 121421 121579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 122389 122147 gene locus_tag LOCUS_17170 122389 122147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 122276 124444 gene locus_tag LOCUS_17180 gene pksE 122276 124444 CDS product polyketide biosynthesis protein PksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34787 protein_id gnl|my_center|LOCUS_17180 124589 125173 gene locus_tag LOCUS_17190 124589 125173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 125362 125287 gene locus_tag LOCUS_t00150 125362 125287 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 125558 127120 gene locus_tag LOCUS_17200 125558 127120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 127117 127794 gene locus_tag LOCUS_17210 127117 127794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 127794 128639 gene locus_tag LOCUS_17220 gene murI 127794 128639 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_17220 128656 129486 gene locus_tag LOCUS_17230 gene rph 128656 129486 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_17230 129483 130793 gene locus_tag LOCUS_17240 129483 130793 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_17240 132312 130828 gene locus_tag LOCUS_17250 gene leuB 132312 130828 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_17250 133027 132347 gene locus_tag LOCUS_17260 133027 132347 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_17260 134109 133054 gene locus_tag LOCUS_17270 gene dsbG 134109 133054 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_17270 134576 135220 gene locus_tag LOCUS_17280 134576 135220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 135883 135335 gene locus_tag LOCUS_17290 135883 135335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 136234 136587 gene locus_tag LOCUS_17300 136234 136587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 138101 136638 gene locus_tag LOCUS_17310 138101 136638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 138277 138858 gene locus_tag LOCUS_17320 138277 138858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 138902 140932 gene locus_tag LOCUS_17330 gene uvrD 138902 140932 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F454 protein_id gnl|my_center|LOCUS_17330 140937 141149 gene locus_tag LOCUS_17340 140937 141149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 141784 141536 gene locus_tag LOCUS_17350 141784 141536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 142808 141939 gene locus_tag LOCUS_17360 gene lifO 142808 141939 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_17360 143791 142868 gene locus_tag LOCUS_17370 gene lip 143791 142868 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_17370 144397 143933 gene locus_tag LOCUS_17380 144397 143933 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_17380 146201 144402 gene locus_tag LOCUS_17390 146201 144402 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115546.1 protein_id gnl|my_center|LOCUS_17390 147032 146217 gene locus_tag LOCUS_17400 147032 146217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 148738 147032 gene locus_tag LOCUS_17410 148738 147032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 151005 148828 gene locus_tag LOCUS_17420 151005 148828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 153133 151019 gene locus_tag LOCUS_17430 153133 151019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 153246 153527 gene locus_tag LOCUS_17440 153246 153527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 153524 153973 gene locus_tag LOCUS_17450 153524 153973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 155736 153970 gene locus_tag LOCUS_17460 155736 153970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 156167 155733 gene locus_tag LOCUS_17470 gene vapC43 156167 155733 CDS product ribonuclease VapC43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF55 protein_id gnl|my_center|LOCUS_17470 156390 156154 gene locus_tag LOCUS_17480 156390 156154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 158248 156434 gene locus_tag LOCUS_17490 158248 156434 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_17490 158676 161648 gene locus_tag LOCUS_17500 158676 161648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 162576 161935 gene locus_tag LOCUS_17510 162576 161935 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405389.1 protein_id gnl|my_center|LOCUS_17510 163899 162601 gene locus_tag LOCUS_17520 163899 162601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 164133 165527 gene locus_tag LOCUS_17530 164133 165527 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_17530 165524 167782 gene locus_tag LOCUS_17540 165524 167782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 167849 168973 gene locus_tag LOCUS_17550 167849 168973 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUT0 protein_id gnl|my_center|LOCUS_17550 169003 170349 gene locus_tag LOCUS_17560 169003 170349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 171121 170921 gene locus_tag LOCUS_17570 171121 170921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 172033 171164 gene locus_tag LOCUS_17580 172033 171164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 172662 172090 gene locus_tag LOCUS_17590 172662 172090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 173372 172800 gene locus_tag LOCUS_17600 173372 172800 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_17600 175469 173442 gene locus_tag LOCUS_17610 175469 173442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 175722 176351 gene locus_tag LOCUS_17620 175722 176351 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_17620 176320 177030 gene locus_tag LOCUS_17630 176320 177030 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_17630 177096 177722 gene locus_tag LOCUS_17640 177096 177722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 177897 178397 gene locus_tag LOCUS_17650 177897 178397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 178449 180722 gene locus_tag LOCUS_17660 178449 180722 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_17660 181428 180733 gene locus_tag LOCUS_17670 181428 180733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_17670 181628 182020 gene locus_tag LOCUS_17680 181628 182020 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_17680 182997 182032 gene locus_tag LOCUS_17690 182997 182032 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_17690 183158 185758 gene locus_tag LOCUS_17700 183158 185758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 185764 186606 gene locus_tag LOCUS_17710 185764 186606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 187094 186609 gene locus_tag LOCUS_17720 187094 186609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391862.1 protein_id gnl|my_center|LOCUS_17720 187365 187081 gene locus_tag LOCUS_17730 187365 187081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 187985 187413 gene locus_tag LOCUS_17740 187985 187413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_17740 189560 188010 gene locus_tag LOCUS_17750 189560 188010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence011 136 672 gene locus_tag LOCUS_17760 136 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1711 692 gene locus_tag LOCUS_17770 gene fabH 1711 692 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y573 protein_id gnl|my_center|LOCUS_17770 1963 2778 gene locus_tag LOCUS_17780 1963 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_17780 3920 2760 gene locus_tag LOCUS_17790 3920 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4162 6285 gene locus_tag LOCUS_17800 4162 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 6687 8948 gene locus_tag LOCUS_17810 6687 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 9145 9591 gene locus_tag LOCUS_17820 9145 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 9704 10498 gene locus_tag LOCUS_17830 9704 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 10597 11232 gene locus_tag LOCUS_17840 10597 11232 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_17840 12705 11251 gene locus_tag LOCUS_17850 12705 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13598 12825 gene locus_tag LOCUS_17860 13598 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 14863 13613 gene locus_tag LOCUS_17870 gene adh 14863 13613 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_17870 16020 14944 gene locus_tag LOCUS_17880 16020 14944 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_17880 16124 16873 gene locus_tag LOCUS_17890 16124 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 20826 16780 gene locus_tag LOCUS_17900 20826 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 21296 23128 gene locus_tag LOCUS_17910 21296 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 23232 23546 gene locus_tag LOCUS_17920 23232 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 23533 23997 gene locus_tag LOCUS_17930 23533 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_17930 24916 24002 gene locus_tag LOCUS_17940 24916 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 25812 24913 gene locus_tag LOCUS_17950 25812 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 26611 25802 gene locus_tag LOCUS_17960 gene phnC 26611 25802 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQH4 protein_id gnl|my_center|LOCUS_17960 27511 26615 gene locus_tag LOCUS_17970 gene phnD 27511 26615 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_17970 29507 27792 gene locus_tag LOCUS_17980 29507 27792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 29634 30776 gene locus_tag LOCUS_17990 29634 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 30836 31873 gene locus_tag LOCUS_18000 30836 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 31866 32102 gene locus_tag LOCUS_18010 31866 32102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 32230 32991 gene locus_tag LOCUS_18020 32230 32991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_18020 35608 32993 gene locus_tag LOCUS_18030 35608 32993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 36699 35605 gene locus_tag LOCUS_18040 gene wbpY 36699 35605 CDS product glycosyltransferase WbpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_18040 37009 36704 gene locus_tag LOCUS_18050 37009 36704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 37894 37052 gene locus_tag LOCUS_18060 37894 37052 CDS product dTDP-Rha--alpha-D-GlcNAc-pyrophosphate polyprenol alpha-3-L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727935.1 protein_id gnl|my_center|LOCUS_18060 38019 38993 gene locus_tag LOCUS_18070 38019 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258969.1 protein_id gnl|my_center|LOCUS_18070 38990 39910 gene locus_tag LOCUS_18080 38990 39910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258970.1 protein_id gnl|my_center|LOCUS_18080 39907 40074 gene locus_tag LOCUS_18090 39907 40074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 40179 40430 gene locus_tag LOCUS_18100 40179 40430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 40427 40849 gene locus_tag LOCUS_18110 40427 40849 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_18110 42466 40853 gene locus_tag LOCUS_18120 42466 40853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 43697 42567 gene locus_tag LOCUS_18130 43697 42567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 43731 43958 gene locus_tag LOCUS_18140 43731 43958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 44057 44629 gene locus_tag LOCUS_18150 44057 44629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 47025 44653 gene locus_tag LOCUS_18160 47025 44653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 47144 47590 gene locus_tag LOCUS_18170 47144 47590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 49126 47789 gene locus_tag LOCUS_18180 49126 47789 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 protein_id gnl|my_center|LOCUS_18180 50190 49123 gene locus_tag LOCUS_18190 50190 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 50305 50550 gene locus_tag LOCUS_18200 50305 50550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 50551 50862 gene locus_tag LOCUS_18210 50551 50862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 51171 51716 gene locus_tag LOCUS_18220 51171 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 51829 52092 gene locus_tag LOCUS_18230 51829 52092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 52264 52500 gene locus_tag LOCUS_18240 52264 52500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 52725 54059 gene locus_tag LOCUS_18250 52725 54059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225428.1 protein_id gnl|my_center|LOCUS_18250 54068 57943 gene locus_tag LOCUS_18260 54068 57943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258729.1 protein_id gnl|my_center|LOCUS_18260 57961 59754 gene locus_tag LOCUS_18270 57961 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 59762 61936 gene locus_tag LOCUS_18280 59762 61936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_18280 63417 62278 gene locus_tag LOCUS_18290 63417 62278 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_18290 63554 66211 gene locus_tag LOCUS_18300 gene mutS 63554 66211 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_18300 67709 66345 gene locus_tag LOCUS_18310 67709 66345 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_18310 67842 69902 gene locus_tag LOCUS_18320 67842 69902 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_18320 70125 72020 gene locus_tag LOCUS_18330 70125 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 72142 72642 gene locus_tag LOCUS_18340 72142 72642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 73660 72677 gene locus_tag LOCUS_18350 gene mdh 73660 72677 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_18350 74042 73845 gene locus_tag LOCUS_18360 74042 73845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 74041 74775 gene locus_tag LOCUS_18370 74041 74775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 75244 74777 gene locus_tag LOCUS_18380 75244 74777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 76095 75241 gene locus_tag LOCUS_18390 76095 75241 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_18390 76688 76197 gene locus_tag LOCUS_18400 gene tpx 76688 76197 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 protein_id gnl|my_center|LOCUS_18400 76915 76829 gene locus_tag LOCUS_t00160 76915 76829 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77326 77922 gene locus_tag LOCUS_18410 77326 77922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 78056 78715 gene locus_tag LOCUS_18420 78056 78715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 78742 81192 gene locus_tag LOCUS_18430 gene priA 78742 81192 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYZ4 protein_id gnl|my_center|LOCUS_18430 81271 82224 gene locus_tag LOCUS_18440 gene accA 81271 82224 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIK7 protein_id gnl|my_center|LOCUS_18440 82305 84089 gene locus_tag LOCUS_18450 gene recJ 82305 84089 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_18450 84031 86220 gene locus_tag LOCUS_18460 84031 86220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 86290 87012 gene locus_tag LOCUS_18470 gene lptB 86290 87012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_18470 87028 88824 gene locus_tag LOCUS_18480 87028 88824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 88839 89381 gene locus_tag LOCUS_18490 gene raiA 88839 89381 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_18490 89399 89854 gene locus_tag LOCUS_18500 89399 89854 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706604.1 protein_id gnl|my_center|LOCUS_18500 89854 90819 gene locus_tag LOCUS_18510 gene hprK 89854 90819 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_18510 90782 91690 gene locus_tag LOCUS_18520 90782 91690 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_18520 91822 92301 gene locus_tag LOCUS_18530 91822 92301 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_18530 92301 92576 gene locus_tag LOCUS_18540 gene ptsH 92301 92576 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_18540 92573 94315 gene locus_tag LOCUS_18550 gene ptsI 92573 94315 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_18550 94348 95220 gene locus_tag LOCUS_18560 94348 95220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 95217 96566 gene locus_tag LOCUS_18570 gene miaB 95217 96566 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X63 protein_id gnl|my_center|LOCUS_18570 96691 97194 gene locus_tag LOCUS_18580 96691 97194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_18580 98010 98774 gene locus_tag LOCUS_18590 98010 98774 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_18590 98767 99639 gene locus_tag LOCUS_18600 98767 99639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 99676 99810 gene locus_tag LOCUS_18610 99676 99810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 100174 102549 gene locus_tag LOCUS_18620 100174 102549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 104022 102634 gene locus_tag LOCUS_18630 gene dnaC 104022 102634 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97CY1 protein_id gnl|my_center|LOCUS_18630 104781 104038 gene locus_tag LOCUS_18640 104781 104038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 107179 104783 gene locus_tag LOCUS_18650 107179 104783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 107345 108493 gene locus_tag LOCUS_18660 107345 108493 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_18660 108505 108771 gene locus_tag LOCUS_18670 gene hupB 108505 108771 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_18670 109309 108854 gene locus_tag LOCUS_18680 gene dtd 109309 108854 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT1 protein_id gnl|my_center|LOCUS_18680 109399 110007 gene locus_tag LOCUS_18690 109399 110007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 110073 111239 gene locus_tag LOCUS_18700 gene rsgA 110073 111239 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNT5 protein_id gnl|my_center|LOCUS_18700 111256 111963 gene locus_tag LOCUS_18710 111256 111963 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_18710 111960 113633 gene locus_tag LOCUS_18720 111960 113633 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_18720 113670 115454 gene locus_tag LOCUS_18730 113670 115454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 116490 115489 gene locus_tag LOCUS_18740 116490 115489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 121515 118558 gene locus_tag LOCUS_18750 121515 118558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 121706 123355 gene locus_tag LOCUS_18760 121706 123355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 126146 123336 gene locus_tag LOCUS_18770 126146 123336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 127691 126159 gene locus_tag LOCUS_18780 127691 126159 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_18780 128077 130611 gene locus_tag LOCUS_18790 128077 130611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 132922 130940 gene locus_tag LOCUS_18800 132922 130940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 134867 133071 gene locus_tag LOCUS_18810 134867 133071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 136506 134998 gene locus_tag LOCUS_18820 136506 134998 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_18820 136647 137132 gene locus_tag LOCUS_18830 136647 137132 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_18830 137158 139971 gene locus_tag LOCUS_18840 137158 139971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 140364 141947 gene locus_tag LOCUS_18850 140364 141947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 144417 142006 gene locus_tag LOCUS_18860 144417 142006 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_18860 144607 145878 gene locus_tag LOCUS_18870 144607 145878 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 145898 146782 gene locus_tag LOCUS_18880 145898 146782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 146906 148708 gene locus_tag LOCUS_18890 146906 148708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 149194 148973 gene locus_tag LOCUS_18900 149194 148973 CDS product UPF0150 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X137 protein_id gnl|my_center|LOCUS_18900 149360 149821 gene locus_tag LOCUS_18910 gene ptpA 149360 149821 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_18910 149818 150726 gene locus_tag LOCUS_18920 149818 150726 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_18920 150729 151811 gene locus_tag LOCUS_18930 150729 151811 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_18930 153375 151945 gene locus_tag LOCUS_18940 153375 151945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 154378 153743 gene locus_tag LOCUS_18950 154378 153743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 156013 154535 gene locus_tag LOCUS_18960 156013 154535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 157846 156413 gene locus_tag LOCUS_18970 157846 156413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 158535 157900 gene locus_tag LOCUS_18980 158535 157900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 161531 158655 gene locus_tag LOCUS_18990 161531 158655 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_18990 162127 161528 gene locus_tag LOCUS_19000 162127 161528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 163968 162169 gene locus_tag LOCUS_19010 gene oppA 163968 162169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_19010 165069 163993 gene locus_tag LOCUS_19020 gene oppC 165069 163993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880981.1 protein_id gnl|my_center|LOCUS_19020 166049 165069 gene locus_tag LOCUS_19030 gene oppB 166049 165069 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880275.1 protein_id gnl|my_center|LOCUS_19030 166867 166046 gene locus_tag LOCUS_19040 166867 166046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087313.1 protein_id gnl|my_center|LOCUS_19040 167753 166857 gene locus_tag LOCUS_19050 gene oppD 167753 166857 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030783.1 protein_id gnl|my_center|LOCUS_19050 169376 167763 gene locus_tag LOCUS_19060 169376 167763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 169499 170230 gene locus_tag LOCUS_19070 169499 170230 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_19070 170233 170946 gene locus_tag LOCUS_19080 170233 170946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 171098 172417 gene locus_tag LOCUS_19090 171098 172417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 172417 172887 gene locus_tag LOCUS_19100 172417 172887 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_19100 172926 174377 gene locus_tag LOCUS_19110 172926 174377 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_19110 175651 174569 gene locus_tag LOCUS_19120 175651 174569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 176940 175975 gene locus_tag LOCUS_19130 176940 175975 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_19130 178009 176969 gene locus_tag LOCUS_19140 gene trpS 178009 176969 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA78 protein_id gnl|my_center|LOCUS_19140 179388 178090 gene locus_tag LOCUS_19150 gene ftsA 179388 178090 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_19150 179986 179459 gene locus_tag LOCUS_19160 179986 179459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 181155 180148 gene locus_tag LOCUS_19170 gene yhdN 181155 180148 CDS product general stress protein 69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80874 protein_id gnl|my_center|LOCUS_19170 182872 181442 gene locus_tag LOCUS_19180 182872 181442 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121141.1 protein_id gnl|my_center|LOCUS_19180 182983 184035 gene locus_tag LOCUS_19190 182983 184035 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence012 338 625 gene locus_tag LOCUS_19200 338 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1244 645 gene locus_tag LOCUS_19210 1244 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1831 1241 gene locus_tag LOCUS_19220 1831 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2189 1935 gene locus_tag LOCUS_19230 2189 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3018 2290 gene locus_tag LOCUS_19240 3018 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3878 3132 gene locus_tag LOCUS_19250 3878 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5242 3878 gene locus_tag LOCUS_19260 5242 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5810 6982 gene locus_tag LOCUS_19270 5810 6982 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_19270 8555 9166 gene locus_tag LOCUS_19280 8555 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 9151 9861 gene locus_tag LOCUS_19290 9151 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 10661 11881 gene locus_tag LOCUS_19300 10661 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142450.1 protein_id gnl|my_center|LOCUS_19300 11878 13194 gene locus_tag LOCUS_19310 11878 13194 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_19310 13207 16338 gene locus_tag LOCUS_19320 gene czcA 13207 16338 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_19320 16335 17276 gene locus_tag LOCUS_19330 gene czcD 16335 17276 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_19330 17701 18027 gene locus_tag LOCUS_19340 17701 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 18137 19450 gene locus_tag LOCUS_19350 18137 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 19443 20654 gene locus_tag LOCUS_19360 19443 20654 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_19360 20654 23785 gene locus_tag LOCUS_19370 gene czcA 20654 23785 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_19370 23782 25959 gene locus_tag LOCUS_19380 23782 25959 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942791.1 protein_id gnl|my_center|LOCUS_19380 26508 26098 gene locus_tag LOCUS_19390 gene zntR 26508 26098 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_19390 27448 26561 gene locus_tag LOCUS_19400 27448 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 27353 27682 gene locus_tag LOCUS_19410 27353 27682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 28275 27592 gene locus_tag LOCUS_19420 28275 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 28555 28292 gene locus_tag LOCUS_19430 28555 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 31247 28755 gene locus_tag LOCUS_19440 31247 28755 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_19440 32512 31247 gene locus_tag LOCUS_19450 32512 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_19450 33891 32545 gene locus_tag LOCUS_19460 33891 32545 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_19460 36430 33908 gene locus_tag LOCUS_19470 36430 33908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 36885 36433 gene locus_tag LOCUS_19480 36885 36433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 38030 36924 gene locus_tag LOCUS_19490 38030 36924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 38575 38057 gene locus_tag LOCUS_19500 38575 38057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 41811 38629 gene locus_tag LOCUS_19510 41811 38629 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_19510 43205 41823 gene locus_tag LOCUS_19520 43205 41823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 44880 43453 gene locus_tag LOCUS_19530 44880 43453 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_19530 46252 46899 gene locus_tag LOCUS_19540 46252 46899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 46907 48538 gene locus_tag LOCUS_19550 46907 48538 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_19550 48575 48955 gene locus_tag LOCUS_19560 48575 48955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 48952 49329 gene locus_tag LOCUS_19570 48952 49329 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887079.1 protein_id gnl|my_center|LOCUS_19570 49342 50985 gene locus_tag LOCUS_19580 49342 50985 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080200.1 protein_id gnl|my_center|LOCUS_19580 51629 52087 gene locus_tag LOCUS_19590 51629 52087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 52919 53674 gene locus_tag LOCUS_19600 52919 53674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 53671 54543 gene locus_tag LOCUS_19610 53671 54543 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19610 54543 56081 gene locus_tag LOCUS_19620 54543 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 56185 56865 gene locus_tag LOCUS_19630 56185 56865 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546325.1 protein_id gnl|my_center|LOCUS_19630 56924 58333 gene locus_tag LOCUS_19640 56924 58333 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263108.1 protein_id gnl|my_center|LOCUS_19640 59049 58609 gene locus_tag LOCUS_19650 59049 58609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 60871 59645 gene locus_tag LOCUS_19660 60871 59645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 61415 60879 gene locus_tag LOCUS_19670 61415 60879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 62842 61412 gene locus_tag LOCUS_19680 62842 61412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 63150 62839 gene locus_tag LOCUS_19690 63150 62839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 63641 68668 gene locus_tag LOCUS_19700 63641 68668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 68665 69117 gene locus_tag LOCUS_19710 68665 69117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 69851 70525 gene locus_tag LOCUS_19720 69851 70525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 70528 71073 gene locus_tag LOCUS_19730 70528 71073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 72816 71485 gene locus_tag LOCUS_19740 72816 71485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 73451 74791 gene locus_tag LOCUS_19750 73451 74791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 74788 75849 gene locus_tag LOCUS_19760 74788 75849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 75846 76595 gene locus_tag LOCUS_19770 75846 76595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 76620 77201 gene locus_tag LOCUS_19780 76620 77201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 77194 78408 gene locus_tag LOCUS_19790 77194 78408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 78422 78982 gene locus_tag LOCUS_19800 78422 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 79458 78946 gene locus_tag LOCUS_19810 79458 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 81501 79477 gene locus_tag LOCUS_19820 81501 79477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 81496 81708 gene locus_tag LOCUS_19830 81496 81708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 82068 81826 gene locus_tag LOCUS_19840 82068 81826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 82970 82488 gene locus_tag LOCUS_19850 82970 82488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 85190 83910 gene locus_tag LOCUS_19860 85190 83910 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939288.1 protein_id gnl|my_center|LOCUS_19860 85689 86045 gene locus_tag LOCUS_19870 85689 86045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 86038 86331 gene locus_tag LOCUS_19880 86038 86331 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_19880 86348 87253 gene locus_tag LOCUS_19890 86348 87253 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393714.1 protein_id gnl|my_center|LOCUS_19890 87787 88458 gene locus_tag LOCUS_19900 87787 88458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 88455 88865 gene locus_tag LOCUS_19910 88455 88865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 88789 89112 gene locus_tag LOCUS_19920 88789 89112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 89539 89207 gene locus_tag LOCUS_19930 89539 89207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 93141 89536 gene locus_tag LOCUS_19940 93141 89536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 93889 93050 gene locus_tag LOCUS_19950 93889 93050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 94476 94273 gene locus_tag LOCUS_19960 94476 94273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 94824 94540 gene locus_tag LOCUS_19970 94824 94540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 95944 95675 gene locus_tag LOCUS_19980 95944 95675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 96723 96019 gene locus_tag LOCUS_19990 96723 96019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 96965 97174 gene locus_tag LOCUS_20000 96965 97174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 97813 97737 gene locus_tag LOCUS_t00170 97813 97737 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 98780 97953 gene locus_tag LOCUS_20010 gene thiG 98780 97953 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_20010 100950 98878 gene locus_tag LOCUS_20020 100950 98878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 101209 101412 gene locus_tag LOCUS_20030 101209 101412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 102466 101447 gene locus_tag LOCUS_20040 102466 101447 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_20040 105252 102640 gene locus_tag LOCUS_20050 105252 102640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 105763 105338 gene locus_tag LOCUS_20060 105763 105338 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_20060 107230 105818 gene locus_tag LOCUS_20070 107230 105818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 107441 109105 gene locus_tag LOCUS_20080 107441 109105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 109489 111885 gene locus_tag LOCUS_20090 109489 111885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 112473 120368 gene locus_tag LOCUS_20100 112473 120368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 120376 121587 gene locus_tag LOCUS_20110 120376 121587 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_20110 121637 122428 gene locus_tag LOCUS_20120 121637 122428 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_20120 122559 130586 gene locus_tag LOCUS_20130 122559 130586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 130576 132807 gene locus_tag LOCUS_20140 130576 132807 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_20140 132909 137411 gene locus_tag LOCUS_20150 132909 137411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 137473 148287 gene locus_tag LOCUS_20160 137473 148287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 150766 148373 gene locus_tag LOCUS_20170 150766 148373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20170 150985 152904 gene locus_tag LOCUS_20180 150985 152904 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_20180 152957 155533 gene locus_tag LOCUS_20190 152957 155533 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009952308.1 protein_id gnl|my_center|LOCUS_20190 155547 156869 gene locus_tag LOCUS_20200 155547 156869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 157903 156893 gene locus_tag LOCUS_20210 157903 156893 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_20210 158792 157932 gene locus_tag LOCUS_20220 158792 157932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 160415 158802 gene locus_tag LOCUS_20230 160415 158802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 161235 160426 gene locus_tag LOCUS_20240 161235 160426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 161651 161292 gene locus_tag LOCUS_20250 161651 161292 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_20250 162116 163774 gene locus_tag LOCUS_20260 162116 163774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 163771 165054 gene locus_tag LOCUS_20270 163771 165054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 165051 165527 gene locus_tag LOCUS_20280 165051 165527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 165524 167788 gene locus_tag LOCUS_20290 165524 167788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 167883 169778 gene locus_tag LOCUS_20300 167883 169778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 169790 170629 gene locus_tag LOCUS_20310 gene cheR40H 169790 170629 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AY4 protein_id gnl|my_center|LOCUS_20310 170626 171726 gene locus_tag LOCUS_20320 gene cheB 170626 171726 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX8 protein_id gnl|my_center|LOCUS_20320 171858 172424 gene locus_tag LOCUS_20330 171858 172424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 172672 174459 gene locus_tag LOCUS_20340 172672 174459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 176877 174481 gene locus_tag LOCUS_20350 176877 174481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 177485 177006 gene locus_tag LOCUS_20360 177485 177006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 178102 178281 gene locus_tag LOCUS_20370 178102 178281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 179578 178271 gene locus_tag LOCUS_20380 179578 178271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 179925 180692 gene locus_tag LOCUS_20390 179925 180692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 180689 181294 gene locus_tag LOCUS_20400 180689 181294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence013 <1 3228 gene locus_tag LOCUS_20410 <1 3228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026867.1:polyketide synthase 3225 12203 gene locus_tag LOCUS_20420 3225 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 12273 12941 gene locus_tag LOCUS_20430 12273 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 14663 12960 gene locus_tag LOCUS_20440 14663 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 14568 14945 gene locus_tag LOCUS_20450 14568 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 14935 15909 gene locus_tag LOCUS_20460 14935 15909 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_20460 15902 17023 gene locus_tag LOCUS_20470 15902 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_20470 18140 16992 gene locus_tag LOCUS_20480 18140 16992 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_20480 19039 18164 gene locus_tag LOCUS_20490 gene nadC 19039 18164 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_20490 23273 19053 gene locus_tag LOCUS_20500 23273 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 33912 23278 gene locus_tag LOCUS_20510 33912 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 36443 34014 gene locus_tag LOCUS_20520 36443 34014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_20520 39910 36485 gene locus_tag LOCUS_20530 39910 36485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 51176 39903 gene locus_tag LOCUS_20540 51176 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20540 51096 51905 gene locus_tag LOCUS_20550 51096 51905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 51912 52244 gene locus_tag LOCUS_20560 51912 52244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 52470 52847 gene locus_tag LOCUS_20570 52470 52847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 56444 53040 gene locus_tag LOCUS_20580 56444 53040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 57570 56536 gene locus_tag LOCUS_20590 57570 56536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 65009 57567 gene locus_tag LOCUS_20600 65009 57567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 66274 65012 gene locus_tag LOCUS_20610 gene adh 66274 65012 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_20610 67614 66271 gene locus_tag LOCUS_20620 67614 66271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 73451 67650 gene locus_tag LOCUS_20630 73451 67650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 74759 73464 gene locus_tag LOCUS_20640 gene ectB 74759 73464 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_20640 76110 74800 gene locus_tag LOCUS_20650 76110 74800 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX2 protein_id gnl|my_center|LOCUS_20650 78096 76768 gene locus_tag LOCUS_20660 78096 76768 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_20660 81242 78093 gene locus_tag LOCUS_20670 81242 78093 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_20670 81573 81328 gene locus_tag LOCUS_20680 81573 81328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 84288 81616 gene locus_tag LOCUS_20690 84288 81616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 87306 84484 gene locus_tag LOCUS_20700 87306 84484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 90627 87601 gene locus_tag LOCUS_20710 90627 87601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 90982 92853 gene locus_tag LOCUS_20720 90982 92853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 96785 92898 gene locus_tag LOCUS_20730 gene dnaE 96785 92898 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3X0 protein_id gnl|my_center|LOCUS_20730 97830 96991 gene locus_tag LOCUS_20740 97830 96991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 99035 97827 gene locus_tag LOCUS_20750 99035 97827 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_20750 100671 99145 gene locus_tag LOCUS_20760 100671 99145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 101060 100671 gene locus_tag LOCUS_20770 101060 100671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 101929 101159 gene locus_tag LOCUS_20780 101929 101159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 103584 101926 gene locus_tag LOCUS_20790 103584 101926 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_20790 104530 103736 gene locus_tag LOCUS_20800 104530 103736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 105570 104527 gene locus_tag LOCUS_20810 105570 104527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087314.1 protein_id gnl|my_center|LOCUS_20810 105841 107856 gene locus_tag LOCUS_20820 105841 107856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 107950 108858 gene locus_tag LOCUS_20830 gene purC 107950 108858 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_20830 108867 110351 gene locus_tag LOCUS_20840 108867 110351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 110404 110613 gene locus_tag LOCUS_20850 110404 110613 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142894.1 protein_id gnl|my_center|LOCUS_20850 111044 111328 gene locus_tag LOCUS_20860 111044 111328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 111350 111565 gene locus_tag LOCUS_20870 111350 111565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 111680 112666 gene locus_tag LOCUS_20880 111680 112666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 113565 112705 gene locus_tag LOCUS_20890 113565 112705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 113638 114789 gene locus_tag LOCUS_20900 gene wecE 113638 114789 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_20900 114821 115114 gene locus_tag LOCUS_20910 114821 115114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 115137 115817 gene locus_tag LOCUS_20920 115137 115817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 119005 116018 gene locus_tag LOCUS_20930 119005 116018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 119938 119048 gene locus_tag LOCUS_20940 gene dhmA1 119938 119048 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64302 protein_id gnl|my_center|LOCUS_20940 120153 122525 gene locus_tag LOCUS_20950 120153 122525 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_20950 122576 123406 gene locus_tag LOCUS_20960 122576 123406 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_20960 123467 124642 gene locus_tag LOCUS_20970 gene rnd 123467 124642 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_20970 125017 127074 gene locus_tag LOCUS_20980 125017 127074 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_20980 127105 128070 gene locus_tag LOCUS_20990 127105 128070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 129152 128100 gene locus_tag LOCUS_21000 129152 128100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 129298 130146 gene locus_tag LOCUS_21010 129298 130146 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_21010 130237 130806 gene locus_tag LOCUS_21020 130237 130806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 130986 132968 gene locus_tag LOCUS_21030 130986 132968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 134117 133092 gene locus_tag LOCUS_21040 134117 133092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 134801 134316 gene locus_tag LOCUS_21050 134801 134316 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_21050 135058 134801 gene locus_tag LOCUS_21060 135058 134801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 135267 137393 gene locus_tag LOCUS_21070 135267 137393 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_21070 137458 146166 gene locus_tag LOCUS_21080 137458 146166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 146159 147883 gene locus_tag LOCUS_21090 146159 147883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 148395 147892 gene locus_tag LOCUS_21100 148395 147892 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_21100 148654 148469 gene locus_tag LOCUS_21110 148654 148469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602028.1 protein_id gnl|my_center|LOCUS_21110 149613 148663 gene locus_tag LOCUS_21120 149613 148663 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_21120 150070 149822 gene locus_tag LOCUS_21130 150070 149822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 150535 150185 gene locus_tag LOCUS_21140 150535 150185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 150684 151268 gene locus_tag LOCUS_21150 150684 151268 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_21150 151258 153534 gene locus_tag LOCUS_21160 151258 153534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 154012 153485 gene locus_tag LOCUS_21170 154012 153485 CDS product methionine-S-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948988.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21170 156790 154436 gene locus_tag LOCUS_21180 156790 154436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 159306 156808 gene locus_tag LOCUS_21190 159306 156808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 163066 159386 gene locus_tag LOCUS_21200 163066 159386 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_21200 167794 163988 gene locus_tag LOCUS_21210 167794 163988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence014 1692 1285 gene locus_tag LOCUS_21220 1692 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1949 1692 gene locus_tag LOCUS_21230 1949 1692 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631141.1 protein_id gnl|my_center|LOCUS_21230 3301 2054 gene locus_tag LOCUS_21240 3301 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3517 5340 gene locus_tag LOCUS_21250 3517 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5340 7310 gene locus_tag LOCUS_21260 5340 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7670 7410 gene locus_tag LOCUS_21270 7670 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8173 9228 gene locus_tag LOCUS_21280 gene pilM 8173 9228 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_21280 9232 9849 gene locus_tag LOCUS_21290 9232 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9869 10459 gene locus_tag LOCUS_21300 9869 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10452 11027 gene locus_tag LOCUS_21310 10452 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 11185 13980 gene locus_tag LOCUS_21320 11185 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 13998 14567 gene locus_tag LOCUS_21330 13998 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 14936 14628 gene locus_tag LOCUS_21340 14936 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 14827 16482 gene locus_tag LOCUS_21350 14827 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 16625 17635 gene locus_tag LOCUS_21360 16625 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 17818 19371 gene locus_tag LOCUS_21370 17818 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 19361 19714 gene locus_tag LOCUS_21380 19361 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 19783 20298 gene locus_tag LOCUS_21390 19783 20298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 20324 21676 gene locus_tag LOCUS_21400 gene accC 20324 21676 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_21400 21693 22376 gene locus_tag LOCUS_21410 21693 22376 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816649.1 protein_id gnl|my_center|LOCUS_21410 22364 23809 gene locus_tag LOCUS_21420 22364 23809 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_21420 23912 24481 gene locus_tag LOCUS_21430 gene aroK 23912 24481 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH27 protein_id gnl|my_center|LOCUS_21430 24466 25209 gene locus_tag LOCUS_21440 24466 25209 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_21440 26640 25198 gene locus_tag LOCUS_21450 26640 25198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 27338 26736 gene locus_tag LOCUS_21460 27338 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_21460 28115 27339 gene locus_tag LOCUS_21470 gene paaG 28115 27339 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_21470 30964 28157 gene locus_tag LOCUS_21480 gene uvrA1 30964 28157 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_21480 31619 30999 gene locus_tag LOCUS_21490 31619 30999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_21490 31783 33345 gene locus_tag LOCUS_21500 31783 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 33436 33741 gene locus_tag LOCUS_21510 33436 33741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 33738 34955 gene locus_tag LOCUS_21520 33738 34955 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_21520 35173 34952 gene locus_tag LOCUS_21530 35173 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 36301 35189 gene locus_tag LOCUS_21540 36301 35189 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AT9 protein_id gnl|my_center|LOCUS_21540 37142 36282 gene locus_tag LOCUS_21550 37142 36282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 40618 37139 gene locus_tag LOCUS_21560 gene mfd 40618 37139 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_21560 40741 41502 gene locus_tag LOCUS_21570 40741 41502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 41606 42607 gene locus_tag LOCUS_21580 41606 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 42633 43904 gene locus_tag LOCUS_21590 42633 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 43977 44726 gene locus_tag LOCUS_21600 43977 44726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 47091 44767 gene locus_tag LOCUS_21610 47091 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 48401 47121 gene locus_tag LOCUS_21620 gene murA 48401 47121 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ23 protein_id gnl|my_center|LOCUS_21620 49426 48437 gene locus_tag LOCUS_21630 49426 48437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 50549 49461 gene locus_tag LOCUS_21640 gene prfA 50549 49461 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIQ7 protein_id gnl|my_center|LOCUS_21640 50853 50644 gene locus_tag LOCUS_21650 gene rpmE 50853 50644 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A8 protein_id gnl|my_center|LOCUS_21650 51992 51072 gene locus_tag LOCUS_21660 51992 51072 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_21660 52789 52031 gene locus_tag LOCUS_21670 52789 52031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 55333 52907 gene locus_tag LOCUS_21680 55333 52907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 55747 55334 gene locus_tag LOCUS_21690 55747 55334 CDS product cell-cycle regulation protein HIT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829828.1 protein_id gnl|my_center|LOCUS_21690 56253 55768 gene locus_tag LOCUS_21700 56253 55768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 57176 56238 gene locus_tag LOCUS_21710 57176 56238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 57661 57173 gene locus_tag LOCUS_21720 57661 57173 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_21720 58328 57654 gene locus_tag LOCUS_21730 58328 57654 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_21730 58404 59267 gene locus_tag LOCUS_21740 58404 59267 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_21740 59264 60961 gene locus_tag LOCUS_21750 59264 60961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_21750 61108 62670 gene locus_tag LOCUS_21760 61108 62670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 64589 62673 gene locus_tag LOCUS_21770 64589 62673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 65630 64605 gene locus_tag LOCUS_21780 65630 64605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 65787 67019 gene locus_tag LOCUS_21790 65787 67019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 67063 68454 gene locus_tag LOCUS_21800 67063 68454 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_21800 68789 70561 gene locus_tag LOCUS_21810 68789 70561 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_21810 70755 70680 gene locus_tag LOCUS_t00180 70755 70680 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70941 71558 gene locus_tag LOCUS_21820 70941 71558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 72120 71578 gene locus_tag LOCUS_21830 72120 71578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 72306 73040 gene locus_tag LOCUS_21840 gene comF 72306 73040 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 protein_id gnl|my_center|LOCUS_21840 73369 75411 gene locus_tag LOCUS_21850 73369 75411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 75576 78377 gene locus_tag LOCUS_21860 75576 78377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21860 78444 79823 gene locus_tag LOCUS_21870 gene pilR 78444 79823 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_21870 79854 80846 gene locus_tag LOCUS_21880 79854 80846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 80843 82825 gene locus_tag LOCUS_21890 80843 82825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 84060 82894 gene locus_tag LOCUS_21900 84060 82894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 85384 84089 gene locus_tag LOCUS_21910 85384 84089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 85461 86750 gene locus_tag LOCUS_21920 85461 86750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 86793 87641 gene locus_tag LOCUS_21930 86793 87641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142198.1 protein_id gnl|my_center|LOCUS_21930 87641 89965 gene locus_tag LOCUS_21940 87641 89965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 89979 90737 gene locus_tag LOCUS_21950 89979 90737 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_21950 90734 91705 gene locus_tag LOCUS_21960 90734 91705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 91702 92757 gene locus_tag LOCUS_21970 91702 92757 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_21970 92852 94684 gene locus_tag LOCUS_21980 92852 94684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 94736 95881 gene locus_tag LOCUS_21990 94736 95881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 95881 96411 gene locus_tag LOCUS_22000 95881 96411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 96442 96960 gene locus_tag LOCUS_22010 96442 96960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 98537 97014 gene locus_tag LOCUS_22020 98537 97014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918535.1 protein_id gnl|my_center|LOCUS_22020 100799 98541 gene locus_tag LOCUS_22030 100799 98541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 101010 102182 gene locus_tag LOCUS_22040 gene sbcD 101010 102182 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT45 protein_id gnl|my_center|LOCUS_22040 102182 105286 gene locus_tag LOCUS_22050 gene sbcC 102182 105286 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT44 protein_id gnl|my_center|LOCUS_22050 105450 107174 gene locus_tag LOCUS_22060 gene pilB 105450 107174 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_22060 109920 107566 gene locus_tag LOCUS_22070 109920 107566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 109823 109911 gene locus_tag LOCUS_t00190 109823 109911 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 110507 109917 gene locus_tag LOCUS_22080 110507 109917 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY9 protein_id gnl|my_center|LOCUS_22080 110646 112583 gene locus_tag LOCUS_22090 110646 112583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 112601 113530 gene locus_tag LOCUS_22100 gene pldB 112601 113530 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_22100 113540 113911 gene locus_tag LOCUS_22110 113540 113911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 115670 113922 gene locus_tag LOCUS_22120 115670 113922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_22120 115777 116778 gene locus_tag LOCUS_22130 gene argF 115777 116778 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF9 protein_id gnl|my_center|LOCUS_22130 117264 116785 gene locus_tag LOCUS_22140 117264 116785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 117378 119309 gene locus_tag LOCUS_22150 117378 119309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 119386 121173 gene locus_tag LOCUS_22160 119386 121173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 121738 121184 gene locus_tag LOCUS_22170 121738 121184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 123332 121791 gene locus_tag LOCUS_22180 123332 121791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 123577 129717 gene locus_tag LOCUS_22190 123577 129717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 129726 135095 gene locus_tag LOCUS_22200 129726 135095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 135092 135328 gene locus_tag LOCUS_22210 135092 135328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 135578 141499 gene locus_tag LOCUS_22220 135578 141499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 145044 141598 gene locus_tag LOCUS_22230 145044 141598 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_22230 147009 145210 gene locus_tag LOCUS_22240 147009 145210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 147521 147015 gene locus_tag LOCUS_22250 147521 147015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 147876 150164 gene locus_tag LOCUS_22260 147876 150164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 150214 151083 gene locus_tag LOCUS_22270 150214 151083 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_22270 151073 152080 gene locus_tag LOCUS_22280 151073 152080 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937987.1 protein_id gnl|my_center|LOCUS_22280 152130 152681 gene locus_tag LOCUS_22290 152130 152681 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_22290 153448 152699 gene locus_tag LOCUS_22300 153448 152699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 154248 153445 gene locus_tag LOCUS_22310 154248 153445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 154820 154512 gene locus_tag LOCUS_22320 154820 154512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 155086 156528 gene locus_tag LOCUS_22330 155086 156528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 156615 158510 gene locus_tag LOCUS_22340 156615 158510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 158526 159494 gene locus_tag LOCUS_22350 158526 159494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 159625 160047 gene locus_tag LOCUS_22360 159625 160047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 161047 160310 gene locus_tag LOCUS_22370 161047 160310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 161200 162948 gene locus_tag LOCUS_22380 161200 162948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 162951 163724 gene locus_tag LOCUS_22390 162951 163724 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_22390 163756 163989 gene locus_tag LOCUS_22400 163756 163989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 164663 164247 gene locus_tag LOCUS_22410 164663 164247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 164940 166064 gene locus_tag LOCUS_22420 164940 166064 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259425.1 protein_id gnl|my_center|LOCUS_22420 166061 167740 gene locus_tag LOCUS_22430 166061 167740 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259426.1 protein_id gnl|my_center|LOCUS_22430 167794 168162 gene locus_tag LOCUS_22440 167794 168162 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259427.1 protein_id gnl|my_center|LOCUS_22440 168318 169200 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgc >Feature sequence015 3406 1043 gene locus_tag LOCUS_22450 3406 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3530 7285 gene locus_tag LOCUS_22460 3530 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 7282 8598 gene locus_tag LOCUS_22470 7282 8598 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_22470 8640 10034 gene locus_tag LOCUS_22480 8640 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 10773 10237 gene locus_tag LOCUS_22490 10773 10237 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_22490 12032 10770 gene locus_tag LOCUS_22500 12032 10770 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887438.1 protein_id gnl|my_center|LOCUS_22500 12162 13460 gene locus_tag LOCUS_22510 12162 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 13453 14355 gene locus_tag LOCUS_22520 13453 14355 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_22520 14372 15124 gene locus_tag LOCUS_22530 14372 15124 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_22530 15117 15995 gene locus_tag LOCUS_22540 gene nadK 15117 15995 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_22540 15988 20079 gene locus_tag LOCUS_22550 15988 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 21861 20536 gene locus_tag LOCUS_22560 21861 20536 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_22560 24567 22006 gene locus_tag LOCUS_22570 24567 22006 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_22570 25287 24613 gene locus_tag LOCUS_22580 25287 24613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_22580 25550 26305 gene locus_tag LOCUS_22590 25550 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 26435 27067 gene locus_tag LOCUS_22600 26435 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 27073 28269 gene locus_tag LOCUS_22610 27073 28269 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_22610 28418 31285 gene locus_tag LOCUS_22620 28418 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 31659 32930 gene locus_tag LOCUS_22630 31659 32930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 32943 35090 gene locus_tag LOCUS_22640 32943 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 35107 35940 gene locus_tag LOCUS_22650 35107 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 38163 35944 gene locus_tag LOCUS_22660 38163 35944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 38339 39502 gene locus_tag LOCUS_22670 38339 39502 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_22670 40109 39543 gene locus_tag LOCUS_22680 40109 39543 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_22680 42103 40106 gene locus_tag LOCUS_22690 42103 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 43603 42317 gene locus_tag LOCUS_22700 gene dctM 43603 42317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103397.1 protein_id gnl|my_center|LOCUS_22700 44085 43600 gene locus_tag LOCUS_22710 44085 43600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 45290 44082 gene locus_tag LOCUS_22720 gene galK 45290 44082 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB97 protein_id gnl|my_center|LOCUS_22720 45434 52075 gene locus_tag LOCUS_22730 45434 52075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 52386 52631 gene locus_tag LOCUS_22740 52386 52631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 55105 52679 gene locus_tag LOCUS_22750 gene dinG 55105 52679 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_22750 55191 56264 gene locus_tag LOCUS_22760 55191 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 56688 56281 gene locus_tag LOCUS_22770 56688 56281 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682163.1 protein_id gnl|my_center|LOCUS_22770 56975 56685 gene locus_tag LOCUS_22780 56975 56685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 59013 57079 gene locus_tag LOCUS_22790 gene pepN 59013 57079 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_22790 59247 60617 gene locus_tag LOCUS_22800 gene rimO 59247 60617 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_22800 60640 61587 gene locus_tag LOCUS_22810 60640 61587 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNS3 protein_id gnl|my_center|LOCUS_22810 61741 62082 gene locus_tag LOCUS_22820 gene trxA 61741 62082 CDS product thioredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA30 protein_id gnl|my_center|LOCUS_22820 62267 64018 gene locus_tag LOCUS_22830 gene recN 62267 64018 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7B8 protein_id gnl|my_center|LOCUS_22830 64015 64647 gene locus_tag LOCUS_22840 64015 64647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 65076 66854 gene locus_tag LOCUS_22850 65076 66854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_22850 66878 69130 gene locus_tag LOCUS_22860 66878 69130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 69506 69114 gene locus_tag LOCUS_22870 gene vapC 69506 69114 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_22870 69802 69503 gene locus_tag LOCUS_22880 69802 69503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 69965 70483 gene locus_tag LOCUS_22890 gene coaD 69965 70483 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5P8 protein_id gnl|my_center|LOCUS_22890 70499 72307 gene locus_tag LOCUS_22900 70499 72307 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR27 protein_id gnl|my_center|LOCUS_22900 72358 72804 gene locus_tag LOCUS_22910 72358 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_22910 73473 72835 gene locus_tag LOCUS_22920 73473 72835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 73714 76635 gene locus_tag LOCUS_22930 73714 76635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 77163 76726 gene locus_tag LOCUS_22940 77163 76726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 77356 77613 gene locus_tag LOCUS_22950 77356 77613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 77610 77849 gene locus_tag LOCUS_22960 77610 77849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 79755 77866 gene locus_tag LOCUS_22970 gene ggt 79755 77866 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_22970 79950 89087 gene locus_tag LOCUS_22980 79950 89087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 89297 90142 gene locus_tag LOCUS_22990 89297 90142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 90272 90676 gene locus_tag LOCUS_23000 90272 90676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 91123 90824 gene locus_tag LOCUS_23010 91123 90824 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403429.1 protein_id gnl|my_center|LOCUS_23010 91467 92000 gene locus_tag LOCUS_23020 91467 92000 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_23020 92544 92164 gene locus_tag LOCUS_23030 92544 92164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 92875 93426 gene locus_tag LOCUS_23040 92875 93426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 94240 93431 gene locus_tag LOCUS_23050 94240 93431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 94460 95302 gene locus_tag LOCUS_23060 94460 95302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 97404 95299 gene locus_tag LOCUS_23070 97404 95299 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730594.1 protein_id gnl|my_center|LOCUS_23070 99368 97404 gene locus_tag LOCUS_23080 99368 97404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 100311 99385 gene locus_tag LOCUS_23090 100311 99385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 100733 100347 gene locus_tag LOCUS_23100 100733 100347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 100946 102031 gene locus_tag LOCUS_23110 100946 102031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 102293 103138 gene locus_tag LOCUS_23120 102293 103138 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_23120 103327 104424 gene locus_tag LOCUS_23130 103327 104424 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_23130 104823 104425 gene locus_tag LOCUS_23140 104823 104425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 105726 105010 gene locus_tag LOCUS_23150 105726 105010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 105903 106883 gene locus_tag LOCUS_23160 105903 106883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 106995 109709 gene locus_tag LOCUS_23170 106995 109709 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108585.1 protein_id gnl|my_center|LOCUS_23170 109971 111146 gene locus_tag LOCUS_23180 109971 111146 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_23180 111293 113188 gene locus_tag LOCUS_23190 111293 113188 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_23190 113435 114553 gene locus_tag LOCUS_23200 113435 114553 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_23200 114571 115764 gene locus_tag LOCUS_23210 114571 115764 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_23210 115793 116323 gene locus_tag LOCUS_23220 115793 116323 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_23220 116935 116342 gene locus_tag LOCUS_23230 116935 116342 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_23230 117333 118349 gene locus_tag LOCUS_23240 gene paaE 117333 118349 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085679.1 protein_id gnl|my_center|LOCUS_23240 118993 118346 gene locus_tag LOCUS_23250 gene trmH 118993 118346 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSB4 protein_id gnl|my_center|LOCUS_23250 119038 120387 gene locus_tag LOCUS_23260 119038 120387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 120781 120377 gene locus_tag LOCUS_23270 gene vapC 120781 120377 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H9 protein_id gnl|my_center|LOCUS_23270 121017 120778 gene locus_tag LOCUS_23280 121017 120778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 121377 122744 gene locus_tag LOCUS_23290 gene nqrA 121377 122744 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ8 protein_id gnl|my_center|LOCUS_23290 122748 123986 gene locus_tag LOCUS_23300 gene nqrB 122748 123986 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_23300 123976 124761 gene locus_tag LOCUS_23310 gene nqrC 123976 124761 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV7 protein_id gnl|my_center|LOCUS_23310 124761 125384 gene locus_tag LOCUS_23320 gene nqrD 124761 125384 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_23320 125386 126003 gene locus_tag LOCUS_23330 gene nqrE 125386 126003 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_23330 126026 127258 gene locus_tag LOCUS_23340 gene nqrF 126026 127258 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05012 protein_id gnl|my_center|LOCUS_23340 127614 128639 gene locus_tag LOCUS_23350 127614 128639 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_23350 128636 128866 gene locus_tag LOCUS_23360 128636 128866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 128863 131193 gene locus_tag LOCUS_23370 128863 131193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 131307 131855 gene locus_tag LOCUS_23380 131307 131855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 132953 132306 gene locus_tag LOCUS_23390 132953 132306 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085670.1 protein_id gnl|my_center|LOCUS_23390 133076 134395 gene locus_tag LOCUS_23400 133076 134395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 134872 134375 gene locus_tag LOCUS_23410 134872 134375 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_23410 135015 135938 gene locus_tag LOCUS_23420 gene ilvE 135015 135938 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_766869.2 protein_id gnl|my_center|LOCUS_23420 136772 136356 gene locus_tag LOCUS_23430 136772 136356 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_23430 137560 136769 gene locus_tag LOCUS_23440 137560 136769 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_23440 137635 138627 gene locus_tag LOCUS_23450 137635 138627 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_23450 139281 138580 gene locus_tag LOCUS_23460 139281 138580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970038.1 protein_id gnl|my_center|LOCUS_23460 141251 139356 gene locus_tag LOCUS_23470 141251 139356 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256963.1 protein_id gnl|my_center|LOCUS_23470 141686 144142 gene locus_tag LOCUS_23480 141686 144142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 146001 144145 gene locus_tag LOCUS_23490 146001 144145 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23490 146939 145998 gene locus_tag LOCUS_23500 146939 145998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 149338 147071 gene locus_tag LOCUS_23510 149338 147071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 150528 149335 gene locus_tag LOCUS_23520 150528 149335 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173846.1 protein_id gnl|my_center|LOCUS_23520 151733 150525 gene locus_tag LOCUS_23530 gene rbsR 151733 150525 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_23530 151939 155382 gene locus_tag LOCUS_23540 151939 155382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 157227 155467 gene locus_tag LOCUS_23550 157227 155467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 158095 157355 gene locus_tag LOCUS_23560 158095 157355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090657.1 protein_id gnl|my_center|LOCUS_23560 159339 158092 gene locus_tag LOCUS_23570 159339 158092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 161125 159350 gene locus_tag LOCUS_23580 161125 159350 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 protein_id gnl|my_center|LOCUS_23580 164753 161214 gene locus_tag LOCUS_23590 164753 161214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 164719 164931 gene locus_tag LOCUS_23600 164719 164931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 165383 166582 gene locus_tag LOCUS_23610 gene mntH 165383 166582 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_23610 166602 167507 gene locus_tag LOCUS_23620 166602 167507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 167928 167530 gene locus_tag LOCUS_23630 167928 167530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 168306 167998 gene locus_tag LOCUS_23640 168306 167998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 <168893 168303 gene locus_tag LOCUS_23650 <168893 168303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001535.1:membrane protein >Feature sequence016 18354 1576 gene locus_tag LOCUS_23660 18354 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 20396 18981 gene locus_tag LOCUS_23670 20396 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 21811 20393 gene locus_tag LOCUS_23680 21811 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_23680 22560 21808 gene locus_tag LOCUS_23690 22560 21808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_23690 22838 25267 gene locus_tag LOCUS_23700 22838 25267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 26957 25377 gene locus_tag LOCUS_23710 26957 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 27328 34347 gene locus_tag LOCUS_23720 27328 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 37515 34363 gene locus_tag LOCUS_23730 37515 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 37789 38217 gene locus_tag LOCUS_23740 37789 38217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 39822 38359 gene locus_tag LOCUS_23750 39822 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 41004 39928 gene locus_tag LOCUS_23760 41004 39928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 43487 41001 gene locus_tag LOCUS_23770 43487 41001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 45643 43499 gene locus_tag LOCUS_23780 45643 43499 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882427.1 protein_id gnl|my_center|LOCUS_23780 47999 45705 gene locus_tag LOCUS_23790 47999 45705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 49029 48292 gene locus_tag LOCUS_23800 49029 48292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 49156 49080 gene locus_tag LOCUS_t00200 49156 49080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49741 49226 gene locus_tag LOCUS_23810 gene apt 49741 49226 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGZ0 protein_id gnl|my_center|LOCUS_23810 50094 49804 gene locus_tag LOCUS_23820 50094 49804 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_23820 50759 50091 gene locus_tag LOCUS_23830 gene pcm 50759 50091 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ5 protein_id gnl|my_center|LOCUS_23830 51565 50765 gene locus_tag LOCUS_23840 gene surE 51565 50765 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_23840 52482 51607 gene locus_tag LOCUS_23850 gene mtnP 52482 51607 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_23850 53517 52555 gene locus_tag LOCUS_23860 53517 52555 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932671.1 protein_id gnl|my_center|LOCUS_23860 54334 53522 gene locus_tag LOCUS_23870 gene lpxA 54334 53522 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I3 protein_id gnl|my_center|LOCUS_23870 54927 54490 gene locus_tag LOCUS_23880 gene fabZ 54927 54490 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25928 protein_id gnl|my_center|LOCUS_23880 56066 54933 gene locus_tag LOCUS_23890 gene lpxD 56066 54933 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DT0 protein_id gnl|my_center|LOCUS_23890 56617 56063 gene locus_tag LOCUS_23900 56617 56063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 59089 56696 gene locus_tag LOCUS_23910 gene yaeT 59089 56696 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_23910 61653 59233 gene locus_tag LOCUS_23920 gene clpC 61653 59233 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880827.1 protein_id gnl|my_center|LOCUS_23920 62388 61675 gene locus_tag LOCUS_23930 gene lolD1 62388 61675 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_23930 62563 62919 gene locus_tag LOCUS_23940 62563 62919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_23940 62925 63281 gene locus_tag LOCUS_23950 62925 63281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 64073 63285 gene locus_tag LOCUS_23960 64073 63285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 65163 64066 gene locus_tag LOCUS_23970 65163 64066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 65675 65160 gene locus_tag LOCUS_23980 65675 65160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 65950 65672 gene locus_tag LOCUS_23990 65950 65672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 67611 66250 gene locus_tag LOCUS_24000 67611 66250 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_24000 67768 70083 gene locus_tag LOCUS_24010 67768 70083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 71035 70478 gene locus_tag LOCUS_24020 71035 70478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 71098 71964 gene locus_tag LOCUS_24030 71098 71964 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_24030 72385 73353 gene locus_tag LOCUS_24040 72385 73353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 73422 74717 gene locus_tag LOCUS_24050 73422 74717 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121707.1 protein_id gnl|my_center|LOCUS_24050 75881 74919 gene locus_tag LOCUS_24060 75881 74919 CDS product UDP-N-acetylglucosamine C4 epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 protein_id gnl|my_center|LOCUS_24060 77485 75899 gene locus_tag LOCUS_24070 77485 75899 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_24070 80639 77868 gene locus_tag LOCUS_24080 80639 77868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 81555 80863 gene locus_tag LOCUS_24090 81555 80863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 82271 81552 gene locus_tag LOCUS_24100 82271 81552 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_24100 83610 82552 gene locus_tag LOCUS_24110 83610 82552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 85579 84257 gene locus_tag LOCUS_24120 85579 84257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 90419 89199 gene locus_tag LOCUS_24130 90419 89199 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HA69 protein_id gnl|my_center|LOCUS_24130 90793 90416 gene locus_tag LOCUS_24140 90793 90416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 90949 90821 gene locus_tag LOCUS_24150 90949 90821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 94886 90990 gene locus_tag LOCUS_24160 94886 90990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 95401 97734 gene locus_tag LOCUS_24170 95401 97734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 99023 97758 gene locus_tag LOCUS_24180 99023 97758 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_24180 100638 99091 gene locus_tag LOCUS_24190 100638 99091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 102157 100631 gene locus_tag LOCUS_24200 102157 100631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 103730 102144 gene locus_tag LOCUS_24210 103730 102144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 103933 104355 gene locus_tag LOCUS_24220 103933 104355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 107619 104398 gene locus_tag LOCUS_24230 107619 104398 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCJ8 protein_id gnl|my_center|LOCUS_24230 111186 108235 gene locus_tag LOCUS_24240 111186 108235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 111624 112235 gene locus_tag LOCUS_24250 111624 112235 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_24250 112232 113734 gene locus_tag LOCUS_24260 112232 113734 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_24260 114425 113949 gene locus_tag LOCUS_24270 114425 113949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 114755 114459 gene locus_tag LOCUS_24280 114755 114459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 114862 116193 gene locus_tag LOCUS_24290 114862 116193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 116229 117410 gene locus_tag LOCUS_24300 116229 117410 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_24300 117403 118569 gene locus_tag LOCUS_24310 gene solA 117403 118569 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_24310 118675 118962 gene locus_tag LOCUS_24320 118675 118962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 118949 119380 gene locus_tag LOCUS_24330 gene vapC 118949 119380 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SG6 protein_id gnl|my_center|LOCUS_24330 120207 119494 gene locus_tag LOCUS_24340 120207 119494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 122294 120207 gene locus_tag LOCUS_24350 gene fusA2 122294 120207 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV3 protein_id gnl|my_center|LOCUS_24350 123524 122535 gene locus_tag LOCUS_24360 123524 122535 CDS product phage-related regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_24360 124714 123521 gene locus_tag LOCUS_24370 124714 123521 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_24370 124866 126455 gene locus_tag LOCUS_24380 gene prfC 124866 126455 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_24380 126472 128211 gene locus_tag LOCUS_24390 126472 128211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_24390 129509 128208 gene locus_tag LOCUS_24400 129509 128208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 129652 131481 gene locus_tag LOCUS_24410 129652 131481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 131780 135235 gene locus_tag LOCUS_24420 131780 135235 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_24420 135482 135709 gene locus_tag LOCUS_24430 135482 135709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 136526 135678 gene locus_tag LOCUS_24440 136526 135678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_24440 136659 137405 gene locus_tag LOCUS_24450 136659 137405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 137414 139600 gene locus_tag LOCUS_24460 137414 139600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 139584 140618 gene locus_tag LOCUS_24470 139584 140618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 141698 140661 gene locus_tag LOCUS_24480 gene rfbG 141698 140661 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_24480 143664 141784 gene locus_tag LOCUS_24490 gene asnB 143664 141784 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942597.1 protein_id gnl|my_center|LOCUS_24490 145046 143664 gene locus_tag LOCUS_24500 145046 143664 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_24500 146208 145048 gene locus_tag LOCUS_24510 146208 145048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 147436 146210 gene locus_tag LOCUS_24520 147436 146210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 149473 147506 gene locus_tag LOCUS_24530 149473 147506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 152699 149463 gene locus_tag LOCUS_24540 152699 149463 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_24540 154577 152847 gene locus_tag LOCUS_24550 154577 152847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence017 2337 352 gene locus_tag LOCUS_24560 2337 352 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_24560 4055 2523 gene locus_tag LOCUS_24570 4055 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 5223 4048 gene locus_tag LOCUS_24580 gene tqsA 5223 4048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_24580 5342 6082 gene locus_tag LOCUS_24590 5342 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_24590 7084 6107 gene locus_tag LOCUS_24600 7084 6107 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064349.1 protein_id gnl|my_center|LOCUS_24600 7285 9519 gene locus_tag LOCUS_24610 7285 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 9927 9505 gene locus_tag LOCUS_24620 9927 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 11063 9924 gene locus_tag LOCUS_24630 11063 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 11236 11469 gene locus_tag LOCUS_24640 11236 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 11447 11866 gene locus_tag LOCUS_24650 11447 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 13527 11857 gene locus_tag LOCUS_24660 13527 11857 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_24660 15266 13563 gene locus_tag LOCUS_24670 15266 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 15548 17080 gene locus_tag LOCUS_24680 15548 17080 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901328.1 protein_id gnl|my_center|LOCUS_24680 17445 17711 gene locus_tag LOCUS_24690 17445 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 19357 17723 gene locus_tag LOCUS_24700 19357 17723 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_24700 20874 19606 gene locus_tag LOCUS_24710 gene kynU 20874 19606 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 protein_id gnl|my_center|LOCUS_24710 21535 20861 gene locus_tag LOCUS_24720 gene upp 21535 20861 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_24720 21870 22526 gene locus_tag LOCUS_24730 21870 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 22559 23476 gene locus_tag LOCUS_24740 22559 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 23557 24267 gene locus_tag LOCUS_24750 23557 24267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 24206 25000 gene locus_tag LOCUS_24760 24206 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 25093 28179 gene locus_tag LOCUS_24770 25093 28179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 28988 28593 gene locus_tag LOCUS_24780 28988 28593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 31006 29066 gene locus_tag LOCUS_24790 gene dnaK 31006 29066 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_24790 32738 31323 gene locus_tag LOCUS_24800 32738 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 34590 32758 gene locus_tag LOCUS_24810 34590 32758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 35085 34624 gene locus_tag LOCUS_24820 35085 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 35215 36027 gene locus_tag LOCUS_24830 35215 36027 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_24830 36193 37272 gene locus_tag LOCUS_24840 36193 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 37287 38465 gene locus_tag LOCUS_24850 gene agxT 37287 38465 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_24850 40465 38441 gene locus_tag LOCUS_24860 40465 38441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_24860 41824 40583 gene locus_tag LOCUS_24870 41824 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 42049 43251 gene locus_tag LOCUS_24880 42049 43251 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_24880 43256 44191 gene locus_tag LOCUS_24890 43256 44191 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_24890 44199 46268 gene locus_tag LOCUS_24900 44199 46268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 46328 48202 gene locus_tag LOCUS_24910 46328 48202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 48774 48199 gene locus_tag LOCUS_24920 48774 48199 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 protein_id gnl|my_center|LOCUS_24920 49965 48799 gene locus_tag LOCUS_24930 49965 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 51953 49962 gene locus_tag LOCUS_24940 51953 49962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 53734 51950 gene locus_tag LOCUS_24950 53734 51950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 54005 55411 gene locus_tag LOCUS_24960 54005 55411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 55615 56646 gene locus_tag LOCUS_24970 55615 56646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 56778 57401 gene locus_tag LOCUS_24980 56778 57401 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_24980 57597 58454 gene locus_tag LOCUS_24990 57597 58454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 59335 58565 gene locus_tag LOCUS_25000 59335 58565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 59921 59328 gene locus_tag LOCUS_25010 59921 59328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 61168 59918 gene locus_tag LOCUS_25020 61168 59918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_25020 62850 61165 gene locus_tag LOCUS_25030 62850 61165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399797.1 protein_id gnl|my_center|LOCUS_25030 64171 62891 gene locus_tag LOCUS_25040 64171 62891 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064557.1 protein_id gnl|my_center|LOCUS_25040 66662 64164 gene locus_tag LOCUS_25050 66662 64164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 66940 68757 gene locus_tag LOCUS_25060 66940 68757 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_25060 68812 69255 gene locus_tag LOCUS_25070 68812 69255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 69302 69454 gene locus_tag LOCUS_25080 69302 69454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 69467 70081 gene locus_tag LOCUS_25090 gene yhdE 69467 70081 CDS product Maf-like protein YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25536 protein_id gnl|my_center|LOCUS_25090 70078 72996 gene locus_tag LOCUS_25100 70078 72996 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5W6 protein_id gnl|my_center|LOCUS_25100 74391 73009 gene locus_tag LOCUS_25110 74391 73009 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLK6 protein_id gnl|my_center|LOCUS_25110 75658 74393 gene locus_tag LOCUS_25120 gene sucB 75658 74393 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_25120 78519 75736 gene locus_tag LOCUS_25130 gene sucA 78519 75736 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_25130 79325 78621 gene locus_tag LOCUS_25140 gene lpxH 79325 78621 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_25140 80424 79345 gene locus_tag LOCUS_25150 80424 79345 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY87 protein_id gnl|my_center|LOCUS_25150 80862 81302 gene locus_tag LOCUS_25160 gene mraZ 80862 81302 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX20 protein_id gnl|my_center|LOCUS_25160 81411 82379 gene locus_tag LOCUS_25170 gene rsmH 81411 82379 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67721 protein_id gnl|my_center|LOCUS_25170 82424 82768 gene locus_tag LOCUS_25180 82424 82768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 82765 84762 gene locus_tag LOCUS_25190 gene ftsI 82765 84762 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_25190 84759 86291 gene locus_tag LOCUS_25200 gene murE 84759 86291 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_25200 86284 87720 gene locus_tag LOCUS_25210 gene murF 86284 87720 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_25210 87720 88805 gene locus_tag LOCUS_25220 gene mraY 87720 88805 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_25220 88825 90264 gene locus_tag LOCUS_25230 gene murD 88825 90264 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_25230 90254 91339 gene locus_tag LOCUS_25240 90254 91339 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_25240 91320 92420 gene locus_tag LOCUS_25250 gene murG 91320 92420 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW01 protein_id gnl|my_center|LOCUS_25250 92413 93852 gene locus_tag LOCUS_25260 gene murC 92413 93852 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_25260 93849 95030 gene locus_tag LOCUS_25270 93849 95030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 95045 96277 gene locus_tag LOCUS_25280 gene ftsA 95045 96277 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_25280 96337 97932 gene locus_tag LOCUS_25290 96337 97932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 100568 98235 gene locus_tag LOCUS_25300 100568 98235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 100716 101858 gene locus_tag LOCUS_25310 100716 101858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 101878 102510 gene locus_tag LOCUS_25320 101878 102510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 102519 103361 gene locus_tag LOCUS_25330 102519 103361 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_25330 103441 104190 gene locus_tag LOCUS_25340 103441 104190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 104183 104887 gene locus_tag LOCUS_25350 104183 104887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 104899 105726 gene locus_tag LOCUS_25360 104899 105726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 107677 105731 gene locus_tag LOCUS_25370 107677 105731 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_25370 107774 109546 gene locus_tag LOCUS_25380 107774 109546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 109777 111495 gene locus_tag LOCUS_25390 109777 111495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 111636 113195 gene locus_tag LOCUS_25400 111636 113195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 113192 113584 gene locus_tag LOCUS_25410 113192 113584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 113581 114309 gene locus_tag LOCUS_25420 113581 114309 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_25420 114395 115642 gene locus_tag LOCUS_25430 114395 115642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 117930 115843 gene locus_tag LOCUS_25440 117930 115843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 118219 117992 gene locus_tag LOCUS_25450 118219 117992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 119399 118278 gene locus_tag LOCUS_25460 119399 118278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 120207 119413 gene locus_tag LOCUS_25470 120207 119413 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_25470 121751 120204 gene locus_tag LOCUS_25480 121751 120204 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_25480 122380 122084 gene locus_tag LOCUS_25490 122380 122084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 123084 122632 gene locus_tag LOCUS_25500 123084 122632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 123467 123102 gene locus_tag LOCUS_25510 gene rplT 123467 123102 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_25510 123793 123602 gene locus_tag LOCUS_25520 123793 123602 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_25520 125806 123872 gene locus_tag LOCUS_25530 gene thrS 125806 123872 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D04 protein_id gnl|my_center|LOCUS_25530 125985 125909 gene locus_tag LOCUS_t00210 125985 125909 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 126068 125992 gene locus_tag LOCUS_t00220 126068 125992 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 126347 127627 gene locus_tag LOCUS_25540 gene ribBA 126347 127627 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_25540 130667 127644 gene locus_tag LOCUS_25550 130667 127644 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_25550 131560 130664 gene locus_tag LOCUS_25560 131560 130664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 132846 131605 gene locus_tag LOCUS_25570 132846 131605 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_25570 133111 138120 gene locus_tag LOCUS_25580 133111 138120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 138142 138561 gene locus_tag LOCUS_25590 138142 138561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 138704 139216 gene locus_tag LOCUS_25600 138704 139216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 139585 140004 gene locus_tag LOCUS_25610 139585 140004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 143626 140030 gene locus_tag LOCUS_25620 143626 140030 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_25620 144879 143623 gene locus_tag LOCUS_25630 gene czcB 144879 143623 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_25630 145188 146105 gene locus_tag LOCUS_25640 145188 146105 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_25640 146593 146177 gene locus_tag LOCUS_25650 146593 146177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 146731 149073 gene locus_tag LOCUS_25660 146731 149073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 149076 149624 gene locus_tag LOCUS_25670 149076 149624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 149621 151138 gene locus_tag LOCUS_25680 149621 151138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence018 1536 607 gene locus_tag LOCUS_25690 1536 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3523 2147 gene locus_tag LOCUS_25700 3523 2147 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_25700 3601 4104 gene locus_tag LOCUS_25710 3601 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4120 4920 gene locus_tag LOCUS_25720 4120 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 5010 6800 gene locus_tag LOCUS_25730 5010 6800 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_25730 6815 7288 gene locus_tag LOCUS_25740 6815 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 7285 7665 gene locus_tag LOCUS_25750 7285 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 7784 9673 gene locus_tag LOCUS_25760 7784 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 9788 11020 gene locus_tag LOCUS_25770 9788 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 11190 11026 gene locus_tag LOCUS_25780 11190 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 11457 12077 gene locus_tag LOCUS_25790 11457 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12080 12481 gene locus_tag LOCUS_25800 12080 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 12580 14715 gene locus_tag LOCUS_25810 12580 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 17172 14734 gene locus_tag LOCUS_25820 17172 14734 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_25820 18310 17198 gene locus_tag LOCUS_25830 18310 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 18456 19661 gene locus_tag LOCUS_25840 18456 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_25840 19664 21571 gene locus_tag LOCUS_25850 gene uup 19664 21571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_25850 22514 21600 gene locus_tag LOCUS_25860 22514 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 23458 22640 gene locus_tag LOCUS_25870 23458 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 24101 23472 gene locus_tag LOCUS_25880 24101 23472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 24730 24113 gene locus_tag LOCUS_25890 24730 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 28164 24784 gene locus_tag LOCUS_25900 28164 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142889.1 protein_id gnl|my_center|LOCUS_25900 28880 28281 gene locus_tag LOCUS_25910 28880 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 34132 29069 gene locus_tag LOCUS_25920 34132 29069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 34374 35234 gene locus_tag LOCUS_25930 34374 35234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 35681 35244 gene locus_tag LOCUS_25940 35681 35244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 35899 35678 gene locus_tag LOCUS_25950 35899 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 37161 35992 gene locus_tag LOCUS_25960 37161 35992 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_25960 37396 37169 gene locus_tag LOCUS_25970 37396 37169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 37739 37443 gene locus_tag LOCUS_25980 37739 37443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 40198 37784 gene locus_tag LOCUS_25990 40198 37784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_25990 38837 38747 gene locus_tag LOCUS_t00230 38837 38747 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40197 40961 gene locus_tag LOCUS_26000 40197 40961 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_26000 41206 42546 gene locus_tag LOCUS_26010 41206 42546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 42566 43795 gene locus_tag LOCUS_26020 42566 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 44945 44070 gene locus_tag LOCUS_26030 gene glpQ 44945 44070 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_26030 46693 44969 gene locus_tag LOCUS_26040 46693 44969 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_26040 48138 46795 gene locus_tag LOCUS_26050 48138 46795 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_26050 49633 48662 gene locus_tag LOCUS_26060 49633 48662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 49976 49611 gene locus_tag LOCUS_26070 49976 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 50296 50622 gene locus_tag LOCUS_26080 50296 50622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 50707 51825 gene locus_tag LOCUS_26090 50707 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 53077 51815 gene locus_tag LOCUS_26100 53077 51815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 54456 53074 gene locus_tag LOCUS_26110 54456 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 55071 54472 gene locus_tag LOCUS_26120 gene tag 55071 54472 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_26120 56627 55110 gene locus_tag LOCUS_26130 56627 55110 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_26130 59013 56704 gene locus_tag LOCUS_26140 59013 56704 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_26140 59307 60047 gene locus_tag LOCUS_26150 59307 60047 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_26150 60051 61565 gene locus_tag LOCUS_26160 gene cusC 60051 61565 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039834.1 protein_id gnl|my_center|LOCUS_26160 61567 62784 gene locus_tag LOCUS_26170 61567 62784 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_26170 62781 66035 gene locus_tag LOCUS_26180 62781 66035 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_26180 68317 66269 gene locus_tag LOCUS_26190 68317 66269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 68640 68443 gene locus_tag LOCUS_26200 gene infA 68640 68443 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_26200 69456 68854 gene locus_tag LOCUS_26210 69456 68854 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947279.1 protein_id gnl|my_center|LOCUS_26210 70021 69449 gene locus_tag LOCUS_26220 70021 69449 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_26220 70437 70036 gene locus_tag LOCUS_26230 70437 70036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 70655 71092 gene locus_tag LOCUS_26240 70655 71092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 72200 71055 gene locus_tag LOCUS_26250 gene mnmA 72200 71055 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_26250 74373 72190 gene locus_tag LOCUS_26260 74373 72190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 76559 74388 gene locus_tag LOCUS_26270 76559 74388 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_26270 76935 77747 gene locus_tag LOCUS_26280 76935 77747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 78741 77935 gene locus_tag LOCUS_26290 78741 77935 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_26290 81254 78744 gene locus_tag LOCUS_26300 81254 78744 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX9 protein_id gnl|my_center|LOCUS_26300 83133 81688 gene locus_tag LOCUS_26310 83133 81688 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_26310 85282 83276 gene locus_tag LOCUS_26320 85282 83276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 86331 85306 gene locus_tag LOCUS_26330 86331 85306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 86550 87824 gene locus_tag LOCUS_26340 86550 87824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 87856 88755 gene locus_tag LOCUS_26350 87856 88755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 90412 88874 gene locus_tag LOCUS_26360 90412 88874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 93420 90574 gene locus_tag LOCUS_26370 93420 90574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 94655 93657 gene locus_tag LOCUS_26380 gene etfA 94655 93657 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_26380 95449 94655 gene locus_tag LOCUS_26390 95449 94655 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_26390 95546 95881 gene locus_tag LOCUS_26400 95546 95881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 95878 96594 gene locus_tag LOCUS_26410 95878 96594 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_26410 96602 97042 gene locus_tag LOCUS_26420 96602 97042 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 protein_id gnl|my_center|LOCUS_26420 97042 97818 gene locus_tag LOCUS_26430 97042 97818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 97836 99230 gene locus_tag LOCUS_26440 gene tolB 97836 99230 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_26440 99425 99982 gene locus_tag LOCUS_26450 99425 99982 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_26450 100165 100863 gene locus_tag LOCUS_26460 100165 100863 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_26460 100971 101237 gene locus_tag LOCUS_26470 gene rpsT 100971 101237 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN07 protein_id gnl|my_center|LOCUS_26470 102005 101451 gene locus_tag LOCUS_26480 102005 101451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 103150 102002 gene locus_tag LOCUS_26490 103150 102002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 103739 103158 gene locus_tag LOCUS_26500 gene nusB 103739 103158 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_26500 104225 103740 gene locus_tag LOCUS_26510 gene ribH 104225 103740 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_26510 104416 104340 gene locus_tag LOCUS_t00240 104416 104340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 104952 104509 gene locus_tag LOCUS_26520 104952 104509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 105287 104961 gene locus_tag LOCUS_26530 gene ihfA 105287 104961 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_26530 106743 105451 gene locus_tag LOCUS_26540 gene der 106743 105451 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_26540 107292 106774 gene locus_tag LOCUS_26550 107292 106774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 107509 107595 gene locus_tag LOCUS_t00250 107509 107595 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108005 107598 gene locus_tag LOCUS_26560 108005 107598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 108304 108011 gene locus_tag LOCUS_26570 108304 108011 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 protein_id gnl|my_center|LOCUS_26570 108400 109014 gene locus_tag LOCUS_26580 gene rex 108400 109014 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB43 protein_id gnl|my_center|LOCUS_26580 109427 111655 gene locus_tag LOCUS_26590 109427 111655 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_26590 111810 113339 gene locus_tag LOCUS_26600 111810 113339 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_26600 113692 113970 gene locus_tag LOCUS_26610 113692 113970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 114772 113975 gene locus_tag LOCUS_26620 gene trpA 114772 113975 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_26620 116094 114769 gene locus_tag LOCUS_26630 gene trpB 116094 114769 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI9 protein_id gnl|my_center|LOCUS_26630 116752 116066 gene locus_tag LOCUS_26640 gene trpF 116752 116066 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_26640 117553 116756 gene locus_tag LOCUS_26650 gene trpC 117553 116756 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_26650 118811 117582 gene locus_tag LOCUS_26660 118811 117582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 119565 118891 gene locus_tag LOCUS_26670 119565 118891 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_26670 120304 119588 gene locus_tag LOCUS_26680 120304 119588 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_26680 121542 120472 gene locus_tag LOCUS_26690 gene modC 121542 120472 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_26690 122231 121539 gene locus_tag LOCUS_26700 gene modB 122231 121539 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_26700 122934 122224 gene locus_tag LOCUS_26710 gene modA 122934 122224 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_26710 123940 123008 gene locus_tag LOCUS_26720 123940 123008 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_26720 125303 124263 gene locus_tag LOCUS_26730 125303 124263 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_26730 125357 125919 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcacggggggcgac 127037 126033 gene locus_tag LOCUS_26740 127037 126033 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_26740 127100 128695 gene locus_tag LOCUS_26750 127100 128695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_26750 128710 131061 gene locus_tag LOCUS_26760 128710 131061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 131816 131067 gene locus_tag LOCUS_26770 131816 131067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 131948 135715 gene locus_tag LOCUS_26780 131948 135715 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_26780 136127 135750 gene locus_tag LOCUS_26790 gene rplQ 136127 135750 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_26790 137151 136159 gene locus_tag LOCUS_26800 gene rpoA 137151 136159 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_26800 137698 137222 gene locus_tag LOCUS_26810 gene rpsD 137698 137222 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS5 protein_id gnl|my_center|LOCUS_26810 138403 138005 gene locus_tag LOCUS_26820 gene rpsK 138403 138005 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72403 protein_id gnl|my_center|LOCUS_26820 138875 138495 gene locus_tag LOCUS_26830 gene rpsM 138875 138495 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_26830 139614 139051 gene locus_tag LOCUS_26840 gene adk 139614 139051 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD4 protein_id gnl|my_center|LOCUS_26840 140983 139601 gene locus_tag LOCUS_26850 gene secY 140983 139601 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_26850 141417 140983 gene locus_tag LOCUS_26860 gene rplO 141417 140983 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19946 protein_id gnl|my_center|LOCUS_26860 141611 141414 gene locus_tag LOCUS_26870 gene rpmD 141611 141414 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CFT2 protein_id gnl|my_center|LOCUS_26870 142239 141748 gene locus_tag LOCUS_26880 gene rpsE 142239 141748 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_26880 142644 142258 gene locus_tag LOCUS_26890 gene rplR 142644 142258 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E9 protein_id gnl|my_center|LOCUS_26890 143270 142731 gene locus_tag LOCUS_26900 gene rplF 143270 142731 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_26900 143709 143311 gene locus_tag LOCUS_26910 gene rpsH 143709 143311 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HB77 protein_id gnl|my_center|LOCUS_26910 143913 143728 gene locus_tag LOCUS_26920 gene rpsZ 143913 143728 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E6 protein_id gnl|my_center|LOCUS_26920 144524 143961 gene locus_tag LOCUS_26930 gene rplE 144524 143961 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG8 protein_id gnl|my_center|LOCUS_26930 144870 144544 gene locus_tag LOCUS_26940 gene rplX 144870 144544 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_26940 145256 144888 gene locus_tag LOCUS_26950 gene rplN 145256 144888 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W5 protein_id gnl|my_center|LOCUS_26950 145549 145268 gene locus_tag LOCUS_26960 145549 145268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 145754 145542 gene locus_tag LOCUS_26970 gene rpmC 145754 145542 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C9 protein_id gnl|my_center|LOCUS_26970 146185 145766 gene locus_tag LOCUS_26980 gene rplP 146185 145766 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14577 protein_id gnl|my_center|LOCUS_26980 146851 146204 gene locus_tag LOCUS_26990 gene rpsC 146851 146204 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_26990 147216 146863 gene locus_tag LOCUS_27000 gene rplV 147216 146863 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PY5 protein_id gnl|my_center|LOCUS_27000 147514 147233 gene locus_tag LOCUS_27010 gene rpsS 147514 147233 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_27010 148360 147527 gene locus_tag LOCUS_27020 gene rplB 148360 147527 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_27020 148686 148396 gene locus_tag LOCUS_27030 gene rplW 148686 148396 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_27030 149306 148683 gene locus_tag LOCUS_27040 gene rplD 149306 148683 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J41 protein_id gnl|my_center|LOCUS_27040 149952 149323 gene locus_tag LOCUS_27050 gene rplC 149952 149323 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60454 protein_id gnl|my_center|LOCUS_27050 150298 149990 gene locus_tag LOCUS_27060 gene rpsJ 150298 149990 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J83 protein_id gnl|my_center|LOCUS_27060 >Feature sequence019 176 931 gene locus_tag LOCUS_27070 176 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1071 1709 gene locus_tag LOCUS_27080 1071 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2914 1700 gene locus_tag LOCUS_27090 2914 1700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_27090 5058 2923 gene locus_tag LOCUS_27100 5058 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5956 5132 gene locus_tag LOCUS_27110 gene apaH 5956 5132 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_27110 7157 5961 gene locus_tag LOCUS_27120 7157 5961 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_27120 7467 7180 gene locus_tag LOCUS_27130 7467 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 7598 8914 gene locus_tag LOCUS_27140 7598 8914 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_27140 8929 9219 gene locus_tag LOCUS_27150 8929 9219 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142322.1 protein_id gnl|my_center|LOCUS_27150 9216 10160 gene locus_tag LOCUS_27160 gene pyrF 9216 10160 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_27160 10173 12587 gene locus_tag LOCUS_27170 10173 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_27170 12735 13574 gene locus_tag LOCUS_27180 12735 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 13586 14941 gene locus_tag LOCUS_27190 gene ndh 13586 14941 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_27190 15286 14978 gene locus_tag LOCUS_27200 15286 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 17085 15325 gene locus_tag LOCUS_27210 17085 15325 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_27210 17619 17116 gene locus_tag LOCUS_27220 17619 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 18405 17662 gene locus_tag LOCUS_27230 18405 17662 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_27230 19173 18409 gene locus_tag LOCUS_27240 19173 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 19342 19267 gene locus_tag LOCUS_t00260 19342 19267 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21447 19420 gene locus_tag LOCUS_27250 21447 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 21821 22666 gene locus_tag LOCUS_27260 21821 22666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 22840 23172 gene locus_tag LOCUS_27270 22840 23172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 23309 25738 gene locus_tag LOCUS_27280 gene mutS2 23309 25738 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FQ9 protein_id gnl|my_center|LOCUS_27280 25751 27535 gene locus_tag LOCUS_27290 gene dnaG 25751 27535 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAL5 protein_id gnl|my_center|LOCUS_27290 27602 29305 gene locus_tag LOCUS_27300 gene rpoD 27602 29305 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_27300 29697 32660 gene locus_tag LOCUS_27310 29697 32660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 32778 33992 gene locus_tag LOCUS_27320 32778 33992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_27320 34062 35180 gene locus_tag LOCUS_27330 34062 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 35177 36193 gene locus_tag LOCUS_27340 35177 36193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_27340 36696 36271 gene locus_tag LOCUS_27350 36696 36271 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228709.1 protein_id gnl|my_center|LOCUS_27350 37320 36715 gene locus_tag LOCUS_27360 gene drga 37320 36715 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_27360 38805 37462 gene locus_tag LOCUS_27370 38805 37462 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_27370 39098 39697 gene locus_tag LOCUS_27380 39098 39697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 39719 40825 gene locus_tag LOCUS_27390 39719 40825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 40859 42082 gene locus_tag LOCUS_27400 40859 42082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 42070 42453 gene locus_tag LOCUS_27410 42070 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 42434 43036 gene locus_tag LOCUS_27420 42434 43036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 43052 44383 gene locus_tag LOCUS_27430 43052 44383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 44432 44656 gene locus_tag LOCUS_27440 44432 44656 CDS product addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_27440 44653 45042 gene locus_tag LOCUS_27450 44653 45042 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_27450 45057 45428 gene locus_tag LOCUS_27460 45057 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 45445 46464 gene locus_tag LOCUS_27470 gene ltaE 45445 46464 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_27470 46505 46831 gene locus_tag LOCUS_27480 46505 46831 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205297.1 protein_id gnl|my_center|LOCUS_27480 46824 47150 gene locus_tag LOCUS_27490 46824 47150 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_27490 48555 47197 gene locus_tag LOCUS_27500 48555 47197 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_27500 50186 48552 gene locus_tag LOCUS_27510 50186 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 50354 51385 gene locus_tag LOCUS_27520 50354 51385 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU2 protein_id gnl|my_center|LOCUS_27520 51382 52587 gene locus_tag LOCUS_27530 gene pgk 51382 52587 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_27530 52584 53378 gene locus_tag LOCUS_27540 gene tpiA 52584 53378 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 protein_id gnl|my_center|LOCUS_27540 53517 54014 gene locus_tag LOCUS_27550 53517 54014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 54134 54220 gene locus_tag LOCUS_t00270 54134 54220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54260 55882 gene locus_tag LOCUS_27560 54260 55882 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_27560 55918 56796 gene locus_tag LOCUS_27570 gene prmC 55918 56796 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W022 protein_id gnl|my_center|LOCUS_27570 56920 57918 gene locus_tag LOCUS_27580 56920 57918 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_27580 58047 60035 gene locus_tag LOCUS_27590 58047 60035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 60084 60851 gene locus_tag LOCUS_27600 60084 60851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 61573 60848 gene locus_tag LOCUS_27610 61573 60848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE57 protein_id gnl|my_center|LOCUS_27610 61826 61584 gene locus_tag LOCUS_27620 61826 61584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 63555 61843 gene locus_tag LOCUS_27630 63555 61843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 64397 63561 gene locus_tag LOCUS_27640 64397 63561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 65075 64518 gene locus_tag LOCUS_27650 65075 64518 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_27650 66880 65273 gene locus_tag LOCUS_27660 66880 65273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 67801 67115 gene locus_tag LOCUS_27670 67801 67115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 68933 67887 gene locus_tag LOCUS_27680 gene manC 68933 67887 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_27680 69045 69917 gene locus_tag LOCUS_27690 69045 69917 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_27690 71241 69922 gene locus_tag LOCUS_27700 71241 69922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 71292 72419 gene locus_tag LOCUS_27710 71292 72419 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_27710 73201 72506 gene locus_tag LOCUS_27720 73201 72506 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_27720 73735 73367 gene locus_tag LOCUS_27730 73735 73367 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ7 protein_id gnl|my_center|LOCUS_27730 75161 73746 gene locus_tag LOCUS_27740 gene mpl 75161 73746 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_27740 75591 76610 gene locus_tag LOCUS_27750 75591 76610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 76823 78094 gene locus_tag LOCUS_27760 76823 78094 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_27760 78393 78848 gene locus_tag LOCUS_27770 78393 78848 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_27770 78915 80357 gene locus_tag LOCUS_27780 gene ycf24 78915 80357 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_27780 80476 81252 gene locus_tag LOCUS_27790 80476 81252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_27790 81262 82590 gene locus_tag LOCUS_27800 81262 82590 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_27800 82609 83901 gene locus_tag LOCUS_27810 82609 83901 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_27810 83894 84346 gene locus_tag LOCUS_27820 83894 84346 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_27820 84376 84723 gene locus_tag LOCUS_27830 84376 84723 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946343.1 protein_id gnl|my_center|LOCUS_27830 84744 85430 gene locus_tag LOCUS_27840 84744 85430 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_27840 85427 85759 gene locus_tag LOCUS_27850 85427 85759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 87174 85873 gene locus_tag LOCUS_27860 87174 85873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 89773 87401 gene locus_tag LOCUS_27870 89773 87401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 91056 90070 gene locus_tag LOCUS_27880 91056 90070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 91437 91069 gene locus_tag LOCUS_27890 91437 91069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 91572 92153 gene locus_tag LOCUS_27900 91572 92153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 92199 93200 gene locus_tag LOCUS_27910 92199 93200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 94759 93239 gene locus_tag LOCUS_27920 94759 93239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 94909 96834 gene locus_tag LOCUS_27930 94909 96834 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_27930 96834 97532 gene locus_tag LOCUS_27940 96834 97532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 97903 97451 gene locus_tag LOCUS_27950 97903 97451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 97802 99364 gene locus_tag LOCUS_27960 97802 99364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 99389 99616 gene locus_tag LOCUS_27970 99389 99616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 99799 101994 gene locus_tag LOCUS_27980 99799 101994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 102208 103731 gene locus_tag LOCUS_27990 102208 103731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 103843 104409 gene locus_tag LOCUS_28000 103843 104409 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_28000 106380 104479 gene locus_tag LOCUS_28010 106380 104479 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_28010 107180 106377 gene locus_tag LOCUS_28020 107180 106377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_28020 107713 107177 gene locus_tag LOCUS_28030 107713 107177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 108717 107740 gene locus_tag LOCUS_28040 108717 107740 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_28040 108909 110822 gene locus_tag LOCUS_28050 gene speA 108909 110822 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_28050 110885 113668 gene locus_tag LOCUS_28060 110885 113668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 113682 114653 gene locus_tag LOCUS_28070 113682 114653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 114754 115008 gene locus_tag LOCUS_28080 114754 115008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 115036 116409 gene locus_tag LOCUS_28090 115036 116409 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_28090 116907 118079 gene locus_tag LOCUS_28100 116907 118079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28100 118076 118432 gene locus_tag LOCUS_28110 118076 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 118487 119692 gene locus_tag LOCUS_28120 118487 119692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 119705 120748 gene locus_tag LOCUS_28130 119705 120748 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_28130 120762 121901 gene locus_tag LOCUS_28140 120762 121901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388256.1 protein_id gnl|my_center|LOCUS_28140 121898 123571 gene locus_tag LOCUS_28150 121898 123571 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_28150 123568 124809 gene locus_tag LOCUS_28160 123568 124809 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_28160 125283 124834 gene locus_tag LOCUS_28170 125283 124834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 125918 125280 gene locus_tag LOCUS_28180 125918 125280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 126248 126033 gene locus_tag LOCUS_28190 126248 126033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 126619 126314 gene locus_tag LOCUS_28200 126619 126314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 127664 126582 gene locus_tag LOCUS_28210 127664 126582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 128136 127756 gene locus_tag LOCUS_28220 128136 127756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_28220 128431 128216 gene locus_tag LOCUS_28230 128431 128216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 128712 128515 gene locus_tag LOCUS_28240 128712 128515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 129745 128975 gene locus_tag LOCUS_28250 129745 128975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 131555 130041 gene locus_tag LOCUS_28260 131555 130041 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_28260 132780 131569 gene locus_tag LOCUS_28270 132780 131569 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_28270 134512 132842 gene locus_tag LOCUS_28280 134512 132842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 134545 134991 gene locus_tag LOCUS_28290 134545 134991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 135027 135977 gene locus_tag LOCUS_28300 gene metF 135027 135977 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_28300 135949 137424 gene locus_tag LOCUS_28310 135949 137424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 137522 140854 gene locus_tag LOCUS_28320 137522 140854 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_28320 141396 140920 gene locus_tag LOCUS_28330 gene vapC 141396 140920 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_28330 141565 141308 gene locus_tag LOCUS_28340 141565 141308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 141844 142932 gene locus_tag LOCUS_28350 gene hppD 141844 142932 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_28350 142945 144099 gene locus_tag LOCUS_28360 142945 144099 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_28360 144117 145619 gene locus_tag LOCUS_28370 144117 145619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 145655 147463 gene locus_tag LOCUS_28380 145655 147463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 148414 147485 gene locus_tag LOCUS_28390 gene thrB 148414 147485 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_28390 148564 150174 gene locus_tag LOCUS_28400 148564 150174 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence020 4232 318 gene locus_tag LOCUS_28410 4232 318 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_28410 4400 5782 gene locus_tag LOCUS_28420 4400 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 6559 6041 gene locus_tag LOCUS_28430 6559 6041 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807810.1 protein_id gnl|my_center|LOCUS_28430 6937 7539 gene locus_tag LOCUS_28440 6937 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_28440 7551 10007 gene locus_tag LOCUS_28450 7551 10007 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_28450 10351 10662 gene locus_tag LOCUS_28460 10351 10662 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388820.1 protein_id gnl|my_center|LOCUS_28460 12821 10692 gene locus_tag LOCUS_28470 12821 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 12940 14484 gene locus_tag LOCUS_28480 12940 14484 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122586.1 protein_id gnl|my_center|LOCUS_28480 15589 14504 gene locus_tag LOCUS_28490 gene leuB 15589 14504 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIE1 protein_id gnl|my_center|LOCUS_28490 16212 15586 gene locus_tag LOCUS_28500 gene leuD 16212 15586 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_28500 17642 16212 gene locus_tag LOCUS_28510 gene leuC 17642 16212 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_28510 18912 17656 gene locus_tag LOCUS_28520 18912 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 19952 18990 gene locus_tag LOCUS_28530 19952 18990 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_28530 21109 20396 gene locus_tag LOCUS_28540 21109 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 21490 21131 gene locus_tag LOCUS_28550 21490 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 24423 21511 gene locus_tag LOCUS_28560 24423 21511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 27287 24420 gene locus_tag LOCUS_28570 27287 24420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 27707 29437 gene locus_tag LOCUS_28580 27707 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 29457 33569 gene locus_tag LOCUS_28590 29457 33569 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_28590 34906 33581 gene locus_tag LOCUS_28600 34906 33581 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_28600 35306 36052 gene locus_tag LOCUS_28610 35306 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 36045 37568 gene locus_tag LOCUS_28620 gene merA 36045 37568 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_28620 38637 37855 gene locus_tag LOCUS_28630 38637 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404735.1 protein_id gnl|my_center|LOCUS_28630 39211 38759 gene locus_tag LOCUS_28640 39211 38759 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_28640 40631 39252 gene locus_tag LOCUS_28650 gene sdaA 40631 39252 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_28650 41415 40729 gene locus_tag LOCUS_28660 41415 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 42187 41390 gene locus_tag LOCUS_28670 gene coaX 42187 41390 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_28670 42975 42184 gene locus_tag LOCUS_28680 42975 42184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 44072 43005 gene locus_tag LOCUS_28690 44072 43005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 47620 44261 gene locus_tag LOCUS_28700 gene icmF 47620 44261 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_28700 49279 47762 gene locus_tag LOCUS_28710 49279 47762 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046961.1 protein_id gnl|my_center|LOCUS_28710 50830 52176 gene locus_tag LOCUS_28720 50830 52176 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403936.1 protein_id gnl|my_center|LOCUS_28720 52176 55313 gene locus_tag LOCUS_28730 52176 55313 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_28730 55869 55333 gene locus_tag LOCUS_28740 55869 55333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 56275 56018 gene locus_tag LOCUS_28750 56275 56018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 58031 56358 gene locus_tag LOCUS_28760 58031 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 59163 58105 gene locus_tag LOCUS_28770 59163 58105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 59440 61335 gene locus_tag LOCUS_28780 59440 61335 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_28780 61835 61554 gene locus_tag LOCUS_28790 61835 61554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 61845 63158 gene locus_tag LOCUS_28800 61845 63158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 63181 65445 gene locus_tag LOCUS_28810 63181 65445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 65442 67136 gene locus_tag LOCUS_28820 65442 67136 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_28820 67129 67968 gene locus_tag LOCUS_28830 67129 67968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 68118 69677 gene locus_tag LOCUS_28840 68118 69677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 69688 70785 gene locus_tag LOCUS_28850 69688 70785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 70782 73055 gene locus_tag LOCUS_28860 70782 73055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 73052 74533 gene locus_tag LOCUS_28870 73052 74533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 74771 74505 gene locus_tag LOCUS_28880 74771 74505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 75492 74899 gene locus_tag LOCUS_28890 75492 74899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_28890 75695 75477 gene locus_tag LOCUS_28900 75695 75477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 75796 76002 gene locus_tag LOCUS_28910 75796 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 76083 76424 gene locus_tag LOCUS_28920 76083 76424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 76763 77551 gene locus_tag LOCUS_28930 76763 77551 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_28930 77554 79461 gene locus_tag LOCUS_28940 gene sdhA 77554 79461 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_28940 79461 80207 gene locus_tag LOCUS_28950 79461 80207 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_28950 84049 80405 gene locus_tag LOCUS_28960 84049 80405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 84366 84893 gene locus_tag LOCUS_28970 84366 84893 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_28970 84927 86318 gene locus_tag LOCUS_28980 gene mgtE 84927 86318 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34442 protein_id gnl|my_center|LOCUS_28980 86335 87081 gene locus_tag LOCUS_28990 86335 87081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 87169 88164 gene locus_tag LOCUS_29000 gene glyQ 87169 88164 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5K3 protein_id gnl|my_center|LOCUS_29000 88161 90236 gene locus_tag LOCUS_29010 gene glyS 88161 90236 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKV5 protein_id gnl|my_center|LOCUS_29010 91479 90238 gene locus_tag LOCUS_29020 91479 90238 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_29020 92890 91484 gene locus_tag LOCUS_29030 92890 91484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921106.1 protein_id gnl|my_center|LOCUS_29030 92967 93557 gene locus_tag LOCUS_29040 92967 93557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 95458 93542 gene locus_tag LOCUS_29050 95458 93542 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269325.1 protein_id gnl|my_center|LOCUS_29050 96576 95470 gene locus_tag LOCUS_29060 96576 95470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 98862 96721 gene locus_tag LOCUS_29070 gene ymxG 98862 96721 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_29070 100448 98904 gene locus_tag LOCUS_29080 100448 98904 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403996.1 protein_id gnl|my_center|LOCUS_29080 101567 100647 gene locus_tag LOCUS_29090 101567 100647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 103077 101575 gene locus_tag LOCUS_29100 103077 101575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 104481 103198 gene locus_tag LOCUS_29110 104481 103198 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123082.1 protein_id gnl|my_center|LOCUS_29110 106402 104549 gene locus_tag LOCUS_29120 106402 104549 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_29120 106938 106399 gene locus_tag LOCUS_29130 106938 106399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 108719 106935 gene locus_tag LOCUS_29140 108719 106935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 109408 108731 gene locus_tag LOCUS_29150 109408 108731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 111250 109421 gene locus_tag LOCUS_29160 111250 109421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 112817 111255 gene locus_tag LOCUS_29170 gene crtH 112817 111255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_29170 114031 112814 gene locus_tag LOCUS_29180 114031 112814 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_29180 115263 114028 gene locus_tag LOCUS_29190 115263 114028 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_29190 116486 115263 gene locus_tag LOCUS_29200 gene fabF 116486 115263 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_29200 116839 116555 gene locus_tag LOCUS_29210 116839 116555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 123081 116974 gene locus_tag LOCUS_29220 123081 116974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 123212 125455 gene locus_tag LOCUS_29230 123212 125455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_29230 126140 125460 gene locus_tag LOCUS_29240 gene msrA 126140 125460 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_29240 126257 126880 gene locus_tag LOCUS_29250 126257 126880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 128737 127217 gene locus_tag LOCUS_29260 128737 127217 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_29260 128864 131023 gene locus_tag LOCUS_29270 128864 131023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 131986 130982 gene locus_tag LOCUS_29280 131986 130982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 132477 132214 gene locus_tag LOCUS_29290 132477 132214 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_29290 133901 132630 gene locus_tag LOCUS_29300 gene hemL 133901 132630 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU97 protein_id gnl|my_center|LOCUS_29300 134884 133898 gene locus_tag LOCUS_29310 gene hemB 134884 133898 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW7 protein_id gnl|my_center|LOCUS_29310 135035 138166 gene locus_tag LOCUS_29320 135035 138166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 138841 138167 gene locus_tag LOCUS_29330 138841 138167 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_29330 139059 138856 gene locus_tag LOCUS_29340 139059 138856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 140574 139285 gene locus_tag LOCUS_29350 140574 139285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 141108 142262 gene locus_tag LOCUS_29360 141108 142262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 142384 144720 gene locus_tag LOCUS_29370 142384 144720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 146428 144728 gene locus_tag LOCUS_29380 146428 144728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 146557 147048 gene locus_tag LOCUS_29390 146557 147048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 147045 147926 gene locus_tag LOCUS_29400 gene tatC 147045 147926 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKH3 protein_id gnl|my_center|LOCUS_29400 >Feature sequence021 2971 143 gene locus_tag LOCUS_29410 2971 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_29410 3444 2932 gene locus_tag LOCUS_29420 3444 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 4271 3522 gene locus_tag LOCUS_29430 4271 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 4792 4241 gene locus_tag LOCUS_29440 4792 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 5093 5974 gene locus_tag LOCUS_29450 5093 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 6978 6292 gene locus_tag LOCUS_29460 6978 6292 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_29460 9366 7027 gene locus_tag LOCUS_29470 9366 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 9253 9615 gene locus_tag LOCUS_29480 9253 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 9767 10354 gene locus_tag LOCUS_29490 9767 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 10745 10473 gene locus_tag LOCUS_29500 10745 10473 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_29500 12841 10991 gene locus_tag LOCUS_29510 12841 10991 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_29510 13340 14161 gene locus_tag LOCUS_29520 13340 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 14729 14190 gene locus_tag LOCUS_29530 14729 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 14944 15894 gene locus_tag LOCUS_29540 14944 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 16094 17260 gene locus_tag LOCUS_29550 gene czcB 16094 17260 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_29550 17414 20860 gene locus_tag LOCUS_29560 gene acrD 17414 20860 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_29560 21186 20857 gene locus_tag LOCUS_29570 21186 20857 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_29570 21635 21183 gene locus_tag LOCUS_29580 21635 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 22081 21632 gene locus_tag LOCUS_29590 22081 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 22838 22083 gene locus_tag LOCUS_29600 22838 22083 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_29600 23704 22835 gene locus_tag LOCUS_29610 23704 22835 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_29610 24729 23734 gene locus_tag LOCUS_29620 24729 23734 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_29620 27657 24790 gene locus_tag LOCUS_29630 gene nrdA 27657 24790 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D561 protein_id gnl|my_center|LOCUS_29630 28179 29081 gene locus_tag LOCUS_29640 28179 29081 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_29640 29509 29063 gene locus_tag LOCUS_29650 29509 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 29904 29506 gene locus_tag LOCUS_29660 29904 29506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 30698 30006 gene locus_tag LOCUS_29670 30698 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 32333 30732 gene locus_tag LOCUS_29680 gene hflX 32333 30732 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_29680 34532 32424 gene locus_tag LOCUS_29690 34532 32424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z840 protein_id gnl|my_center|LOCUS_29690 35215 34529 gene locus_tag LOCUS_29700 35215 34529 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709673.1 protein_id gnl|my_center|LOCUS_29700 36100 35255 gene locus_tag LOCUS_29710 36100 35255 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383303.1 protein_id gnl|my_center|LOCUS_29710 36255 37826 gene locus_tag LOCUS_29720 36255 37826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 37819 39384 gene locus_tag LOCUS_29730 37819 39384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 39422 39730 gene locus_tag LOCUS_29740 gene ndoA 39422 39730 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_29740 39727 40329 gene locus_tag LOCUS_29750 39727 40329 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_29750 40326 40574 gene locus_tag LOCUS_29760 40326 40574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 41771 40950 gene locus_tag LOCUS_29770 41771 40950 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_29770 42583 41807 gene locus_tag LOCUS_29780 42583 41807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 42911 43846 gene locus_tag LOCUS_29790 gene hemF 42911 43846 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4U8 protein_id gnl|my_center|LOCUS_29790 43915 45852 gene locus_tag LOCUS_29800 43915 45852 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_29800 45866 47026 gene locus_tag LOCUS_29810 45866 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_29810 48109 47000 gene locus_tag LOCUS_29820 48109 47000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 49862 48099 gene locus_tag LOCUS_29830 49862 48099 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_29830 50414 50070 gene locus_tag LOCUS_29840 50414 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 50554 51123 gene locus_tag LOCUS_29850 50554 51123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 51350 51015 gene locus_tag LOCUS_29860 51350 51015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 52658 51423 gene locus_tag LOCUS_29870 52658 51423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 54876 52708 gene locus_tag LOCUS_29880 gene rlmL 54876 52708 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_29880 56270 54873 gene locus_tag LOCUS_29890 56270 54873 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635937.2 protein_id gnl|my_center|LOCUS_29890 57288 56290 gene locus_tag LOCUS_29900 57288 56290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_29900 59115 57355 gene locus_tag LOCUS_29910 59115 57355 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_29910 59589 59251 gene locus_tag LOCUS_29920 59589 59251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 59743 60849 gene locus_tag LOCUS_29930 59743 60849 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_29930 60892 62262 gene locus_tag LOCUS_29940 60892 62262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_29940 63471 62248 gene locus_tag LOCUS_29950 63471 62248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_29950 64414 63566 gene locus_tag LOCUS_29960 64414 63566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 65960 64584 gene locus_tag LOCUS_29970 65960 64584 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_29970 67355 65973 gene locus_tag LOCUS_29980 67355 65973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 67579 68226 gene locus_tag LOCUS_29990 gene dck 67579 68226 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_29990 68484 69410 gene locus_tag LOCUS_30000 gene panB 68484 69410 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_30000 69403 70269 gene locus_tag LOCUS_30010 gene panC 69403 70269 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_30010 70299 70703 gene locus_tag LOCUS_30020 gene panD 70299 70703 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBZ3 protein_id gnl|my_center|LOCUS_30020 70757 77686 gene locus_tag LOCUS_30030 70757 77686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 77750 80344 gene locus_tag LOCUS_30040 77750 80344 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_30040 80689 80889 gene locus_tag LOCUS_30050 80689 80889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 80908 82092 gene locus_tag LOCUS_30060 80908 82092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 83756 82080 gene locus_tag LOCUS_30070 83756 82080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 86515 83807 gene locus_tag LOCUS_30080 86515 83807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 86665 87252 gene locus_tag LOCUS_30090 86665 87252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 87259 90321 gene locus_tag LOCUS_30100 87259 90321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 90318 91964 gene locus_tag LOCUS_30110 90318 91964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 93926 92217 gene locus_tag LOCUS_30120 93926 92217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 96016 93923 gene locus_tag LOCUS_30130 96016 93923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 97156 96290 gene locus_tag LOCUS_30140 97156 96290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 97395 99197 gene locus_tag LOCUS_30150 97395 99197 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_30150 99563 101158 gene locus_tag LOCUS_30160 99563 101158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 103413 101113 gene locus_tag LOCUS_30170 103413 101113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 103907 103413 gene locus_tag LOCUS_30180 103907 103413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 106895 104202 gene locus_tag LOCUS_30190 106895 104202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 107063 109495 gene locus_tag LOCUS_30200 107063 109495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 109492 111243 gene locus_tag LOCUS_30210 109492 111243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 112849 111275 gene locus_tag LOCUS_30220 112849 111275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 113311 115956 gene locus_tag LOCUS_30230 113311 115956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 116439 118994 gene locus_tag LOCUS_30240 116439 118994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 119008 120045 gene locus_tag LOCUS_30250 gene fmt 119008 120045 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_30250 120065 121504 gene locus_tag LOCUS_30260 gene rsmB 120065 121504 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_30260 121741 122022 gene locus_tag LOCUS_30270 gene hupB 121741 122022 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_30270 123084 122413 gene locus_tag LOCUS_30280 123084 122413 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_30280 123118 123627 gene locus_tag LOCUS_30290 gene moaC 123118 123627 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_30290 123624 124826 gene locus_tag LOCUS_30300 123624 124826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_30300 124875 125363 gene locus_tag LOCUS_30310 124875 125363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 125356 126432 gene locus_tag LOCUS_30320 125356 126432 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_30320 126507 128087 gene locus_tag LOCUS_30330 gene serA 126507 128087 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_30330 128243 129331 gene locus_tag LOCUS_30340 gene ddl 128243 129331 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ7 protein_id gnl|my_center|LOCUS_30340 129347 130237 gene locus_tag LOCUS_30350 129347 130237 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_30350 131794 130322 gene locus_tag LOCUS_30360 gene guaB 131794 130322 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEU7 protein_id gnl|my_center|LOCUS_30360 131978 132544 gene locus_tag LOCUS_30370 gene algU 131978 132544 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_30370 132598 133332 gene locus_tag LOCUS_30380 132598 133332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 133392 136757 gene locus_tag LOCUS_30390 133392 136757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 137097 136816 gene locus_tag LOCUS_30400 137097 136816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 142206 137116 gene locus_tag LOCUS_30410 142206 137116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 142442 143362 gene locus_tag LOCUS_30420 142442 143362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence022 1002 5477 gene locus_tag LOCUS_30430 1002 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 6761 5478 gene locus_tag LOCUS_30440 6761 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 11194 6851 gene locus_tag LOCUS_30450 11194 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 11661 19091 gene locus_tag LOCUS_30460 11661 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 19088 19726 gene locus_tag LOCUS_30470 19088 19726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 23749 19757 gene locus_tag LOCUS_30480 23749 19757 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_30480 24189 24114 gene locus_tag LOCUS_t00280 24189 24114 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25569 24253 gene locus_tag LOCUS_30490 25569 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 25701 26105 gene locus_tag LOCUS_30500 25701 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 26231 26500 gene locus_tag LOCUS_30510 26231 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 26529 27380 gene locus_tag LOCUS_30520 gene cpdA 26529 27380 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_30520 27398 29845 gene locus_tag LOCUS_30530 27398 29845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 29854 31140 gene locus_tag LOCUS_30540 29854 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 31137 32387 gene locus_tag LOCUS_30550 31137 32387 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090217.1 protein_id gnl|my_center|LOCUS_30550 32523 33149 gene locus_tag LOCUS_30560 32523 33149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 33149 35836 gene locus_tag LOCUS_30570 33149 35836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 37032 35743 gene locus_tag LOCUS_30580 gene hutI 37032 35743 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_30580 38435 37029 gene locus_tag LOCUS_30590 gene cca 38435 37029 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_30590 40650 38467 gene locus_tag LOCUS_30600 40650 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 41874 40831 gene locus_tag LOCUS_30610 41874 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 42563 41871 gene locus_tag LOCUS_30620 42563 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 44332 42851 gene locus_tag LOCUS_30630 44332 42851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_30630 45195 44422 gene locus_tag LOCUS_30640 45195 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 46620 45235 gene locus_tag LOCUS_30650 gene cyp135B1 46620 45235 CDS product putative cytochrome P450 135B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPM9 protein_id gnl|my_center|LOCUS_30650 48319 47987 gene locus_tag LOCUS_30660 48319 47987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 48341 52348 gene locus_tag LOCUS_30670 48341 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 53077 52238 gene locus_tag LOCUS_30680 53077 52238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 53219 53995 gene locus_tag LOCUS_30690 53219 53995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 54613 54032 gene locus_tag LOCUS_30700 54613 54032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 55814 54672 gene locus_tag LOCUS_30710 55814 54672 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_30710 55974 57134 gene locus_tag LOCUS_30720 55974 57134 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW7 protein_id gnl|my_center|LOCUS_30720 57151 58638 gene locus_tag LOCUS_30730 57151 58638 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_30730 58685 60517 gene locus_tag LOCUS_30740 58685 60517 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_30740 60756 61673 gene locus_tag LOCUS_30750 60756 61673 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_30750 63361 61694 gene locus_tag LOCUS_30760 63361 61694 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_30760 65854 63467 gene locus_tag LOCUS_30770 65854 63467 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_30770 66124 69249 gene locus_tag LOCUS_30780 66124 69249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 69487 69314 gene locus_tag LOCUS_30790 69487 69314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 70278 69496 gene locus_tag LOCUS_30800 gene dhrS4 70278 69496 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_30800 71204 70275 gene locus_tag LOCUS_30810 71204 70275 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_30810 71679 71218 gene locus_tag LOCUS_30820 71679 71218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_30820 72176 71694 gene locus_tag LOCUS_30830 72176 71694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390561.1 protein_id gnl|my_center|LOCUS_30830 72655 72179 gene locus_tag LOCUS_30840 72655 72179 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_30840 74055 73072 gene locus_tag LOCUS_30850 74055 73072 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_30850 75427 74237 gene locus_tag LOCUS_30860 75427 74237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 75490 76290 gene locus_tag LOCUS_30870 75490 76290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_30870 76287 76802 gene locus_tag LOCUS_30880 76287 76802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 77390 76830 gene locus_tag LOCUS_30890 77390 76830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_30890 77420 78361 gene locus_tag LOCUS_30900 77420 78361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 81234 78412 gene locus_tag LOCUS_30910 81234 78412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 81453 81911 gene locus_tag LOCUS_30920 81453 81911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 81908 83119 gene locus_tag LOCUS_30930 gene queG 81908 83119 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR1 protein_id gnl|my_center|LOCUS_30930 83309 85261 gene locus_tag LOCUS_30940 gene rpsA 83309 85261 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_30940 85325 85618 gene locus_tag LOCUS_30950 gene ihfB-2 85325 85618 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_30950 85637 86002 gene locus_tag LOCUS_30960 85637 86002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 86008 86199 gene locus_tag LOCUS_30970 86008 86199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 86208 87383 gene locus_tag LOCUS_30980 gene lpxB 86208 87383 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_30980 87380 89347 gene locus_tag LOCUS_30990 gene msbA 87380 89347 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_30990 89350 90231 gene locus_tag LOCUS_31000 89350 90231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_31000 90245 90880 gene locus_tag LOCUS_31010 gene gmk 90245 90880 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44310 protein_id gnl|my_center|LOCUS_31010 91003 91266 gene locus_tag LOCUS_31020 91003 91266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 91286 91993 gene locus_tag LOCUS_31030 91286 91993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 91962 92921 gene locus_tag LOCUS_31040 91962 92921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 92990 94279 gene locus_tag LOCUS_31050 92990 94279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 94355 95320 gene locus_tag LOCUS_31060 94355 95320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 95345 96544 gene locus_tag LOCUS_31070 95345 96544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_31070 96544 97065 gene locus_tag LOCUS_31080 gene yfiT 96544 97065 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_31080 97990 97070 gene locus_tag LOCUS_31090 97990 97070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_31090 98340 97987 gene locus_tag LOCUS_31100 98340 97987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 98568 98386 gene locus_tag LOCUS_31110 98568 98386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 99770 98592 gene locus_tag LOCUS_31120 99770 98592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 102664 99908 gene locus_tag LOCUS_31130 102664 99908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31130 102897 102661 gene locus_tag LOCUS_31140 102897 102661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 103090 105441 gene locus_tag LOCUS_31150 103090 105441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 105700 106098 gene locus_tag LOCUS_31160 gene vapc1 105700 106098 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P733 protein_id gnl|my_center|LOCUS_31160 115365 106120 gene locus_tag LOCUS_31170 115365 106120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 115415 115900 gene locus_tag LOCUS_31180 115415 115900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 115911 117530 gene locus_tag LOCUS_31190 115911 117530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 117530 119392 gene locus_tag LOCUS_31200 117530 119392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 119434 120060 gene locus_tag LOCUS_31210 119434 120060 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_31210 120214 120471 gene locus_tag LOCUS_31220 120214 120471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 120674 122188 gene locus_tag LOCUS_31230 120674 122188 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_31230 122179 124164 gene locus_tag LOCUS_31240 gene nadE 122179 124164 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_31240 124493 124221 gene locus_tag LOCUS_31250 124493 124221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 127046 124509 gene locus_tag LOCUS_31260 gene leuS 127046 124509 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816T0 protein_id gnl|my_center|LOCUS_31260 127326 129044 gene locus_tag LOCUS_31270 127326 129044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 129248 130069 gene locus_tag LOCUS_31280 129248 130069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 130298 131611 gene locus_tag LOCUS_31290 130298 131611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 132724 133341 gene locus_tag LOCUS_31300 132724 133341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 133344 133751 gene locus_tag LOCUS_31310 133344 133751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 134804 133839 gene locus_tag LOCUS_31320 134804 133839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 139070 135024 gene locus_tag LOCUS_31330 139070 135024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 139395 140546 gene locus_tag LOCUS_31340 139395 140546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence023 1425 949 gene locus_tag LOCUS_31350 1425 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 4170 1453 gene locus_tag LOCUS_31360 4170 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 5324 4170 gene locus_tag LOCUS_31370 5324 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 6939 5752 gene locus_tag LOCUS_31380 6939 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 8607 6949 gene locus_tag LOCUS_31390 8607 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 9702 8617 gene locus_tag LOCUS_31400 9702 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 11185 9695 gene locus_tag LOCUS_31410 11185 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 12663 11200 gene locus_tag LOCUS_31420 gene gumC 12663 11200 CDS product GumC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037594.1 protein_id gnl|my_center|LOCUS_31420 13391 12696 gene locus_tag LOCUS_31430 13391 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 14141 13587 gene locus_tag LOCUS_31440 14141 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 16426 14138 gene locus_tag LOCUS_31450 16426 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 16765 16541 gene locus_tag LOCUS_31460 16765 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 20815 16937 gene locus_tag LOCUS_31470 20815 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 21141 21989 gene locus_tag LOCUS_31480 21141 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 22407 22889 gene locus_tag LOCUS_31490 22407 22889 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_31490 24036 22993 gene locus_tag LOCUS_31500 24036 22993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 26030 24033 gene locus_tag LOCUS_31510 26030 24033 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_31510 27248 26067 gene locus_tag LOCUS_31520 27248 26067 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390855.1 protein_id gnl|my_center|LOCUS_31520 28456 27302 gene locus_tag LOCUS_31530 28456 27302 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_31530 28923 28510 gene locus_tag LOCUS_31540 gene vapC 28923 28510 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H9 protein_id gnl|my_center|LOCUS_31540 29171 28920 gene locus_tag LOCUS_31550 29171 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 31615 29405 gene locus_tag LOCUS_31560 31615 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 33404 31626 gene locus_tag LOCUS_31570 gene nolO 33404 31626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_31570 36986 33519 gene locus_tag LOCUS_31580 36986 33519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 38580 37528 gene locus_tag LOCUS_31590 38580 37528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 39629 38610 gene locus_tag LOCUS_31600 gene psd 39629 38610 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFM0 protein_id gnl|my_center|LOCUS_31600 42004 39629 gene locus_tag LOCUS_31610 42004 39629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 42428 42144 gene locus_tag LOCUS_31620 42428 42144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 42309 43061 gene locus_tag LOCUS_31630 42309 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_31630 44967 43021 gene locus_tag LOCUS_31640 44967 43021 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510922.1 protein_id gnl|my_center|LOCUS_31640 45752 45063 gene locus_tag LOCUS_31650 gene wlbG 45752 45063 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807105.1 protein_id gnl|my_center|LOCUS_31650 46968 45754 gene locus_tag LOCUS_31660 gene spsC 46968 45754 CDS product spore coat polysaccharide biosynthesis protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39623 protein_id gnl|my_center|LOCUS_31660 47298 47038 gene locus_tag LOCUS_31670 47298 47038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 47840 47370 gene locus_tag LOCUS_31680 47840 47370 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_31680 48629 47856 gene locus_tag LOCUS_31690 48629 47856 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_31690 49602 48697 gene locus_tag LOCUS_31700 gene pstB 49602 48697 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_31700 51597 49618 gene locus_tag LOCUS_31710 gene pstA 51597 49618 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_31710 54452 51594 gene locus_tag LOCUS_31720 54452 51594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 55603 54596 gene locus_tag LOCUS_31730 55603 54596 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_31730 55873 57240 gene locus_tag LOCUS_31740 55873 57240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 57237 57587 gene locus_tag LOCUS_31750 57237 57587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_31750 57587 58396 gene locus_tag LOCUS_31760 57587 58396 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_31760 59277 58735 gene locus_tag LOCUS_31770 59277 58735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 60538 59396 gene locus_tag LOCUS_31780 60538 59396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 61248 60778 gene locus_tag LOCUS_31790 61248 60778 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_31790 61647 63935 gene locus_tag LOCUS_31800 61647 63935 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_31800 64003 64293 gene locus_tag LOCUS_31810 64003 64293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 64290 64739 gene locus_tag LOCUS_31820 64290 64739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 66538 64829 gene locus_tag LOCUS_31830 66538 64829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 68454 66748 gene locus_tag LOCUS_31840 68454 66748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 71058 68713 gene locus_tag LOCUS_31850 71058 68713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 73214 71190 gene locus_tag LOCUS_31860 73214 71190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 73485 74858 gene locus_tag LOCUS_31870 73485 74858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 75669 75094 gene locus_tag LOCUS_31880 75669 75094 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_31880 75829 77835 gene locus_tag LOCUS_31890 75829 77835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 77850 78980 gene locus_tag LOCUS_31900 gene dinB 77850 78980 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_31900 81076 78965 gene locus_tag LOCUS_31910 gene greA 81076 78965 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51157 protein_id gnl|my_center|LOCUS_31910 81185 82000 gene locus_tag LOCUS_31920 81185 82000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944035.1 protein_id gnl|my_center|LOCUS_31920 82201 83268 gene locus_tag LOCUS_31930 82201 83268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 83300 84319 gene locus_tag LOCUS_31940 83300 84319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 84331 85023 gene locus_tag LOCUS_31950 84331 85023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 85023 85874 gene locus_tag LOCUS_31960 85023 85874 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257018.1 protein_id gnl|my_center|LOCUS_31960 87451 86294 gene locus_tag LOCUS_31970 87451 86294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 87971 88047 gene locus_tag LOCUS_t00290 87971 88047 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88186 89676 gene locus_tag LOCUS_31980 88186 89676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_31980 89711 90040 gene locus_tag LOCUS_31990 89711 90040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 90607 90128 gene locus_tag LOCUS_32000 90607 90128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 91027 108996 gene locus_tag LOCUS_32010 91027 108996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 96980 97075 gene locus_tag LOCUS_t00300 96980 97075 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 113053 108959 gene locus_tag LOCUS_32020 113053 108959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 117348 113257 gene locus_tag LOCUS_32030 117348 113257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 117567 127646 gene locus_tag LOCUS_32040 117567 127646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 127688 128716 gene locus_tag LOCUS_32050 127688 128716 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257661.1 protein_id gnl|my_center|LOCUS_32050 129288 128725 gene locus_tag LOCUS_32060 129288 128725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 129351 130508 gene locus_tag LOCUS_32070 129351 130508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 131842 130493 gene locus_tag LOCUS_32080 131842 130493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 132269 131835 gene locus_tag LOCUS_32090 132269 131835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 132396 133538 gene locus_tag LOCUS_32100 132396 133538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 133535 135211 gene locus_tag LOCUS_32110 133535 135211 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_32110 135208 136023 gene locus_tag LOCUS_32120 135208 136023 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_32120 138029 136056 gene locus_tag LOCUS_32130 138029 136056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 138898 138146 gene locus_tag LOCUS_32140 138898 138146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 139377 139535 gene locus_tag LOCUS_32150 139377 139535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence024 2733 4670 gene locus_tag LOCUS_32160 2733 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 7892 4689 gene locus_tag LOCUS_32170 7892 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 8903 8037 gene locus_tag LOCUS_32180 8903 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 9175 11979 gene locus_tag LOCUS_32190 9175 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_32190 12068 13321 gene locus_tag LOCUS_32200 12068 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 13346 14587 gene locus_tag LOCUS_32210 13346 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 15060 14578 gene locus_tag LOCUS_32220 15060 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 15150 16247 gene locus_tag LOCUS_32230 gene metE 15150 16247 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_32230 17521 16307 gene locus_tag LOCUS_32240 17521 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 17628 18506 gene locus_tag LOCUS_32250 17628 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 18602 20161 gene locus_tag LOCUS_32260 18602 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 23064 20386 gene locus_tag LOCUS_32270 23064 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_32270 23404 23057 gene locus_tag LOCUS_32280 23404 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 23689 24570 gene locus_tag LOCUS_32290 23689 24570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 24709 25656 gene locus_tag LOCUS_32300 24709 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 27476 25653 gene locus_tag LOCUS_32310 27476 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 27663 28193 gene locus_tag LOCUS_32320 27663 28193 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_32320 28288 30069 gene locus_tag LOCUS_32330 gene aspS 28288 30069 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_32330 30069 31361 gene locus_tag LOCUS_32340 30069 31361 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208729.1 protein_id gnl|my_center|LOCUS_32340 31461 33170 gene locus_tag LOCUS_32350 31461 33170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 33167 34315 gene locus_tag LOCUS_32360 33167 34315 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_32360 35066 34335 gene locus_tag LOCUS_32370 35066 34335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_32370 35897 35118 gene locus_tag LOCUS_32380 35897 35118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 36161 37300 gene locus_tag LOCUS_32390 36161 37300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 37394 37663 gene locus_tag LOCUS_32400 37394 37663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 37660 38085 gene locus_tag LOCUS_32410 37660 38085 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_32410 38082 39923 gene locus_tag LOCUS_32420 gene uvrC 38082 39923 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_32420 40035 41483 gene locus_tag LOCUS_32430 40035 41483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 44121 41965 gene locus_tag LOCUS_32440 44121 41965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 44881 44318 gene locus_tag LOCUS_32450 44881 44318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 45138 44896 gene locus_tag LOCUS_32460 45138 44896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 45019 45321 gene locus_tag LOCUS_32470 45019 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 45318 45767 gene locus_tag LOCUS_32480 gene vapC 45318 45767 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHV0 protein_id gnl|my_center|LOCUS_32480 45777 46724 gene locus_tag LOCUS_32490 45777 46724 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404175.1 protein_id gnl|my_center|LOCUS_32490 46769 47533 gene locus_tag LOCUS_32500 46769 47533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 47622 48431 gene locus_tag LOCUS_32510 gene scpA 47622 48431 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_32510 48428 49291 gene locus_tag LOCUS_32520 48428 49291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 49281 50372 gene locus_tag LOCUS_32530 49281 50372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 50302 51681 gene locus_tag LOCUS_32540 50302 51681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 51776 54034 gene locus_tag LOCUS_32550 51776 54034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 54932 54009 gene locus_tag LOCUS_32560 54932 54009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 55363 55773 gene locus_tag LOCUS_32570 55363 55773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 57056 56037 gene locus_tag LOCUS_32580 57056 56037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 57181 58230 gene locus_tag LOCUS_32590 57181 58230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 58690 58478 gene locus_tag LOCUS_32600 58690 58478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 58971 59852 gene locus_tag LOCUS_32610 58971 59852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 59930 61537 gene locus_tag LOCUS_32620 59930 61537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 62152 61601 gene locus_tag LOCUS_32630 gene blc 62152 61601 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_32630 62364 63140 gene locus_tag LOCUS_32640 62364 63140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 63261 64367 gene locus_tag LOCUS_32650 63261 64367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 64364 65815 gene locus_tag LOCUS_32660 64364 65815 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_32660 66088 67743 gene locus_tag LOCUS_32670 66088 67743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 67902 68921 gene locus_tag LOCUS_32680 67902 68921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 70801 68918 gene locus_tag LOCUS_32690 70801 68918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 72768 70882 gene locus_tag LOCUS_32700 72768 70882 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 protein_id gnl|my_center|LOCUS_32700 73388 72768 gene locus_tag LOCUS_32710 73388 72768 CDS product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 protein_id gnl|my_center|LOCUS_32710 74296 73385 gene locus_tag LOCUS_32720 74296 73385 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_32720 76866 74413 gene locus_tag LOCUS_32730 76866 74413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_32730 76941 77561 gene locus_tag LOCUS_32740 76941 77561 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_32740 77705 78451 gene locus_tag LOCUS_32750 77705 78451 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 protein_id gnl|my_center|LOCUS_32750 78488 78832 gene locus_tag LOCUS_32760 78488 78832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 79488 78991 gene locus_tag LOCUS_32770 79488 78991 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_32770 79677 80132 gene locus_tag LOCUS_32780 79677 80132 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_32780 80995 80129 gene locus_tag LOCUS_32790 80995 80129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 82069 81020 gene locus_tag LOCUS_32800 82069 81020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 81980 82165 gene locus_tag LOCUS_32810 81980 82165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 82826 82224 gene locus_tag LOCUS_32820 82826 82224 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 protein_id gnl|my_center|LOCUS_32820 84447 82861 gene locus_tag LOCUS_32830 84447 82861 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_32830 85678 84512 gene locus_tag LOCUS_32840 gene menC 85678 84512 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4D0 protein_id gnl|my_center|LOCUS_32840 86586 85702 gene locus_tag LOCUS_32850 86586 85702 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_32850 89415 86683 gene locus_tag LOCUS_32860 89415 86683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 91038 89419 gene locus_tag LOCUS_32870 91038 89419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 90940 91137 gene locus_tag LOCUS_32880 90940 91137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 91211 91573 gene locus_tag LOCUS_32890 91211 91573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 91566 92414 gene locus_tag LOCUS_32900 91566 92414 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392010.1 protein_id gnl|my_center|LOCUS_32900 92452 93261 gene locus_tag LOCUS_32910 92452 93261 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_32910 93254 94117 gene locus_tag LOCUS_32920 gene pstA2 93254 94117 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_32920 94114 95004 gene locus_tag LOCUS_32930 94114 95004 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878856.1 protein_id gnl|my_center|LOCUS_32930 95424 95059 gene locus_tag LOCUS_32940 95424 95059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 95626 96849 gene locus_tag LOCUS_32950 95626 96849 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_32950 96846 98222 gene locus_tag LOCUS_32960 96846 98222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 99907 98201 gene locus_tag LOCUS_32970 99907 98201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 101459 99897 gene locus_tag LOCUS_32980 101459 99897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 103444 101456 gene locus_tag LOCUS_32990 103444 101456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 103605 104369 gene locus_tag LOCUS_33000 103605 104369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 104662 104375 gene locus_tag LOCUS_33010 104662 104375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 105322 104750 gene locus_tag LOCUS_33020 105322 104750 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_33020 108592 105845 gene locus_tag LOCUS_33030 gene ppc 108592 105845 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_33030 110469 108670 gene locus_tag LOCUS_33040 gene lepA2 110469 108670 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_33040 110569 112026 gene locus_tag LOCUS_33050 110569 112026 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_33050 112163 113428 gene locus_tag LOCUS_33060 112163 113428 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_33060 114006 113425 gene locus_tag LOCUS_33070 114006 113425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 114782 114003 gene locus_tag LOCUS_33080 114782 114003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 116630 114912 gene locus_tag LOCUS_33090 116630 114912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 116727 117701 gene locus_tag LOCUS_33100 116727 117701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 117698 118831 gene locus_tag LOCUS_33110 117698 118831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 119074 118844 gene locus_tag LOCUS_33120 119074 118844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_33120 119324 119064 gene locus_tag LOCUS_33130 119324 119064 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_33130 119512 121704 gene locus_tag LOCUS_33140 119512 121704 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_33140 121826 125080 gene locus_tag LOCUS_33150 121826 125080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 125798 125085 gene locus_tag LOCUS_33160 125798 125085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 126681 125791 gene locus_tag LOCUS_33170 126681 125791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 128513 126744 gene locus_tag LOCUS_33180 128513 126744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 128625 131279 gene locus_tag LOCUS_33190 128625 131279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 131341 131883 gene locus_tag LOCUS_33200 131341 131883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 131891 132298 gene locus_tag LOCUS_33210 131891 132298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence025 2201 2515 gene locus_tag LOCUS_33220 2201 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 4820 2559 gene locus_tag LOCUS_33230 4820 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 5058 5348 gene locus_tag LOCUS_33240 5058 5348 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX7 protein_id gnl|my_center|LOCUS_33240 5395 6435 gene locus_tag LOCUS_33250 gene atuE 5395 6435 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_33250 6504 8069 gene locus_tag LOCUS_33260 6504 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 8082 9620 gene locus_tag LOCUS_33270 8082 9620 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_33270 10823 9642 gene locus_tag LOCUS_33280 10823 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 12867 11044 gene locus_tag LOCUS_33290 12867 11044 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_33290 13085 13939 gene locus_tag LOCUS_33300 gene desC 13085 13939 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_33300 15515 14175 gene locus_tag LOCUS_33310 15515 14175 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_33310 17433 15538 gene locus_tag LOCUS_33320 gene sppA 17433 15538 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_33320 17576 18370 gene locus_tag LOCUS_33330 gene thyA 17576 18370 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_33330 18443 18658 gene locus_tag LOCUS_33340 18443 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 18646 19068 gene locus_tag LOCUS_33350 gene vapC21 18646 19068 CDS product ribonuclease VapC21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF91 protein_id gnl|my_center|LOCUS_33350 19144 19629 gene locus_tag LOCUS_33360 gene folA 19144 19629 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E3 protein_id gnl|my_center|LOCUS_33360 19622 20194 gene locus_tag LOCUS_33370 19622 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_33370 20887 20180 gene locus_tag LOCUS_33380 20887 20180 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_33380 21020 22015 gene locus_tag LOCUS_33390 21020 22015 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_33390 22572 22045 gene locus_tag LOCUS_33400 22572 22045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 24814 22811 gene locus_tag LOCUS_33410 24814 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_33410 25003 26646 gene locus_tag LOCUS_33420 25003 26646 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_33420 29688 27031 gene locus_tag LOCUS_33430 gene ape1 29688 27031 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 protein_id gnl|my_center|LOCUS_33430 31466 29736 gene locus_tag LOCUS_33440 31466 29736 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_33440 31986 32690 gene locus_tag LOCUS_33450 31986 32690 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_33450 32763 33200 gene locus_tag LOCUS_33460 32763 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_33460 33234 34607 gene locus_tag LOCUS_33470 33234 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 35673 34897 gene locus_tag LOCUS_33480 35673 34897 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_33480 37307 35742 gene locus_tag LOCUS_33490 37307 35742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 37440 39770 gene locus_tag LOCUS_33500 37440 39770 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204019.1 protein_id gnl|my_center|LOCUS_33500 39774 40355 gene locus_tag LOCUS_33510 39774 40355 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 protein_id gnl|my_center|LOCUS_33510 40872 42899 gene locus_tag LOCUS_33520 40872 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 43040 43267 gene locus_tag LOCUS_33530 43040 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 43260 43661 gene locus_tag LOCUS_33540 43260 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 43970 46231 gene locus_tag LOCUS_33550 gene phuR 43970 46231 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_33550 46262 48673 gene locus_tag LOCUS_33560 46262 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 48673 49281 gene locus_tag LOCUS_33570 48673 49281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 49320 49676 gene locus_tag LOCUS_33580 49320 49676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 51209 49722 gene locus_tag LOCUS_33590 51209 49722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 51270 51932 gene locus_tag LOCUS_33600 51270 51932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 51929 52732 gene locus_tag LOCUS_33610 51929 52732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 53383 52751 gene locus_tag LOCUS_33620 53383 52751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 54279 53401 gene locus_tag LOCUS_33630 54279 53401 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_33630 54869 54321 gene locus_tag LOCUS_33640 54869 54321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 56713 54866 gene locus_tag LOCUS_33650 56713 54866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_33650 58809 56710 gene locus_tag LOCUS_33660 58809 56710 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_33660 60423 58819 gene locus_tag LOCUS_33670 60423 58819 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_33670 60595 61284 gene locus_tag LOCUS_33680 60595 61284 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_33680 61946 61479 gene locus_tag LOCUS_33690 61946 61479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 63079 61988 gene locus_tag LOCUS_33700 63079 61988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 64205 63195 gene locus_tag LOCUS_33710 64205 63195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 65251 64217 gene locus_tag LOCUS_33720 65251 64217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 66674 65370 gene locus_tag LOCUS_33730 gene colS 66674 65370 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380966.1 protein_id gnl|my_center|LOCUS_33730 67364 66675 gene locus_tag LOCUS_33740 67364 66675 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_33740 69852 67600 gene locus_tag LOCUS_33750 69852 67600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_33750 69903 71021 gene locus_tag LOCUS_33760 69903 71021 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224431.1 protein_id gnl|my_center|LOCUS_33760 71380 73074 gene locus_tag LOCUS_33770 71380 73074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 74641 73124 gene locus_tag LOCUS_33780 74641 73124 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_33780 74845 75678 gene locus_tag LOCUS_33790 74845 75678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 75723 77270 gene locus_tag LOCUS_33800 gene purH 75723 77270 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IP9 protein_id gnl|my_center|LOCUS_33800 77369 78019 gene locus_tag LOCUS_33810 77369 78019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 78016 78747 gene locus_tag LOCUS_33820 78016 78747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 80182 79139 gene locus_tag LOCUS_33830 gene bex 80182 79139 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_33830 81489 80185 gene locus_tag LOCUS_33840 81489 80185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 82000 81482 gene locus_tag LOCUS_33850 gene ybeY 82000 81482 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX9 protein_id gnl|my_center|LOCUS_33850 84386 81990 gene locus_tag LOCUS_33860 84386 81990 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_33860 85470 84511 gene locus_tag LOCUS_33870 85470 84511 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_33870 86321 85467 gene locus_tag LOCUS_33880 86321 85467 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_33880 86895 86401 gene locus_tag LOCUS_33890 86895 86401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 88481 86892 gene locus_tag LOCUS_33900 gene yjeF 88481 86892 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C72 protein_id gnl|my_center|LOCUS_33900 89149 88487 gene locus_tag LOCUS_33910 89149 88487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_33910 89276 89461 gene locus_tag LOCUS_33920 89276 89461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 89806 89594 gene locus_tag LOCUS_33930 89806 89594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 90233 89772 gene locus_tag LOCUS_33940 90233 89772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 92103 90370 gene locus_tag LOCUS_33950 92103 90370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 93018 92215 gene locus_tag LOCUS_33960 93018 92215 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_33960 93857 93015 gene locus_tag LOCUS_33970 93857 93015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 99297 93925 gene locus_tag LOCUS_33980 99297 93925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 101903 99369 gene locus_tag LOCUS_33990 101903 99369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 102216 103304 gene locus_tag LOCUS_34000 102216 103304 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_34000 103341 104627 gene locus_tag LOCUS_34010 103341 104627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705648.1 protein_id gnl|my_center|LOCUS_34010 104630 105184 gene locus_tag LOCUS_34020 104630 105184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 105260 106222 gene locus_tag LOCUS_34030 105260 106222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 107135 106293 gene locus_tag LOCUS_34040 107135 106293 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_34040 109507 107138 gene locus_tag LOCUS_34050 109507 107138 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_34050 109985 109512 gene locus_tag LOCUS_34060 109985 109512 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_34060 110080 110328 gene locus_tag LOCUS_34070 110080 110328 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844758.1 protein_id gnl|my_center|LOCUS_34070 110322 110666 gene locus_tag LOCUS_34080 gene mazF6 110322 110666 CDS product endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WII3 protein_id gnl|my_center|LOCUS_34080 111181 110696 gene locus_tag LOCUS_34090 111181 110696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 111339 114350 gene locus_tag LOCUS_34100 111339 114350 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_34100 114373 114876 gene locus_tag LOCUS_34110 114373 114876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 115134 115991 gene locus_tag LOCUS_34120 115134 115991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 115988 117559 gene locus_tag LOCUS_34130 115988 117559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_34130 117654 118307 gene locus_tag LOCUS_34140 117654 118307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 118304 120883 gene locus_tag LOCUS_34150 118304 120883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 120938 121132 gene locus_tag LOCUS_34160 120938 121132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 121136 121597 gene locus_tag LOCUS_34170 121136 121597 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_34170 123034 121823 gene locus_tag LOCUS_34180 123034 121823 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_34180 125546 123111 gene locus_tag LOCUS_34190 125546 123111 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_34190 126393 125581 gene locus_tag LOCUS_34200 gene xth 126393 125581 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_34200 126541 127740 gene locus_tag LOCUS_34210 126541 127740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 127744 129024 gene locus_tag LOCUS_34220 127744 129024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 129420 128980 gene locus_tag LOCUS_34230 gene furR2 129420 128980 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880915.1 protein_id gnl|my_center|LOCUS_34230 129618 132113 gene locus_tag LOCUS_34240 129618 132113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence026 4268 1152 gene locus_tag LOCUS_34250 4268 1152 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_34250 6471 4792 gene locus_tag LOCUS_34260 6471 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 7828 6461 gene locus_tag LOCUS_34270 7828 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 8400 7903 gene locus_tag LOCUS_34280 8400 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 13185 8539 gene locus_tag LOCUS_34290 13185 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 14586 13426 gene locus_tag LOCUS_34300 14586 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 14764 16236 gene locus_tag LOCUS_34310 14764 16236 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_34310 16239 17087 gene locus_tag LOCUS_34320 16239 17087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_34320 17147 17917 gene locus_tag LOCUS_34330 17147 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 17939 19444 gene locus_tag LOCUS_34340 gene lnt 17939 19444 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_34340 19858 20847 gene locus_tag LOCUS_34350 gene prfB 19858 20847 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPZ1 protein_id gnl|my_center|LOCUS_34350 21169 20888 gene locus_tag LOCUS_34360 21169 20888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 22563 21211 gene locus_tag LOCUS_34370 22563 21211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 23546 22572 gene locus_tag LOCUS_34380 23546 22572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 23935 24327 gene locus_tag LOCUS_34390 23935 24327 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_34390 24324 25217 gene locus_tag LOCUS_34400 24324 25217 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_34400 25214 25900 gene locus_tag LOCUS_34410 25214 25900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 25958 27178 gene locus_tag LOCUS_34420 25958 27178 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920069.1 protein_id gnl|my_center|LOCUS_34420 27613 27188 gene locus_tag LOCUS_34430 27613 27188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 27900 27607 gene locus_tag LOCUS_34440 27900 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 29016 27955 gene locus_tag LOCUS_34450 29016 27955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 29135 30076 gene locus_tag LOCUS_34460 29135 30076 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_34460 30154 32058 gene locus_tag LOCUS_34470 30154 32058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_34470 32062 32784 gene locus_tag LOCUS_34480 32062 32784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_34480 33684 32761 gene locus_tag LOCUS_34490 33684 32761 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_34490 33850 34446 gene locus_tag LOCUS_34500 33850 34446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 35580 34987 gene locus_tag LOCUS_34510 35580 34987 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_34510 37466 35604 gene locus_tag LOCUS_34520 37466 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 37598 37846 gene locus_tag LOCUS_34530 37598 37846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 37836 38273 gene locus_tag LOCUS_34540 37836 38273 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_34540 39030 38341 gene locus_tag LOCUS_34550 39030 38341 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_34550 41368 39059 gene locus_tag LOCUS_34560 gene fadE 41368 39059 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_34560 41562 42713 gene locus_tag LOCUS_34570 gene aroB 41562 42713 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL6 protein_id gnl|my_center|LOCUS_34570 42900 44762 gene locus_tag LOCUS_34580 42900 44762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 44802 45167 gene locus_tag LOCUS_34590 44802 45167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 45250 46266 gene locus_tag LOCUS_34600 gene ftsY 45250 46266 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_34600 46241 47368 gene locus_tag LOCUS_34610 46241 47368 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_34610 47332 47958 gene locus_tag LOCUS_34620 gene ribE 47332 47958 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_34620 47955 49073 gene locus_tag LOCUS_34630 47955 49073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 49398 52358 gene locus_tag LOCUS_34640 49398 52358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 54639 54007 gene locus_tag LOCUS_34650 54639 54007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 55265 54672 gene locus_tag LOCUS_34660 55265 54672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 56080 55268 gene locus_tag LOCUS_34670 56080 55268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 56145 57461 gene locus_tag LOCUS_34680 56145 57461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_34680 57521 63199 gene locus_tag LOCUS_34690 57521 63199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 63529 63308 gene locus_tag LOCUS_34700 63529 63308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 63520 64545 gene locus_tag LOCUS_34710 gene nadA 63520 64545 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U4 protein_id gnl|my_center|LOCUS_34710 64542 66173 gene locus_tag LOCUS_34720 gene nadB 64542 66173 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S64 protein_id gnl|my_center|LOCUS_34720 66596 66381 gene locus_tag LOCUS_34730 66596 66381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 66861 66625 gene locus_tag LOCUS_34740 66861 66625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 68282 67314 gene locus_tag LOCUS_34750 68282 67314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 70255 68513 gene locus_tag LOCUS_34760 70255 68513 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_34760 70710 70252 gene locus_tag LOCUS_34770 gene fsxA 70710 70252 CDS product exclusion protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938508.1 protein_id gnl|my_center|LOCUS_34770 71414 70749 gene locus_tag LOCUS_34780 gene aat 71414 70749 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJE0 protein_id gnl|my_center|LOCUS_34780 71567 72748 gene locus_tag LOCUS_34790 gene sucC 71567 72748 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MG7 protein_id gnl|my_center|LOCUS_34790 72748 73620 gene locus_tag LOCUS_34800 gene sucD 72748 73620 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EA4 protein_id gnl|my_center|LOCUS_34800 73617 74285 gene locus_tag LOCUS_34810 73617 74285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 74625 75047 gene locus_tag LOCUS_34820 gene ndk 74625 75047 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84508 protein_id gnl|my_center|LOCUS_34820 76923 75157 gene locus_tag LOCUS_34830 76923 75157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 77766 77056 gene locus_tag LOCUS_34840 77766 77056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 78926 77763 gene locus_tag LOCUS_34850 78926 77763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 80102 79056 gene locus_tag LOCUS_34860 gene queA 80102 79056 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_34860 81203 80112 gene locus_tag LOCUS_34870 81203 80112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 82179 81196 gene locus_tag LOCUS_34880 82179 81196 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_34880 83854 82211 gene locus_tag LOCUS_34890 83854 82211 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_34890 83975 85345 gene locus_tag LOCUS_34900 83975 85345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 85424 86863 gene locus_tag LOCUS_34910 85424 86863 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_34910 86996 88024 gene locus_tag LOCUS_34920 86996 88024 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391950.1 protein_id gnl|my_center|LOCUS_34920 88063 88836 gene locus_tag LOCUS_34930 88063 88836 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_34930 88839 90224 gene locus_tag LOCUS_34940 88839 90224 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_34940 90229 91611 gene locus_tag LOCUS_34950 90229 91611 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976260.1 protein_id gnl|my_center|LOCUS_34950 91998 93347 gene locus_tag LOCUS_34960 91998 93347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971261.1 protein_id gnl|my_center|LOCUS_34960 93328 94653 gene locus_tag LOCUS_34970 93328 94653 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971260.1 protein_id gnl|my_center|LOCUS_34970 94657 98070 gene locus_tag LOCUS_34980 94657 98070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345441.1 protein_id gnl|my_center|LOCUS_34980 98075 99136 gene locus_tag LOCUS_34990 98075 99136 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_34990 99133 100743 gene locus_tag LOCUS_35000 gene dnlI 99133 100743 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118433.1 protein_id gnl|my_center|LOCUS_35000 101104 101943 gene locus_tag LOCUS_35010 101104 101943 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_35010 101982 102530 gene locus_tag LOCUS_35020 101982 102530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 102541 103254 gene locus_tag LOCUS_35030 102541 103254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337320.1 protein_id gnl|my_center|LOCUS_35030 103303 105948 gene locus_tag LOCUS_35040 103303 105948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 105945 106631 gene locus_tag LOCUS_35050 105945 106631 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_35050 106712 107569 gene locus_tag LOCUS_35060 106712 107569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069728.1 protein_id gnl|my_center|LOCUS_35060 107668 108357 gene locus_tag LOCUS_35070 107668 108357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 108400 109071 gene locus_tag LOCUS_35080 108400 109071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 109168 109028 gene locus_tag LOCUS_35090 109168 109028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 109256 109807 gene locus_tag LOCUS_35100 109256 109807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence027 3349 1226 gene locus_tag LOCUS_35110 3349 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4394 3372 gene locus_tag LOCUS_35120 4394 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814937.1 protein_id gnl|my_center|LOCUS_35120 10148 4455 gene locus_tag LOCUS_35130 10148 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 11247 10279 gene locus_tag LOCUS_35140 11247 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 11415 11681 gene locus_tag LOCUS_35150 11415 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 11678 11851 gene locus_tag LOCUS_35160 11678 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 11858 12157 gene locus_tag LOCUS_35170 11858 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 12608 12159 gene locus_tag LOCUS_35180 12608 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 14920 12710 gene locus_tag LOCUS_35190 gene fadJ 14920 12710 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_35190 15276 16583 gene locus_tag LOCUS_35200 gene fadI 15276 16583 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK76 protein_id gnl|my_center|LOCUS_35200 17084 16512 gene locus_tag LOCUS_35210 17084 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 17141 17908 gene locus_tag LOCUS_35220 17141 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 18279 18704 gene locus_tag LOCUS_35230 18279 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 23087 18708 gene locus_tag LOCUS_35240 23087 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 24247 23084 gene locus_tag LOCUS_35250 24247 23084 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_35250 24918 24283 gene locus_tag LOCUS_35260 24918 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 27250 25202 gene locus_tag LOCUS_35270 27250 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 29235 27247 gene locus_tag LOCUS_35280 29235 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 29607 30872 gene locus_tag LOCUS_35290 29607 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 30882 31400 gene locus_tag LOCUS_35300 30882 31400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 31854 31405 gene locus_tag LOCUS_35310 31854 31405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090099.1 protein_id gnl|my_center|LOCUS_35310 31902 33323 gene locus_tag LOCUS_35320 31902 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_35320 33837 33304 gene locus_tag LOCUS_35330 33837 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 34184 35209 gene locus_tag LOCUS_35340 gene pheS 34184 35209 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_35340 35220 37751 gene locus_tag LOCUS_35350 gene pheT 35220 37751 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH19 protein_id gnl|my_center|LOCUS_35350 37753 38529 gene locus_tag LOCUS_35360 37753 38529 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_35360 38831 38574 gene locus_tag LOCUS_35370 38831 38574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 39015 39251 gene locus_tag LOCUS_35380 39015 39251 CDS product plasmid stability protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529622.1 protein_id gnl|my_center|LOCUS_35380 39273 41405 gene locus_tag LOCUS_35390 39273 41405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 41427 42602 gene locus_tag LOCUS_35400 41427 42602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 42611 44938 gene locus_tag LOCUS_35410 42611 44938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 45752 45144 gene locus_tag LOCUS_35420 45752 45144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 46147 45830 gene locus_tag LOCUS_35430 46147 45830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 46624 48183 gene locus_tag LOCUS_35440 46624 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 48755 48180 gene locus_tag LOCUS_35450 48755 48180 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_35450 48863 51412 gene locus_tag LOCUS_35460 48863 51412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 51519 54203 gene locus_tag LOCUS_35470 51519 54203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 54203 54895 gene locus_tag LOCUS_35480 54203 54895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 56846 54900 gene locus_tag LOCUS_35490 56846 54900 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_35490 58010 56874 gene locus_tag LOCUS_35500 gene menC 58010 56874 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_35500 58909 58007 gene locus_tag LOCUS_35510 58909 58007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_35510 60146 59091 gene locus_tag LOCUS_35520 60146 59091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_35520 60752 60989 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatcgagccgccggaggtgtcg 62337 61543 gene locus_tag LOCUS_35530 62337 61543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 63773 62454 gene locus_tag LOCUS_35540 63773 62454 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 protein_id gnl|my_center|LOCUS_35540 64099 64971 gene locus_tag LOCUS_35550 64099 64971 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140901.1 protein_id gnl|my_center|LOCUS_35550 67407 65392 gene locus_tag LOCUS_35560 67407 65392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 67567 68973 gene locus_tag LOCUS_35570 gene asnS 67567 68973 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43829 protein_id gnl|my_center|LOCUS_35570 69010 69756 gene locus_tag LOCUS_35580 69010 69756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 69789 70964 gene locus_tag LOCUS_35590 69789 70964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 71417 70986 gene locus_tag LOCUS_35600 71417 70986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 72785 71493 gene locus_tag LOCUS_35610 72785 71493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_35610 74050 72782 gene locus_tag LOCUS_35620 74050 72782 CDS product amino acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373777.1 protein_id gnl|my_center|LOCUS_35620 74227 76677 gene locus_tag LOCUS_35630 74227 76677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_35630 76850 78079 gene locus_tag LOCUS_35640 76850 78079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 78127 81477 gene locus_tag LOCUS_35650 78127 81477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 81921 82187 gene locus_tag LOCUS_35660 81921 82187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 82274 82876 gene locus_tag LOCUS_35670 82274 82876 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_35670 82869 85502 gene locus_tag LOCUS_35680 82869 85502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 85647 86042 gene locus_tag LOCUS_35690 85647 86042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 86605 86330 gene locus_tag LOCUS_35700 86605 86330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 86550 89225 gene locus_tag LOCUS_35710 86550 89225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 89609 89226 gene locus_tag LOCUS_35720 89609 89226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 90200 89796 gene locus_tag LOCUS_35730 90200 89796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 92126 90213 gene locus_tag LOCUS_35740 92126 90213 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_35740 93942 92128 gene locus_tag LOCUS_35750 93942 92128 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_35750 94230 95234 gene locus_tag LOCUS_35760 gene adhP 94230 95234 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_35760 95270 95369 gene locus_tag LOCUS_t00310 95270 95369 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 95437 96876 gene locus_tag LOCUS_35770 gene fadI 95437 96876 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD46 protein_id gnl|my_center|LOCUS_35770 96879 98093 gene locus_tag LOCUS_35780 96879 98093 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_35780 98146 99120 gene locus_tag LOCUS_35790 98146 99120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 99214 100278 gene locus_tag LOCUS_35800 99214 100278 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266701.1 protein_id gnl|my_center|LOCUS_35800 100329 102212 gene locus_tag LOCUS_35810 100329 102212 CDS product TRAP transporter subunit DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_35810 102216 103814 gene locus_tag LOCUS_35820 102216 103814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 103811 104548 gene locus_tag LOCUS_35830 103811 104548 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_35830 104936 104541 gene locus_tag LOCUS_35840 104936 104541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 105268 104960 gene locus_tag LOCUS_35850 105268 104960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 105407 106696 gene locus_tag LOCUS_35860 105407 106696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_35860 106761 107921 gene locus_tag LOCUS_35870 106761 107921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 107927 108670 gene locus_tag LOCUS_35880 107927 108670 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence028 613 161 gene locus_tag LOCUS_35890 613 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 877 704 gene locus_tag LOCUS_35900 877 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4836 1120 gene locus_tag LOCUS_35910 4836 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 5255 6496 gene locus_tag LOCUS_35920 5255 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 7873 6506 gene locus_tag LOCUS_35930 gene rseP 7873 6506 CDS product protease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH59 protein_id gnl|my_center|LOCUS_35930 8745 7861 gene locus_tag LOCUS_35940 8745 7861 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_35940 10691 8754 gene locus_tag LOCUS_35950 10691 8754 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_35950 15645 10741 gene locus_tag LOCUS_35960 15645 10741 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_35960 16052 15741 gene locus_tag LOCUS_35970 16052 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 15966 19571 gene locus_tag LOCUS_35980 15966 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 21180 19633 gene locus_tag LOCUS_35990 21180 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 21432 21184 gene locus_tag LOCUS_36000 21432 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 22061 21432 gene locus_tag LOCUS_36010 22061 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 22914 22096 gene locus_tag LOCUS_36020 gene fdhD 22914 22096 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_36020 23776 22946 gene locus_tag LOCUS_36030 23776 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 23902 24621 gene locus_tag LOCUS_36040 gene sfsA 23902 24621 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_36040 24717 26288 gene locus_tag LOCUS_36050 24717 26288 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_36050 26509 28458 gene locus_tag LOCUS_36060 26509 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 28589 28762 gene locus_tag LOCUS_36070 28589 28762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 28895 30076 gene locus_tag LOCUS_36080 28895 30076 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_36080 30223 32133 gene locus_tag LOCUS_36090 30223 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 32230 32460 gene locus_tag LOCUS_36100 32230 32460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 32457 32810 gene locus_tag LOCUS_36110 32457 32810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 32872 35331 gene locus_tag LOCUS_36120 32872 35331 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_36120 35484 36869 gene locus_tag LOCUS_36130 35484 36869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 37050 38411 gene locus_tag LOCUS_36140 37050 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 38671 39249 gene locus_tag LOCUS_36150 38671 39249 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 protein_id gnl|my_center|LOCUS_36150 39239 40291 gene locus_tag LOCUS_36160 39239 40291 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 protein_id gnl|my_center|LOCUS_36160 40433 43708 gene locus_tag LOCUS_36170 40433 43708 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 protein_id gnl|my_center|LOCUS_36170 43946 48595 gene locus_tag LOCUS_36180 43946 48595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 48592 49881 gene locus_tag LOCUS_36190 gene exuT 48592 49881 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_36190 49949 50704 gene locus_tag LOCUS_36200 49949 50704 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_36200 50721 51758 gene locus_tag LOCUS_36210 50721 51758 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_36210 54070 51983 gene locus_tag LOCUS_36220 gene ligA 54070 51983 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31498 protein_id gnl|my_center|LOCUS_36220 55856 54132 gene locus_tag LOCUS_36230 55856 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 56077 56700 gene locus_tag LOCUS_36240 56077 56700 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_36240 56752 57351 gene locus_tag LOCUS_36250 56752 57351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 57338 58942 gene locus_tag LOCUS_36260 57338 58942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 60546 58939 gene locus_tag LOCUS_36270 60546 58939 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529694.1 protein_id gnl|my_center|LOCUS_36270 61005 60550 gene locus_tag LOCUS_36280 61005 60550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 61201 63426 gene locus_tag LOCUS_36290 gene recD2 61201 63426 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI9 protein_id gnl|my_center|LOCUS_36290 63436 65106 gene locus_tag LOCUS_36300 63436 65106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 66933 65122 gene locus_tag LOCUS_36310 66933 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 67255 67944 gene locus_tag LOCUS_36320 67255 67944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 71440 68027 gene locus_tag LOCUS_36330 71440 68027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 73433 71583 gene locus_tag LOCUS_36340 73433 71583 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_36340 73673 73512 gene locus_tag LOCUS_36350 73673 73512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 73925 76798 gene locus_tag LOCUS_36360 73925 76798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_36360 76803 78596 gene locus_tag LOCUS_36370 76803 78596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_36370 78905 79264 gene locus_tag LOCUS_36380 78905 79264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 80555 79290 gene locus_tag LOCUS_36390 gene ampG 80555 79290 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367956.1 protein_id gnl|my_center|LOCUS_36390 81439 80564 gene locus_tag LOCUS_36400 81439 80564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 81660 82808 gene locus_tag LOCUS_36410 gene carA 81660 82808 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_36410 82805 84052 gene locus_tag LOCUS_36420 gene lolE 82805 84052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_36420 84772 84113 gene locus_tag LOCUS_36430 84772 84113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 84922 85839 gene locus_tag LOCUS_36440 84922 85839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 88729 85823 gene locus_tag LOCUS_36450 88729 85823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 89968 88961 gene locus_tag LOCUS_36460 89968 88961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 91268 90450 gene locus_tag LOCUS_36470 gene uppP 91268 90450 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_36470 91443 92543 gene locus_tag LOCUS_36480 91443 92543 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_36480 92543 93097 gene locus_tag LOCUS_36490 gene rfbC 92543 93097 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_36490 93150 94634 gene locus_tag LOCUS_36500 93150 94634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_36500 97739 94710 gene locus_tag LOCUS_36510 97739 94710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 100881 98050 gene locus_tag LOCUS_36520 100881 98050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 101443 100871 gene locus_tag LOCUS_36530 101443 100871 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_36530 101618 103144 gene locus_tag LOCUS_36540 gene badA 101618 103144 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_36540 103684 103328 gene locus_tag LOCUS_36550 103684 103328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence029 1961 78 gene locus_tag LOCUS_36560 1961 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022280.1 protein_id gnl|my_center|LOCUS_36560 2210 3238 gene locus_tag LOCUS_36570 2210 3238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_36570 3235 3984 gene locus_tag LOCUS_36580 3235 3984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_36580 3998 6028 gene locus_tag LOCUS_36590 3998 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 6028 7092 gene locus_tag LOCUS_36600 6028 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 8583 7099 gene locus_tag LOCUS_36610 8583 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 11023 8633 gene locus_tag LOCUS_36620 11023 8633 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030087.1 protein_id gnl|my_center|LOCUS_36620 11816 11358 gene locus_tag LOCUS_36630 11816 11358 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_36630 12099 11800 gene locus_tag LOCUS_36640 12099 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 12277 12837 gene locus_tag LOCUS_36650 12277 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 13645 12845 gene locus_tag LOCUS_36660 13645 12845 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_36660 13713 14828 gene locus_tag LOCUS_36670 13713 14828 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_36670 14963 16012 gene locus_tag LOCUS_36680 14963 16012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 16038 17492 gene locus_tag LOCUS_36690 16038 17492 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_36690 18389 17883 gene locus_tag LOCUS_36700 18389 17883 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_36700 18679 19644 gene locus_tag LOCUS_36710 18679 19644 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_36710 19641 20555 gene locus_tag LOCUS_36720 19641 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_36720 20552 21109 gene locus_tag LOCUS_36730 20552 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 21106 22116 gene locus_tag LOCUS_36740 21106 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 22113 24281 gene locus_tag LOCUS_36750 22113 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 26108 24282 gene locus_tag LOCUS_36760 26108 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_36760 27242 26118 gene locus_tag LOCUS_36770 gene clpX 27242 26118 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_36770 27123 27626 gene locus_tag LOCUS_36780 27123 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 27639 27962 gene locus_tag LOCUS_36790 27639 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 27964 28497 gene locus_tag LOCUS_36800 27964 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 28484 29698 gene locus_tag LOCUS_36810 28484 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 30270 29776 gene locus_tag LOCUS_36820 30270 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 30893 30309 gene locus_tag LOCUS_36830 30893 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 31628 31047 gene locus_tag LOCUS_36840 31628 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402633.1 protein_id gnl|my_center|LOCUS_36840 33566 31629 gene locus_tag LOCUS_36850 33566 31629 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267774.1 protein_id gnl|my_center|LOCUS_36850 34117 33566 gene locus_tag LOCUS_36860 gene dcd 34117 33566 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267773.1 protein_id gnl|my_center|LOCUS_36860 34626 34114 gene locus_tag LOCUS_36870 34626 34114 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410416.1 protein_id gnl|my_center|LOCUS_36870 34528 34728 gene locus_tag LOCUS_36880 34528 34728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 34725 35522 gene locus_tag LOCUS_36890 34725 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 37955 35532 gene locus_tag LOCUS_36900 37955 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_36900 39062 37965 gene locus_tag LOCUS_36910 39062 37965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 39502 40104 gene locus_tag LOCUS_36920 39502 40104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 40207 41322 gene locus_tag LOCUS_36930 40207 41322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 42299 41427 gene locus_tag LOCUS_36940 gene rarD 42299 41427 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260942.1 protein_id gnl|my_center|LOCUS_36940 44288 42474 gene locus_tag LOCUS_36950 44288 42474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 44601 45206 gene locus_tag LOCUS_36960 44601 45206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 45285 45992 gene locus_tag LOCUS_36970 45285 45992 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_36970 46014 47726 gene locus_tag LOCUS_36980 gene ctaD 46014 47726 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_36980 47726 48328 gene locus_tag LOCUS_36990 47726 48328 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_36990 48337 48591 gene locus_tag LOCUS_37000 48337 48591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 48592 49410 gene locus_tag LOCUS_37010 48592 49410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 49462 50607 gene locus_tag LOCUS_37020 49462 50607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 52902 50656 gene locus_tag LOCUS_37030 52902 50656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 53381 53010 gene locus_tag LOCUS_37040 53381 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 54293 53505 gene locus_tag LOCUS_37050 54293 53505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 54410 55618 gene locus_tag LOCUS_37060 54410 55618 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_37060 56806 55973 gene locus_tag LOCUS_37070 56806 55973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 60744 56881 gene locus_tag LOCUS_37080 60744 56881 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_37080 62875 61148 gene locus_tag LOCUS_37090 62875 61148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 65022 63280 gene locus_tag LOCUS_37100 65022 63280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 65239 68169 gene locus_tag LOCUS_37110 65239 68169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 68180 70540 gene locus_tag LOCUS_37120 68180 70540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 70639 70908 gene locus_tag LOCUS_37130 70639 70908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 73236 70963 gene locus_tag LOCUS_37140 73236 70963 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_37140 73799 73350 gene locus_tag LOCUS_37150 73799 73350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 74450 73803 gene locus_tag LOCUS_37160 74450 73803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 74697 76040 gene locus_tag LOCUS_37170 gene pepQ 74697 76040 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_37170 76109 78217 gene locus_tag LOCUS_37180 76109 78217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 78980 79843 gene locus_tag LOCUS_37190 78980 79843 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_37190 81869 79938 gene locus_tag LOCUS_37200 81869 79938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 83555 82032 gene locus_tag LOCUS_37210 83555 82032 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_37210 83688 85049 gene locus_tag LOCUS_37220 83688 85049 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_37220 85042 86442 gene locus_tag LOCUS_37230 85042 86442 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_37230 88279 86429 gene locus_tag LOCUS_37240 88279 86429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 89001 88372 gene locus_tag LOCUS_37250 89001 88372 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_37250 89412 90620 gene locus_tag LOCUS_37260 gene capB 89412 90620 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_37260 90613 91065 gene locus_tag LOCUS_37270 gene capC 90613 91065 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_37270 91092 92270 gene locus_tag LOCUS_37280 91092 92270 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118209.1 protein_id gnl|my_center|LOCUS_37280 92267 93235 gene locus_tag LOCUS_37290 92267 93235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 93240 95228 gene locus_tag LOCUS_37300 93240 95228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 97822 95231 gene locus_tag LOCUS_37310 97822 95231 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_37310 97994 98860 gene locus_tag LOCUS_37320 97994 98860 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888458.1 protein_id gnl|my_center|LOCUS_37320 98981 100387 gene locus_tag LOCUS_37330 98981 100387 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_37330 >Feature sequence030 273 629 gene locus_tag LOCUS_37340 273 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 1271 720 gene locus_tag LOCUS_37350 1271 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 1625 1275 gene locus_tag LOCUS_37360 1625 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 2854 1934 gene locus_tag LOCUS_37370 2854 1934 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_37370 4359 2851 gene locus_tag LOCUS_37380 gene glpK2 4359 2851 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_37380 5087 4365 gene locus_tag LOCUS_37390 5087 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 5590 7011 gene locus_tag LOCUS_37400 5590 7011 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_37400 7248 8426 gene locus_tag LOCUS_37410 7248 8426 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_37410 8439 9572 gene locus_tag LOCUS_37420 gene bamB 8439 9572 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ47 protein_id gnl|my_center|LOCUS_37420 9634 10977 gene locus_tag LOCUS_37430 gene hemN 9634 10977 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_37430 10398 10304 gene locus_tag LOCUS_t00320 10398 10304 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10997 12367 gene locus_tag LOCUS_37440 10997 12367 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_37440 12459 13805 gene locus_tag LOCUS_37450 12459 13805 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_37450 13984 16830 gene locus_tag LOCUS_37460 13984 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 16874 17326 gene locus_tag LOCUS_37470 16874 17326 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_37470 17323 18039 gene locus_tag LOCUS_37480 gene lolD1 17323 18039 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_37480 18024 21554 gene locus_tag LOCUS_37490 18024 21554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_37490 21589 22044 gene locus_tag LOCUS_37500 21589 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 23026 22055 gene locus_tag LOCUS_37510 23026 22055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 23869 23156 gene locus_tag LOCUS_37520 23869 23156 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403528.1 protein_id gnl|my_center|LOCUS_37520 24677 23862 gene locus_tag LOCUS_37530 gene proC 24677 23862 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_37530 25603 24698 gene locus_tag LOCUS_37540 25603 24698 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW55 protein_id gnl|my_center|LOCUS_37540 26964 25609 gene locus_tag LOCUS_37550 26964 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 27507 27049 gene locus_tag LOCUS_37560 27507 27049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 28840 27830 gene locus_tag LOCUS_37570 gene lipA 28840 27830 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 protein_id gnl|my_center|LOCUS_37570 29071 30162 gene locus_tag LOCUS_37580 gene gluQ 29071 30162 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_37580 32030 30348 gene locus_tag LOCUS_37590 32030 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 33635 32274 gene locus_tag LOCUS_37600 gene gdhA 33635 32274 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_37600 33821 35134 gene locus_tag LOCUS_37610 33821 35134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_37610 35134 36126 gene locus_tag LOCUS_37620 35134 36126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 36209 36493 gene locus_tag LOCUS_37630 36209 36493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 36518 36940 gene locus_tag LOCUS_37640 gene ntrR1 36518 36940 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7APC4 protein_id gnl|my_center|LOCUS_37640 36978 38681 gene locus_tag LOCUS_37650 36978 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 38840 42067 gene locus_tag LOCUS_37660 38840 42067 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_37660 42106 43650 gene locus_tag LOCUS_37670 42106 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 43652 47116 gene locus_tag LOCUS_37680 43652 47116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 47106 47918 gene locus_tag LOCUS_37690 47106 47918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 50544 48007 gene locus_tag LOCUS_37700 50544 48007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 50666 51973 gene locus_tag LOCUS_37710 50666 51973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 51970 52968 gene locus_tag LOCUS_37720 51970 52968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 53049 55049 gene locus_tag LOCUS_37730 gene deaD 53049 55049 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_37730 55868 55101 gene locus_tag LOCUS_37740 55868 55101 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_37740 59043 55954 gene locus_tag LOCUS_37750 59043 55954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 60831 59233 gene locus_tag LOCUS_37760 60831 59233 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_37760 63971 60828 gene locus_tag LOCUS_37770 63971 60828 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940506.1 protein_id gnl|my_center|LOCUS_37770 65167 63917 gene locus_tag LOCUS_37780 65167 63917 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766159.1 protein_id gnl|my_center|LOCUS_37780 65592 70946 gene locus_tag LOCUS_37790 65592 70946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 73846 70973 gene locus_tag LOCUS_37800 73846 70973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 74706 73936 gene locus_tag LOCUS_37810 74706 73936 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_37810 75543 74710 gene locus_tag LOCUS_37820 75543 74710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 75799 76137 gene locus_tag LOCUS_37830 75799 76137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_37830 76134 77240 gene locus_tag LOCUS_37840 gene pyrD 76134 77240 CDS product dihydroorotate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405098.1 protein_id gnl|my_center|LOCUS_37840 78166 77243 gene locus_tag LOCUS_37850 78166 77243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 78569 78207 gene locus_tag LOCUS_37860 78569 78207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 78546 79538 gene locus_tag LOCUS_37870 78546 79538 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_37870 80334 79570 gene locus_tag LOCUS_37880 80334 79570 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_37880 80427 82118 gene locus_tag LOCUS_37890 80427 82118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 82276 85752 gene locus_tag LOCUS_37900 82276 85752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 86804 86103 gene locus_tag LOCUS_37910 86804 86103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 88697 87078 gene locus_tag LOCUS_37920 88697 87078 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_37920 88778 90325 gene locus_tag LOCUS_37930 88778 90325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 90392 90856 gene locus_tag LOCUS_37940 90392 90856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 90853 91350 gene locus_tag LOCUS_37950 90853 91350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 92598 91372 gene locus_tag LOCUS_37960 92598 91372 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NG8 protein_id gnl|my_center|LOCUS_37960 93036 93935 gene locus_tag LOCUS_37970 93036 93935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 94194 96893 gene locus_tag LOCUS_37980 gene secA 94194 96893 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence031 1804 188 gene locus_tag LOCUS_37990 1804 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3059 2109 gene locus_tag LOCUS_38000 3059 2109 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN12 protein_id gnl|my_center|LOCUS_38000 4066 3056 gene locus_tag LOCUS_38010 4066 3056 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_38010 6378 4246 gene locus_tag LOCUS_38020 6378 4246 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404836.1 protein_id gnl|my_center|LOCUS_38020 6665 7102 gene locus_tag LOCUS_38030 6665 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 7658 7116 gene locus_tag LOCUS_38040 7658 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 7899 8147 gene locus_tag LOCUS_38050 7899 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 8354 9103 gene locus_tag LOCUS_38060 8354 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 10403 9144 gene locus_tag LOCUS_38070 10403 9144 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_38070 11256 10432 gene locus_tag LOCUS_38080 11256 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 11979 11326 gene locus_tag LOCUS_38090 11979 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 12281 12970 gene locus_tag LOCUS_38100 12281 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 13033 14010 gene locus_tag LOCUS_38110 gene psuG 13033 14010 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_38110 23170 14438 gene locus_tag LOCUS_38120 23170 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 23328 25610 gene locus_tag LOCUS_38130 23328 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 25737 28802 gene locus_tag LOCUS_38140 25737 28802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 28838 29764 gene locus_tag LOCUS_38150 28838 29764 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_38150 29830 30063 gene locus_tag LOCUS_38160 29830 30063 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFG9 protein_id gnl|my_center|LOCUS_38160 30060 30449 gene locus_tag LOCUS_38170 30060 30449 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_38170 30737 31480 gene locus_tag LOCUS_38180 30737 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 31534 31896 gene locus_tag LOCUS_38190 31534 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 31896 32357 gene locus_tag LOCUS_38200 31896 32357 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_38200 32470 33873 gene locus_tag LOCUS_38210 32470 33873 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_38210 34346 33927 gene locus_tag LOCUS_38220 34346 33927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 34966 34349 gene locus_tag LOCUS_38230 34966 34349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 35288 35623 gene locus_tag LOCUS_38240 35288 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 35620 36564 gene locus_tag LOCUS_38250 35620 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 37234 38328 gene locus_tag LOCUS_38260 37234 38328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 38451 38720 gene locus_tag LOCUS_38270 38451 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 39792 38710 gene locus_tag LOCUS_38280 39792 38710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 40898 39915 gene locus_tag LOCUS_38290 40898 39915 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_38290 41036 41959 gene locus_tag LOCUS_38300 gene ilvE2 41036 41959 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_38300 42126 44273 gene locus_tag LOCUS_38310 gene bfrA 42126 44273 CDS product exogenous ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_38310 44382 45245 gene locus_tag LOCUS_38320 44382 45245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_38320 45571 45266 gene locus_tag LOCUS_38330 45571 45266 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_38330 46866 45883 gene locus_tag LOCUS_38340 46866 45883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 49852 46853 gene locus_tag LOCUS_38350 49852 46853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 50439 50095 gene locus_tag LOCUS_38360 50439 50095 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J686 protein_id gnl|my_center|LOCUS_38360 51970 50516 gene locus_tag LOCUS_38370 51970 50516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804447.1 protein_id gnl|my_center|LOCUS_38370 52499 51963 gene locus_tag LOCUS_38380 52499 51963 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_38380 53875 52496 gene locus_tag LOCUS_38390 53875 52496 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804441.1 protein_id gnl|my_center|LOCUS_38390 54918 53872 gene locus_tag LOCUS_38400 54918 53872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 57280 54932 gene locus_tag LOCUS_38410 57280 54932 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_38410 58862 57267 gene locus_tag LOCUS_38420 58862 57267 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_38420 61058 58914 gene locus_tag LOCUS_38430 61058 58914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 62013 61078 gene locus_tag LOCUS_38440 gene glsA 62013 61078 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WD71 protein_id gnl|my_center|LOCUS_38440 62125 64266 gene locus_tag LOCUS_38450 62125 64266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38450 65975 64278 gene locus_tag LOCUS_38460 gene trxB 65975 64278 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118394.1 protein_id gnl|my_center|LOCUS_38460 67152 66016 gene locus_tag LOCUS_38470 67152 66016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 69974 67287 gene locus_tag LOCUS_38480 69974 67287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 70093 72072 gene locus_tag LOCUS_38490 70093 72072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 72069 75299 gene locus_tag LOCUS_38500 72069 75299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 75330 75752 gene locus_tag LOCUS_38510 75330 75752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 75765 76136 gene locus_tag LOCUS_38520 75765 76136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 76180 76929 gene locus_tag LOCUS_38530 76180 76929 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_38530 76940 77362 gene locus_tag LOCUS_38540 76940 77362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 78686 77400 gene locus_tag LOCUS_38550 78686 77400 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_38550 78856 80256 gene locus_tag LOCUS_38560 78856 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 80471 82240 gene locus_tag LOCUS_38570 80471 82240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_38570 82340 84067 gene locus_tag LOCUS_38580 82340 84067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_38580 84120 85616 gene locus_tag LOCUS_38590 84120 85616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_38590 87283 85613 gene locus_tag LOCUS_38600 87283 85613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 87372 88079 gene locus_tag LOCUS_38610 87372 88079 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_38610 88123 89568 gene locus_tag LOCUS_38620 88123 89568 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_38620 90013 89573 gene locus_tag LOCUS_38630 90013 89573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 90877 90215 gene locus_tag LOCUS_38640 90877 90215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 92036 91059 gene locus_tag LOCUS_38650 92036 91059 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030232.1 protein_id gnl|my_center|LOCUS_38650 93459 92077 gene locus_tag LOCUS_38660 93459 92077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 94344 93514 gene locus_tag LOCUS_38670 94344 93514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 95379 94369 gene locus_tag LOCUS_38680 95379 94369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 96239 95502 gene locus_tag LOCUS_38690 96239 95502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence032 2093 285 gene locus_tag LOCUS_38700 2093 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 3736 2090 gene locus_tag LOCUS_38710 3736 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3809 5824 gene locus_tag LOCUS_38720 3809 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 5821 7521 gene locus_tag LOCUS_38730 5821 7521 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_38730 7695 10013 gene locus_tag LOCUS_38740 7695 10013 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_38740 10212 11294 gene locus_tag LOCUS_38750 10212 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 11466 14273 gene locus_tag LOCUS_38760 11466 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 14449 14955 gene locus_tag LOCUS_38770 14449 14955 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_38770 14952 15305 gene locus_tag LOCUS_38780 14952 15305 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_38780 15305 15664 gene locus_tag LOCUS_38790 15305 15664 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_38790 15670 16287 gene locus_tag LOCUS_38800 15670 16287 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_38800 16284 16706 gene locus_tag LOCUS_38810 16284 16706 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_38810 16703 17050 gene locus_tag LOCUS_38820 16703 17050 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_38820 17047 18573 gene locus_tag LOCUS_38830 17047 18573 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_38830 18570 20057 gene locus_tag LOCUS_38840 18570 20057 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_38840 20054 20329 gene locus_tag LOCUS_38850 20054 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 20333 20593 gene locus_tag LOCUS_38860 20333 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 20600 22360 gene locus_tag LOCUS_38870 20600 22360 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_38870 22368 22688 gene locus_tag LOCUS_38880 22368 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 22692 22901 gene locus_tag LOCUS_38890 22692 22901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 22992 25484 gene locus_tag LOCUS_38900 22992 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 25489 26280 gene locus_tag LOCUS_38910 25489 26280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 26441 27616 gene locus_tag LOCUS_38920 gene clpX 26441 27616 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_38920 28920 27907 gene locus_tag LOCUS_38930 28920 27907 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_38930 29642 28938 gene locus_tag LOCUS_38940 29642 28938 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391618.1 protein_id gnl|my_center|LOCUS_38940 31111 29750 gene locus_tag LOCUS_38950 31111 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 31584 31192 gene locus_tag LOCUS_38960 31584 31192 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525346.1 protein_id gnl|my_center|LOCUS_38960 31847 31581 gene locus_tag LOCUS_38970 31847 31581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 34263 31840 gene locus_tag LOCUS_38980 34263 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 34643 34278 gene locus_tag LOCUS_38990 34643 34278 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_38990 34990 34640 gene locus_tag LOCUS_39000 34990 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 35138 36679 gene locus_tag LOCUS_39010 35138 36679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 37021 37425 gene locus_tag LOCUS_39020 37021 37425 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_39020 37429 38358 gene locus_tag LOCUS_39030 37429 38358 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_39030 38358 39881 gene locus_tag LOCUS_39040 38358 39881 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_39040 41147 40071 gene locus_tag LOCUS_39050 41147 40071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 42020 41322 gene locus_tag LOCUS_39060 42020 41322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 44294 42450 gene locus_tag LOCUS_39070 44294 42450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 44589 45104 gene locus_tag LOCUS_39080 44589 45104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545294.1 protein_id gnl|my_center|LOCUS_39080 45091 45297 gene locus_tag LOCUS_39090 45091 45297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 47792 45360 gene locus_tag LOCUS_39100 47792 45360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_39100 48011 48514 gene locus_tag LOCUS_39110 gene yrdA 48011 48514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07079 protein_id gnl|my_center|LOCUS_39110 48534 49184 gene locus_tag LOCUS_39120 48534 49184 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456648.1 protein_id gnl|my_center|LOCUS_39120 49292 53047 gene locus_tag LOCUS_39130 49292 53047 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_39130 54910 53252 gene locus_tag LOCUS_39140 54910 53252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 55050 55550 gene locus_tag LOCUS_39150 55050 55550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 58332 55558 gene locus_tag LOCUS_39160 58332 55558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 58444 59643 gene locus_tag LOCUS_39170 58444 59643 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_39170 59663 60742 gene locus_tag LOCUS_39180 gene srkA 59663 60742 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F359 protein_id gnl|my_center|LOCUS_39180 61192 64110 gene locus_tag LOCUS_39190 gene oar 61192 64110 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_39190 65394 64597 gene locus_tag LOCUS_39200 65394 64597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 66498 65398 gene locus_tag LOCUS_39210 66498 65398 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_39210 66851 66585 gene locus_tag LOCUS_39220 66851 66585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_39220 66963 69635 gene locus_tag LOCUS_39230 gene polA 66963 69635 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_39230 70886 69711 gene locus_tag LOCUS_39240 70886 69711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 71335 70901 gene locus_tag LOCUS_39250 71335 70901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 71621 76465 gene locus_tag LOCUS_39260 71621 76465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 77058 76567 gene locus_tag LOCUS_39270 77058 76567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 79743 77062 gene locus_tag LOCUS_39280 79743 77062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 80696 79740 gene locus_tag LOCUS_39290 80696 79740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 82789 81092 gene locus_tag LOCUS_39300 82789 81092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 82715 82960 gene locus_tag LOCUS_39310 82715 82960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 82951 84705 gene locus_tag LOCUS_39320 82951 84705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_39320 84978 86123 gene locus_tag LOCUS_39330 84978 86123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 86896 86255 gene locus_tag LOCUS_39340 86896 86255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 87573 86998 gene locus_tag LOCUS_39350 87573 86998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 88260 87697 gene locus_tag LOCUS_39360 88260 87697 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708362.1 protein_id gnl|my_center|LOCUS_39360 88468 89493 gene locus_tag LOCUS_39370 88468 89493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 89490 92303 gene locus_tag LOCUS_39380 89490 92303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 92331 93125 gene locus_tag LOCUS_39390 92331 93125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence033 976 1356 gene locus_tag LOCUS_39400 976 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 2586 1363 gene locus_tag LOCUS_39410 2586 1363 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_39410 3360 3770 gene locus_tag LOCUS_39420 3360 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4197 3820 gene locus_tag LOCUS_39430 4197 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4298 6880 gene locus_tag LOCUS_39440 4298 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 6907 8064 gene locus_tag LOCUS_39450 6907 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 8061 9275 gene locus_tag LOCUS_39460 8061 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 9327 10742 gene locus_tag LOCUS_39470 9327 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 10747 12723 gene locus_tag LOCUS_39480 gene asnB 10747 12723 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_39480 13108 12740 gene locus_tag LOCUS_39490 13108 12740 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_39490 13197 15164 gene locus_tag LOCUS_39500 13197 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 15161 17101 gene locus_tag LOCUS_39510 15161 17101 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124155.1 protein_id gnl|my_center|LOCUS_39510 17694 17092 gene locus_tag LOCUS_39520 17694 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 18527 17841 gene locus_tag LOCUS_39530 18527 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 21253 18788 gene locus_tag LOCUS_39540 gene glgB 21253 18788 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1W2 protein_id gnl|my_center|LOCUS_39540 21287 21517 gene locus_tag LOCUS_39550 21287 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 22137 21574 gene locus_tag LOCUS_39560 22137 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 22261 24990 gene locus_tag LOCUS_39570 22261 24990 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_39570 25703 24987 gene locus_tag LOCUS_39580 gene pyrE 25703 24987 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 protein_id gnl|my_center|LOCUS_39580 25811 26752 gene locus_tag LOCUS_39590 25811 26752 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_39590 27904 27092 gene locus_tag LOCUS_39600 gene stp 27904 27092 CDS product serine/threonine phosphatase stp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y678 protein_id gnl|my_center|LOCUS_39600 28272 28054 gene locus_tag LOCUS_39610 28272 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 28357 29790 gene locus_tag LOCUS_39620 28357 29790 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_39620 29866 30429 gene locus_tag LOCUS_39630 29866 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 30435 32432 gene locus_tag LOCUS_39640 30435 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 32858 34231 gene locus_tag LOCUS_39650 32858 34231 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_39650 34254 35579 gene locus_tag LOCUS_39660 34254 35579 CDS product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635954.2 protein_id gnl|my_center|LOCUS_39660 35610 37007 gene locus_tag LOCUS_39670 35610 37007 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_39670 37018 37284 gene locus_tag LOCUS_39680 37018 37284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_39680 37407 39980 gene locus_tag LOCUS_39690 37407 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 40305 40231 gene locus_tag LOCUS_t00330 40305 40231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40454 40378 gene locus_tag LOCUS_t00340 40454 40378 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40539 40463 gene locus_tag LOCUS_t00350 40539 40463 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40709 42082 gene locus_tag LOCUS_39700 40709 42082 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_39700 42093 43541 gene locus_tag LOCUS_39710 42093 43541 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_39710 44221 43496 gene locus_tag LOCUS_39720 44221 43496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 47062 44474 gene locus_tag LOCUS_39730 47062 44474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 47061 47321 gene locus_tag LOCUS_39740 47061 47321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 50184 47473 gene locus_tag LOCUS_39750 50184 47473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 50327 51451 gene locus_tag LOCUS_39760 50327 51451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 52823 51420 gene locus_tag LOCUS_39770 52823 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 54145 52820 gene locus_tag LOCUS_39780 54145 52820 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_39780 54409 55065 gene locus_tag LOCUS_39790 gene lexA 54409 55065 CDS product lexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33927 protein_id gnl|my_center|LOCUS_39790 55259 55723 gene locus_tag LOCUS_39800 55259 55723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 55787 56569 gene locus_tag LOCUS_39810 55787 56569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_39810 56569 56847 gene locus_tag LOCUS_39820 56569 56847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 56932 60102 gene locus_tag LOCUS_39830 56932 60102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 60132 61307 gene locus_tag LOCUS_39840 gene degP 60132 61307 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_39840 61311 63374 gene locus_tag LOCUS_39850 61311 63374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 63426 63971 gene locus_tag LOCUS_39860 63426 63971 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_39860 63984 65150 gene locus_tag LOCUS_39870 63984 65150 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_39870 65196 65969 gene locus_tag LOCUS_39880 65196 65969 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_39880 66212 67825 gene locus_tag LOCUS_39890 gene pckA 66212 67825 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLL5 protein_id gnl|my_center|LOCUS_39890 68549 67815 gene locus_tag LOCUS_39900 gene ate 68549 67815 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_39900 70561 68546 gene locus_tag LOCUS_39910 70561 68546 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHI0 protein_id gnl|my_center|LOCUS_39910 71799 70582 gene locus_tag LOCUS_39920 71799 70582 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_39920 72502 72014 gene locus_tag LOCUS_39930 72502 72014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_39930 72746 72495 gene locus_tag LOCUS_39940 72746 72495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_39940 74188 72779 gene locus_tag LOCUS_39950 74188 72779 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE20 protein_id gnl|my_center|LOCUS_39950 75450 74170 gene locus_tag LOCUS_39960 gene metB 75450 74170 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_39960 76526 75450 gene locus_tag LOCUS_39970 gene metA 76526 75450 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 protein_id gnl|my_center|LOCUS_39970 77084 76899 gene locus_tag LOCUS_39980 77084 76899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 77539 79968 gene locus_tag LOCUS_39990 77539 79968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_39990 83520 79969 gene locus_tag LOCUS_40000 83520 79969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 84889 83543 gene locus_tag LOCUS_40010 84889 83543 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_40010 85388 84936 gene locus_tag LOCUS_40020 85388 84936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704230.1 protein_id gnl|my_center|LOCUS_40020 85419 86078 gene locus_tag LOCUS_40030 gene tmk 85419 86078 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_40030 86075 86920 gene locus_tag LOCUS_40040 86075 86920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 86944 88110 gene locus_tag LOCUS_40050 86944 88110 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_40050 88838 88122 gene locus_tag LOCUS_40060 88838 88122 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_40060 89219 88860 gene locus_tag LOCUS_40070 89219 88860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 89833 89444 gene locus_tag LOCUS_40080 89833 89444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 90003 90230 gene locus_tag LOCUS_40090 90003 90230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 90230 90865 gene locus_tag LOCUS_40100 90230 90865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_40100 90898 91260 gene locus_tag LOCUS_40110 90898 91260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40110 91282 91677 gene locus_tag LOCUS_40120 91282 91677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40120 92086 91697 gene locus_tag LOCUS_40130 92086 91697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence034 1136 222 gene locus_tag LOCUS_40140 1136 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 1345 2793 gene locus_tag LOCUS_40150 1345 2793 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_40150 2790 3362 gene locus_tag LOCUS_40160 2790 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_40160 3398 3814 gene locus_tag LOCUS_40170 3398 3814 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_40170 4591 4013 gene locus_tag LOCUS_40180 4591 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 6906 4669 gene locus_tag LOCUS_40190 6906 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 7191 9617 gene locus_tag LOCUS_40200 7191 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_40200 11241 10015 gene locus_tag LOCUS_40210 11241 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 13079 11238 gene locus_tag LOCUS_40220 13079 11238 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_40220 13234 14319 gene locus_tag LOCUS_40230 13234 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 14335 15492 gene locus_tag LOCUS_40240 gene atuD 14335 15492 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_40240 15699 15917 gene locus_tag LOCUS_40250 15699 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 17791 15935 gene locus_tag LOCUS_40260 17791 15935 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_40260 21863 17850 gene locus_tag LOCUS_40270 gene cyaI4 21863 17850 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967947.1 protein_id gnl|my_center|LOCUS_40270 23293 21974 gene locus_tag LOCUS_40280 23293 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_40280 25328 23415 gene locus_tag LOCUS_40290 25328 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 25479 27395 gene locus_tag LOCUS_40300 25479 27395 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_40300 30915 27427 gene locus_tag LOCUS_40310 30915 27427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40310 32103 30967 gene locus_tag LOCUS_40320 32103 30967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40320 32734 32171 gene locus_tag LOCUS_40330 32734 32171 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027853.1 protein_id gnl|my_center|LOCUS_40330 32915 35398 gene locus_tag LOCUS_40340 32915 35398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 35410 36567 gene locus_tag LOCUS_40350 35410 36567 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_40350 36615 37616 gene locus_tag LOCUS_40360 36615 37616 CDS product putative phenylacetic acid degradation protein PaaE/phenylacetate-CoA oxygenase/reductase, PaaK subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701658.1 protein_id gnl|my_center|LOCUS_40360 38799 37837 gene locus_tag LOCUS_40370 38799 37837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 39646 38969 gene locus_tag LOCUS_40380 39646 38969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 39795 40037 gene locus_tag LOCUS_40390 39795 40037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 40059 40802 gene locus_tag LOCUS_40400 40059 40802 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_40400 42044 40977 gene locus_tag LOCUS_40410 42044 40977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_40410 42145 42465 gene locus_tag LOCUS_40420 gene clpS 42145 42465 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I31 protein_id gnl|my_center|LOCUS_40420 42483 44771 gene locus_tag LOCUS_40430 42483 44771 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_40430 45252 44827 gene locus_tag LOCUS_40440 45252 44827 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_40440 45751 45275 gene locus_tag LOCUS_40450 45751 45275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_40450 46508 45816 gene locus_tag LOCUS_40460 46508 45816 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_40460 47721 46501 gene locus_tag LOCUS_40470 47721 46501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 47802 48719 gene locus_tag LOCUS_40480 47802 48719 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_40480 48740 51112 gene locus_tag LOCUS_40490 48740 51112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 54887 51216 gene locus_tag LOCUS_40500 54887 51216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 55115 57307 gene locus_tag LOCUS_40510 55115 57307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 58874 57309 gene locus_tag LOCUS_40520 58874 57309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 59659 58871 gene locus_tag LOCUS_40530 59659 58871 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 protein_id gnl|my_center|LOCUS_40530 61899 59656 gene locus_tag LOCUS_40540 61899 59656 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_40540 62028 62645 gene locus_tag LOCUS_40550 62028 62645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 62743 63891 gene locus_tag LOCUS_40560 gene metK 62743 63891 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_40560 64722 64006 gene locus_tag LOCUS_40570 64722 64006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 65336 66904 gene locus_tag LOCUS_40580 65336 66904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 71351 66924 gene locus_tag LOCUS_40590 71351 66924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 72706 71348 gene locus_tag LOCUS_40600 72706 71348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 74445 72769 gene locus_tag LOCUS_40610 74445 72769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 75117 74509 gene locus_tag LOCUS_40620 75117 74509 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGK7 protein_id gnl|my_center|LOCUS_40620 75245 77443 gene locus_tag LOCUS_40630 75245 77443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 77830 78684 gene locus_tag LOCUS_40640 77830 78684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 79846 78692 gene locus_tag LOCUS_40650 79846 78692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 79992 82487 gene locus_tag LOCUS_40660 79992 82487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 82510 83394 gene locus_tag LOCUS_40670 82510 83394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 86633 83424 gene locus_tag LOCUS_40680 86633 83424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 87199 90603 gene locus_tag LOCUS_40690 87199 90603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence035 1667 189 gene locus_tag LOCUS_40700 1667 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 2067 1621 gene locus_tag LOCUS_40710 2067 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 2690 2064 gene locus_tag LOCUS_40720 2690 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 3288 2797 gene locus_tag LOCUS_40730 3288 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_40730 3629 3285 gene locus_tag LOCUS_40740 3629 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 6584 3777 gene locus_tag LOCUS_40750 6584 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 7083 7937 gene locus_tag LOCUS_40760 7083 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 8641 8096 gene locus_tag LOCUS_40770 8641 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 9653 8862 gene locus_tag LOCUS_40780 gene nodB 9653 8862 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_40780 9629 10969 gene locus_tag LOCUS_40790 gene fabF 9629 10969 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_40790 10966 12108 gene locus_tag LOCUS_40800 10966 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 12109 14628 gene locus_tag LOCUS_40810 12109 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 14621 15547 gene locus_tag LOCUS_40820 14621 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 18302 15897 gene locus_tag LOCUS_40830 18302 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_40830 18348 18860 gene locus_tag LOCUS_40840 18348 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 19927 19136 gene locus_tag LOCUS_40850 19927 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 20513 19947 gene locus_tag LOCUS_40860 gene algU 20513 19947 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_40860 22339 20648 gene locus_tag LOCUS_40870 22339 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_40870 23298 22342 gene locus_tag LOCUS_40880 23298 22342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_40880 23455 24729 gene locus_tag LOCUS_40890 23455 24729 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143683.1 protein_id gnl|my_center|LOCUS_40890 24919 24788 gene locus_tag LOCUS_40900 24919 24788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 25528 25298 gene locus_tag LOCUS_40910 25528 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_40910 27411 25702 gene locus_tag LOCUS_40920 gene proS 27411 25702 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_40920 29274 27427 gene locus_tag LOCUS_40930 29274 27427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 30057 29287 gene locus_tag LOCUS_40940 30057 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 33332 30402 gene locus_tag LOCUS_40950 33332 30402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 33528 34706 gene locus_tag LOCUS_40960 33528 34706 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083872.1 protein_id gnl|my_center|LOCUS_40960 34709 37831 gene locus_tag LOCUS_40970 34709 37831 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881459.1 protein_id gnl|my_center|LOCUS_40970 38173 37844 gene locus_tag LOCUS_40980 38173 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 39577 38390 gene locus_tag LOCUS_40990 39577 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 39799 41670 gene locus_tag LOCUS_41000 39799 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 41680 42228 gene locus_tag LOCUS_41010 41680 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 42247 43518 gene locus_tag LOCUS_41020 gene erg3 42247 43518 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_41020 44302 43523 gene locus_tag LOCUS_41030 gene paaG 44302 43523 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_41030 44581 45372 gene locus_tag LOCUS_41040 44581 45372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41040 45397 46581 gene locus_tag LOCUS_41050 45397 46581 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_41050 46628 47230 gene locus_tag LOCUS_41060 46628 47230 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_41060 47273 48253 gene locus_tag LOCUS_41070 47273 48253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 48502 49218 gene locus_tag LOCUS_41080 48502 49218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_41080 49249 51612 gene locus_tag LOCUS_41090 49249 51612 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_41090 51616 52884 gene locus_tag LOCUS_41100 51616 52884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_41100 53121 53690 gene locus_tag LOCUS_41110 53121 53690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 53690 55588 gene locus_tag LOCUS_41120 53690 55588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 55597 56046 gene locus_tag LOCUS_41130 55597 56046 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_41130 56063 57583 gene locus_tag LOCUS_41140 56063 57583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 57580 59202 gene locus_tag LOCUS_41150 57580 59202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 59214 61538 gene locus_tag LOCUS_41160 59214 61538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 61688 62851 gene locus_tag LOCUS_41170 gene mvaS 61688 62851 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_41170 63097 62786 gene locus_tag LOCUS_41180 63097 62786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 63002 63688 gene locus_tag LOCUS_41190 63002 63688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 63709 64281 gene locus_tag LOCUS_41200 63709 64281 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_41200 65584 64424 gene locus_tag LOCUS_41210 65584 64424 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870467.1 protein_id gnl|my_center|LOCUS_41210 65876 65532 gene locus_tag LOCUS_41220 65876 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 68043 65761 gene locus_tag LOCUS_41230 gene pnp 68043 65761 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_41230 68474 68205 gene locus_tag LOCUS_41240 gene rpsO 68474 68205 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_41240 69559 68621 gene locus_tag LOCUS_41250 gene truB 69559 68621 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66922 protein_id gnl|my_center|LOCUS_41250 70536 69556 gene locus_tag LOCUS_41260 70536 69556 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_41260 70879 70511 gene locus_tag LOCUS_41270 gene rbfA 70879 70511 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_41270 71169 70876 gene locus_tag LOCUS_41280 71169 70876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411038.1 protein_id gnl|my_center|LOCUS_41280 74010 71248 gene locus_tag LOCUS_41290 74010 71248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 75730 74198 gene locus_tag LOCUS_41300 75730 74198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 76244 75744 gene locus_tag LOCUS_41310 gene rimP 76244 75744 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT6 protein_id gnl|my_center|LOCUS_41310 76818 78335 gene locus_tag LOCUS_41320 gene degP 76818 78335 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_41320 78514 79878 gene locus_tag LOCUS_41330 gene dctD 78514 79878 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_41330 80098 81243 gene locus_tag LOCUS_41340 80098 81243 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_41340 81262 82401 gene locus_tag LOCUS_41350 81262 82401 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_41350 85659 82732 gene locus_tag LOCUS_41360 85659 82732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 87512 86058 gene locus_tag LOCUS_41370 87512 86058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 87575 89443 gene locus_tag LOCUS_41380 87575 89443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 89997 89545 gene locus_tag LOCUS_41390 89997 89545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence036 539 1072 gene locus_tag LOCUS_41400 539 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 1676 1825 gene locus_tag LOCUS_41410 1676 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41410 1816 1941 gene locus_tag LOCUS_41420 1816 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1935 2774 gene locus_tag LOCUS_41430 1935 2774 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_41430 3071 2709 gene locus_tag LOCUS_41440 3071 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 5120 5386 gene locus_tag LOCUS_41450 5120 5386 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918402.1 protein_id gnl|my_center|LOCUS_41450 5380 6219 gene locus_tag LOCUS_41460 5380 6219 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_41460 6366 6154 gene locus_tag LOCUS_41470 6366 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 6900 7472 gene locus_tag LOCUS_41480 6900 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 7487 9418 gene locus_tag LOCUS_41490 7487 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 9572 12670 gene locus_tag LOCUS_41500 9572 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 14461 12749 gene locus_tag LOCUS_41510 14461 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 16876 14522 gene locus_tag LOCUS_41520 16876 14522 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_41520 23048 17277 gene locus_tag LOCUS_41530 23048 17277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975658.1 protein_id gnl|my_center|LOCUS_41530 23327 24610 gene locus_tag LOCUS_41540 23327 24610 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_41540 24607 25161 gene locus_tag LOCUS_41550 24607 25161 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529065.1 protein_id gnl|my_center|LOCUS_41550 26819 25170 gene locus_tag LOCUS_41560 26819 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 29085 26908 gene locus_tag LOCUS_41570 29085 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 32594 29166 gene locus_tag LOCUS_41580 32594 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 33255 32647 gene locus_tag LOCUS_41590 33255 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 33909 33319 gene locus_tag LOCUS_41600 33909 33319 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_41600 33948 35174 gene locus_tag LOCUS_41610 33948 35174 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_41610 35222 36388 gene locus_tag LOCUS_41620 35222 36388 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_41620 37454 36360 gene locus_tag LOCUS_41630 37454 36360 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_41630 39070 37451 gene locus_tag LOCUS_41640 39070 37451 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_41640 40244 39126 gene locus_tag LOCUS_41650 gene idiA 40244 39126 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_41650 40449 42227 gene locus_tag LOCUS_41660 40449 42227 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_41660 43763 42231 gene locus_tag LOCUS_41670 43763 42231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 45148 43763 gene locus_tag LOCUS_41680 45148 43763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 45538 45275 gene locus_tag LOCUS_41690 45538 45275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 46026 47156 gene locus_tag LOCUS_41700 46026 47156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 47408 48502 gene locus_tag LOCUS_41710 47408 48502 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 protein_id gnl|my_center|LOCUS_41710 48679 61104 gene locus_tag LOCUS_41720 48679 61104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 61280 66970 gene locus_tag LOCUS_41730 61280 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 66985 67413 gene locus_tag LOCUS_41740 66985 67413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 67488 73190 gene locus_tag LOCUS_41750 67488 73190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 73178 73636 gene locus_tag LOCUS_41760 73178 73636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 75897 74368 gene locus_tag LOCUS_41770 75897 74368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143839.1 protein_id gnl|my_center|LOCUS_41770 79854 75922 gene locus_tag LOCUS_41780 79854 75922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 80435 79935 gene locus_tag LOCUS_41790 80435 79935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_41790 81316 80432 gene locus_tag LOCUS_41800 81316 80432 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_41800 82540 81542 gene locus_tag LOCUS_41810 82540 81542 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_41810 83747 82590 gene locus_tag LOCUS_41820 83747 82590 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391547.1 protein_id gnl|my_center|LOCUS_41820 84346 83744 gene locus_tag LOCUS_41830 84346 83744 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_41830 84533 85411 gene locus_tag LOCUS_41840 84533 85411 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_41840 85595 86194 gene locus_tag LOCUS_41850 85595 86194 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357892.1 protein_id gnl|my_center|LOCUS_41850 86477 87607 gene locus_tag LOCUS_41860 86477 87607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 87781 89013 gene locus_tag LOCUS_41870 87781 89013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 89444 89028 gene locus_tag LOCUS_41880 89444 89028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence037 48 2427 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccccgcgtgggggcgtggattgaaac 2536 3567 gene locus_tag LOCUS_41890 2536 3567 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_41890 3642 6680 gene locus_tag LOCUS_41900 3642 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 7118 6957 gene locus_tag LOCUS_41910 7118 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 7072 8547 gene locus_tag LOCUS_41920 7072 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 8722 9522 gene locus_tag LOCUS_41930 gene ftsE 8722 9522 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_41930 9533 10477 gene locus_tag LOCUS_41940 gene ftsX 9533 10477 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_41940 10807 11466 gene locus_tag LOCUS_41950 10807 11466 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_41950 11540 14644 gene locus_tag LOCUS_41960 11540 14644 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_41960 14663 16060 gene locus_tag LOCUS_41970 14663 16060 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_41970 16053 16604 gene locus_tag LOCUS_41980 16053 16604 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_41980 16594 17316 gene locus_tag LOCUS_41990 16594 17316 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_41990 17309 18568 gene locus_tag LOCUS_42000 17309 18568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_42000 18561 19082 gene locus_tag LOCUS_42010 18561 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 19075 19932 gene locus_tag LOCUS_42020 19075 19932 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_42020 19935 20930 gene locus_tag LOCUS_42030 19935 20930 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_42030 20935 22611 gene locus_tag LOCUS_42040 20935 22611 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_42040 22630 23418 gene locus_tag LOCUS_42050 22630 23418 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_42050 23423 23731 gene locus_tag LOCUS_42060 23423 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 23943 24458 gene locus_tag LOCUS_42070 23943 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 25492 24581 gene locus_tag LOCUS_42080 25492 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 26159 25560 gene locus_tag LOCUS_42090 26159 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 26775 26152 gene locus_tag LOCUS_42100 gene rpoE 26775 26152 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_42100 28151 27057 gene locus_tag LOCUS_42110 gene pflA 28151 27057 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_42110 28623 28952 gene locus_tag LOCUS_42120 28623 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 29002 30078 gene locus_tag LOCUS_42130 29002 30078 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_42130 30101 30538 gene locus_tag LOCUS_42140 gene dut 30101 30538 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66592 protein_id gnl|my_center|LOCUS_42140 30676 31026 gene locus_tag LOCUS_42150 30676 31026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 31749 31144 gene locus_tag LOCUS_42160 31749 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 34097 31782 gene locus_tag LOCUS_42170 gene maeB 34097 31782 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_42170 34132 34842 gene locus_tag LOCUS_42180 34132 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 34879 35835 gene locus_tag LOCUS_42190 34879 35835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 35838 37142 gene locus_tag LOCUS_42200 35838 37142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 37139 37918 gene locus_tag LOCUS_42210 37139 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 38826 37915 gene locus_tag LOCUS_42220 38826 37915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 39236 38838 gene locus_tag LOCUS_42230 gene oxpG 39236 38838 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_42230 39850 39314 gene locus_tag LOCUS_42240 gene pulG 39850 39314 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_42240 41884 39953 gene locus_tag LOCUS_42250 41884 39953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 42483 41902 gene locus_tag LOCUS_42260 42483 41902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 43166 42480 gene locus_tag LOCUS_42270 43166 42480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 44395 43163 gene locus_tag LOCUS_42280 44395 43163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 45296 44397 gene locus_tag LOCUS_42290 45296 44397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 46992 45346 gene locus_tag LOCUS_42300 gene pulE 46992 45346 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_42300 48261 47047 gene locus_tag LOCUS_42310 gene pulF 48261 47047 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_42310 49240 48371 gene locus_tag LOCUS_42320 49240 48371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 49914 49237 gene locus_tag LOCUS_42330 49914 49237 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_42330 50064 51413 gene locus_tag LOCUS_42340 gene waaA 50064 51413 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_42340 51410 52477 gene locus_tag LOCUS_42350 gene lpxK 51410 52477 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_42350 52494 52958 gene locus_tag LOCUS_42360 52494 52958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 54928 53084 gene locus_tag LOCUS_42370 54928 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 55210 55482 gene locus_tag LOCUS_42380 55210 55482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 58256 55503 gene locus_tag LOCUS_42390 58256 55503 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140588.1 protein_id gnl|my_center|LOCUS_42390 58469 59761 gene locus_tag LOCUS_42400 58469 59761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 61024 59966 gene locus_tag LOCUS_42410 61024 59966 CDS product amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_42410 61178 61789 gene locus_tag LOCUS_42420 gene rpoE 61178 61789 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222975.1 protein_id gnl|my_center|LOCUS_42420 61783 62544 gene locus_tag LOCUS_42430 61783 62544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 62516 63178 gene locus_tag LOCUS_42440 62516 63178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 64849 63227 gene locus_tag LOCUS_42450 64849 63227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 65057 65944 gene locus_tag LOCUS_42460 65057 65944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_42460 67768 65954 gene locus_tag LOCUS_42470 67768 65954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 68507 67959 gene locus_tag LOCUS_42480 68507 67959 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_42480 70022 68541 gene locus_tag LOCUS_42490 gene glgA1 70022 68541 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_42490 71295 70033 gene locus_tag LOCUS_42500 gene glgC 71295 70033 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_42500 71625 72278 gene locus_tag LOCUS_42510 71625 72278 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_42510 72381 74282 gene locus_tag LOCUS_42520 gene fadE10 72381 74282 CDS product putative acyl-CoA dehydrogenase FadE10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQF7 protein_id gnl|my_center|LOCUS_42520 74381 75589 gene locus_tag LOCUS_42530 74381 75589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 76297 75815 gene locus_tag LOCUS_42540 76297 75815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 77339 76389 gene locus_tag LOCUS_42550 gene yedA 77339 76389 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_42550 77558 79717 gene locus_tag LOCUS_42560 gene htpG 77558 79717 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4W3 protein_id gnl|my_center|LOCUS_42560 80597 79821 gene locus_tag LOCUS_42570 80597 79821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 81539 80643 gene locus_tag LOCUS_42580 81539 80643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 82398 81625 gene locus_tag LOCUS_42590 82398 81625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 82658 82978 gene locus_tag LOCUS_42600 82658 82978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544962.1 protein_id gnl|my_center|LOCUS_42600 83087 83662 gene locus_tag LOCUS_42610 83087 83662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 83662 83982 gene locus_tag LOCUS_42620 83662 83982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 85265 84006 gene locus_tag LOCUS_42630 85265 84006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 <88304 85265 gene locus_tag LOCUS_42640 <88304 85265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459216.1:TIGR02680 family protein >Feature sequence038 1484 447 gene locus_tag LOCUS_42650 1484 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 1622 2224 gene locus_tag LOCUS_42660 1622 2224 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_42660 2221 4563 gene locus_tag LOCUS_42670 2221 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 4576 5553 gene locus_tag LOCUS_42680 4576 5553 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_42680 5550 6371 gene locus_tag LOCUS_42690 gene yedP 5550 6371 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65418 protein_id gnl|my_center|LOCUS_42690 6374 7591 gene locus_tag LOCUS_42700 6374 7591 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_42700 9373 7631 gene locus_tag LOCUS_42710 9373 7631 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_42710 10269 9442 gene locus_tag LOCUS_42720 10269 9442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_42720 12587 10266 gene locus_tag LOCUS_42730 12587 10266 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_42730 12821 14116 gene locus_tag LOCUS_42740 gene adh 12821 14116 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_42740 14113 15375 gene locus_tag LOCUS_42750 14113 15375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 15528 16955 gene locus_tag LOCUS_42760 15528 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 16962 18191 gene locus_tag LOCUS_42770 16962 18191 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110125.1 protein_id gnl|my_center|LOCUS_42770 18194 19156 gene locus_tag LOCUS_42780 18194 19156 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_42780 19174 21687 gene locus_tag LOCUS_42790 19174 21687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 24545 21705 gene locus_tag LOCUS_42800 24545 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 24787 25644 gene locus_tag LOCUS_42810 24787 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 25773 27668 gene locus_tag LOCUS_42820 25773 27668 CDS product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368471.1 protein_id gnl|my_center|LOCUS_42820 28752 27778 gene locus_tag LOCUS_42830 28752 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 29346 28858 gene locus_tag LOCUS_42840 29346 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 29859 29353 gene locus_tag LOCUS_42850 29859 29353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_42850 31396 29906 gene locus_tag LOCUS_42860 31396 29906 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_42860 32032 31409 gene locus_tag LOCUS_42870 32032 31409 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005041656.1 protein_id gnl|my_center|LOCUS_42870 33302 32169 gene locus_tag LOCUS_42880 33302 32169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_42880 33502 34758 gene locus_tag LOCUS_42890 33502 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 34787 36877 gene locus_tag LOCUS_42900 34787 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_42900 36958 37689 gene locus_tag LOCUS_42910 36958 37689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 37710 38462 gene locus_tag LOCUS_42920 37710 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 38472 40157 gene locus_tag LOCUS_42930 38472 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 40179 41483 gene locus_tag LOCUS_42940 40179 41483 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404686.1 protein_id gnl|my_center|LOCUS_42940 43699 41552 gene locus_tag LOCUS_42950 43699 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 43791 46334 gene locus_tag LOCUS_42960 43791 46334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030349.1 protein_id gnl|my_center|LOCUS_42960 48258 46471 gene locus_tag LOCUS_42970 gene cya 48258 46471 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_42970 50279 48306 gene locus_tag LOCUS_42980 50279 48306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 51700 50369 gene locus_tag LOCUS_42990 51700 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_42990 53282 51717 gene locus_tag LOCUS_43000 53282 51717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_43000 53837 53394 gene locus_tag LOCUS_43010 53837 53394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 54272 53841 gene locus_tag LOCUS_43020 54272 53841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 55008 54379 gene locus_tag LOCUS_43030 55008 54379 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_43030 57599 55065 gene locus_tag LOCUS_43040 57599 55065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_43040 60207 57604 gene locus_tag LOCUS_43050 60207 57604 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_43050 60112 60351 gene locus_tag LOCUS_43060 60112 60351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 60525 62816 gene locus_tag LOCUS_43070 gene bglX 60525 62816 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229136.1 protein_id gnl|my_center|LOCUS_43070 62813 64180 gene locus_tag LOCUS_43080 62813 64180 CDS product gluconate:H+ symporter, GntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227857.1 protein_id gnl|my_center|LOCUS_43080 64190 65329 gene locus_tag LOCUS_43090 gene gnl 64190 65329 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039182.1 protein_id gnl|my_center|LOCUS_43090 65322 65828 gene locus_tag LOCUS_43100 65322 65828 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_43100 65867 67054 gene locus_tag LOCUS_43110 gene hemN 65867 67054 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_43110 67710 67114 gene locus_tag LOCUS_43120 67710 67114 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_43120 68876 67797 gene locus_tag LOCUS_43130 68876 67797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 69013 71253 gene locus_tag LOCUS_43140 69013 71253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 71790 71257 gene locus_tag LOCUS_43150 71790 71257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 72188 72490 gene locus_tag LOCUS_43160 72188 72490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 72540 74120 gene locus_tag LOCUS_43170 72540 74120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 74248 76629 gene locus_tag LOCUS_43180 74248 76629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 79129 76706 gene locus_tag LOCUS_43190 79129 76706 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_43190 79290 80552 gene locus_tag LOCUS_43200 79290 80552 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_43200 80549 81802 gene locus_tag LOCUS_43210 80549 81802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 81799 83136 gene locus_tag LOCUS_43220 81799 83136 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_43220 83133 84374 gene locus_tag LOCUS_43230 83133 84374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 84379 85053 gene locus_tag LOCUS_43240 84379 85053 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_43240 86694 85780 gene locus_tag LOCUS_43250 86694 85780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 86999 86691 gene locus_tag LOCUS_43260 86999 86691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence039 2261 234 gene locus_tag LOCUS_43270 2261 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 2941 2258 gene locus_tag LOCUS_43280 2941 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 3460 5730 gene locus_tag LOCUS_43290 3460 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 7280 5781 gene locus_tag LOCUS_43300 gene phr 7280 5781 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_43300 7484 11578 gene locus_tag LOCUS_43310 7484 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 13976 11589 gene locus_tag LOCUS_43320 13976 11589 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_43320 15426 14044 gene locus_tag LOCUS_43330 15426 14044 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_43330 17533 15569 gene locus_tag LOCUS_43340 17533 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 18252 17530 gene locus_tag LOCUS_43350 gene cheY 18252 17530 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122299.1 protein_id gnl|my_center|LOCUS_43350 18550 20094 gene locus_tag LOCUS_43360 18550 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347929.1 protein_id gnl|my_center|LOCUS_43360 20151 20693 gene locus_tag LOCUS_43370 20151 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 20693 21238 gene locus_tag LOCUS_43380 20693 21238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 22434 21241 gene locus_tag LOCUS_43390 22434 21241 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_43390 22631 28003 gene locus_tag LOCUS_43400 22631 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 29629 28022 gene locus_tag LOCUS_43410 29629 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 31484 29754 gene locus_tag LOCUS_43420 gene sopT 31484 29754 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_43420 34064 31689 gene locus_tag LOCUS_43430 34064 31689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_43430 35416 34175 gene locus_tag LOCUS_43440 35416 34175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_43440 38598 35563 gene locus_tag LOCUS_43450 38598 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 40365 38866 gene locus_tag LOCUS_43460 40365 38866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 42155 40362 gene locus_tag LOCUS_43470 42155 40362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 43299 42181 gene locus_tag LOCUS_43480 43299 42181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 47021 43389 gene locus_tag LOCUS_43490 gene ppkA 47021 43389 CDS product serine/threonine-protein kinase PknK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119761.1 protein_id gnl|my_center|LOCUS_43490 49117 47282 gene locus_tag LOCUS_43500 49117 47282 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062663.1 protein_id gnl|my_center|LOCUS_43500 49558 50061 gene locus_tag LOCUS_43510 gene mmyF 49558 50061 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_43510 50077 51861 gene locus_tag LOCUS_43520 50077 51861 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_43520 51872 52972 gene locus_tag LOCUS_43530 gene murB 51872 52972 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUJ2 protein_id gnl|my_center|LOCUS_43530 52989 53666 gene locus_tag LOCUS_43540 gene nth 52989 53666 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_43540 54552 53674 gene locus_tag LOCUS_43550 54552 53674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 56045 54582 gene locus_tag LOCUS_43560 56045 54582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 57769 56042 gene locus_tag LOCUS_43570 57769 56042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 58094 58600 gene locus_tag LOCUS_43580 58094 58600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 58611 59570 gene locus_tag LOCUS_43590 58611 59570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 59831 60814 gene locus_tag LOCUS_43600 59831 60814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 62160 60922 gene locus_tag LOCUS_43610 62160 60922 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_43610 62337 63899 gene locus_tag LOCUS_43620 62337 63899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 63896 64708 gene locus_tag LOCUS_43630 63896 64708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 64945 64727 gene locus_tag LOCUS_43640 64945 64727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 65119 67014 gene locus_tag LOCUS_43650 65119 67014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 67512 67096 gene locus_tag LOCUS_43660 67512 67096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 68911 67967 gene locus_tag LOCUS_43670 68911 67967 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_43670 70207 69119 gene locus_tag LOCUS_43680 70207 69119 CDS product acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_43680 71436 70204 gene locus_tag LOCUS_43690 gene argD 71436 70204 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_43690 72236 71433 gene locus_tag LOCUS_43700 72236 71433 CDS product putative acetylglutamate kinase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUG6 protein_id gnl|my_center|LOCUS_43700 73437 72397 gene locus_tag LOCUS_43710 gene argC 73437 72397 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD17 protein_id gnl|my_center|LOCUS_43710 74470 73508 gene locus_tag LOCUS_43720 74470 73508 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_43720 74739 74467 gene locus_tag LOCUS_43730 74739 74467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 76189 75200 gene locus_tag LOCUS_43740 76189 75200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 76816 76214 gene locus_tag LOCUS_43750 76816 76214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 77571 76816 gene locus_tag LOCUS_43760 77571 76816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 77685 78464 gene locus_tag LOCUS_43770 gene yqjF 77685 78464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_43770 78531 78944 gene locus_tag LOCUS_43780 78531 78944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 79471 78947 gene locus_tag LOCUS_43790 79471 78947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 79668 80714 gene locus_tag LOCUS_43800 79668 80714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 80754 81824 gene locus_tag LOCUS_43810 80754 81824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence040 1956 163 gene locus_tag LOCUS_43820 gene lpd 1956 163 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NW1 protein_id gnl|my_center|LOCUS_43820 2847 2059 gene locus_tag LOCUS_43830 2847 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_43830 4290 3040 gene locus_tag LOCUS_43840 4290 3040 CDS product peptidase ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_43840 4554 7316 gene locus_tag LOCUS_43850 4554 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 7618 7358 gene locus_tag LOCUS_43860 gene ccmL 7618 7358 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056789.1 protein_id gnl|my_center|LOCUS_43860 7925 7632 gene locus_tag LOCUS_43870 7925 7632 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_43870 8524 7925 gene locus_tag LOCUS_43880 8524 7925 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_43880 9999 8524 gene locus_tag LOCUS_43890 9999 8524 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_43890 10283 9996 gene locus_tag LOCUS_43900 gene eutN 10283 9996 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118935.1 protein_id gnl|my_center|LOCUS_43900 10570 10283 gene locus_tag LOCUS_43910 gene ccmK2 10570 10283 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_43910 11283 10651 gene locus_tag LOCUS_43920 11283 10651 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_43920 12145 11270 gene locus_tag LOCUS_43930 gene deoC 12145 11270 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFK2 protein_id gnl|my_center|LOCUS_43930 12750 12220 gene locus_tag LOCUS_43940 12750 12220 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393869.1 protein_id gnl|my_center|LOCUS_43940 12880 13095 gene locus_tag LOCUS_43950 12880 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258117.1 protein_id gnl|my_center|LOCUS_43950 13243 14943 gene locus_tag LOCUS_43960 13243 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 15574 14927 gene locus_tag LOCUS_43970 15574 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 17234 15603 gene locus_tag LOCUS_43980 17234 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 17763 17326 gene locus_tag LOCUS_43990 gene vapC25 17763 17326 CDS product ribonuclease VapC25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF85 protein_id gnl|my_center|LOCUS_43990 18020 17760 gene locus_tag LOCUS_44000 18020 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 18463 18083 gene locus_tag LOCUS_44010 18463 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 18523 18912 gene locus_tag LOCUS_44020 18523 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 18922 20823 gene locus_tag LOCUS_44030 gene mutL 18922 20823 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ86 protein_id gnl|my_center|LOCUS_44030 21051 21803 gene locus_tag LOCUS_44040 gene rnc 21051 21803 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MUJ1 protein_id gnl|my_center|LOCUS_44040 21839 23143 gene locus_tag LOCUS_44050 gene asnS 21839 23143 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA97 protein_id gnl|my_center|LOCUS_44050 23179 24069 gene locus_tag LOCUS_44060 23179 24069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_44060 24142 24750 gene locus_tag LOCUS_44070 24142 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 25582 25025 gene locus_tag LOCUS_44080 25582 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 25794 26372 gene locus_tag LOCUS_44090 gene pyrR 25794 26372 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K6 protein_id gnl|my_center|LOCUS_44090 26369 27319 gene locus_tag LOCUS_44100 gene pyrB 26369 27319 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_44100 27322 28632 gene locus_tag LOCUS_44110 gene pyrC 27322 28632 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 protein_id gnl|my_center|LOCUS_44110 28625 29518 gene locus_tag LOCUS_44120 gene suhB 28625 29518 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 protein_id gnl|my_center|LOCUS_44120 29672 30787 gene locus_tag LOCUS_44130 29672 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 31555 30800 gene locus_tag LOCUS_44140 31555 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108665.1 protein_id gnl|my_center|LOCUS_44140 31732 32946 gene locus_tag LOCUS_44150 31732 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 32980 34014 gene locus_tag LOCUS_44160 32980 34014 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_44160 34019 36973 gene locus_tag LOCUS_44170 34019 36973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 37287 37541 gene locus_tag LOCUS_44180 37287 37541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 37531 37878 gene locus_tag LOCUS_44190 37531 37878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 38884 39807 gene locus_tag LOCUS_44200 38884 39807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_44200 39946 40179 gene locus_tag LOCUS_44210 39946 40179 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRZ3 protein_id gnl|my_center|LOCUS_44210 40182 40592 gene locus_tag LOCUS_44220 40182 40592 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_44220 40671 41519 gene locus_tag LOCUS_44230 40671 41519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 41503 43374 gene locus_tag LOCUS_44240 41503 43374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 43427 44764 gene locus_tag LOCUS_44250 43427 44764 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_44250 44906 45343 gene locus_tag LOCUS_44260 44906 45343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 45396 47024 gene locus_tag LOCUS_44270 gene trxB 45396 47024 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118394.1 protein_id gnl|my_center|LOCUS_44270 48106 47093 gene locus_tag LOCUS_44280 48106 47093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 48955 48113 gene locus_tag LOCUS_44290 48955 48113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_44290 49309 49004 gene locus_tag LOCUS_44300 49309 49004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 49260 50078 gene locus_tag LOCUS_44310 49260 50078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 50075 51592 gene locus_tag LOCUS_44320 50075 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 51597 51746 gene locus_tag LOCUS_44330 51597 51746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 54492 51751 gene locus_tag LOCUS_44340 54492 51751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 54616 55992 gene locus_tag LOCUS_44350 54616 55992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 59207 55989 gene locus_tag LOCUS_44360 gene dnaE2 59207 55989 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT5 protein_id gnl|my_center|LOCUS_44360 60767 59328 gene locus_tag LOCUS_44370 60767 59328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 60920 62365 gene locus_tag LOCUS_44380 60920 62365 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_44380 63425 62418 gene locus_tag LOCUS_44390 63425 62418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 66506 63465 gene locus_tag LOCUS_44400 66506 63465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 70167 66493 gene locus_tag LOCUS_44410 70167 66493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 71233 70199 gene locus_tag LOCUS_44420 71233 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 protein_id gnl|my_center|LOCUS_44420 71453 71671 gene locus_tag LOCUS_44430 71453 71671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 74874 71644 gene locus_tag LOCUS_44440 74874 71644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 75014 77737 gene locus_tag LOCUS_44450 75014 77737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 78208 77813 gene locus_tag LOCUS_44460 78208 77813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 78788 78471 gene locus_tag LOCUS_44470 78788 78471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 >Feature sequence041 922 137 gene locus_tag LOCUS_44480 922 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 1612 926 gene locus_tag LOCUS_44490 1612 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2062 1652 gene locus_tag LOCUS_44500 2062 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 5467 2162 gene locus_tag LOCUS_44510 5467 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 6035 5571 gene locus_tag LOCUS_44520 6035 5571 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_44520 6237 6482 gene locus_tag LOCUS_44530 6237 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 6446 7204 gene locus_tag LOCUS_44540 6446 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 7318 8271 gene locus_tag LOCUS_44550 7318 8271 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_44550 8426 13921 gene locus_tag LOCUS_44560 8426 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 13946 14152 gene locus_tag LOCUS_44570 13946 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 14244 16010 gene locus_tag LOCUS_44580 14244 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_44580 16205 17269 gene locus_tag LOCUS_44590 gene hemE 16205 17269 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_44590 21032 17385 gene locus_tag LOCUS_44600 21032 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 24879 21265 gene locus_tag LOCUS_44610 24879 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 26810 24996 gene locus_tag LOCUS_44620 26810 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 27363 26782 gene locus_tag LOCUS_44630 27363 26782 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_44630 28046 27360 gene locus_tag LOCUS_44640 28046 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 29460 28060 gene locus_tag LOCUS_44650 29460 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 29716 29504 gene locus_tag LOCUS_44660 gene hfq 29716 29504 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A74 protein_id gnl|my_center|LOCUS_44660 30678 29737 gene locus_tag LOCUS_44670 gene miaA 30678 29737 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_44670 33030 30688 gene locus_tag LOCUS_44680 gene comE 33030 30688 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_44680 33142 34101 gene locus_tag LOCUS_44690 33142 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 35252 34104 gene locus_tag LOCUS_44700 35252 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 35340 35576 gene locus_tag LOCUS_44710 35340 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 38102 36000 gene locus_tag LOCUS_44720 38102 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 39366 38119 gene locus_tag LOCUS_44730 39366 38119 CDS product putative mannose-6-phosphate isomerase ManA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704330.1 protein_id gnl|my_center|LOCUS_44730 40233 39376 gene locus_tag LOCUS_44740 40233 39376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_44740 40412 41773 gene locus_tag LOCUS_44750 gene creD 40412 41773 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_44750 43630 41894 gene locus_tag LOCUS_44760 43630 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 44097 43627 gene locus_tag LOCUS_44770 44097 43627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 44608 44180 gene locus_tag LOCUS_44780 gene vapC 44608 44180 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK4 protein_id gnl|my_center|LOCUS_44780 44900 44613 gene locus_tag LOCUS_44790 44900 44613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 45111 46550 gene locus_tag LOCUS_44800 45111 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 46661 47035 gene locus_tag LOCUS_44810 46661 47035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 48456 47092 gene locus_tag LOCUS_44820 48456 47092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_44820 48835 48617 gene locus_tag LOCUS_44830 48835 48617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 48798 49769 gene locus_tag LOCUS_44840 48798 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 49782 51839 gene locus_tag LOCUS_44850 49782 51839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 51942 54593 gene locus_tag LOCUS_44860 51942 54593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 54590 55072 gene locus_tag LOCUS_44870 54590 55072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 55739 55089 gene locus_tag LOCUS_44880 55739 55089 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_44880 56413 55817 gene locus_tag LOCUS_44890 56413 55817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 56785 56438 gene locus_tag LOCUS_44900 56785 56438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 59502 56836 gene locus_tag LOCUS_44910 59502 56836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 59676 60845 gene locus_tag LOCUS_44920 59676 60845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 60842 62437 gene locus_tag LOCUS_44930 gene tetV 60842 62437 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 protein_id gnl|my_center|LOCUS_44930 63103 63549 gene locus_tag LOCUS_44940 63103 63549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 64085 63474 gene locus_tag LOCUS_44950 64085 63474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44950 65899 64598 gene locus_tag LOCUS_44960 65899 64598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 67795 66047 gene locus_tag LOCUS_44970 67795 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 68328 67837 gene locus_tag LOCUS_44980 68328 67837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 72022 68459 gene locus_tag LOCUS_44990 72022 68459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 75750 72058 gene locus_tag LOCUS_45000 75750 72058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 77163 75886 gene locus_tag LOCUS_45010 77163 75886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 78355 77156 gene locus_tag LOCUS_45020 78355 77156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 78962 79471 gene locus_tag LOCUS_45030 78962 79471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence042 904 551 gene locus_tag LOCUS_45040 904 551 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_45040 1404 976 gene locus_tag LOCUS_45050 1404 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 1610 2812 gene locus_tag LOCUS_45060 gene argG 1610 2812 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_45060 2809 4212 gene locus_tag LOCUS_45070 gene argH 2809 4212 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34858 protein_id gnl|my_center|LOCUS_45070 4424 5422 gene locus_tag LOCUS_45080 4424 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 5473 6378 gene locus_tag LOCUS_45090 5473 6378 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_45090 6778 6356 gene locus_tag LOCUS_45100 6778 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 6931 7746 gene locus_tag LOCUS_45110 6931 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 7743 8405 gene locus_tag LOCUS_45120 7743 8405 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L71 protein_id gnl|my_center|LOCUS_45120 8402 9295 gene locus_tag LOCUS_45130 8402 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 9297 10226 gene locus_tag LOCUS_45140 9297 10226 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_45140 10339 11679 gene locus_tag LOCUS_45150 10339 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 11738 11974 gene locus_tag LOCUS_45160 11738 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 12211 12915 gene locus_tag LOCUS_45170 12211 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 13185 13009 gene locus_tag LOCUS_45180 gene tatA 13185 13009 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM8 protein_id gnl|my_center|LOCUS_45180 13445 13765 gene locus_tag LOCUS_45190 13445 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 13783 14859 gene locus_tag LOCUS_45200 gene rlmN 13783 14859 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_45200 17442 15076 gene locus_tag LOCUS_45210 gene mrcB 17442 15076 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_45210 19082 17628 gene locus_tag LOCUS_45220 19082 17628 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_45220 21097 19091 gene locus_tag LOCUS_45230 21097 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 22857 21094 gene locus_tag LOCUS_45240 22857 21094 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_45240 24857 22983 gene locus_tag LOCUS_45250 24857 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 26692 24854 gene locus_tag LOCUS_45260 26692 24854 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_45260 32123 26727 gene locus_tag LOCUS_45270 32123 26727 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_45270 32813 32550 gene locus_tag LOCUS_45280 32813 32550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 33413 32823 gene locus_tag LOCUS_45290 33413 32823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 34126 33410 gene locus_tag LOCUS_45300 34126 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 35065 34505 gene locus_tag LOCUS_45310 35065 34505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 35281 35526 gene locus_tag LOCUS_45320 35281 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 36824 35523 gene locus_tag LOCUS_45330 36824 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 36955 37971 gene locus_tag LOCUS_45340 36955 37971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 38137 39531 gene locus_tag LOCUS_45350 38137 39531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 39528 40223 gene locus_tag LOCUS_45360 39528 40223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 40220 41458 gene locus_tag LOCUS_45370 40220 41458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 41463 42884 gene locus_tag LOCUS_45380 41463 42884 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_45380 42941 43342 gene locus_tag LOCUS_45390 42941 43342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 44771 43749 gene locus_tag LOCUS_45400 44771 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 45091 44774 gene locus_tag LOCUS_45410 45091 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 45579 46187 gene locus_tag LOCUS_45420 45579 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 47332 46295 gene locus_tag LOCUS_45430 gene recA 47332 46295 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_45430 47594 48298 gene locus_tag LOCUS_45440 47594 48298 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_45440 48377 49003 gene locus_tag LOCUS_45450 48377 49003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 49132 50106 gene locus_tag LOCUS_45460 49132 50106 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_45460 50115 51185 gene locus_tag LOCUS_45470 50115 51185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 51280 53442 gene locus_tag LOCUS_45480 51280 53442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 54345 54887 gene locus_tag LOCUS_45490 54345 54887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 55040 56674 gene locus_tag LOCUS_45500 55040 56674 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_45500 57068 56736 gene locus_tag LOCUS_45510 57068 56736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_45510 57373 57065 gene locus_tag LOCUS_45520 57373 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 57971 57438 gene locus_tag LOCUS_45530 57971 57438 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388274.1 protein_id gnl|my_center|LOCUS_45530 59278 57968 gene locus_tag LOCUS_45540 gene norM 59278 57968 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W72 protein_id gnl|my_center|LOCUS_45540 59475 62570 gene locus_tag LOCUS_45550 59475 62570 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_45550 62799 63881 gene locus_tag LOCUS_45560 62799 63881 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_45560 64213 64674 gene locus_tag LOCUS_45570 64213 64674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 64707 65426 gene locus_tag LOCUS_45580 64707 65426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_45580 66644 65427 gene locus_tag LOCUS_45590 66644 65427 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_45590 67869 66649 gene locus_tag LOCUS_45600 67869 66649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 69715 67967 gene locus_tag LOCUS_45610 69715 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 70717 69806 gene locus_tag LOCUS_45620 70717 69806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 71799 70777 gene locus_tag LOCUS_45630 71799 70777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 73832 71880 gene locus_tag LOCUS_45640 73832 71880 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 protein_id gnl|my_center|LOCUS_45640 74065 74805 gene locus_tag LOCUS_45650 74065 74805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 >Feature sequence043 8 868 gene locus_tag LOCUS_45660 8 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 3285 1141 gene locus_tag LOCUS_45670 3285 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 4925 3300 gene locus_tag LOCUS_45680 4925 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 6141 5077 gene locus_tag LOCUS_45690 6141 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_45690 7229 6240 gene locus_tag LOCUS_45700 7229 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 7332 7721 gene locus_tag LOCUS_45710 7332 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 7852 8130 gene locus_tag LOCUS_45720 7852 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 8333 9727 gene locus_tag LOCUS_45730 8333 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 9712 11394 gene locus_tag LOCUS_45740 9712 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 11815 14973 gene locus_tag LOCUS_45750 11815 14973 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_45750 16075 15032 gene locus_tag LOCUS_45760 16075 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 17110 16118 gene locus_tag LOCUS_45770 17110 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 17351 18625 gene locus_tag LOCUS_45780 17351 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_45780 19946 18636 gene locus_tag LOCUS_45790 19946 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120748.1 protein_id gnl|my_center|LOCUS_45790 20055 20648 gene locus_tag LOCUS_45800 gene rpoE3 20055 20648 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_45800 21717 20797 gene locus_tag LOCUS_45810 21717 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 25450 21836 gene locus_tag LOCUS_45820 25450 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 29217 25897 gene locus_tag LOCUS_45830 29217 25897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_45830 29796 30599 gene locus_tag LOCUS_45840 29796 30599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 30724 31920 gene locus_tag LOCUS_45850 30724 31920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 32345 32602 gene locus_tag LOCUS_45860 32345 32602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 35844 32599 gene locus_tag LOCUS_45870 35844 32599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 35924 37318 gene locus_tag LOCUS_45880 35924 37318 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_45880 37512 40652 gene locus_tag LOCUS_45890 37512 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 41352 40639 gene locus_tag LOCUS_45900 41352 40639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 41351 43762 gene locus_tag LOCUS_45910 41351 43762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 43867 44205 gene locus_tag LOCUS_45920 43867 44205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 44209 46959 gene locus_tag LOCUS_45930 44209 46959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_45930 48815 46986 gene locus_tag LOCUS_45940 48815 46986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 50890 48812 gene locus_tag LOCUS_45950 50890 48812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 53858 50991 gene locus_tag LOCUS_45960 53858 50991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_45960 55098 54118 gene locus_tag LOCUS_45970 55098 54118 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_45970 55266 56996 gene locus_tag LOCUS_45980 55266 56996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 58278 57367 gene locus_tag LOCUS_45990 58278 57367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 58502 59068 gene locus_tag LOCUS_46000 58502 59068 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_46000 61742 59205 gene locus_tag LOCUS_46010 61742 59205 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_46010 62111 63694 gene locus_tag LOCUS_46020 62111 63694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 64924 64367 gene locus_tag LOCUS_46030 64924 64367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 65707 65126 gene locus_tag LOCUS_46040 65707 65126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 66481 65732 gene locus_tag LOCUS_46050 66481 65732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 66893 66624 gene locus_tag LOCUS_46060 66893 66624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 67993 66878 gene locus_tag LOCUS_46070 67993 66878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 68831 68439 gene locus_tag LOCUS_46080 68831 68439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 69130 69450 gene locus_tag LOCUS_46090 69130 69450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 69461 70354 gene locus_tag LOCUS_46100 69461 70354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 70540 70376 gene locus_tag LOCUS_46110 70540 70376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 72017 71712 gene locus_tag LOCUS_46120 72017 71712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence044 564 160 gene locus_tag LOCUS_46130 564 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 1373 771 gene locus_tag LOCUS_46140 1373 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 2119 1352 gene locus_tag LOCUS_46150 2119 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 2505 2134 gene locus_tag LOCUS_46160 2505 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 2584 3963 gene locus_tag LOCUS_46170 2584 3963 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_46170 4009 4239 gene locus_tag LOCUS_46180 4009 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 4661 5791 gene locus_tag LOCUS_46190 4661 5791 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_46190 5761 7059 gene locus_tag LOCUS_46200 5761 7059 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_46200 7197 8519 gene locus_tag LOCUS_46210 7197 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 8516 9340 gene locus_tag LOCUS_46220 8516 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 9295 9543 gene locus_tag LOCUS_46230 9295 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 9804 10505 gene locus_tag LOCUS_46240 9804 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 12126 10486 gene locus_tag LOCUS_46250 12126 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 13326 12235 gene locus_tag LOCUS_46260 gene ychF 13326 12235 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF19 protein_id gnl|my_center|LOCUS_46260 13217 13498 gene locus_tag LOCUS_46270 13217 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 13585 16188 gene locus_tag LOCUS_46280 13585 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 16315 20415 gene locus_tag LOCUS_46290 gene cyaI3 16315 20415 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967832.1 protein_id gnl|my_center|LOCUS_46290 20563 22854 gene locus_tag LOCUS_46300 20563 22854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_46300 24628 22952 gene locus_tag LOCUS_46310 24628 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 25893 24640 gene locus_tag LOCUS_46320 25893 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 28145 25890 gene locus_tag LOCUS_46330 28145 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 30358 28142 gene locus_tag LOCUS_46340 30358 28142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 31695 30445 gene locus_tag LOCUS_46350 31695 30445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 32972 31692 gene locus_tag LOCUS_46360 32972 31692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 34222 32969 gene locus_tag LOCUS_46370 34222 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 36958 34244 gene locus_tag LOCUS_46380 36958 34244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 37945 36974 gene locus_tag LOCUS_46390 37945 36974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 38865 37945 gene locus_tag LOCUS_46400 38865 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 39729 38992 gene locus_tag LOCUS_46410 39729 38992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 41311 39722 gene locus_tag LOCUS_46420 41311 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 42555 41308 gene locus_tag LOCUS_46430 42555 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 43066 42548 gene locus_tag LOCUS_46440 43066 42548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 45004 43139 gene locus_tag LOCUS_46450 45004 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 46302 45124 gene locus_tag LOCUS_46460 46302 45124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 47618 46359 gene locus_tag LOCUS_46470 47618 46359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 48052 47636 gene locus_tag LOCUS_46480 48052 47636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 48531 48043 gene locus_tag LOCUS_46490 48531 48043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 49422 48553 gene locus_tag LOCUS_46500 49422 48553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 49683 49435 gene locus_tag LOCUS_46510 gene acpP 49683 49435 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP4 protein_id gnl|my_center|LOCUS_46510 50306 49926 gene locus_tag LOCUS_46520 50306 49926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 51362 50754 gene locus_tag LOCUS_46530 51362 50754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_46530 51513 52088 gene locus_tag LOCUS_46540 51513 52088 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_46540 52085 53407 gene locus_tag LOCUS_46550 52085 53407 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_46550 53490 53885 gene locus_tag LOCUS_46560 53490 53885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 55237 53924 gene locus_tag LOCUS_46570 55237 53924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 57001 55298 gene locus_tag LOCUS_46580 57001 55298 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_46580 57217 59676 gene locus_tag LOCUS_46590 57217 59676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 60100 60600 gene locus_tag LOCUS_46600 60100 60600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 60863 64411 gene locus_tag LOCUS_46610 60863 64411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 64440 65345 gene locus_tag LOCUS_46620 gene dapA 64440 65345 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK4 protein_id gnl|my_center|LOCUS_46620 65342 65998 gene locus_tag LOCUS_46630 65342 65998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 66008 68251 gene locus_tag LOCUS_46640 66008 68251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 68274 68570 gene locus_tag LOCUS_46650 68274 68570 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461368.1 protein_id gnl|my_center|LOCUS_46650 68884 68543 gene locus_tag LOCUS_46660 68884 68543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 69384 68977 gene locus_tag LOCUS_46670 69384 68977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 >Feature sequence045 1235 147 gene locus_tag LOCUS_46680 1235 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 1564 2748 gene locus_tag LOCUS_46690 1564 2748 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_46690 2777 3202 gene locus_tag LOCUS_46700 2777 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 3293 5176 gene locus_tag LOCUS_46710 3293 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 5173 5550 gene locus_tag LOCUS_46720 gene cheY 5173 5550 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4H5 protein_id gnl|my_center|LOCUS_46720 5553 6251 gene locus_tag LOCUS_46730 5553 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 6288 6752 gene locus_tag LOCUS_46740 6288 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 6769 7713 gene locus_tag LOCUS_46750 6769 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 7784 8947 gene locus_tag LOCUS_46760 gene ydiP 7784 8947 CDS product putative BsuMI modification methylase subunit YdiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34680 protein_id gnl|my_center|LOCUS_46760 8956 9399 gene locus_tag LOCUS_46770 gene vsr 8956 9399 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970457.1 protein_id gnl|my_center|LOCUS_46770 9736 9419 gene locus_tag LOCUS_46780 9736 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_46780 10405 9767 gene locus_tag LOCUS_46790 10405 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 10977 10405 gene locus_tag LOCUS_46800 gene rfaY 10977 10405 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_46800 12171 10999 gene locus_tag LOCUS_46810 12171 10999 CDS product Na+ ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_46810 12908 12171 gene locus_tag LOCUS_46820 gene natA 12908 12171 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_46820 14433 12928 gene locus_tag LOCUS_46830 14433 12928 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_46830 14951 14706 gene locus_tag LOCUS_46840 14951 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 14911 16116 gene locus_tag LOCUS_46850 14911 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 16119 17369 gene locus_tag LOCUS_46860 16119 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 18424 17351 gene locus_tag LOCUS_46870 18424 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 20475 18598 gene locus_tag LOCUS_46880 20475 18598 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_46880 20584 21297 gene locus_tag LOCUS_46890 20584 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 21372 23630 gene locus_tag LOCUS_46900 21372 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 25468 23627 gene locus_tag LOCUS_46910 25468 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 26166 25486 gene locus_tag LOCUS_46920 26166 25486 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_46920 27678 26350 gene locus_tag LOCUS_46930 27678 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 28808 27843 gene locus_tag LOCUS_46940 28808 27843 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_46940 29458 28805 gene locus_tag LOCUS_46950 29458 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 30784 29648 gene locus_tag LOCUS_46960 30784 29648 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381494.1 protein_id gnl|my_center|LOCUS_46960 31036 31401 gene locus_tag LOCUS_46970 31036 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 31403 32122 gene locus_tag LOCUS_46980 31403 32122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 32115 34766 gene locus_tag LOCUS_46990 32115 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 37213 34772 gene locus_tag LOCUS_47000 37213 34772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 38611 37370 gene locus_tag LOCUS_47010 38611 37370 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7K8 protein_id gnl|my_center|LOCUS_47010 38770 39177 gene locus_tag LOCUS_47020 38770 39177 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_47020 40146 39178 gene locus_tag LOCUS_47030 40146 39178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 40207 42132 gene locus_tag LOCUS_47040 40207 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 42183 45926 gene locus_tag LOCUS_47050 42183 45926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 46108 46455 gene locus_tag LOCUS_47060 46108 46455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 47110 46478 gene locus_tag LOCUS_47070 47110 46478 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_47070 49104 47335 gene locus_tag LOCUS_47080 49104 47335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 49175 49585 gene locus_tag LOCUS_47090 49175 49585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969851.1 protein_id gnl|my_center|LOCUS_47090 49592 50824 gene locus_tag LOCUS_47100 49592 50824 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_47100 50859 51137 gene locus_tag LOCUS_47110 50859 51137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 51776 51210 gene locus_tag LOCUS_47120 51776 51210 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_47120 54737 51816 gene locus_tag LOCUS_47130 54737 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 55204 55025 gene locus_tag LOCUS_47140 55204 55025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 56324 55341 gene locus_tag LOCUS_47150 56324 55341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 57592 56336 gene locus_tag LOCUS_47160 57592 56336 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_47160 57872 57621 gene locus_tag LOCUS_47170 gene acpP 57872 57621 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E38 protein_id gnl|my_center|LOCUS_47170 58832 58089 gene locus_tag LOCUS_47180 58832 58089 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_47180 59873 58851 gene locus_tag LOCUS_47190 gene plsX 59873 58851 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_47190 60063 59878 gene locus_tag LOCUS_47200 gene rpmF 60063 59878 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_47200 60740 60183 gene locus_tag LOCUS_47210 60740 60183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_47210 62879 60891 gene locus_tag LOCUS_47220 62879 60891 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124155.1 protein_id gnl|my_center|LOCUS_47220 62987 63982 gene locus_tag LOCUS_47230 62987 63982 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118476.1 protein_id gnl|my_center|LOCUS_47230 63955 65586 gene locus_tag LOCUS_47240 gene prnC 63955 65586 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_47240 65608 65898 gene locus_tag LOCUS_47250 65608 65898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 65908 66726 gene locus_tag LOCUS_47260 65908 66726 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_47260 68357 66747 gene locus_tag LOCUS_47270 68357 66747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence046 1084 461 gene locus_tag LOCUS_47280 1084 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 1377 2129 gene locus_tag LOCUS_47290 1377 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 3387 2221 gene locus_tag LOCUS_47300 3387 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 5087 3417 gene locus_tag LOCUS_47310 5087 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 5901 5494 gene locus_tag LOCUS_47320 5901 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 6078 8126 gene locus_tag LOCUS_47330 6078 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 8263 9987 gene locus_tag LOCUS_47340 8263 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 9987 11918 gene locus_tag LOCUS_47350 9987 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 12180 13562 gene locus_tag LOCUS_47360 12180 13562 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_47360 14169 13573 gene locus_tag LOCUS_47370 14169 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_47370 14297 15145 gene locus_tag LOCUS_47380 14297 15145 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948306.1 protein_id gnl|my_center|LOCUS_47380 15314 17479 gene locus_tag LOCUS_47390 15314 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 17490 18833 gene locus_tag LOCUS_47400 17490 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 19265 18897 gene locus_tag LOCUS_47410 19265 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 19430 21595 gene locus_tag LOCUS_47420 19430 21595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_47420 21698 21934 gene locus_tag LOCUS_47430 21698 21934 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_47430 23069 22008 gene locus_tag LOCUS_47440 23069 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 24247 23084 gene locus_tag LOCUS_47450 24247 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 24341 27769 gene locus_tag LOCUS_47460 24341 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 35603 27726 gene locus_tag LOCUS_47470 35603 27726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 35826 35626 gene locus_tag LOCUS_47480 35826 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 36157 37605 gene locus_tag LOCUS_47490 36157 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 38680 37532 gene locus_tag LOCUS_47500 38680 37532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 39756 38677 gene locus_tag LOCUS_47510 39756 38677 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_47510 40961 39756 gene locus_tag LOCUS_47520 40961 39756 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_47520 42691 40979 gene locus_tag LOCUS_47530 42691 40979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 43419 42688 gene locus_tag LOCUS_47540 43419 42688 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_47540 43839 43522 gene locus_tag LOCUS_47550 43839 43522 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103070.1 protein_id gnl|my_center|LOCUS_47550 45626 43845 gene locus_tag LOCUS_47560 45626 43845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 47502 45697 gene locus_tag LOCUS_47570 47502 45697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 48616 47513 gene locus_tag LOCUS_47580 48616 47513 CDS product acetylneuraminic acid synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_47580 49266 48613 gene locus_tag LOCUS_47590 49266 48613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 50131 49304 gene locus_tag LOCUS_47600 gene dthD 50131 49304 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYC2 protein_id gnl|my_center|LOCUS_47600 51164 50124 gene locus_tag LOCUS_47610 51164 50124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 52030 51161 gene locus_tag LOCUS_47620 52030 51161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 52859 52122 gene locus_tag LOCUS_47630 gene spsF 52859 52122 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_47630 53740 52925 gene locus_tag LOCUS_47640 53740 52925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 53930 55081 gene locus_tag LOCUS_47650 53930 55081 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_47650 55074 56255 gene locus_tag LOCUS_47660 55074 56255 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_47660 56252 57676 gene locus_tag LOCUS_47670 56252 57676 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_47670 57768 59108 gene locus_tag LOCUS_47680 57768 59108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 59871 60671 gene locus_tag LOCUS_47690 59871 60671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 61143 60757 gene locus_tag LOCUS_47700 61143 60757 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_47700 61475 63370 gene locus_tag LOCUS_47710 61475 63370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 63513 66785 gene locus_tag LOCUS_47720 63513 66785 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV0 protein_id gnl|my_center|LOCUS_47720 66857 68458 gene locus_tag LOCUS_47730 66857 68458 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122586.1 protein_id gnl|my_center|LOCUS_47730 >Feature sequence047 921 2204 gene locus_tag LOCUS_47740 921 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 2542 2228 gene locus_tag LOCUS_47750 2542 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 3752 2739 gene locus_tag LOCUS_47760 3752 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 5186 3756 gene locus_tag LOCUS_47770 5186 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 7754 5238 gene locus_tag LOCUS_47780 7754 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 9128 7767 gene locus_tag LOCUS_47790 9128 7767 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390270.1 protein_id gnl|my_center|LOCUS_47790 9502 10179 gene locus_tag LOCUS_47800 9502 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 10389 10850 gene locus_tag LOCUS_47810 10389 10850 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561349.1 protein_id gnl|my_center|LOCUS_47810 10855 13083 gene locus_tag LOCUS_47820 10855 13083 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_47820 13090 13722 gene locus_tag LOCUS_47830 13090 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_47830 14137 15123 gene locus_tag LOCUS_47840 gene selD 14137 15123 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_47840 16893 15340 gene locus_tag LOCUS_47850 16893 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 16960 17514 gene locus_tag LOCUS_47860 16960 17514 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_47860 17507 17899 gene locus_tag LOCUS_47870 17507 17899 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_47870 20909 18249 gene locus_tag LOCUS_47880 20909 18249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 22182 21073 gene locus_tag LOCUS_47890 22182 21073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 23950 22193 gene locus_tag LOCUS_47900 gene mviN 23950 22193 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_47900 24803 23934 gene locus_tag LOCUS_47910 24803 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 25701 24826 gene locus_tag LOCUS_47920 25701 24826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 27644 25845 gene locus_tag LOCUS_47930 27644 25845 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228351.1 protein_id gnl|my_center|LOCUS_47930 28705 27641 gene locus_tag LOCUS_47940 28705 27641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 29250 28759 gene locus_tag LOCUS_47950 29250 28759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 29437 30987 gene locus_tag LOCUS_47960 29437 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 31039 31566 gene locus_tag LOCUS_47970 31039 31566 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_47970 31579 32115 gene locus_tag LOCUS_47980 31579 32115 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_47980 32133 32651 gene locus_tag LOCUS_47990 32133 32651 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_47990 32718 33335 gene locus_tag LOCUS_48000 32718 33335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 35377 33395 gene locus_tag LOCUS_48010 35377 33395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 35543 36970 gene locus_tag LOCUS_48020 gene glcD 35543 36970 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_48020 38164 37007 gene locus_tag LOCUS_48030 38164 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_661574.1 protein_id gnl|my_center|LOCUS_48030 39820 38279 gene locus_tag LOCUS_48040 gene guaA 39820 38279 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVI7 protein_id gnl|my_center|LOCUS_48040 40843 39833 gene locus_tag LOCUS_48050 gene gpsA 40843 39833 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_48050 41478 40843 gene locus_tag LOCUS_48060 gene plsY1 41478 40843 CDS product glycerol-3-phosphate acyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSV1 protein_id gnl|my_center|LOCUS_48060 42805 41471 gene locus_tag LOCUS_48070 42805 41471 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_48070 42900 43592 gene locus_tag LOCUS_48080 42900 43592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 43628 46417 gene locus_tag LOCUS_48090 43628 46417 CDS product deacylase/carboxypeptidase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405360.1 protein_id gnl|my_center|LOCUS_48090 48190 46625 gene locus_tag LOCUS_48100 48190 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 48286 49179 gene locus_tag LOCUS_48110 48286 49179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 49262 49336 gene locus_tag LOCUS_t00360 49262 49336 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49462 49731 gene locus_tag LOCUS_48120 49462 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 50181 49735 gene locus_tag LOCUS_48130 50181 49735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 51188 50418 gene locus_tag LOCUS_48140 51188 50418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 51326 52696 gene locus_tag LOCUS_48150 51326 52696 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 protein_id gnl|my_center|LOCUS_48150 53195 52890 gene locus_tag LOCUS_48160 53195 52890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 54467 53214 gene locus_tag LOCUS_48170 54467 53214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 54946 54596 gene locus_tag LOCUS_48180 54946 54596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 55139 56752 gene locus_tag LOCUS_48190 55139 56752 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_48190 56771 57253 gene locus_tag LOCUS_48200 56771 57253 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_48200 57264 58403 gene locus_tag LOCUS_48210 57264 58403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118452.1 protein_id gnl|my_center|LOCUS_48210 60260 58425 gene locus_tag LOCUS_48220 60260 58425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 60464 61642 gene locus_tag LOCUS_48230 60464 61642 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_48230 63346 61649 gene locus_tag LOCUS_48240 63346 61649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 65151 63346 gene locus_tag LOCUS_48250 65151 63346 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_48250 66923 65229 gene locus_tag LOCUS_48260 66923 65229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 67261 67980 gene locus_tag LOCUS_48270 67261 67980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence048 1249 80 gene locus_tag LOCUS_48280 1249 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 2092 1298 gene locus_tag LOCUS_48290 2092 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 3118 2168 gene locus_tag LOCUS_48300 3118 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 4287 3115 gene locus_tag LOCUS_48310 4287 3115 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_48310 5777 4284 gene locus_tag LOCUS_48320 5777 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_48320 5980 5777 gene locus_tag LOCUS_48330 5980 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 6042 8531 gene locus_tag LOCUS_48340 6042 8531 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205051.1 protein_id gnl|my_center|LOCUS_48340 8904 10874 gene locus_tag LOCUS_48350 8904 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 10871 12451 gene locus_tag LOCUS_48360 10871 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 13309 12455 gene locus_tag LOCUS_48370 gene cdsA 13309 12455 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP76 protein_id gnl|my_center|LOCUS_48370 14139 13321 gene locus_tag LOCUS_48380 14139 13321 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_48380 15041 14241 gene locus_tag LOCUS_48390 gene truA 15041 14241 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60350 protein_id gnl|my_center|LOCUS_48390 16332 15052 gene locus_tag LOCUS_48400 16332 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 16443 17954 gene locus_tag LOCUS_48410 16443 17954 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_48410 19165 17966 gene locus_tag LOCUS_48420 gene ybhS 19165 17966 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1B4 protein_id gnl|my_center|LOCUS_48420 20172 19162 gene locus_tag LOCUS_48430 20172 19162 CDS product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_48430 21005 20169 gene locus_tag LOCUS_48440 21005 20169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616206.1 protein_id gnl|my_center|LOCUS_48440 21594 21124 gene locus_tag LOCUS_48450 21594 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_48450 22632 21742 gene locus_tag LOCUS_48460 22632 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 22853 22566 gene locus_tag LOCUS_48470 22853 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 25733 23010 gene locus_tag LOCUS_48480 25733 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 27790 25874 gene locus_tag LOCUS_48490 27790 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 27978 28748 gene locus_tag LOCUS_48500 27978 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_48500 29823 28756 gene locus_tag LOCUS_48510 29823 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918827.1 protein_id gnl|my_center|LOCUS_48510 30427 29879 gene locus_tag LOCUS_48520 30427 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 33309 30448 gene locus_tag LOCUS_48530 33309 30448 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_48530 35531 33312 gene locus_tag LOCUS_48540 35531 33312 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_48540 36964 35528 gene locus_tag LOCUS_48550 36964 35528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 38948 36945 gene locus_tag LOCUS_48560 38948 36945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_48560 39252 38950 gene locus_tag LOCUS_48570 39252 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 40584 39283 gene locus_tag LOCUS_48580 gene eno 40584 39283 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR6 protein_id gnl|my_center|LOCUS_48580 41707 40709 gene locus_tag LOCUS_48590 41707 40709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 41945 43045 gene locus_tag LOCUS_48600 41945 43045 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462240.1 protein_id gnl|my_center|LOCUS_48600 43271 44059 gene locus_tag LOCUS_48610 43271 44059 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117832.1 protein_id gnl|my_center|LOCUS_48610 44659 44096 gene locus_tag LOCUS_48620 44659 44096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 46104 44998 gene locus_tag LOCUS_48630 46104 44998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 47235 46219 gene locus_tag LOCUS_48640 gene trxB 47235 46219 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_48640 47671 47423 gene locus_tag LOCUS_48650 47671 47423 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_48650 47965 49593 gene locus_tag LOCUS_48660 47965 49593 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_48660 50147 49851 gene locus_tag LOCUS_48670 50147 49851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 50420 50187 gene locus_tag LOCUS_48680 50420 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 50519 50764 gene locus_tag LOCUS_48690 50519 50764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 50802 51044 gene locus_tag LOCUS_48700 50802 51044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 53435 51123 gene locus_tag LOCUS_48710 53435 51123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 54049 55392 gene locus_tag LOCUS_48720 54049 55392 CDS product tyrosinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530378.1 protein_id gnl|my_center|LOCUS_48720 55373 55936 gene locus_tag LOCUS_48730 55373 55936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 57558 55891 gene locus_tag LOCUS_48740 57558 55891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 60156 57562 gene locus_tag LOCUS_48750 60156 57562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 60267 61352 gene locus_tag LOCUS_48760 60267 61352 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_48760 61498 61878 gene locus_tag LOCUS_48770 gene spoIIAA 61498 61878 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_48770 61897 62658 gene locus_tag LOCUS_48780 61897 62658 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141932.1 protein_id gnl|my_center|LOCUS_48780 63565 62666 gene locus_tag LOCUS_48790 63565 62666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 64536 63568 gene locus_tag LOCUS_48800 64536 63568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 64931 67937 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccccgcgtgggggcgtggattgaaac >Feature sequence049 <1 2614 gene locus_tag LOCUS_48810 <1 2614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q07833:tRNA nuclease WapA 2611 2856 gene locus_tag LOCUS_48820 2611 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 3588 3118 gene locus_tag LOCUS_48830 3588 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_48830 4890 3682 gene locus_tag LOCUS_48840 4890 3682 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_48840 5708 4908 gene locus_tag LOCUS_48850 5708 4908 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088822.1 protein_id gnl|my_center|LOCUS_48850 6241 5735 gene locus_tag LOCUS_48860 6241 5735 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_48860 7196 6369 gene locus_tag LOCUS_48870 7196 6369 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_48870 7540 7202 gene locus_tag LOCUS_48880 7540 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 8018 7575 gene locus_tag LOCUS_48890 gene spoIIAB 8018 7575 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_48890 9845 8247 gene locus_tag LOCUS_48900 9845 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48900 11452 9887 gene locus_tag LOCUS_48910 11452 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48910 11671 13149 gene locus_tag LOCUS_48920 gene selA 11671 13149 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFK3 protein_id gnl|my_center|LOCUS_48920 14336 13146 gene locus_tag LOCUS_48930 14336 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 14623 14384 gene locus_tag LOCUS_48940 14623 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 14764 15429 gene locus_tag LOCUS_48950 14764 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 15422 16810 gene locus_tag LOCUS_48960 15422 16810 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_48960 18072 16855 gene locus_tag LOCUS_48970 18072 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 18169 18846 gene locus_tag LOCUS_48980 18169 18846 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975724.1 protein_id gnl|my_center|LOCUS_48980 18843 19889 gene locus_tag LOCUS_48990 18843 19889 CDS product UPF0194 membrane protein RB0873 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V44 protein_id gnl|my_center|LOCUS_48990 19882 21633 gene locus_tag LOCUS_49000 19882 21633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887495.1 protein_id gnl|my_center|LOCUS_49000 21630 22766 gene locus_tag LOCUS_49010 21630 22766 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_49010 22763 23893 gene locus_tag LOCUS_49020 22763 23893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529052.1 protein_id gnl|my_center|LOCUS_49020 23890 25356 gene locus_tag LOCUS_49030 23890 25356 CDS product multidrug efflux system outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040261.1 protein_id gnl|my_center|LOCUS_49030 25372 26442 gene locus_tag LOCUS_49040 25372 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_49040 28282 26447 gene locus_tag LOCUS_49050 28282 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_49050 28585 29061 gene locus_tag LOCUS_49060 28585 29061 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_49060 29218 29832 gene locus_tag LOCUS_49070 29218 29832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 29949 31055 gene locus_tag LOCUS_49080 29949 31055 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_49080 31100 32131 gene locus_tag LOCUS_49090 31100 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 33811 32156 gene locus_tag LOCUS_49100 33811 32156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 34909 33824 gene locus_tag LOCUS_49110 34909 33824 CDS product TorS-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_49110 35352 34918 gene locus_tag LOCUS_49120 35352 34918 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224916.1 protein_id gnl|my_center|LOCUS_49120 35705 35349 gene locus_tag LOCUS_49130 gene rsbS 35705 35349 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_49130 36568 35708 gene locus_tag LOCUS_49140 36568 35708 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883995.1 protein_id gnl|my_center|LOCUS_49140 36840 36673 gene locus_tag LOCUS_49150 36840 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 37883 36915 gene locus_tag LOCUS_49160 37883 36915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 38138 38863 gene locus_tag LOCUS_49170 38138 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 38856 40214 gene locus_tag LOCUS_49180 38856 40214 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187694.1 protein_id gnl|my_center|LOCUS_49180 40337 40678 gene locus_tag LOCUS_49190 40337 40678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 41207 40776 gene locus_tag LOCUS_49200 41207 40776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 41767 41207 gene locus_tag LOCUS_49210 41767 41207 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_49210 41766 42017 gene locus_tag LOCUS_49220 41766 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 42238 42029 gene locus_tag LOCUS_49230 42238 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 57748 42440 gene locus_tag LOCUS_49240 57748 42440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 58105 58995 gene locus_tag LOCUS_49250 58105 58995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 59979 58996 gene locus_tag LOCUS_49260 59979 58996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 60119 60439 gene locus_tag LOCUS_49270 60119 60439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 60510 60719 gene locus_tag LOCUS_49280 60510 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 61431 60721 gene locus_tag LOCUS_49290 gene rfbF 61431 60721 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_49290 61531 62814 gene locus_tag LOCUS_49300 61531 62814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 62804 63625 gene locus_tag LOCUS_49310 62804 63625 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_49310 64920 63529 gene locus_tag LOCUS_49320 64920 63529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 66040 65060 gene locus_tag LOCUS_49330 gene asd 66040 65060 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWX8 protein_id gnl|my_center|LOCUS_49330 66861 66037 gene locus_tag LOCUS_49340 gene pssA 66861 66037 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_49340 67546 66875 gene locus_tag LOCUS_49350 gene psd 67546 66875 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y8 protein_id gnl|my_center|LOCUS_49350 67812 67582 gene locus_tag LOCUS_49360 67812 67582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_49360 >Feature sequence050 758 141 gene locus_tag LOCUS_49370 758 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 1069 1419 gene locus_tag LOCUS_49380 1069 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 1423 2397 gene locus_tag LOCUS_49390 1423 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 2524 2348 gene locus_tag LOCUS_49400 2524 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 4113 3421 gene locus_tag LOCUS_49410 4113 3421 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_49410 4174 6945 gene locus_tag LOCUS_49420 4174 6945 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:5254..5256,aa:Sec) note codon on position 361 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_49420 7377 6979 gene locus_tag LOCUS_49430 7377 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 7634 7374 gene locus_tag LOCUS_49440 7634 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 8468 7728 gene locus_tag LOCUS_49450 8468 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404006.1 protein_id gnl|my_center|LOCUS_49450 8760 8473 gene locus_tag LOCUS_49460 8760 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 8876 9661 gene locus_tag LOCUS_49470 8876 9661 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_49470 9672 11561 gene locus_tag LOCUS_49480 9672 11561 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_49480 11569 13500 gene locus_tag LOCUS_49490 gene pepF 11569 13500 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_49490 13607 14809 gene locus_tag LOCUS_49500 13607 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 14814 16049 gene locus_tag LOCUS_49510 14814 16049 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_49510 16057 17913 gene locus_tag LOCUS_49520 16057 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 17946 20201 gene locus_tag LOCUS_49530 17946 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 20229 25301 gene locus_tag LOCUS_49540 20229 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 25324 26127 gene locus_tag LOCUS_49550 25324 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 26152 27381 gene locus_tag LOCUS_49560 26152 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 27854 30643 gene locus_tag LOCUS_49570 27854 30643 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_49570 30853 32598 gene locus_tag LOCUS_49580 30853 32598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 32640 33716 gene locus_tag LOCUS_49590 32640 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 34498 33824 gene locus_tag LOCUS_49600 34498 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 35505 34510 gene locus_tag LOCUS_49610 35505 34510 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_49610 35651 37162 gene locus_tag LOCUS_49620 35651 37162 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_49620 37667 37131 gene locus_tag LOCUS_49630 37667 37131 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_49630 40000 37664 gene locus_tag LOCUS_49640 40000 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 40144 41448 gene locus_tag LOCUS_49650 40144 41448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 46516 42077 gene locus_tag LOCUS_49660 46516 42077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 48058 46826 gene locus_tag LOCUS_49670 48058 46826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 50512 48068 gene locus_tag LOCUS_49680 50512 48068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 51052 50546 gene locus_tag LOCUS_49690 51052 50546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 51284 53062 gene locus_tag LOCUS_49700 51284 53062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 53451 53747 gene locus_tag LOCUS_49710 53451 53747 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882942.1 protein_id gnl|my_center|LOCUS_49710 53925 54422 gene locus_tag LOCUS_49720 gene mogA 53925 54422 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_49720 54426 55289 gene locus_tag LOCUS_49730 54426 55289 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_49730 55291 55668 gene locus_tag LOCUS_49740 gene crcB 55291 55668 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_49740 56030 56791 gene locus_tag LOCUS_49750 56030 56791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 56785 57546 gene locus_tag LOCUS_49760 56785 57546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 57890 59068 gene locus_tag LOCUS_49770 57890 59068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 59089 59250 gene locus_tag LOCUS_49780 59089 59250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 61399 60074 gene locus_tag LOCUS_49790 61399 60074 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_49790 61764 63182 gene locus_tag LOCUS_49800 61764 63182 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_49800 63336 63974 gene locus_tag LOCUS_49810 63336 63974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 64152 64616 gene locus_tag LOCUS_49820 64152 64616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 64835 65194 gene locus_tag LOCUS_49830 64835 65194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 65291 65749 gene locus_tag LOCUS_49840 65291 65749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 >Feature sequence051 215 436 gene locus_tag LOCUS_49850 215 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 1855 437 gene locus_tag LOCUS_49860 1855 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 3182 1857 gene locus_tag LOCUS_49870 3182 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 4160 3231 gene locus_tag LOCUS_49880 4160 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 5694 4519 gene locus_tag LOCUS_49890 5694 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 5848 9543 gene locus_tag LOCUS_49900 gene metH 5848 9543 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_49900 10028 11602 gene locus_tag LOCUS_49910 10028 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 11599 12900 gene locus_tag LOCUS_49920 gene pfkA 11599 12900 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXU6 protein_id gnl|my_center|LOCUS_49920 13226 12903 gene locus_tag LOCUS_49930 13226 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 13474 13256 gene locus_tag LOCUS_49940 13474 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 14098 13511 gene locus_tag LOCUS_49950 14098 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 14407 14114 gene locus_tag LOCUS_49960 14407 14114 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_49960 14526 15293 gene locus_tag LOCUS_49970 14526 15293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_49970 15293 16057 gene locus_tag LOCUS_49980 15293 16057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 protein_id gnl|my_center|LOCUS_49980 16072 17526 gene locus_tag LOCUS_49990 16072 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 17934 17557 gene locus_tag LOCUS_50000 gene vapC 17934 17557 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK4 protein_id gnl|my_center|LOCUS_50000 18182 17931 gene locus_tag LOCUS_50010 18182 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 18376 22356 gene locus_tag LOCUS_50020 18376 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 22356 23762 gene locus_tag LOCUS_50030 22356 23762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 28024 23759 gene locus_tag LOCUS_50040 28024 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 28796 28149 gene locus_tag LOCUS_50050 28796 28149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401355.1 protein_id gnl|my_center|LOCUS_50050 28896 30338 gene locus_tag LOCUS_50060 28896 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 30526 34968 gene locus_tag LOCUS_50070 30526 34968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 36984 35275 gene locus_tag LOCUS_50080 36984 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 37231 37022 gene locus_tag LOCUS_50090 37231 37022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 39649 37364 gene locus_tag LOCUS_50100 39649 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_50100 39957 41789 gene locus_tag LOCUS_50110 39957 41789 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_50110 41889 42839 gene locus_tag LOCUS_50120 41889 42839 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_50120 44227 42848 gene locus_tag LOCUS_50130 44227 42848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 44446 45309 gene locus_tag LOCUS_50140 44446 45309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 45716 45369 gene locus_tag LOCUS_50150 45716 45369 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 protein_id gnl|my_center|LOCUS_50150 45945 47054 gene locus_tag LOCUS_50160 45945 47054 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_50160 47261 48100 gene locus_tag LOCUS_50170 47261 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 48265 48975 gene locus_tag LOCUS_50180 48265 48975 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_50180 49973 48972 gene locus_tag LOCUS_50190 gene argK 49973 48972 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_50190 51183 49978 gene locus_tag LOCUS_50200 51183 49978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 51817 51206 gene locus_tag LOCUS_50210 51817 51206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 52937 51810 gene locus_tag LOCUS_50220 52937 51810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 54873 52921 gene locus_tag LOCUS_50230 54873 52921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 55046 56305 gene locus_tag LOCUS_50240 55046 56305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 56331 60857 gene locus_tag LOCUS_50250 56331 60857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 60979 62067 gene locus_tag LOCUS_50260 60979 62067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 62064 63059 gene locus_tag LOCUS_50270 62064 63059 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_50270 63078 64445 gene locus_tag LOCUS_50280 gene algD 63078 64445 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730922.1 protein_id gnl|my_center|LOCUS_50280 >Feature sequence052 3471 3265 gene locus_tag LOCUS_50290 3471 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 4158 4082 gene locus_tag LOCUS_t00370 4158 4082 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5275 4241 gene locus_tag LOCUS_50300 gene moaA 5275 4241 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z1 protein_id gnl|my_center|LOCUS_50300 6662 5388 gene locus_tag LOCUS_50310 gene gltA 6662 5388 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_50310 7414 6854 gene locus_tag LOCUS_50320 7414 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 7568 7873 gene locus_tag LOCUS_50330 7568 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 8546 7875 gene locus_tag LOCUS_50340 gene udk 8546 7875 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 protein_id gnl|my_center|LOCUS_50340 9514 8555 gene locus_tag LOCUS_50350 gene mutM 9514 8555 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIH4 protein_id gnl|my_center|LOCUS_50350 10247 9756 gene locus_tag LOCUS_50360 10247 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 10605 11420 gene locus_tag LOCUS_50370 gene kynA 10605 11420 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_50370 11428 12660 gene locus_tag LOCUS_50380 11428 12660 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_50380 12680 13786 gene locus_tag LOCUS_50390 12680 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 13794 16385 gene locus_tag LOCUS_50400 13794 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 16450 16713 gene locus_tag LOCUS_50410 16450 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 16710 17105 gene locus_tag LOCUS_50420 gene vapC 16710 17105 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W00 protein_id gnl|my_center|LOCUS_50420 17951 17190 gene locus_tag LOCUS_50430 17951 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 18107 18859 gene locus_tag LOCUS_50440 18107 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 18917 20185 gene locus_tag LOCUS_50450 gene adh 18917 20185 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_50450 20199 21386 gene locus_tag LOCUS_50460 20199 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 21552 21881 gene locus_tag LOCUS_50470 21552 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 21973 22419 gene locus_tag LOCUS_50480 21973 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 22401 23630 gene locus_tag LOCUS_50490 22401 23630 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_50490 24783 23617 gene locus_tag LOCUS_50500 24783 23617 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_50500 24844 26538 gene locus_tag LOCUS_50510 24844 26538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 26522 28486 gene locus_tag LOCUS_50520 26522 28486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_50520 28809 28483 gene locus_tag LOCUS_50530 28809 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_50530 29249 28806 gene locus_tag LOCUS_50540 29249 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 29861 29268 gene locus_tag LOCUS_50550 29861 29268 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123703.1 protein_id gnl|my_center|LOCUS_50550 29964 30899 gene locus_tag LOCUS_50560 29964 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 31412 32410 gene locus_tag LOCUS_50570 31412 32410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 35012 32463 gene locus_tag LOCUS_50580 35012 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 35159 36049 gene locus_tag LOCUS_50590 gene menB 35159 36049 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYX3 protein_id gnl|my_center|LOCUS_50590 36069 36827 gene locus_tag LOCUS_50600 36069 36827 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_50600 37080 36787 gene locus_tag LOCUS_50610 37080 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 37675 37082 gene locus_tag LOCUS_50620 37675 37082 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_50620 38740 37694 gene locus_tag LOCUS_50630 38740 37694 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_50630 39438 38737 gene locus_tag LOCUS_50640 39438 38737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 40097 39435 gene locus_tag LOCUS_50650 40097 39435 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_50650 40528 40247 gene locus_tag LOCUS_50660 40528 40247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 40634 42556 gene locus_tag LOCUS_50670 40634 42556 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_50670 43405 42557 gene locus_tag LOCUS_50680 43405 42557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 44143 43463 gene locus_tag LOCUS_50690 44143 43463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 46400 44376 gene locus_tag LOCUS_50700 46400 44376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 47077 46535 gene locus_tag LOCUS_50710 47077 46535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 47359 47084 gene locus_tag LOCUS_50720 47359 47084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 48123 47419 gene locus_tag LOCUS_50730 gene rpoE 48123 47419 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_50730 48328 48582 gene locus_tag LOCUS_50740 48328 48582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 48572 48985 gene locus_tag LOCUS_50750 48572 48985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 49071 49955 gene locus_tag LOCUS_50760 gene atpB 49071 49955 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_50760 50134 50451 gene locus_tag LOCUS_50770 50134 50451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 50614 51228 gene locus_tag LOCUS_50780 gene atpF 50614 51228 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814V8 protein_id gnl|my_center|LOCUS_50780 51240 51836 gene locus_tag LOCUS_50790 gene atpH 51240 51836 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S433 protein_id gnl|my_center|LOCUS_50790 51860 53587 gene locus_tag LOCUS_50800 51860 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 53592 54458 gene locus_tag LOCUS_50810 gene atpG 53592 54458 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_50810 54477 55922 gene locus_tag LOCUS_50820 gene atpD 54477 55922 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_50820 55962 56360 gene locus_tag LOCUS_50830 gene atpC 55962 56360 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_50830 56534 56950 gene locus_tag LOCUS_50840 56534 56950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 56947 58419 gene locus_tag LOCUS_50850 56947 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 58451 60808 gene locus_tag LOCUS_50860 58451 60808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 61563 60814 gene locus_tag LOCUS_50870 61563 60814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 62706 61894 gene locus_tag LOCUS_50880 62706 61894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 >Feature sequence053 692 222 gene locus_tag LOCUS_50890 gene rimI 692 222 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJL0 protein_id gnl|my_center|LOCUS_50890 1394 696 gene locus_tag LOCUS_50900 1394 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 2982 1387 gene locus_tag LOCUS_50910 gene lysS 2982 1387 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_50910 3167 4108 gene locus_tag LOCUS_50920 3167 4108 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_50920 4113 5240 gene locus_tag LOCUS_50930 4113 5240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_50930 5414 6181 gene locus_tag LOCUS_50940 5414 6181 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_50940 6206 7222 gene locus_tag LOCUS_50950 6206 7222 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_50950 7215 7823 gene locus_tag LOCUS_50960 7215 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 8044 8529 gene locus_tag LOCUS_50970 gene nrfC 8044 8529 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_50970 8561 10255 gene locus_tag LOCUS_50980 gene nrfA 8561 10255 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_50980 10463 11860 gene locus_tag LOCUS_50990 10463 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 11910 12248 gene locus_tag LOCUS_51000 11910 12248 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_51000 12248 14374 gene locus_tag LOCUS_51010 12248 14374 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919852.1 protein_id gnl|my_center|LOCUS_51010 14445 14957 gene locus_tag LOCUS_51020 14445 14957 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEG2 protein_id gnl|my_center|LOCUS_51020 16114 15068 gene locus_tag LOCUS_51030 16114 15068 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_51030 17206 16178 gene locus_tag LOCUS_51040 gene fbp 17206 16178 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AZ9 protein_id gnl|my_center|LOCUS_51040 17541 18341 gene locus_tag LOCUS_51050 17541 18341 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291082.1 protein_id gnl|my_center|LOCUS_51050 18495 19694 gene locus_tag LOCUS_51060 18495 19694 CDS product putative acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268525.1 protein_id gnl|my_center|LOCUS_51060 19705 20481 gene locus_tag LOCUS_51070 gene echA8 19705 20481 CDS product putative enoyl-CoA hydratase echA8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNN9 protein_id gnl|my_center|LOCUS_51070 20542 21321 gene locus_tag LOCUS_51080 20542 21321 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_51080 21416 24442 gene locus_tag LOCUS_51090 21416 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 24524 27556 gene locus_tag LOCUS_51100 24524 27556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 27613 29127 gene locus_tag LOCUS_51110 27613 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 29201 29434 gene locus_tag LOCUS_51120 29201 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 29939 29661 gene locus_tag LOCUS_51130 29939 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_51130 32668 29936 gene locus_tag LOCUS_51140 gene ppdK 32668 29936 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_51140 32780 33295 gene locus_tag LOCUS_51150 32780 33295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 33407 34504 gene locus_tag LOCUS_51160 33407 34504 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_51160 34879 34508 gene locus_tag LOCUS_51170 34879 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 36406 35276 gene locus_tag LOCUS_51180 36406 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_51180 37926 36436 gene locus_tag LOCUS_51190 37926 36436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 40190 37938 gene locus_tag LOCUS_51200 40190 37938 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121437.1 protein_id gnl|my_center|LOCUS_51200 42039 40477 gene locus_tag LOCUS_51210 42039 40477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 43679 42036 gene locus_tag LOCUS_51220 43679 42036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 43895 44845 gene locus_tag LOCUS_51230 43895 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 44842 46743 gene locus_tag LOCUS_51240 44842 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 48849 46990 gene locus_tag LOCUS_51250 48849 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_51250 49888 49088 gene locus_tag LOCUS_51260 49888 49088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_51260 50244 49900 gene locus_tag LOCUS_51270 50244 49900 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_51270 50536 50225 gene locus_tag LOCUS_51280 50536 50225 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_51280 51922 50543 gene locus_tag LOCUS_51290 51922 50543 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_51290 52531 52034 gene locus_tag LOCUS_51300 52531 52034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 52784 52518 gene locus_tag LOCUS_51310 52784 52518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 53837 52806 gene locus_tag LOCUS_51320 53837 52806 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_51320 55431 54100 gene locus_tag LOCUS_51330 gene cfaA 55431 54100 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636703.2 protein_id gnl|my_center|LOCUS_51330 56344 55436 gene locus_tag LOCUS_51340 56344 55436 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_51340 57612 56341 gene locus_tag LOCUS_51350 57612 56341 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_51350 58445 57609 gene locus_tag LOCUS_51360 58445 57609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_51360 58666 59913 gene locus_tag LOCUS_51370 gene rocD 58666 59913 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RB7 protein_id gnl|my_center|LOCUS_51370 60023 60529 gene locus_tag LOCUS_51380 60023 60529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 61472 60585 gene locus_tag LOCUS_51390 61472 60585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 61714 61487 gene locus_tag LOCUS_51400 61714 61487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 62235 61873 gene locus_tag LOCUS_51410 62235 61873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 >Feature sequence054 1310 2404 gene locus_tag LOCUS_51420 1310 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_51420 2463 4454 gene locus_tag LOCUS_51430 2463 4454 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_51430 4451 6157 gene locus_tag LOCUS_51440 4451 6157 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529476.1 protein_id gnl|my_center|LOCUS_51440 6291 6800 gene locus_tag LOCUS_51450 6291 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 8397 6853 gene locus_tag LOCUS_51460 8397 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 10886 8394 gene locus_tag LOCUS_51470 10886 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 11544 10954 gene locus_tag LOCUS_51480 11544 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 11600 12856 gene locus_tag LOCUS_51490 gene gltP 11600 12856 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_51490 12866 13738 gene locus_tag LOCUS_51500 12866 13738 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705061.1 protein_id gnl|my_center|LOCUS_51500 13725 15014 gene locus_tag LOCUS_51510 13725 15014 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_51510 16210 15221 gene locus_tag LOCUS_51520 gene truD 16210 15221 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_51520 16348 16854 gene locus_tag LOCUS_51530 16348 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 16851 18356 gene locus_tag LOCUS_51540 16851 18356 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_51540 18580 19179 gene locus_tag LOCUS_51550 18580 19179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 19215 20573 gene locus_tag LOCUS_51560 19215 20573 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118033.1 protein_id gnl|my_center|LOCUS_51560 21771 20584 gene locus_tag LOCUS_51570 21771 20584 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_51570 23984 21768 gene locus_tag LOCUS_51580 23984 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 26305 23984 gene locus_tag LOCUS_51590 26305 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 26418 27062 gene locus_tag LOCUS_51600 26418 27062 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_except (pos:26664..26666,aa:Sec) note codon on position 83 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_51600 29606 27093 gene locus_tag LOCUS_51610 29606 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 32651 29610 gene locus_tag LOCUS_51620 32651 29610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 32847 33092 gene locus_tag LOCUS_51630 32847 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 33670 33098 gene locus_tag LOCUS_51640 33670 33098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 34905 33673 gene locus_tag LOCUS_51650 34905 33673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 36099 34975 gene locus_tag LOCUS_51660 36099 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 36871 36101 gene locus_tag LOCUS_51670 36871 36101 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_51670 37351 36902 gene locus_tag LOCUS_51680 37351 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 38236 37373 gene locus_tag LOCUS_51690 38236 37373 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_51690 38514 40319 gene locus_tag LOCUS_51700 38514 40319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 40717 41127 gene locus_tag LOCUS_51710 40717 41127 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_51710 42398 41163 gene locus_tag LOCUS_51720 gene hadHB 42398 41163 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_51720 43249 42398 gene locus_tag LOCUS_51730 gene nudC 43249 42398 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86062 protein_id gnl|my_center|LOCUS_51730 43653 43255 gene locus_tag LOCUS_51740 43653 43255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 44033 45340 gene locus_tag LOCUS_51750 44033 45340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836244.1 protein_id gnl|my_center|LOCUS_51750 45337 46599 gene locus_tag LOCUS_51760 45337 46599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 46596 47732 gene locus_tag LOCUS_51770 46596 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 47746 48516 gene locus_tag LOCUS_51780 47746 48516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 53136 48607 gene locus_tag LOCUS_51790 53136 48607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 53531 56458 gene locus_tag LOCUS_51800 53531 56458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 57502 56693 gene locus_tag LOCUS_51810 57502 56693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_51810 57760 58848 gene locus_tag LOCUS_51820 57760 58848 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_51820 60613 59177 gene locus_tag LOCUS_51830 60613 59177 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_51830 >Feature sequence055 32 603 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcacggggggcgac 967 1599 gene locus_tag LOCUS_51840 967 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 1615 3078 gene locus_tag LOCUS_51850 1615 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 5371 3113 gene locus_tag LOCUS_51860 gene ppk1 5371 3113 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_51860 5454 5957 gene locus_tag LOCUS_51870 5454 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950516.1 protein_id gnl|my_center|LOCUS_51870 7593 5947 gene locus_tag LOCUS_51880 7593 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 9983 7590 gene locus_tag LOCUS_51890 9983 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 11855 9999 gene locus_tag LOCUS_51900 gene argS 11855 9999 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_51900 13161 11860 gene locus_tag LOCUS_51910 13161 11860 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_51910 15684 13201 gene locus_tag LOCUS_51920 15684 13201 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_51920 15909 16757 gene locus_tag LOCUS_51930 15909 16757 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404077.1 protein_id gnl|my_center|LOCUS_51930 16812 17366 gene locus_tag LOCUS_51940 16812 17366 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UH72 protein_id gnl|my_center|LOCUS_51940 17400 20081 gene locus_tag LOCUS_51950 17400 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 20344 21291 gene locus_tag LOCUS_51960 20344 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 21301 22167 gene locus_tag LOCUS_51970 21301 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 22167 23132 gene locus_tag LOCUS_51980 22167 23132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_51980 23129 23971 gene locus_tag LOCUS_51990 23129 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 24496 23975 gene locus_tag LOCUS_52000 24496 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 24717 25691 gene locus_tag LOCUS_52010 24717 25691 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106287.1 protein_id gnl|my_center|LOCUS_52010 25848 26795 gene locus_tag LOCUS_52020 25848 26795 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_52020 26843 27628 gene locus_tag LOCUS_52030 26843 27628 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967961.1 protein_id gnl|my_center|LOCUS_52030 27748 29589 gene locus_tag LOCUS_52040 27748 29589 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 protein_id gnl|my_center|LOCUS_52040 32091 29680 gene locus_tag LOCUS_52050 32091 29680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_52050 34080 32269 gene locus_tag LOCUS_52060 gene phoR 34080 32269 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_52060 34788 34087 gene locus_tag LOCUS_52070 34788 34087 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_52070 35491 34832 gene locus_tag LOCUS_52080 gene phoU 35491 34832 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_52080 36427 35657 gene locus_tag LOCUS_52090 36427 35657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 36718 36476 gene locus_tag LOCUS_52100 36718 36476 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN5 protein_id gnl|my_center|LOCUS_52100 37662 36718 gene locus_tag LOCUS_52110 37662 36718 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_52110 38990 37680 gene locus_tag LOCUS_52120 38990 37680 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_52120 39998 39015 gene locus_tag LOCUS_52130 39998 39015 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_52130 40746 40339 gene locus_tag LOCUS_52140 40746 40339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 41190 40789 gene locus_tag LOCUS_52150 gene vapC 41190 40789 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K1 protein_id gnl|my_center|LOCUS_52150 41548 41198 gene locus_tag LOCUS_52160 41548 41198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 42704 41496 gene locus_tag LOCUS_52170 42704 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 44850 42805 gene locus_tag LOCUS_52180 44850 42805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 46679 44910 gene locus_tag LOCUS_52190 gene hsdM 46679 44910 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_52190 47622 46870 gene locus_tag LOCUS_52200 47622 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 47864 48493 gene locus_tag LOCUS_52210 gene sigE 47864 48493 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW35 protein_id gnl|my_center|LOCUS_52210 48626 49132 gene locus_tag LOCUS_52220 48626 49132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 49129 49674 gene locus_tag LOCUS_52230 49129 49674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 49789 53118 gene locus_tag LOCUS_52240 49789 53118 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_52240 53361 53996 gene locus_tag LOCUS_52250 53361 53996 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813947.1 protein_id gnl|my_center|LOCUS_52250 54015 54890 gene locus_tag LOCUS_52260 gene echA2 54015 54890 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_52260 54962 56008 gene locus_tag LOCUS_52270 54962 56008 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142635.1 protein_id gnl|my_center|LOCUS_52270 56029 56505 gene locus_tag LOCUS_52280 56029 56505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52280 56502 57548 gene locus_tag LOCUS_52290 56502 57548 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_52290 >Feature sequence056 <1 952 gene locus_tag LOCUS_52300 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001535.1:membrane protein 967 1278 gene locus_tag LOCUS_52310 967 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 1268 1675 gene locus_tag LOCUS_52320 1268 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 2937 1750 gene locus_tag LOCUS_52330 2937 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 4343 2937 gene locus_tag LOCUS_52340 gene algI 4343 2937 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51392 protein_id gnl|my_center|LOCUS_52340 5740 4340 gene locus_tag LOCUS_52350 5740 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 7133 5718 gene locus_tag LOCUS_52360 7133 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 7218 8525 gene locus_tag LOCUS_52370 7218 8525 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_52370 8615 9856 gene locus_tag LOCUS_52380 8615 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 12344 9843 gene locus_tag LOCUS_52390 12344 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 13508 12420 gene locus_tag LOCUS_52400 13508 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_52400 15041 13518 gene locus_tag LOCUS_52410 15041 13518 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_52410 16143 15193 gene locus_tag LOCUS_52420 gene trxB 16143 15193 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_52420 16734 16279 gene locus_tag LOCUS_52430 16734 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_52430 16965 17624 gene locus_tag LOCUS_52440 16965 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 17784 19304 gene locus_tag LOCUS_52450 17784 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 19435 19944 gene locus_tag LOCUS_52460 19435 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 20022 20756 gene locus_tag LOCUS_52470 20022 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 22870 20750 gene locus_tag LOCUS_52480 22870 20750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 24495 23011 gene locus_tag LOCUS_52490 24495 23011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 25838 24837 gene locus_tag LOCUS_52500 gene kdsD 25838 24837 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_52500 26687 25851 gene locus_tag LOCUS_52510 gene kdsA 26687 25851 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61654 protein_id gnl|my_center|LOCUS_52510 28342 26684 gene locus_tag LOCUS_52520 gene pyrG 28342 26684 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT4 protein_id gnl|my_center|LOCUS_52520 29151 28396 gene locus_tag LOCUS_52530 gene kdsB 29151 28396 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_52530 32701 29300 gene locus_tag LOCUS_52540 32701 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 32751 33779 gene locus_tag LOCUS_52550 32751 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 protein_id gnl|my_center|LOCUS_52550 34917 33985 gene locus_tag LOCUS_52560 34917 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703787.1 protein_id gnl|my_center|LOCUS_52560 35526 35140 gene locus_tag LOCUS_52570 35526 35140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_52570 39700 35558 gene locus_tag LOCUS_52580 39700 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 protein_id gnl|my_center|LOCUS_52580 40563 39697 gene locus_tag LOCUS_52590 40563 39697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 42004 40586 gene locus_tag LOCUS_52600 42004 40586 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705719.1 protein_id gnl|my_center|LOCUS_52600 42608 42129 gene locus_tag LOCUS_52610 42608 42129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 42780 44567 gene locus_tag LOCUS_52620 42780 44567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 45264 44581 gene locus_tag LOCUS_52630 45264 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 47143 45323 gene locus_tag LOCUS_52640 47143 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 47308 47616 gene locus_tag LOCUS_52650 47308 47616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 47609 48865 gene locus_tag LOCUS_52660 47609 48865 CDS product putative kinase Y4mE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55564 protein_id gnl|my_center|LOCUS_52660 48975 50207 gene locus_tag LOCUS_52670 48975 50207 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_52670 50336 50902 gene locus_tag LOCUS_52680 50336 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_52680 53533 51227 gene locus_tag LOCUS_52690 53533 51227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 55800 53515 gene locus_tag LOCUS_52700 55800 53515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence057 5409 3772 gene locus_tag LOCUS_52710 5409 3772 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_52710 5974 5570 gene locus_tag LOCUS_52720 5974 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 8624 5988 gene locus_tag LOCUS_52730 8624 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 8708 9583 gene locus_tag LOCUS_52740 8708 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 9622 10734 gene locus_tag LOCUS_52750 9622 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 12989 10881 gene locus_tag LOCUS_52760 12989 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 14045 13122 gene locus_tag LOCUS_52770 gene b0867 14045 13122 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816210.1 protein_id gnl|my_center|LOCUS_52770 15640 14135 gene locus_tag LOCUS_52780 15640 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 16016 17974 gene locus_tag LOCUS_52790 16016 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 18154 19377 gene locus_tag LOCUS_52800 18154 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 19605 21500 gene locus_tag LOCUS_52810 19605 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 21899 22576 gene locus_tag LOCUS_52820 21899 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 22651 23190 gene locus_tag LOCUS_52830 22651 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 23205 24596 gene locus_tag LOCUS_52840 23205 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 24593 25195 gene locus_tag LOCUS_52850 24593 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 25318 29424 gene locus_tag LOCUS_52860 25318 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 29449 31530 gene locus_tag LOCUS_52870 29449 31530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 31527 33659 gene locus_tag LOCUS_52880 31527 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52880 33684 35054 gene locus_tag LOCUS_52890 gene atoC 33684 35054 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_52890 35293 38097 gene locus_tag LOCUS_52900 35293 38097 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_52900 38987 38406 gene locus_tag LOCUS_52910 38987 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 42257 39063 gene locus_tag LOCUS_52920 42257 39063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 42406 49611 gene locus_tag LOCUS_52930 42406 49611 CDS product hybrid non-ribosomal peptide synthetase/type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225536.1 protein_id gnl|my_center|LOCUS_52930 50692 49595 gene locus_tag LOCUS_52940 50692 49595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_52940 50892 51707 gene locus_tag LOCUS_52950 50892 51707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 51707 52339 gene locus_tag LOCUS_52960 51707 52339 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_52960 52352 52591 gene locus_tag LOCUS_52970 52352 52591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 53187 52711 gene locus_tag LOCUS_52980 53187 52711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 53350 53652 gene locus_tag LOCUS_52990 53350 53652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 53772 54845 gene locus_tag LOCUS_53000 53772 54845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 >Feature sequence058 12131 921 gene locus_tag LOCUS_53010 12131 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 9297 9198 gene locus_tag LOCUS_t00380 9297 9198 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18442 12128 gene locus_tag LOCUS_53020 18442 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53020 18371 18778 gene locus_tag LOCUS_53030 18371 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 21649 19214 gene locus_tag LOCUS_53040 21649 19214 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_53040 22655 21642 gene locus_tag LOCUS_53050 22655 21642 CDS product syrP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267821.1 protein_id gnl|my_center|LOCUS_53050 31517 22701 gene locus_tag LOCUS_53060 31517 22701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53060 31863 32180 gene locus_tag LOCUS_53070 31863 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 33513 32221 gene locus_tag LOCUS_53080 gene ectB 33513 32221 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_53080 34791 33550 gene locus_tag LOCUS_53090 34791 33550 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_53090 39588 34837 gene locus_tag LOCUS_53100 39588 34837 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973237.1 protein_id gnl|my_center|LOCUS_53100 50873 39585 gene locus_tag LOCUS_53110 50873 39585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 51135 52292 gene locus_tag LOCUS_53120 51135 52292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 >Feature sequence059 167 1060 gene locus_tag LOCUS_53130 gene hbd 167 1060 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52041 protein_id gnl|my_center|LOCUS_53130 1064 1831 gene locus_tag LOCUS_53140 1064 1831 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189909.1 protein_id gnl|my_center|LOCUS_53140 2303 2551 gene locus_tag LOCUS_53150 2303 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 4019 2499 gene locus_tag LOCUS_53160 gene speE1 4019 2499 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_53160 4242 4024 gene locus_tag LOCUS_53170 4242 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 4420 4244 gene locus_tag LOCUS_53180 4420 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 5680 4424 gene locus_tag LOCUS_53190 5680 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 6360 5677 gene locus_tag LOCUS_53200 6360 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53200 8867 6366 gene locus_tag LOCUS_53210 8867 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 9434 10015 gene locus_tag LOCUS_53220 9434 10015 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 protein_id gnl|my_center|LOCUS_53220 10068 11318 gene locus_tag LOCUS_53230 10068 11318 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_53230 11315 14542 gene locus_tag LOCUS_53240 11315 14542 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_53240 14539 16179 gene locus_tag LOCUS_53250 gene oprN 14539 16179 CDS product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_53250 16254 16655 gene locus_tag LOCUS_53260 16254 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 16658 17080 gene locus_tag LOCUS_53270 16658 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 18327 17083 gene locus_tag LOCUS_53280 18327 17083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_53280 18738 21581 gene locus_tag LOCUS_53290 18738 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 22031 24667 gene locus_tag LOCUS_53300 22031 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 24858 25166 gene locus_tag LOCUS_53310 24858 25166 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_53310 25176 28628 gene locus_tag LOCUS_53320 25176 28628 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404548.1 protein_id gnl|my_center|LOCUS_53320 28833 29612 gene locus_tag LOCUS_53330 28833 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 31449 29830 gene locus_tag LOCUS_53340 31449 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 31565 33217 gene locus_tag LOCUS_53350 31565 33217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 34440 33214 gene locus_tag LOCUS_53360 34440 33214 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227368.1 protein_id gnl|my_center|LOCUS_53360 35813 34626 gene locus_tag LOCUS_53370 35813 34626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 39295 35924 gene locus_tag LOCUS_53380 39295 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 42708 39307 gene locus_tag LOCUS_53390 42708 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 43399 42731 gene locus_tag LOCUS_53400 43399 42731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 44376 43573 gene locus_tag LOCUS_53410 44376 43573 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_53410 44771 44364 gene locus_tag LOCUS_53420 44771 44364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 44818 45177 gene locus_tag LOCUS_53430 44818 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 45446 47548 gene locus_tag LOCUS_53440 45446 47548 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_53440 48655 47540 gene locus_tag LOCUS_53450 48655 47540 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_53450 48722 49489 gene locus_tag LOCUS_53460 gene drrA 48722 49489 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_53460 49482 50516 gene locus_tag LOCUS_53470 49482 50516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 50814 50587 gene locus_tag LOCUS_53480 50814 50587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 51424 50759 gene locus_tag LOCUS_53490 51424 50759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 51920 53338 gene locus_tag LOCUS_53500 51920 53338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 >Feature sequence060 1217 231 gene locus_tag LOCUS_53510 1217 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 1349 1930 gene locus_tag LOCUS_53520 1349 1930 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_53520 1945 2880 gene locus_tag LOCUS_53530 1945 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 2880 5978 gene locus_tag LOCUS_53540 2880 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_53540 6159 7859 gene locus_tag LOCUS_53550 6159 7859 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_53550 8039 8839 gene locus_tag LOCUS_53560 8039 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 9312 10094 gene locus_tag LOCUS_53570 9312 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 10207 11349 gene locus_tag LOCUS_53580 gene ydjI 10207 11349 CDS product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_53580 11361 12452 gene locus_tag LOCUS_53590 11361 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_53590 12522 14045 gene locus_tag LOCUS_53600 12522 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 14008 14577 gene locus_tag LOCUS_53610 14008 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 14587 17010 gene locus_tag LOCUS_53620 14587 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 17046 17630 gene locus_tag LOCUS_53630 17046 17630 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_53630 17623 20028 gene locus_tag LOCUS_53640 17623 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 20653 20195 gene locus_tag LOCUS_53650 20653 20195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 20931 20650 gene locus_tag LOCUS_53660 20931 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 23228 20988 gene locus_tag LOCUS_53670 23228 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 23868 23233 gene locus_tag LOCUS_53680 23868 23233 CDS product lipoprotein, RlpA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546239.1 protein_id gnl|my_center|LOCUS_53680 24619 23873 gene locus_tag LOCUS_53690 gene pdxJ 24619 23873 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_53690 26089 24716 gene locus_tag LOCUS_53700 gene glmM 26089 24716 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HA92 protein_id gnl|my_center|LOCUS_53700 26820 26140 gene locus_tag LOCUS_53710 26820 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 27758 26817 gene locus_tag LOCUS_53720 27758 26817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_53720 28676 27786 gene locus_tag LOCUS_53730 gene folP 28676 27786 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942453.1 protein_id gnl|my_center|LOCUS_53730 30640 28673 gene locus_tag LOCUS_53740 gene ftsH-2 30640 28673 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_53740 32219 30732 gene locus_tag LOCUS_53750 32219 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 32337 32261 gene locus_tag LOCUS_t00390 32337 32261 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 32862 32554 gene locus_tag LOCUS_53760 32862 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 33849 33250 gene locus_tag LOCUS_53770 gene sodA 33849 33250 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_53770 34058 34133 gene locus_tag LOCUS_t00400 34058 34133 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34192 34268 gene locus_tag LOCUS_t00410 34192 34268 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 34470 34625 gene locus_tag LOCUS_53780 gene rpmG 34470 34625 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_53780 34657 36039 gene locus_tag LOCUS_53790 gene mtaD 34657 36039 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_53790 37690 36077 gene locus_tag LOCUS_53800 37690 36077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 39542 37698 gene locus_tag LOCUS_53810 39542 37698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 40231 39611 gene locus_tag LOCUS_53820 40231 39611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 41084 40386 gene locus_tag LOCUS_53830 41084 40386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 41668 41405 gene locus_tag LOCUS_53840 41668 41405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 42086 42322 gene locus_tag LOCUS_53850 42086 42322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 42461 44341 gene locus_tag LOCUS_53860 42461 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 44350 45048 gene locus_tag LOCUS_53870 44350 45048 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_53870 45284 45535 gene locus_tag LOCUS_53880 45284 45535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 50821 45827 gene locus_tag LOCUS_53890 50821 45827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 >Feature sequence061 4277 279 gene locus_tag LOCUS_53900 4277 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 7368 4279 gene locus_tag LOCUS_53910 7368 4279 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_53910 8474 7368 gene locus_tag LOCUS_53920 8474 7368 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_53920 9175 8486 gene locus_tag LOCUS_53930 9175 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 10128 9175 gene locus_tag LOCUS_53940 10128 9175 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_53940 12923 10125 gene locus_tag LOCUS_53950 12923 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 14703 13048 gene locus_tag LOCUS_53960 14703 13048 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_53960 14894 15493 gene locus_tag LOCUS_53970 14894 15493 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_53970 15483 18071 gene locus_tag LOCUS_53980 15483 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 18108 18296 gene locus_tag LOCUS_53990 18108 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 18293 18613 gene locus_tag LOCUS_54000 18293 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 18737 19330 gene locus_tag LOCUS_54010 18737 19330 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_54010 19327 19989 gene locus_tag LOCUS_54020 19327 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 20042 21280 gene locus_tag LOCUS_54030 20042 21280 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_54030 21894 21277 gene locus_tag LOCUS_54040 21894 21277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 22361 21891 gene locus_tag LOCUS_54050 22361 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 22803 22393 gene locus_tag LOCUS_54060 22803 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 24029 22989 gene locus_tag LOCUS_54070 24029 22989 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA19 protein_id gnl|my_center|LOCUS_54070 24145 24786 gene locus_tag LOCUS_54080 24145 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 24788 25531 gene locus_tag LOCUS_54090 24788 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 25565 26323 gene locus_tag LOCUS_54100 25565 26323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 28270 26324 gene locus_tag LOCUS_54110 28270 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 28810 28391 gene locus_tag LOCUS_54120 gene vapC 28810 28391 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_54120 29121 28810 gene locus_tag LOCUS_54130 29121 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 30396 29239 gene locus_tag LOCUS_54140 30396 29239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 31330 30512 gene locus_tag LOCUS_54150 31330 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 32059 31352 gene locus_tag LOCUS_54160 32059 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 32749 32258 gene locus_tag LOCUS_54170 32749 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 33186 32755 gene locus_tag LOCUS_54180 gene exbD 33186 32755 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_54180 33890 33216 gene locus_tag LOCUS_54190 33890 33216 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_54190 34800 34237 gene locus_tag LOCUS_54200 gene ruvC 34800 34237 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBW8 protein_id gnl|my_center|LOCUS_54200 35539 34793 gene locus_tag LOCUS_54210 35539 34793 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_54210 35912 35724 gene locus_tag LOCUS_54220 35912 35724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 37291 36950 gene locus_tag LOCUS_54230 37291 36950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 37327 39321 gene locus_tag LOCUS_54240 37327 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 39409 39633 gene locus_tag LOCUS_54250 39409 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 39637 40485 gene locus_tag LOCUS_54260 gene accD 39637 40485 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43778 protein_id gnl|my_center|LOCUS_54260 40507 41853 gene locus_tag LOCUS_54270 40507 41853 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869696.1 protein_id gnl|my_center|LOCUS_54270 41850 42863 gene locus_tag LOCUS_54280 41850 42863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 43625 42882 gene locus_tag LOCUS_54290 gene trmJ 43625 42882 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_54290 43628 43867 gene locus_tag LOCUS_54300 43628 43867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 44273 45016 gene locus_tag LOCUS_54310 44273 45016 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202426.1 protein_id gnl|my_center|LOCUS_54310 45189 46697 gene locus_tag LOCUS_54320 45189 46697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 46982 48475 gene locus_tag LOCUS_54330 46982 48475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 >Feature sequence062 6034 140 gene locus_tag LOCUS_54340 6034 140 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387865.1 protein_id gnl|my_center|LOCUS_54340 6249 7052 gene locus_tag LOCUS_54350 6249 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 7138 10710 gene locus_tag LOCUS_54360 gene recC 7138 10710 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_54360 10727 12109 gene locus_tag LOCUS_54370 10727 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 12387 16355 gene locus_tag LOCUS_54380 gene recB 12387 16355 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI1 protein_id gnl|my_center|LOCUS_54380 16352 18604 gene locus_tag LOCUS_54390 gene recD 16352 18604 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH9 protein_id gnl|my_center|LOCUS_54390 18611 19333 gene locus_tag LOCUS_54400 18611 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 19531 22773 gene locus_tag LOCUS_54410 19531 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 22849 23613 gene locus_tag LOCUS_54420 22849 23613 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_54420 23844 25232 gene locus_tag LOCUS_54430 23844 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 25229 27424 gene locus_tag LOCUS_54440 25229 27424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 27511 29937 gene locus_tag LOCUS_54450 27511 29937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 29924 31360 gene locus_tag LOCUS_54460 29924 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 31357 33414 gene locus_tag LOCUS_54470 31357 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 33736 36726 gene locus_tag LOCUS_54480 33736 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 36981 36736 gene locus_tag LOCUS_54490 36981 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 37267 38814 gene locus_tag LOCUS_54500 gene abfD 37267 38814 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_54500 38817 39143 gene locus_tag LOCUS_54510 38817 39143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 39668 39144 gene locus_tag LOCUS_54520 39668 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 39786 40262 gene locus_tag LOCUS_54530 39786 40262 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_54530 40351 40806 gene locus_tag LOCUS_54540 40351 40806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_54540 40881 41240 gene locus_tag LOCUS_54550 40881 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_54550 41810 41295 gene locus_tag LOCUS_54560 41810 41295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 41890 44106 gene locus_tag LOCUS_54570 41890 44106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 44230 44790 gene locus_tag LOCUS_54580 44230 44790 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_54580 44822 45757 gene locus_tag LOCUS_54590 44822 45757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 protein_id gnl|my_center|LOCUS_54590 46262 45702 gene locus_tag LOCUS_54600 46262 45702 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_54600 >Feature sequence063 647 459 gene locus_tag LOCUS_54610 647 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 1334 696 gene locus_tag LOCUS_54620 1334 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 3072 1327 gene locus_tag LOCUS_54630 3072 1327 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_54630 3677 3180 gene locus_tag LOCUS_54640 3677 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 3810 5366 gene locus_tag LOCUS_54650 gene glyQS 3810 5366 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_54650 6768 5371 gene locus_tag LOCUS_54660 6768 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 7087 10029 gene locus_tag LOCUS_54670 7087 10029 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_54670 12896 10656 gene locus_tag LOCUS_54680 12896 10656 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_54680 13528 12902 gene locus_tag LOCUS_54690 13528 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 13740 14240 gene locus_tag LOCUS_54700 gene smpB 13740 14240 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG4 protein_id gnl|my_center|LOCUS_54700 14273 15628 gene locus_tag LOCUS_54710 gene gdhA 14273 15628 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_54710 16536 17240 gene locus_tag LOCUS_54720 16536 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 17237 18139 gene locus_tag LOCUS_54730 17237 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 19988 18159 gene locus_tag LOCUS_54740 19988 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 20115 21449 gene locus_tag LOCUS_54750 gene aroA 20115 21449 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z0 protein_id gnl|my_center|LOCUS_54750 21437 24643 gene locus_tag LOCUS_54760 21437 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 25014 25655 gene locus_tag LOCUS_54770 25014 25655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 26702 25713 gene locus_tag LOCUS_54780 gene thiL 26702 25713 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_54780 29099 26721 gene locus_tag LOCUS_54790 gene lon 29099 26721 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_54790 29603 29109 gene locus_tag LOCUS_54800 gene nrdR 29603 29109 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4W1 protein_id gnl|my_center|LOCUS_54800 31126 29600 gene locus_tag LOCUS_54810 31126 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 32071 31340 gene locus_tag LOCUS_54820 32071 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 32370 33413 gene locus_tag LOCUS_54830 gene hrcA 32370 33413 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_54830 33447 34223 gene locus_tag LOCUS_54840 33447 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 34261 36075 gene locus_tag LOCUS_54850 gene dnaK 34261 36075 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_54850 36137 37246 gene locus_tag LOCUS_54860 gene dnaJ 36137 37246 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_54860 37243 38154 gene locus_tag LOCUS_54870 37243 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 38124 38873 gene locus_tag LOCUS_54880 38124 38873 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD87 protein_id gnl|my_center|LOCUS_54880 38891 39220 gene locus_tag LOCUS_54890 38891 39220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 39399 39223 gene locus_tag LOCUS_54900 39399 39223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 39355 39582 gene locus_tag LOCUS_54910 39355 39582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 39676 40854 gene locus_tag LOCUS_54920 gene pilT-1 39676 40854 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_54920 40902 41378 gene locus_tag LOCUS_54930 40902 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 41394 44042 gene locus_tag LOCUS_54940 gene alaS 41394 44042 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ3 protein_id gnl|my_center|LOCUS_54940 44061 45368 gene locus_tag LOCUS_54950 gene aspC 44061 45368 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_54950 >Feature sequence064 818 1612 gene locus_tag LOCUS_54960 818 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 3194 1623 gene locus_tag LOCUS_54970 3194 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 4885 3191 gene locus_tag LOCUS_54980 4885 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 5772 4882 gene locus_tag LOCUS_54990 5772 4882 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_54990 7221 5782 gene locus_tag LOCUS_55000 7221 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55000 9450 7237 gene locus_tag LOCUS_55010 9450 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 9919 11451 gene locus_tag LOCUS_55020 9919 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 11532 12452 gene locus_tag LOCUS_55030 11532 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 12449 13090 gene locus_tag LOCUS_55040 gene hisG 12449 13090 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM15 protein_id gnl|my_center|LOCUS_55040 13098 14396 gene locus_tag LOCUS_55050 gene hisD 13098 14396 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHM2 protein_id gnl|my_center|LOCUS_55050 14393 15487 gene locus_tag LOCUS_55060 gene hisC 14393 15487 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRM7 protein_id gnl|my_center|LOCUS_55060 15484 16086 gene locus_tag LOCUS_55070 gene hisB 15484 16086 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_55070 16083 16736 gene locus_tag LOCUS_55080 gene hisH 16083 16736 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S299 protein_id gnl|my_center|LOCUS_55080 16736 17467 gene locus_tag LOCUS_55090 gene priA 16736 17467 CDS product phosphoribosyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBX5 protein_id gnl|my_center|LOCUS_55090 17460 18272 gene locus_tag LOCUS_55100 gene hisF 17460 18272 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMM3 protein_id gnl|my_center|LOCUS_55100 18269 18955 gene locus_tag LOCUS_55110 gene hisI 18269 18955 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK5 protein_id gnl|my_center|LOCUS_55110 18952 20424 gene locus_tag LOCUS_55120 gene trpE 18952 20424 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404407.1 protein_id gnl|my_center|LOCUS_55120 20426 21016 gene locus_tag LOCUS_55130 20426 21016 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_55130 21030 22043 gene locus_tag LOCUS_55140 gene trpD 21030 22043 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD71 protein_id gnl|my_center|LOCUS_55140 22075 22389 gene locus_tag LOCUS_55150 22075 22389 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_55150 22379 22720 gene locus_tag LOCUS_55160 22379 22720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 22733 23665 gene locus_tag LOCUS_55170 gene phhA 22733 23665 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204188.1 protein_id gnl|my_center|LOCUS_55170 23906 23679 gene locus_tag LOCUS_55180 23906 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 24122 26023 gene locus_tag LOCUS_55190 24122 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 26035 27135 gene locus_tag LOCUS_55200 gene pilT-3 26035 27135 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_55200 27206 28867 gene locus_tag LOCUS_55210 27206 28867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 29366 29695 gene locus_tag LOCUS_55220 29366 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 30381 29959 gene locus_tag LOCUS_55230 30381 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 30651 31526 gene locus_tag LOCUS_55240 30651 31526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 31736 31536 gene locus_tag LOCUS_55250 31736 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 33118 31817 gene locus_tag LOCUS_55260 33118 31817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_55260 35155 33143 gene locus_tag LOCUS_55270 35155 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 35281 36105 gene locus_tag LOCUS_55280 35281 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 36665 36135 gene locus_tag LOCUS_55290 36665 36135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 38260 36662 gene locus_tag LOCUS_55300 38260 36662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_55300 38739 38257 gene locus_tag LOCUS_55310 38739 38257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 39404 38877 gene locus_tag LOCUS_55320 39404 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 39657 40283 gene locus_tag LOCUS_55330 39657 40283 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_55330 40337 41368 gene locus_tag LOCUS_55340 40337 41368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 41365 42492 gene locus_tag LOCUS_55350 41365 42492 CDS product anion transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_55350 42868 44550 gene locus_tag LOCUS_55360 42868 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989412.1 protein_id gnl|my_center|LOCUS_55360 >Feature sequence065 557 1252 gene locus_tag LOCUS_55370 557 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936261.1 protein_id gnl|my_center|LOCUS_55370 2094 2582 gene locus_tag LOCUS_55380 2094 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 2597 3301 gene locus_tag LOCUS_55390 2597 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 3301 3648 gene locus_tag LOCUS_55400 3301 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 4184 3645 gene locus_tag LOCUS_55410 4184 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 4739 4197 gene locus_tag LOCUS_55420 4739 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 5084 4740 gene locus_tag LOCUS_55430 5084 4740 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499010.1 protein_id gnl|my_center|LOCUS_55430 5622 5116 gene locus_tag LOCUS_55440 5622 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 7011 5638 gene locus_tag LOCUS_55450 7011 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 9338 7008 gene locus_tag LOCUS_55460 9338 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 12124 9356 gene locus_tag LOCUS_55470 12124 9356 CDS product Clp-type ATPase chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205629.1 protein_id gnl|my_center|LOCUS_55470 10540 10636 gene locus_tag LOCUS_t00420 10540 10636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13248 12121 gene locus_tag LOCUS_55480 gene tssG 13248 12121 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_55480 15005 13212 gene locus_tag LOCUS_55490 15005 13212 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480666.1 protein_id gnl|my_center|LOCUS_55490 15490 15056 gene locus_tag LOCUS_55500 15490 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 protein_id gnl|my_center|LOCUS_55500 16010 15540 gene locus_tag LOCUS_55510 16010 15540 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997068.1 protein_id gnl|my_center|LOCUS_55510 17546 16047 gene locus_tag LOCUS_55520 17546 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640195.1 protein_id gnl|my_center|LOCUS_55520 18140 17574 gene locus_tag LOCUS_55530 18140 17574 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 protein_id gnl|my_center|LOCUS_55530 18501 20189 gene locus_tag LOCUS_55540 18501 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 20238 22289 gene locus_tag LOCUS_55550 20238 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 22292 23608 gene locus_tag LOCUS_55560 22292 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 24354 23614 gene locus_tag LOCUS_55570 24354 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 25442 25669 gene locus_tag LOCUS_55580 25442 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 25906 26142 gene locus_tag LOCUS_55590 25906 26142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 29816 26817 gene locus_tag LOCUS_55600 29816 26817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 31790 29883 gene locus_tag LOCUS_55610 31790 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 33880 31790 gene locus_tag LOCUS_55620 33880 31790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 37240 33917 gene locus_tag LOCUS_55630 37240 33917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 35671 35768 gene locus_tag LOCUS_t00430 35671 35768 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37616 38362 gene locus_tag LOCUS_55640 37616 38362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 39070 38411 gene locus_tag LOCUS_55650 39070 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 >Feature sequence066 522 659 gene locus_tag LOCUS_55660 522 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 699 1670 gene locus_tag LOCUS_55670 699 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 1839 2468 gene locus_tag LOCUS_55680 1839 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_55680 3690 2722 gene locus_tag LOCUS_55690 3690 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 4955 3747 gene locus_tag LOCUS_55700 4955 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 6227 4998 gene locus_tag LOCUS_55710 gene envC 6227 4998 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196275.1 protein_id gnl|my_center|LOCUS_55710 6369 7271 gene locus_tag LOCUS_55720 6369 7271 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_55720 7288 10938 gene locus_tag LOCUS_55730 7288 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_55730 10951 12834 gene locus_tag LOCUS_55740 10951 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 16123 12824 gene locus_tag LOCUS_55750 16123 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 16764 16210 gene locus_tag LOCUS_55760 16764 16210 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_55760 17996 16761 gene locus_tag LOCUS_55770 17996 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 19300 17990 gene locus_tag LOCUS_55780 19300 17990 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206548.1 protein_id gnl|my_center|LOCUS_55780 20102 19323 gene locus_tag LOCUS_55790 20102 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 22501 20261 gene locus_tag LOCUS_55800 22501 20261 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_55800 22605 23144 gene locus_tag LOCUS_55810 22605 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_55810 23172 24203 gene locus_tag LOCUS_55820 23172 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 24203 26566 gene locus_tag LOCUS_55830 24203 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 27866 26577 gene locus_tag LOCUS_55840 27866 26577 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_55840 28265 27921 gene locus_tag LOCUS_55850 28265 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_55850 31597 28619 gene locus_tag LOCUS_55860 gene cyaI3 31597 28619 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967832.1 protein_id gnl|my_center|LOCUS_55860 31538 31816 gene locus_tag LOCUS_55870 31538 31816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 32364 31936 gene locus_tag LOCUS_55880 32364 31936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 32564 33001 gene locus_tag LOCUS_55890 32564 33001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 33026 34303 gene locus_tag LOCUS_55900 33026 34303 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 protein_id gnl|my_center|LOCUS_55900 34403 35212 gene locus_tag LOCUS_55910 34403 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 35450 37633 gene locus_tag LOCUS_55920 35450 37633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 37630 38832 gene locus_tag LOCUS_55930 37630 38832 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975225.1 protein_id gnl|my_center|LOCUS_55930 38829 41987 gene locus_tag LOCUS_55940 gene nolG 38829 41987 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_55940 42001 42648 gene locus_tag LOCUS_55950 42001 42648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 >Feature sequence067 352 810 gene locus_tag LOCUS_55960 352 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 2784 1432 gene locus_tag LOCUS_55970 2784 1432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_55970 5962 2777 gene locus_tag LOCUS_55980 5962 2777 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_55980 7108 5969 gene locus_tag LOCUS_55990 7108 5969 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 protein_id gnl|my_center|LOCUS_55990 8420 7098 gene locus_tag LOCUS_56000 8420 7098 CDS product multidrug efflux system lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205381.1 protein_id gnl|my_center|LOCUS_56000 8809 10905 gene locus_tag LOCUS_56010 8809 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 10902 18458 gene locus_tag LOCUS_56020 10902 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 18491 19597 gene locus_tag LOCUS_56030 18491 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 19594 21951 gene locus_tag LOCUS_56040 19594 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 21948 24356 gene locus_tag LOCUS_56050 21948 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 24458 25558 gene locus_tag LOCUS_56060 24458 25558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 26962 25562 gene locus_tag LOCUS_56070 26962 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 27705 27016 gene locus_tag LOCUS_56080 27705 27016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 28525 27692 gene locus_tag LOCUS_56090 28525 27692 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651232.1 protein_id gnl|my_center|LOCUS_56090 28700 30355 gene locus_tag LOCUS_56100 28700 30355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 31419 30565 gene locus_tag LOCUS_56110 gene pnp 31419 30565 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5V2 protein_id gnl|my_center|LOCUS_56110 32735 31416 gene locus_tag LOCUS_56120 gene pyn 32735 31416 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403917.1 protein_id gnl|my_center|LOCUS_56120 33912 32737 gene locus_tag LOCUS_56130 gene deoB 33912 32737 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_56130 34074 35219 gene locus_tag LOCUS_56140 34074 35219 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_56140 35223 35630 gene locus_tag LOCUS_56150 35223 35630 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_56150 35627 35929 gene locus_tag LOCUS_56160 35627 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 37416 35956 gene locus_tag LOCUS_56170 37416 35956 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_56170 37643 37413 gene locus_tag LOCUS_56180 37643 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 37840 39111 gene locus_tag LOCUS_56190 37840 39111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 >Feature sequence068 826 422 gene locus_tag LOCUS_56200 826 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 1286 2170 gene locus_tag LOCUS_56210 1286 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 3768 2191 gene locus_tag LOCUS_56220 3768 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 5469 3820 gene locus_tag LOCUS_56230 5469 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 8511 5479 gene locus_tag LOCUS_56240 8511 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 9956 8535 gene locus_tag LOCUS_56250 9956 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 13011 10081 gene locus_tag LOCUS_56260 13011 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090864.1 protein_id gnl|my_center|LOCUS_56260 13857 13492 gene locus_tag LOCUS_56270 13857 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 14629 13877 gene locus_tag LOCUS_56280 14629 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 15216 14626 gene locus_tag LOCUS_56290 15216 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 15778 16800 gene locus_tag LOCUS_56300 15778 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 16878 19298 gene locus_tag LOCUS_56310 16878 19298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 20175 19372 gene locus_tag LOCUS_56320 20175 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 20252 22576 gene locus_tag LOCUS_56330 20252 22576 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704240.1 protein_id gnl|my_center|LOCUS_56330 22573 23967 gene locus_tag LOCUS_56340 22573 23967 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_56340 23964 27224 gene locus_tag LOCUS_56350 23964 27224 CDS product type I restriction-modification system, restriction (R) subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_56350 27401 28639 gene locus_tag LOCUS_56360 27401 28639 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_56360 28639 29622 gene locus_tag LOCUS_56370 28639 29622 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_56370 29632 30141 gene locus_tag LOCUS_56380 gene dcd 29632 30141 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MG72 protein_id gnl|my_center|LOCUS_56380 30240 31646 gene locus_tag LOCUS_56390 30240 31646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 31643 33187 gene locus_tag LOCUS_56400 gene gltB2 31643 33187 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_56400 <39073 33791 gene locus_tag LOCUS_56410 <39073 33791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs >Feature sequence069 335 72 gene locus_tag LOCUS_56420 335 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 994 2016 gene locus_tag LOCUS_56430 994 2016 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_56430 2212 4926 gene locus_tag LOCUS_56440 2212 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 4940 6424 gene locus_tag LOCUS_56450 4940 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 6426 7949 gene locus_tag LOCUS_56460 6426 7949 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_56460 7946 9196 gene locus_tag LOCUS_56470 7946 9196 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_56470 9207 10091 gene locus_tag LOCUS_56480 9207 10091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_56480 10088 10915 gene locus_tag LOCUS_56490 10088 10915 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_56490 10959 12212 gene locus_tag LOCUS_56500 10959 12212 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788030.1 protein_id gnl|my_center|LOCUS_56500 13339 12245 gene locus_tag LOCUS_56510 13339 12245 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_56510 15067 14147 gene locus_tag LOCUS_56520 15067 14147 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_56520 15698 15156 gene locus_tag LOCUS_56530 15698 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 16178 15777 gene locus_tag LOCUS_56540 16178 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 16778 16470 gene locus_tag LOCUS_56550 16778 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 17055 18206 gene locus_tag LOCUS_56560 17055 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 18228 18512 gene locus_tag LOCUS_56570 18228 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 19331 18849 gene locus_tag LOCUS_56580 19331 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 19631 19374 gene locus_tag LOCUS_56590 19631 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 20332 19628 gene locus_tag LOCUS_56600 20332 19628 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL23 protein_id gnl|my_center|LOCUS_56600 21645 20446 gene locus_tag LOCUS_56610 21645 20446 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_56610 21980 21907 gene locus_tag LOCUS_t00440 21980 21907 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 24544 22052 gene locus_tag LOCUS_56620 gene rne 24544 22052 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EP1 protein_id gnl|my_center|LOCUS_56620 27199 24758 gene locus_tag LOCUS_56630 27199 24758 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_56630 27477 28700 gene locus_tag LOCUS_56640 gene add 27477 28700 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_56640 29072 30517 gene locus_tag LOCUS_56650 29072 30517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 30501 31340 gene locus_tag LOCUS_56660 30501 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 31487 32272 gene locus_tag LOCUS_56670 31487 32272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 34363 32273 gene locus_tag LOCUS_56680 34363 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 36845 34644 gene locus_tag LOCUS_56690 36845 34644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 <37988 36953 gene locus_tag LOCUS_56700 <37988 36953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence070 1471 242 gene locus_tag LOCUS_56710 gene acrE 1471 242 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_56710 1935 3359 gene locus_tag LOCUS_56720 1935 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 3356 11002 gene locus_tag LOCUS_56730 3356 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 10999 14472 gene locus_tag LOCUS_56740 10999 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 14469 17300 gene locus_tag LOCUS_56750 14469 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 17293 24006 gene locus_tag LOCUS_56760 17293 24006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56760 23999 32683 gene locus_tag LOCUS_56770 23999 32683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56770 32680 34410 gene locus_tag LOCUS_56780 32680 34410 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_56780 34479 35468 gene locus_tag LOCUS_56790 34479 35468 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_56790 35468 36235 gene locus_tag LOCUS_56800 35468 36235 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M7 protein_id gnl|my_center|LOCUS_56800 36245 37534 gene locus_tag LOCUS_56810 36245 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 >Feature sequence071 1790 153 gene locus_tag LOCUS_56820 1790 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 2184 1828 gene locus_tag LOCUS_56830 2184 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 2619 2200 gene locus_tag LOCUS_56840 2619 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 2844 2665 gene locus_tag LOCUS_56850 2844 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 5083 3137 gene locus_tag LOCUS_56860 5083 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 5709 5101 gene locus_tag LOCUS_56870 gene tdk 5709 5101 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL9 protein_id gnl|my_center|LOCUS_56870 5794 6132 gene locus_tag LOCUS_56880 5794 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_56880 6149 7111 gene locus_tag LOCUS_56890 6149 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_56890 8072 7404 gene locus_tag LOCUS_56900 gene ompW 8072 7404 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_56900 9674 8283 gene locus_tag LOCUS_56910 9674 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_56910 11470 9737 gene locus_tag LOCUS_56920 11470 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_56920 12377 11601 gene locus_tag LOCUS_56930 12377 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 13115 12381 gene locus_tag LOCUS_56940 13115 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989617.1 protein_id gnl|my_center|LOCUS_56940 13854 13123 gene locus_tag LOCUS_56950 13854 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 14458 13928 gene locus_tag LOCUS_56960 14458 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 15248 14445 gene locus_tag LOCUS_56970 15248 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 15247 15459 gene locus_tag LOCUS_56980 15247 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 16553 15441 gene locus_tag LOCUS_56990 16553 15441 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_56990 17625 16843 gene locus_tag LOCUS_57000 17625 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 17740 21477 gene locus_tag LOCUS_57010 17740 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 21474 23000 gene locus_tag LOCUS_57020 21474 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 24167 22971 gene locus_tag LOCUS_57030 24167 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 26156 24288 gene locus_tag LOCUS_57040 26156 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 28315 26153 gene locus_tag LOCUS_57050 28315 26153 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_57050 28953 28384 gene locus_tag LOCUS_57060 28953 28384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57060 29210 28956 gene locus_tag LOCUS_57070 29210 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 31856 29241 gene locus_tag LOCUS_57080 31856 29241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 >Feature sequence072 499 702 gene locus_tag LOCUS_57090 499 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 3284 852 gene locus_tag LOCUS_57100 3284 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_57100 4703 3309 gene locus_tag LOCUS_57110 4703 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 6118 4715 gene locus_tag LOCUS_57120 6118 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_57120 7224 6145 gene locus_tag LOCUS_57130 7224 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226588.1 protein_id gnl|my_center|LOCUS_57130 8408 7227 gene locus_tag LOCUS_57140 8408 7227 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225912.1 protein_id gnl|my_center|LOCUS_57140 8655 8410 gene locus_tag LOCUS_57150 8655 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225913.1 protein_id gnl|my_center|LOCUS_57150 9566 8703 gene locus_tag LOCUS_57160 gene paaH 9566 8703 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_57160 10561 9842 gene locus_tag LOCUS_57170 10561 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 11271 10867 gene locus_tag LOCUS_57180 11271 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 13976 11508 gene locus_tag LOCUS_57190 13976 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 17444 14211 gene locus_tag LOCUS_57200 17444 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 17798 18721 gene locus_tag LOCUS_57210 17798 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 18718 20028 gene locus_tag LOCUS_57220 18718 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 20053 22179 gene locus_tag LOCUS_57230 20053 22179 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_57230 22247 24022 gene locus_tag LOCUS_57240 22247 24022 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_57240 24183 23953 gene locus_tag LOCUS_57250 24183 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 24498 24244 gene locus_tag LOCUS_57260 24498 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 26122 24587 gene locus_tag LOCUS_57270 26122 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 27120 26134 gene locus_tag LOCUS_57280 27120 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 27654 27232 gene locus_tag LOCUS_57290 gene vapC 27654 27232 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI02 protein_id gnl|my_center|LOCUS_57290 27896 27651 gene locus_tag LOCUS_57300 27896 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 29455 28025 gene locus_tag LOCUS_57310 29455 28025 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_57310 31074 29452 gene locus_tag LOCUS_57320 31074 29452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 >Feature sequence073 3675 163 gene locus_tag LOCUS_57330 3675 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 4480 3683 gene locus_tag LOCUS_57340 4480 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 7374 4489 gene locus_tag LOCUS_57350 7374 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 9241 7382 gene locus_tag LOCUS_57360 9241 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 12227 9297 gene locus_tag LOCUS_57370 12227 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 16531 12224 gene locus_tag LOCUS_57380 16531 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 20094 16528 gene locus_tag LOCUS_57390 20094 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 20290 22629 gene locus_tag LOCUS_57400 20290 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 24096 22678 gene locus_tag LOCUS_57410 gene purB 24096 22678 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_57410 24274 25563 gene locus_tag LOCUS_57420 gene arcA 24274 25563 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZA0 protein_id gnl|my_center|LOCUS_57420 25665 27479 gene locus_tag LOCUS_57430 25665 27479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 27499 28038 gene locus_tag LOCUS_57440 27499 28038 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762369.1 protein_id gnl|my_center|LOCUS_57440 >Feature sequence074 5266 2915 gene locus_tag LOCUS_57450 5266 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 5501 6979 gene locus_tag LOCUS_57460 gene hisS 5501 6979 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWD2 protein_id gnl|my_center|LOCUS_57460 8616 7219 gene locus_tag LOCUS_57470 8616 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 8898 9518 gene locus_tag LOCUS_57480 8898 9518 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CI47 protein_id gnl|my_center|LOCUS_57480 9523 10920 gene locus_tag LOCUS_57490 9523 10920 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_57490 11766 10939 gene locus_tag LOCUS_57500 11766 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 12674 11763 gene locus_tag LOCUS_57510 12674 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 13569 12739 gene locus_tag LOCUS_57520 13569 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 13971 13603 gene locus_tag LOCUS_57530 13971 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 14212 14547 gene locus_tag LOCUS_57540 14212 14547 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_57540 14918 16138 gene locus_tag LOCUS_57550 14918 16138 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090895.1 protein_id gnl|my_center|LOCUS_57550 16395 16081 gene locus_tag LOCUS_57560 16395 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 17633 17118 gene locus_tag LOCUS_57570 17633 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57570 20369 17667 gene locus_tag LOCUS_57580 20369 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 20834 20529 gene locus_tag LOCUS_57590 20834 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 22545 21376 gene locus_tag LOCUS_57600 22545 21376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57600 22898 22542 gene locus_tag LOCUS_57610 22898 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 23450 22917 gene locus_tag LOCUS_57620 23450 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 24871 23447 gene locus_tag LOCUS_57630 24871 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 25182 24868 gene locus_tag LOCUS_57640 25182 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 25409 25179 gene locus_tag LOCUS_57650 25409 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 25747 25409 gene locus_tag LOCUS_57660 25747 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 >Feature sequence075 473 862 gene locus_tag LOCUS_57670 473 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 859 1458 gene locus_tag LOCUS_57680 859 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 2102 2896 gene locus_tag LOCUS_57690 2102 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 3165 2977 gene locus_tag LOCUS_57700 3165 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 3382 4137 gene locus_tag LOCUS_57710 3382 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 4250 4642 gene locus_tag LOCUS_57720 4250 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 5208 5639 gene locus_tag LOCUS_57730 5208 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 5639 6523 gene locus_tag LOCUS_57740 5639 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 6520 6771 gene locus_tag LOCUS_57750 6520 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 6814 7710 gene locus_tag LOCUS_57760 6814 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 7707 8720 gene locus_tag LOCUS_57770 7707 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 9497 8730 gene locus_tag LOCUS_57780 9497 8730 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_57780 10000 9494 gene locus_tag LOCUS_57790 10000 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 10483 10046 gene locus_tag LOCUS_57800 10483 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 15470 10746 gene locus_tag LOCUS_57810 15470 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 16260 15481 gene locus_tag LOCUS_57820 16260 15481 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_57820 17075 16257 gene locus_tag LOCUS_57830 gene aldC 17075 16257 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_57830 18025 17072 gene locus_tag LOCUS_57840 18025 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 19380 18046 gene locus_tag LOCUS_57850 19380 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 19534 19409 gene locus_tag LOCUS_57860 19534 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 22310 19656 gene locus_tag LOCUS_57870 22310 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 23184 22372 gene locus_tag LOCUS_57880 23184 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 23902 23225 gene locus_tag LOCUS_57890 23902 23225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 24332 23934 gene locus_tag LOCUS_57900 24332 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 25379 26338 gene locus_tag LOCUS_57910 25379 26338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 >Feature sequence076 2284 209 gene locus_tag LOCUS_57920 gene fusA2 2284 209 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_57920 2944 2474 gene locus_tag LOCUS_57930 gene rpsG 2944 2474 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44376 protein_id gnl|my_center|LOCUS_57930 3351 2977 gene locus_tag LOCUS_57940 gene rpsL 3351 2977 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_57940 5668 3800 gene locus_tag LOCUS_57950 5668 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 5806 8955 gene locus_tag LOCUS_57960 5806 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 9003 9920 gene locus_tag LOCUS_57970 9003 9920 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_57970 9917 11257 gene locus_tag LOCUS_57980 9917 11257 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_57980 11798 13030 gene locus_tag LOCUS_57990 11798 13030 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_57990 15510 13093 gene locus_tag LOCUS_58000 15510 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_58000 15871 18177 gene locus_tag LOCUS_58010 15871 18177 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_58010 18194 18937 gene locus_tag LOCUS_58020 18194 18937 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_58020 18937 20691 gene locus_tag LOCUS_58030 18937 20691 CDS product CRISPR-associated Csd1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_58030 20693 21634 gene locus_tag LOCUS_58040 20693 21634 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_58040 21646 22308 gene locus_tag LOCUS_58050 21646 22308 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_58050 22305 23330 gene locus_tag LOCUS_58060 gene cas1 22305 23330 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF5 protein_id gnl|my_center|LOCUS_58060 23444 23737 gene locus_tag LOCUS_58070 gene cas2 23444 23737 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDC5 protein_id gnl|my_center|LOCUS_58070 23923 >24555 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccccgtgcgggggcgtggattgaaac >Feature sequence077 342 881 gene locus_tag LOCUS_58080 342 881 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_58080 963 1421 gene locus_tag LOCUS_58090 963 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 5014 1418 gene locus_tag LOCUS_58100 5014 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 5208 5642 gene locus_tag LOCUS_58110 5208 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 7331 5697 gene locus_tag LOCUS_58120 7331 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 9142 7259 gene locus_tag LOCUS_58130 9142 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 10657 9272 gene locus_tag LOCUS_58140 10657 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 11628 10654 gene locus_tag LOCUS_58150 11628 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 11776 12195 gene locus_tag LOCUS_58160 gene yphP 11776 12195 CDS product UPF0403 protein YphP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54170 protein_id gnl|my_center|LOCUS_58160 12200 12472 gene locus_tag LOCUS_58170 12200 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 12487 12870 gene locus_tag LOCUS_58180 12487 12870 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_58180 13022 14647 gene locus_tag LOCUS_58190 gene pruA 13022 14647 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_58190 15045 16781 gene locus_tag LOCUS_58200 gene ilvG 15045 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_58200 16791 17807 gene locus_tag LOCUS_58210 16791 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 18416 17880 gene locus_tag LOCUS_58220 18416 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 19278 18436 gene locus_tag LOCUS_58230 19278 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 19864 21225 gene locus_tag LOCUS_58240 gene dhs1 19864 21225 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_58240 21248 22573 gene locus_tag LOCUS_58250 21248 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 22789 23106 gene locus_tag LOCUS_58260 22789 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 24369 23116 gene locus_tag LOCUS_58270 24369 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 >Feature sequence078 19 4383 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccccgtgcgggggcgtggattgaaac 4435 5499 gene locus_tag LOCUS_58280 4435 5499 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_58280 5513 7228 gene locus_tag LOCUS_58290 5513 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 7557 8054 gene locus_tag LOCUS_58300 7557 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 9741 8872 gene locus_tag LOCUS_58310 9741 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 10462 9785 gene locus_tag LOCUS_58320 10462 9785 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_58320 11131 10472 gene locus_tag LOCUS_58330 11131 10472 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 protein_id gnl|my_center|LOCUS_58330 12334 11135 gene locus_tag LOCUS_58340 12334 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 12903 12331 gene locus_tag LOCUS_58350 12903 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 12812 13141 gene locus_tag LOCUS_58360 12812 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 14579 13194 gene locus_tag LOCUS_58370 14579 13194 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_58370 14710 15828 gene locus_tag LOCUS_58380 14710 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 15900 19322 gene locus_tag LOCUS_58390 15900 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_58390 19367 20122 gene locus_tag LOCUS_58400 19367 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 20119 20826 gene locus_tag LOCUS_58410 20119 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 20819 21352 gene locus_tag LOCUS_58420 20819 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 22222 21356 gene locus_tag LOCUS_58430 22222 21356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 >Feature sequence079 1640 291 gene locus_tag LOCUS_58440 1640 291 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_58440 1871 3325 gene locus_tag LOCUS_58450 1871 3325 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_58450 4369 3329 gene locus_tag LOCUS_58460 4369 3329 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_58460 4431 5006 gene locus_tag LOCUS_58470 4431 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522192.1 protein_id gnl|my_center|LOCUS_58470 6220 5018 gene locus_tag LOCUS_58480 6220 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 9404 6354 gene locus_tag LOCUS_58490 9404 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 11759 10263 gene locus_tag LOCUS_58500 11759 10263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_58500 11873 12883 gene locus_tag LOCUS_58510 11873 12883 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_58510 14057 13107 gene locus_tag LOCUS_58520 14057 13107 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870293.1 protein_id gnl|my_center|LOCUS_58520 14234 14644 gene locus_tag LOCUS_58530 14234 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 14677 15657 gene locus_tag LOCUS_58540 14677 15657 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_58540 15654 16322 gene locus_tag LOCUS_58550 gene yniC 15654 16322 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_58550 19394 16341 gene locus_tag LOCUS_58560 19394 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 20409 19483 gene locus_tag LOCUS_58570 20409 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 21499 20801 gene locus_tag LOCUS_58580 21499 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 >Feature sequence080 1329 124 gene locus_tag LOCUS_58590 1329 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 2835 1435 gene locus_tag LOCUS_58600 2835 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 3118 3420 gene locus_tag LOCUS_58610 3118 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 6944 3507 gene locus_tag LOCUS_58620 6944 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 7313 9145 gene locus_tag LOCUS_58630 7313 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 9142 9597 gene locus_tag LOCUS_58640 9142 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 9603 10979 gene locus_tag LOCUS_58650 9603 10979 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168531.1 protein_id gnl|my_center|LOCUS_58650 10992 11684 gene locus_tag LOCUS_58660 10992 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 11704 16134 gene locus_tag LOCUS_58670 11704 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 16136 17107 gene locus_tag LOCUS_58680 16136 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 17116 19563 gene locus_tag LOCUS_58690 17116 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 >Feature sequence081 2708 156 gene locus_tag LOCUS_58700 2708 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 3310 2705 gene locus_tag LOCUS_58710 3310 2705 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120523.1 protein_id gnl|my_center|LOCUS_58710 4377 3349 gene locus_tag LOCUS_58720 4377 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 4522 5724 gene locus_tag LOCUS_58730 4522 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 6118 7011 gene locus_tag LOCUS_58740 6118 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 7192 11250 gene locus_tag LOCUS_58750 gene cyaI3 7192 11250 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967832.1 protein_id gnl|my_center|LOCUS_58750 11247 13193 gene locus_tag LOCUS_58760 11247 13193 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_58760 13190 13633 gene locus_tag LOCUS_58770 13190 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 13942 13742 gene locus_tag LOCUS_58780 13942 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 14897 14004 gene locus_tag LOCUS_58790 14897 14004 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023349.1 protein_id gnl|my_center|LOCUS_58790 17145 15154 gene locus_tag LOCUS_58800 gene uvrB 17145 15154 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV3 protein_id gnl|my_center|LOCUS_58800 17161 18498 gene locus_tag LOCUS_58810 17161 18498 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089359.1 protein_id gnl|my_center|LOCUS_58810 >Feature sequence082 <1 1132 gene locus_tag LOCUS_58820 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031052.1:protein kinase 1138 4734 gene locus_tag LOCUS_58830 1138 4734 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030180.1 protein_id gnl|my_center|LOCUS_58830 4776 8507 gene locus_tag LOCUS_58840 4776 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031061.1 protein_id gnl|my_center|LOCUS_58840 8504 11296 gene locus_tag LOCUS_58850 8504 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 protein_id gnl|my_center|LOCUS_58850 11293 12603 gene locus_tag LOCUS_58860 11293 12603 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_58860 12600 14705 gene locus_tag LOCUS_58870 12600 14705 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_58870 14801 15403 gene locus_tag LOCUS_58880 14801 15403 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_58880 15626 18439 gene locus_tag LOCUS_58890 15626 18439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence083 336 73 gene locus_tag LOCUS_58900 336 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 452 670 gene locus_tag LOCUS_58910 452 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 1716 781 gene locus_tag LOCUS_58920 1716 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 1827 4580 gene locus_tag LOCUS_58930 1827 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 6020 4566 gene locus_tag LOCUS_58940 6020 4566 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146808.1 protein_id gnl|my_center|LOCUS_58940 7379 6057 gene locus_tag LOCUS_58950 7379 6057 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_58950 8467 7427 gene locus_tag LOCUS_58960 8467 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 8961 9437 gene locus_tag LOCUS_58970 8961 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 11488 9497 gene locus_tag LOCUS_58980 11488 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 12083 13789 gene locus_tag LOCUS_58990 12083 13789 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_58990 13786 15387 gene locus_tag LOCUS_59000 13786 15387 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_59000 16517 15582 gene locus_tag LOCUS_59010 16517 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 17065 17412 gene locus_tag LOCUS_59020 17065 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 17858 17340 gene locus_tag LOCUS_59030 17858 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence084 2408 1167 gene locus_tag LOCUS_59040 2408 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 3330 2398 gene locus_tag LOCUS_59050 3330 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 7783 3581 gene locus_tag LOCUS_59060 gene rpoC 7783 3581 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_59060 12195 7945 gene locus_tag LOCUS_59070 gene rpoB 12195 7945 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFV8 protein_id gnl|my_center|LOCUS_59070 12931 12554 gene locus_tag LOCUS_59080 gene rplL 12931 12554 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6T8 protein_id gnl|my_center|LOCUS_59080 13537 13010 gene locus_tag LOCUS_59090 gene rplJ 13537 13010 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035V5 protein_id gnl|my_center|LOCUS_59090 14248 13547 gene locus_tag LOCUS_59100 gene rplA 14248 13547 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN6 protein_id gnl|my_center|LOCUS_59100 14773 14348 gene locus_tag LOCUS_59110 gene rplK 14773 14348 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66054 protein_id gnl|my_center|LOCUS_59110 15328 14795 gene locus_tag LOCUS_59120 gene nusG 15328 14795 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_59120 15534 15328 gene locus_tag LOCUS_59130 15534 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 15692 15617 gene locus_tag LOCUS_t00450 15692 15617 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 1230 196 gene locus_tag LOCUS_59140 1230 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 1626 1387 gene locus_tag LOCUS_59150 1626 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 1979 3175 gene locus_tag LOCUS_59160 gene thrC 1979 3175 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_59160 3286 6183 gene locus_tag LOCUS_59170 3286 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 6253 7218 gene locus_tag LOCUS_59180 6253 7218 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_59180 8993 7233 gene locus_tag LOCUS_59190 8993 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 9463 8990 gene locus_tag LOCUS_59200 9463 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 9622 10533 gene locus_tag LOCUS_59210 9622 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 10536 11996 gene locus_tag LOCUS_59220 10536 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 12141 12013 gene locus_tag LOCUS_59230 12141 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 12427 13071 gene locus_tag LOCUS_59240 gene folE 12427 13071 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJV0 protein_id gnl|my_center|LOCUS_59240 13109 13702 gene locus_tag LOCUS_59250 13109 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 13809 14882 gene locus_tag LOCUS_59260 gene fabH2 13809 14882 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_59260 >Feature sequence086 68 220 gene locus_tag LOCUS_59270 68 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 819 415 gene locus_tag LOCUS_59280 819 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 2052 1300 gene locus_tag LOCUS_59290 2052 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 2643 3851 gene locus_tag LOCUS_59300 2643 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 3848 4792 gene locus_tag LOCUS_59310 gene mrsF 3848 4792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 protein_id gnl|my_center|LOCUS_59310 4789 5574 gene locus_tag LOCUS_59320 4789 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 6273 5797 gene locus_tag LOCUS_59330 6273 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 7414 6317 gene locus_tag LOCUS_59340 7414 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 >Feature sequence087 1129 941 gene locus_tag LOCUS_59350 1129 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 4151 1209 gene locus_tag LOCUS_59360 gene gcvP 4151 1209 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_59360 4519 6231 gene locus_tag LOCUS_59370 4519 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 6335 7444 gene locus_tag LOCUS_59380 6335 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 7434 10391 gene locus_tag LOCUS_59390 7434 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 10431 11555 gene locus_tag LOCUS_59400 10431 11555 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAV7 protein_id gnl|my_center|LOCUS_59400 11555 13942 gene locus_tag LOCUS_59410 11555 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 13942 14445 gene locus_tag LOCUS_59420 13942 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 14445 14690 gene locus_tag LOCUS_59430 14445 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 >Feature sequence088 224 433 gene locus_tag LOCUS_59440 224 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59440 989 837 gene locus_tag LOCUS_59450 989 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 1975 1799 gene locus_tag LOCUS_59460 1975 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 2365 2177 gene locus_tag LOCUS_59470 2365 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 2591 2406 gene locus_tag LOCUS_59480 2591 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 2843 6046 gene locus_tag LOCUS_59490 2843 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_59490 6055 7353 gene locus_tag LOCUS_59500 6055 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_59500 7391 9259 gene locus_tag LOCUS_59510 7391 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 9256 11475 gene locus_tag LOCUS_59520 9256 11475 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_59520 11472 12392 gene locus_tag LOCUS_59530 11472 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 >Feature sequence089 1471 242 gene locus_tag LOCUS_59540 gene acrE 1471 242 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_59540 3836 1608 gene locus_tag LOCUS_59550 3836 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 3727 3939 gene locus_tag LOCUS_59560 3727 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 4012 5205 gene locus_tag LOCUS_59570 4012 5205 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_59570 5324 7198 gene locus_tag LOCUS_59580 5324 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 7359 7435 gene locus_tag LOCUS_t00460 7359 7435 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8390 7395 gene locus_tag LOCUS_59590 8390 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 >Feature sequence090 414 340 gene locus_tag LOCUS_t00470 414 340 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 841 767 gene locus_tag LOCUS_t00480 841 767 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1037 952 gene locus_tag LOCUS_t00490 1037 952 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1140 1065 gene locus_tag LOCUS_t00500 1140 1065 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2011 1319 gene locus_tag LOCUS_59600 2011 1319 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_59600 2614 2060 gene locus_tag LOCUS_59610 gene frr 2614 2060 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_59610 3470 2739 gene locus_tag LOCUS_59620 gene pyrH 3470 2739 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_59620 4140 3481 gene locus_tag LOCUS_59630 gene tsf 4140 3481 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_59630 5218 4292 gene locus_tag LOCUS_59640 5218 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 5622 5230 gene locus_tag LOCUS_59650 gene rpsI 5622 5230 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI4 protein_id gnl|my_center|LOCUS_59650 6152 5691 gene locus_tag LOCUS_59660 gene rplM 6152 5691 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_59660 <7164 6330 gene locus_tag LOCUS_59670 <7164 6330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MD13:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence091 635 258 gene locus_tag LOCUS_59680 635 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59680 1061 732 gene locus_tag LOCUS_59690 1061 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 2621 1212 gene locus_tag LOCUS_59700 2621 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 3631 2660 gene locus_tag LOCUS_59710 3631 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 3620 4603 gene locus_tag LOCUS_59720 3620 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 5946 5044 gene locus_tag LOCUS_59730 5946 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 >Feature sequence092 1175 246 gene locus_tag LOCUS_59740 1175 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 2188 1304 gene locus_tag LOCUS_59750 2188 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 3050 2199 gene locus_tag LOCUS_59760 gene ku 3050 2199 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE1 protein_id gnl|my_center|LOCUS_59760 3081 5696 gene locus_tag LOCUS_59770 3081 5696 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_59770 >Feature sequence093 175 969 gene locus_tag LOCUS_59780 175 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 969 1571 gene locus_tag LOCUS_59790 969 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 1728 2483 gene locus_tag LOCUS_59800 1728 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 2480 2704 gene locus_tag LOCUS_59810 2480 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 2734 4038 gene locus_tag LOCUS_59820 gene dnaB 2734 4038 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM5 protein_id gnl|my_center|LOCUS_59820 4153 5133 gene locus_tag LOCUS_59830 4153 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 5408 5130 gene locus_tag LOCUS_59840 5408 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 >Feature sequence094 175 969 gene locus_tag LOCUS_59850 175 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 1136 1894 gene locus_tag LOCUS_59860 1136 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 1891 2115 gene locus_tag LOCUS_59870 1891 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 2145 3449 gene locus_tag LOCUS_59880 gene dnaB 2145 3449 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM5 protein_id gnl|my_center|LOCUS_59880 3967 3446 gene locus_tag LOCUS_59890 3967 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 4353 3964 gene locus_tag LOCUS_59900 4353 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 >Feature sequence095 425 3100 gene locus_tag LOCUS_59910 gene valS 425 3100 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF0 protein_id gnl|my_center|LOCUS_59910 3196 4228 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcctcccgtgcggaggcgtggattgaaac >Feature sequence096 >Feature sequence097 76 456 gene locus_tag LOCUS_59920 76 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 453 830 gene locus_tag LOCUS_59930 453 830 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887079.1 protein_id gnl|my_center|LOCUS_59930 843 2387 gene locus_tag LOCUS_59940 843 2387 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968130.1 protein_id gnl|my_center|LOCUS_59940 >Feature sequence098 >Feature sequence099 2084 1356 gene locus_tag LOCUS_59950 2084 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 >Feature sequence100 1442 222 gene locus_tag LOCUS_59960 1442 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 >Feature sequence101 364 744 gene locus_tag LOCUS_59970 364 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 741 1415 gene locus_tag LOCUS_59980 741 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 1372 1536 gene locus_tag LOCUS_59990 1372 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 >Feature sequence102 <1 727 gene locus_tag LOCUS_60000 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038986.1:ABC transporter ATP-binding protein >Feature sequence103 <1 727 gene locus_tag LOCUS_60010 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038986.1:ABC transporter ATP-binding protein