>Feature sequence0001 9 2159 gene locus_tag LOCUS_00010 9 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2326 3138 gene locus_tag LOCUS_00020 2326 3138 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_00020 3222 3623 gene locus_tag LOCUS_00030 3222 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4515 3712 gene locus_tag LOCUS_00040 4515 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_00040 5612 4821 gene locus_tag LOCUS_00050 5612 4821 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_00050 6242 6406 gene locus_tag LOCUS_00060 6242 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6653 7921 gene locus_tag LOCUS_00070 6653 7921 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_00070 8680 7994 gene locus_tag LOCUS_00080 gene trmD 8680 7994 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM8 protein_id gnl|my_center|LOCUS_00080 8887 9351 gene locus_tag LOCUS_00090 8887 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9476 10561 gene locus_tag LOCUS_00100 gene pdhA 9476 10561 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_00100 10609 11448 gene locus_tag LOCUS_00110 10609 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11454 11690 gene locus_tag LOCUS_00120 11454 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11705 12532 gene locus_tag LOCUS_00130 11705 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12596 13480 gene locus_tag LOCUS_00140 12596 13480 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_00140 13546 14829 gene locus_tag LOCUS_00150 13546 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15487 14891 gene locus_tag LOCUS_00160 15487 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15908 18193 gene locus_tag LOCUS_00170 gene spoT 15908 18193 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_00170 19704 18220 gene locus_tag LOCUS_00180 19704 18220 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1C6 protein_id gnl|my_center|LOCUS_00180 20720 19719 gene locus_tag LOCUS_00190 gene tsaD 20720 19719 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_00190 20833 21780 gene locus_tag LOCUS_00200 20833 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21919 24192 gene locus_tag LOCUS_00210 21919 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25416 24196 gene locus_tag LOCUS_00220 25416 24196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25798 25445 gene locus_tag LOCUS_00230 25798 25445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27047 26112 gene locus_tag LOCUS_00240 gene era 27047 26112 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_00240 27261 27334 gene locus_tag LOCUS_t00010 27261 27334 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27460 28590 gene locus_tag LOCUS_00250 27460 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 >Feature sequence0002 <1 2304 gene locus_tag LOCUS_00260 <1 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T65:phenylalanine--tRNA ligase beta subunit 2486 3214 gene locus_tag LOCUS_00270 2486 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 3211 4233 gene locus_tag LOCUS_00280 3211 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 5054 4230 gene locus_tag LOCUS_00290 5054 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 6758 5085 gene locus_tag LOCUS_00300 6758 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8322 7030 gene locus_tag LOCUS_00310 8322 7030 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_00310 8847 8449 gene locus_tag LOCUS_00320 8847 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 10412 8973 gene locus_tag LOCUS_00330 10412 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 11203 10631 gene locus_tag LOCUS_00340 11203 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 12243 11314 gene locus_tag LOCUS_00350 12243 11314 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_00350 13262 12366 gene locus_tag LOCUS_00360 13262 12366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_00360 13708 15096 gene locus_tag LOCUS_00370 13708 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 15327 18428 gene locus_tag LOCUS_00380 15327 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 20084 18879 gene locus_tag LOCUS_00390 20084 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_00390 20671 20132 gene locus_tag LOCUS_00400 gene rimM 20671 20132 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_00400 21305 20829 gene locus_tag LOCUS_00410 21305 20829 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_00410 21938 21426 gene locus_tag LOCUS_00420 21938 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 22479 22138 gene locus_tag LOCUS_00430 22479 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 22629 23099 gene locus_tag LOCUS_00440 22629 23099 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_00440 23646 23200 gene locus_tag LOCUS_00450 23646 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 23887 24366 gene locus_tag LOCUS_00460 23887 24366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 24574 25419 gene locus_tag LOCUS_00470 24574 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 26318 25494 gene locus_tag LOCUS_00480 26318 25494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 27078 26338 gene locus_tag LOCUS_00490 gene ste14 27078 26338 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_00490 28150 27146 gene locus_tag LOCUS_00500 28150 27146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_00500 28277 28837 gene locus_tag LOCUS_00510 gene pth 28277 28837 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_00510 >Feature sequence0003 582 139 gene locus_tag LOCUS_00520 582 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 1080 2546 gene locus_tag LOCUS_00530 1080 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3019 4581 gene locus_tag LOCUS_00540 3019 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4584 5516 gene locus_tag LOCUS_00550 4584 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 7000 5612 gene locus_tag LOCUS_00560 gene hisS 7000 5612 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_00560 10268 7155 gene locus_tag LOCUS_00570 10268 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 12813 10741 gene locus_tag LOCUS_00580 12813 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 14199 12856 gene locus_tag LOCUS_00590 14199 12856 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_00590 15217 14240 gene locus_tag LOCUS_00600 15217 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 15924 15340 gene locus_tag LOCUS_00610 gene ruvA 15924 15340 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ9 protein_id gnl|my_center|LOCUS_00610 16880 16050 gene locus_tag LOCUS_00620 16880 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 18360 17203 gene locus_tag LOCUS_00630 18360 17203 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence0004 1781 1041 gene locus_tag LOCUS_00640 gene dapB 1781 1041 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_00640 2480 1884 gene locus_tag LOCUS_00650 2480 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3558 2665 gene locus_tag LOCUS_00660 3558 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4742 3690 gene locus_tag LOCUS_00670 4742 3690 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184625.1 protein_id gnl|my_center|LOCUS_00670 5630 4773 gene locus_tag LOCUS_00680 5630 4773 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_00680 6100 7548 gene locus_tag LOCUS_00690 6100 7548 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_00690 7654 8412 gene locus_tag LOCUS_00700 7654 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8503 9843 gene locus_tag LOCUS_00710 8503 9843 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_00710 11360 10062 gene locus_tag LOCUS_00720 11360 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 12691 11618 gene locus_tag LOCUS_00730 12691 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12935 14188 gene locus_tag LOCUS_00740 12935 14188 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_00740 14185 15120 gene locus_tag LOCUS_00750 14185 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 15203 15355 gene locus_tag LOCUS_00760 15203 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 15573 16145 gene locus_tag LOCUS_00770 15573 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_00770 16167 17276 gene locus_tag LOCUS_00780 16167 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_00780 17301 18227 gene locus_tag LOCUS_00790 gene ykcC 17301 18227 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_00790 >Feature sequence0005 1623 961 gene locus_tag LOCUS_00800 1623 961 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_00800 2199 1720 gene locus_tag LOCUS_00810 2199 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_00810 3619 2381 gene locus_tag LOCUS_00820 gene pgk 3619 2381 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_00820 3880 4269 gene locus_tag LOCUS_00830 3880 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 4786 4367 gene locus_tag LOCUS_00840 gene ndk 4786 4367 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_00840 5239 7452 gene locus_tag LOCUS_00850 5239 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7493 8176 gene locus_tag LOCUS_00860 7493 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 9068 8253 gene locus_tag LOCUS_00870 9068 8253 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_00870 9880 9158 gene locus_tag LOCUS_00880 9880 9158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_00880 10408 10037 gene locus_tag LOCUS_00890 gene rplL 10408 10037 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_00890 11210 10677 gene locus_tag LOCUS_00900 11210 10677 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_00900 11938 11240 gene locus_tag LOCUS_00910 gene rplA 11938 11240 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_00910 12471 12022 gene locus_tag LOCUS_00920 gene rplK 12471 12022 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_00920 13387 12806 gene locus_tag LOCUS_00930 gene nusG 13387 12806 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_00930 13642 13451 gene locus_tag LOCUS_00940 gene secE 13642 13451 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ1 protein_id gnl|my_center|LOCUS_00940 13901 13828 gene locus_tag LOCUS_t00020 13901 13828 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 14278 15138 gene locus_tag LOCUS_00950 14278 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15644 15240 gene locus_tag LOCUS_00960 15644 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16171 15695 gene locus_tag LOCUS_00970 16171 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 16976 16284 gene locus_tag LOCUS_00980 16976 16284 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence0006 1462 422 gene locus_tag LOCUS_00990 1462 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 2352 1540 gene locus_tag LOCUS_01000 2352 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2965 2510 gene locus_tag LOCUS_01010 2965 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 3685 3029 gene locus_tag LOCUS_01020 3685 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 4936 3788 gene locus_tag LOCUS_01030 4936 3788 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_01030 5445 5798 gene locus_tag LOCUS_01040 5445 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5890 7278 gene locus_tag LOCUS_01050 5890 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7552 7800 gene locus_tag LOCUS_01060 7552 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7801 8160 gene locus_tag LOCUS_01070 7801 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 8157 8726 gene locus_tag LOCUS_01080 8157 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 8740 9213 gene locus_tag LOCUS_01090 8740 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9227 9688 gene locus_tag LOCUS_01100 9227 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 10363 9695 gene locus_tag LOCUS_01110 10363 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 11049 10378 gene locus_tag LOCUS_01120 11049 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 11213 12142 gene locus_tag LOCUS_01130 11213 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016250.1 protein_id gnl|my_center|LOCUS_01130 12372 12749 gene locus_tag LOCUS_01140 12372 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 12934 12695 gene locus_tag LOCUS_01150 12934 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence0007 276 2108 gene locus_tag LOCUS_01160 276 2108 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_01160 2694 2194 gene locus_tag LOCUS_01170 2694 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_01170 3117 4274 gene locus_tag LOCUS_01180 gene menE 3117 4274 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_01180 4892 4335 gene locus_tag LOCUS_01190 gene frr 4892 4335 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_01190 5166 5609 gene locus_tag LOCUS_01200 5166 5609 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_01200 5698 6297 gene locus_tag LOCUS_01210 5698 6297 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403562.1 protein_id gnl|my_center|LOCUS_01210 6546 7361 gene locus_tag LOCUS_01220 6546 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 7647 9050 gene locus_tag LOCUS_01230 7647 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 9371 9183 gene locus_tag LOCUS_01240 9371 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9509 10060 gene locus_tag LOCUS_01250 9509 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 11424 10117 gene locus_tag LOCUS_01260 11424 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 11680 11997 gene locus_tag LOCUS_01270 11680 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12767 11994 gene locus_tag LOCUS_01280 12767 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 13176 12904 gene locus_tag LOCUS_01290 gene rpmA 13176 12904 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_01290 13582 13271 gene locus_tag LOCUS_01300 13582 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence0008 1968 772 gene locus_tag LOCUS_01310 1968 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_01310 2661 2203 gene locus_tag LOCUS_01320 2661 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3409 3900 gene locus_tag LOCUS_01330 3409 3900 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_01330 3985 4536 gene locus_tag LOCUS_01340 3985 4536 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_01340 5773 4604 gene locus_tag LOCUS_01350 5773 4604 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_01350 6694 6059 gene locus_tag LOCUS_01360 6694 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7526 6702 gene locus_tag LOCUS_01370 7526 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_01370 8641 7604 gene locus_tag LOCUS_01380 8641 7604 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_01380 8986 10113 gene locus_tag LOCUS_01390 8986 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 10362 11528 gene locus_tag LOCUS_01400 10362 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 11692 13011 gene locus_tag LOCUS_01410 gene phrB1 11692 13011 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_01410 13100 14269 gene locus_tag LOCUS_01420 13100 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence0009 1920 121 gene locus_tag LOCUS_01430 1920 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2811 2083 gene locus_tag LOCUS_01440 2811 2083 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_01440 3601 2858 gene locus_tag LOCUS_01450 3601 2858 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_01450 4173 4101 gene locus_tag LOCUS_t00030 4173 4101 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4710 4186 gene locus_tag LOCUS_01460 4710 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6105 4813 gene locus_tag LOCUS_01470 6105 4813 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_01470 7149 6259 gene locus_tag LOCUS_01480 7149 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_01480 7225 8217 gene locus_tag LOCUS_01490 7225 8217 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence0010 428 1213 gene locus_tag LOCUS_01500 428 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 1269 4736 gene locus_tag LOCUS_01510 1269 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5129 5719 gene locus_tag LOCUS_01520 5129 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_01520 5810 6172 gene locus_tag LOCUS_01530 5810 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6569 9877 gene locus_tag LOCUS_01540 6569 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9971 10960 gene locus_tag LOCUS_01550 9971 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11356 11787 gene locus_tag LOCUS_01560 11356 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11924 12574 gene locus_tag LOCUS_01570 11924 12574 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_01570 12642 13166 gene locus_tag LOCUS_01580 12642 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence0011 2239 1274 gene locus_tag LOCUS_01590 2239 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3173 2367 gene locus_tag LOCUS_01600 3173 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_01600 4107 3253 gene locus_tag LOCUS_01610 gene dinD 4107 3253 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_01610 5204 5410 gene locus_tag LOCUS_01620 5204 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5414 6646 gene locus_tag LOCUS_01630 5414 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7573 7124 gene locus_tag LOCUS_01640 7573 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8951 7599 gene locus_tag LOCUS_01650 8951 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 10233 9856 gene locus_tag LOCUS_01660 10233 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence0012 <1 4919 gene locus_tag LOCUS_01670 <1 4919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 5059 6888 gene locus_tag LOCUS_01680 5059 6888 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_01680 7298 8317 gene locus_tag LOCUS_01690 gene mreB 7298 8317 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_01690 8722 9531 gene locus_tag LOCUS_01700 8722 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9537 10046 gene locus_tag LOCUS_01710 9537 10046 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_01710 11089 10124 gene locus_tag LOCUS_01720 gene hldD 11089 10124 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_01720 11505 12176 gene locus_tag LOCUS_01730 11505 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0013 2339 294 gene locus_tag LOCUS_01740 gene yyaL 2339 294 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_01740 3504 2467 gene locus_tag LOCUS_01750 gene holA 3504 2467 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_01750 3777 3553 gene locus_tag LOCUS_01760 3777 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3999 4742 gene locus_tag LOCUS_01770 3999 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4934 6226 gene locus_tag LOCUS_01780 gene pyrC2 4934 6226 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_01780 6460 7164 gene locus_tag LOCUS_01790 6460 7164 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_01790 7597 7202 gene locus_tag LOCUS_01800 7597 7202 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_01800 7750 9018 gene locus_tag LOCUS_01810 7750 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9088 9561 gene locus_tag LOCUS_01820 9088 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10037 11785 gene locus_tag LOCUS_01830 10037 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_01830 11825 12556 gene locus_tag LOCUS_01840 11825 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12560 13282 gene locus_tag LOCUS_01850 12560 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 13399 13833 gene locus_tag LOCUS_01860 13399 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence0014 787 2775 gene locus_tag LOCUS_01870 gene gyrB 787 2775 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 protein_id gnl|my_center|LOCUS_01870 3468 3653 gene locus_tag LOCUS_01880 3468 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3829 3987 gene locus_tag LOCUS_01890 3829 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4280 5173 gene locus_tag LOCUS_01900 gene dapA 4280 5173 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM6 protein_id gnl|my_center|LOCUS_01900 6208 6978 gene locus_tag LOCUS_01910 6208 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 7598 10993 gene locus_tag LOCUS_01920 7598 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11945 11082 gene locus_tag LOCUS_01930 gene lpxH 11945 11082 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_01930 12746 12027 gene locus_tag LOCUS_01940 12746 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 <13526 12760 gene locus_tag LOCUS_01950 <13526 12760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000437621.1:5-methylcytosine-specific restriction system specificity protein McrC >Feature sequence0015 587 1447 gene locus_tag LOCUS_01960 587 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1905 1450 gene locus_tag LOCUS_01970 1905 1450 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_01970 2086 2622 gene locus_tag LOCUS_01980 2086 2622 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_01980 2987 4348 gene locus_tag LOCUS_01990 gene murF 2987 4348 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z76 protein_id gnl|my_center|LOCUS_01990 4941 4345 gene locus_tag LOCUS_02000 4941 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5519 5169 gene locus_tag LOCUS_02010 5519 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5746 5994 gene locus_tag LOCUS_02020 5746 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 6335 6709 gene locus_tag LOCUS_02030 6335 6709 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_02030 6971 7852 gene locus_tag LOCUS_02040 gene prmA 6971 7852 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_02040 7926 9038 gene locus_tag LOCUS_02050 7926 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9266 9889 gene locus_tag LOCUS_02060 9266 9889 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_02060 10491 9886 gene locus_tag LOCUS_02070 10491 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 <13436 10632 gene locus_tag LOCUS_02080 <13436 10632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64U07:isoleucine--tRNA ligase >Feature sequence0016 742 545 gene locus_tag LOCUS_02090 742 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 741 944 gene locus_tag LOCUS_02100 741 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1175 915 gene locus_tag LOCUS_02110 1175 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2491 1292 gene locus_tag LOCUS_02120 2491 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_02120 2731 4392 gene locus_tag LOCUS_02130 2731 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4534 4983 gene locus_tag LOCUS_02140 4534 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 7973 5067 gene locus_tag LOCUS_02150 7973 5067 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_02150 8330 9139 gene locus_tag LOCUS_02160 gene crt 8330 9139 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_02160 9449 12124 gene locus_tag LOCUS_02170 9449 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_02170 12246 12704 gene locus_tag LOCUS_02180 gene crtZ 12246 12704 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_02180 13121 12708 gene locus_tag LOCUS_02190 13121 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence0017 1748 2287 gene locus_tag LOCUS_02200 1748 2287 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_02200 4644 2359 gene locus_tag LOCUS_02210 4644 2359 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_02210 5362 4763 gene locus_tag LOCUS_02220 5362 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888357.1 protein_id gnl|my_center|LOCUS_02220 5448 6632 gene locus_tag LOCUS_02230 gene celE 5448 6632 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_02230 6970 6677 gene locus_tag LOCUS_02240 gene gatC 6970 6677 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S325 protein_id gnl|my_center|LOCUS_02240 8823 7060 gene locus_tag LOCUS_02250 8823 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9245 10075 gene locus_tag LOCUS_02260 9245 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11973 10180 gene locus_tag LOCUS_02270 11973 10180 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence0018 726 172 gene locus_tag LOCUS_02280 726 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1014 2366 gene locus_tag LOCUS_02290 1014 2366 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_02290 3179 2472 gene locus_tag LOCUS_02300 3179 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3299 4849 gene locus_tag LOCUS_02310 3299 4849 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_02310 6206 4836 gene locus_tag LOCUS_02320 6206 4836 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460649.1 protein_id gnl|my_center|LOCUS_02320 6587 6982 gene locus_tag LOCUS_02330 6587 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8451 7102 gene locus_tag LOCUS_02340 8451 7102 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 protein_id gnl|my_center|LOCUS_02340 8801 11044 gene locus_tag LOCUS_02350 8801 11044 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_02350 11559 11128 gene locus_tag LOCUS_02360 11559 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12337 11660 gene locus_tag LOCUS_02370 gene crtO 12337 11660 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence0019 21 638 gene locus_tag LOCUS_02380 21 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2634 718 gene locus_tag LOCUS_02390 gene wbpQ 2634 718 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_02390 3549 2647 gene locus_tag LOCUS_02400 3549 2647 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_02400 3704 5911 gene locus_tag LOCUS_02410 3704 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6040 7212 gene locus_tag LOCUS_02420 gene nusB 6040 7212 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_02420 7389 7694 gene locus_tag LOCUS_02430 7389 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7854 8381 gene locus_tag LOCUS_02440 7854 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_02440 9163 8459 gene locus_tag LOCUS_02450 9163 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9775 9236 gene locus_tag LOCUS_02460 9775 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 9887 10855 gene locus_tag LOCUS_02470 9887 10855 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02470 10958 12325 gene locus_tag LOCUS_02480 10958 12325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011124.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence0020 1018 1091 gene locus_tag LOCUS_t00040 1018 1091 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1290 2699 gene locus_tag LOCUS_02490 1290 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 3308 2757 gene locus_tag LOCUS_02500 gene def 3308 2757 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_02500 3862 3389 gene locus_tag LOCUS_02510 3862 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4038 5414 gene locus_tag LOCUS_02520 4038 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5549 6421 gene locus_tag LOCUS_02530 5549 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6871 6485 gene locus_tag LOCUS_02540 6871 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7110 6943 gene locus_tag LOCUS_02550 7110 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7984 7346 gene locus_tag LOCUS_02560 gene tpm 7984 7346 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_02560 8357 9094 gene locus_tag LOCUS_02570 gene pyrH 8357 9094 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_02570 9270 9659 gene locus_tag LOCUS_02580 9270 9659 CDS product camphor resistance protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_02580 9732 10604 gene locus_tag LOCUS_02590 9732 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11539 10637 gene locus_tag LOCUS_02600 11539 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 <12834 11640 gene locus_tag LOCUS_02610 <12834 11640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525183.1:serine hydrolase >Feature sequence0021 <1 2111 gene locus_tag LOCUS_02620 <1 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964554.1:gliding motility protein 2394 3224 gene locus_tag LOCUS_02630 2394 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4215 3301 gene locus_tag LOCUS_02640 4215 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4785 4219 gene locus_tag LOCUS_02650 4785 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5091 6494 gene locus_tag LOCUS_02660 5091 6494 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_02660 6700 8616 gene locus_tag LOCUS_02670 6700 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 9437 8664 gene locus_tag LOCUS_02680 gene trn2 9437 8664 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_02680 9524 9817 gene locus_tag LOCUS_02690 9524 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 10572 9820 gene locus_tag LOCUS_02700 10572 9820 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_02700 11072 12505 gene locus_tag LOCUS_02710 gene pykA 11072 12505 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0022 119 2002 gene locus_tag LOCUS_02720 119 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2079 2783 gene locus_tag LOCUS_02730 gene fabG 2079 2783 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_02730 3719 2850 gene locus_tag LOCUS_02740 gene tktA 3719 2850 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_02740 6208 4301 gene locus_tag LOCUS_02750 6208 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238727.1 protein_id gnl|my_center|LOCUS_02750 7001 6801 gene locus_tag LOCUS_02760 7001 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8708 7002 gene locus_tag LOCUS_02770 8708 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238727.1 protein_id gnl|my_center|LOCUS_02770 10082 9300 gene locus_tag LOCUS_02780 10082 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10334 10876 gene locus_tag LOCUS_02790 10334 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10983 11324 gene locus_tag LOCUS_02800 10983 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 11513 11836 gene locus_tag LOCUS_02810 11513 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 12409 12065 gene locus_tag LOCUS_02820 12409 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence0023 734 1585 gene locus_tag LOCUS_02830 734 1585 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_02830 1834 3189 gene locus_tag LOCUS_02840 1834 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3333 5174 gene locus_tag LOCUS_02850 gene glmS 3333 5174 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_02850 5361 5822 gene locus_tag LOCUS_02860 5361 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7234 5897 gene locus_tag LOCUS_02870 7234 5897 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_02870 7954 8241 gene locus_tag LOCUS_02880 7954 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 8354 9388 gene locus_tag LOCUS_02890 gene pyrD 8354 9388 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_02890 9438 10040 gene locus_tag LOCUS_02900 9438 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10884 10252 gene locus_tag LOCUS_02910 10884 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 11029 12084 gene locus_tag LOCUS_02920 11029 12084 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence0024 366 710 gene locus_tag LOCUS_02930 gene rplT 366 710 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_02930 970 2262 gene locus_tag LOCUS_02940 970 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_02940 2536 2907 gene locus_tag LOCUS_02950 2536 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3558 2977 gene locus_tag LOCUS_02960 3558 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3665 4219 gene locus_tag LOCUS_02970 3665 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4445 7219 gene locus_tag LOCUS_02980 4445 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7564 9495 gene locus_tag LOCUS_02990 7564 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9917 11419 gene locus_tag LOCUS_03000 9917 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11519 11908 gene locus_tag LOCUS_03010 11519 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0025 <1 567 gene locus_tag LOCUS_03020 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404427.1:DNA polymerase/3'-5' exonuclease PolX 737 1282 gene locus_tag LOCUS_03030 737 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1285 1959 gene locus_tag LOCUS_03040 1285 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_03040 2529 1963 gene locus_tag LOCUS_03050 2529 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2886 6155 gene locus_tag LOCUS_03060 2886 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7995 6277 gene locus_tag LOCUS_03070 7995 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9184 8588 gene locus_tag LOCUS_03080 9184 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 9379 10680 gene locus_tag LOCUS_03090 9379 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 11068 10682 gene locus_tag LOCUS_03100 11068 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 12390 11299 gene locus_tag LOCUS_03110 12390 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0026 1122 340 gene locus_tag LOCUS_03120 1122 340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_03120 2078 1167 gene locus_tag LOCUS_03130 gene rnz 2078 1167 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZN1 protein_id gnl|my_center|LOCUS_03130 2444 2677 gene locus_tag LOCUS_03140 2444 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2829 6116 gene locus_tag LOCUS_03150 2829 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6364 7377 gene locus_tag LOCUS_03160 gene asd 6364 7377 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_03160 7834 7424 gene locus_tag LOCUS_03170 7834 7424 CDS product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_03170 8293 9786 gene locus_tag LOCUS_03180 gene gatB 8293 9786 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_03180 9979 10551 gene locus_tag LOCUS_03190 gene yhgD 9979 10551 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 protein_id gnl|my_center|LOCUS_03190 10641 11462 gene locus_tag LOCUS_03200 10641 11462 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644332.1 protein_id gnl|my_center|LOCUS_03200 <12250 11531 gene locus_tag LOCUS_03210 <12250 11531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023149.1:zinc metalloprotease >Feature sequence0027 482 1591 gene locus_tag LOCUS_03220 gene smf 482 1591 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_03220 1728 2870 gene locus_tag LOCUS_03230 1728 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3007 3615 gene locus_tag LOCUS_03240 3007 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3695 4231 gene locus_tag LOCUS_03250 3695 4231 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_03250 4309 6372 gene locus_tag LOCUS_03260 4309 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6652 12063 gene locus_tag LOCUS_03270 6652 12063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence0028 <1 1243 gene locus_tag LOCUS_03280 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962229.1:two-component sensor histidine kinase 1826 1245 gene locus_tag LOCUS_03290 1826 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3187 1823 gene locus_tag LOCUS_03300 3187 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_03300 4368 3244 gene locus_tag LOCUS_03310 4368 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_03310 4717 5790 gene locus_tag LOCUS_03320 gene cfbpA 4717 5790 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 protein_id gnl|my_center|LOCUS_03320 6973 5840 gene locus_tag LOCUS_03330 6973 5840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_03330 7116 9317 gene locus_tag LOCUS_03340 7116 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9759 9322 gene locus_tag LOCUS_03350 9759 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9994 10524 gene locus_tag LOCUS_03360 9994 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 10527 11228 gene locus_tag LOCUS_03370 10527 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence0029 765 1313 gene locus_tag LOCUS_03380 765 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1499 2455 gene locus_tag LOCUS_03390 1499 2455 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_03390 2770 3456 gene locus_tag LOCUS_03400 gene pyrE 2770 3456 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y668 protein_id gnl|my_center|LOCUS_03400 3522 4202 gene locus_tag LOCUS_03410 3522 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4265 4894 gene locus_tag LOCUS_03420 gene hisI 4265 4894 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_03420 5362 4907 gene locus_tag LOCUS_03430 5362 4907 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_03430 5519 6343 gene locus_tag LOCUS_03440 5519 6343 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_03440 6796 7053 gene locus_tag LOCUS_03450 6796 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7072 7515 gene locus_tag LOCUS_03460 7072 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7502 7885 gene locus_tag LOCUS_03470 7502 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 8800 7976 gene locus_tag LOCUS_03480 8800 7976 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 protein_id gnl|my_center|LOCUS_03480 8960 9565 gene locus_tag LOCUS_03490 8960 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_03490 10326 9640 gene locus_tag LOCUS_03500 10326 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10695 11294 gene locus_tag LOCUS_03510 gene grpE 10695 11294 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0030 274 2016 gene locus_tag LOCUS_03520 274 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2025 2579 gene locus_tag LOCUS_03530 2025 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2786 3337 gene locus_tag LOCUS_03540 2786 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5767 3395 gene locus_tag LOCUS_03550 5767 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_03550 6546 5932 gene locus_tag LOCUS_03560 6546 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7191 6571 gene locus_tag LOCUS_03570 7191 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8475 7393 gene locus_tag LOCUS_03580 8475 7393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_03580 9185 8697 gene locus_tag LOCUS_03590 9185 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10342 9341 gene locus_tag LOCUS_03600 10342 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 <12028 10688 gene locus_tag LOCUS_03610 <12028 10688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962640.1:GTP-binding protein >Feature sequence0031 999 1274 gene locus_tag LOCUS_03620 999 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5448 1447 gene locus_tag LOCUS_03630 5448 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5672 6151 gene locus_tag LOCUS_03640 5672 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7072 6242 gene locus_tag LOCUS_03650 7072 6242 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_03650 7166 7996 gene locus_tag LOCUS_03660 7166 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_03660 8042 9217 gene locus_tag LOCUS_03670 8042 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_03670 9631 9296 gene locus_tag LOCUS_03680 gene phnA 9631 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914988.1 protein_id gnl|my_center|LOCUS_03680 9743 10435 gene locus_tag LOCUS_03690 gene nth 9743 10435 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_03690 10532 11836 gene locus_tag LOCUS_03700 10532 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence0032 208 978 gene locus_tag LOCUS_03710 208 978 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_03710 2778 2104 gene locus_tag LOCUS_03720 2778 2104 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110067.1 protein_id gnl|my_center|LOCUS_03720 3378 2794 gene locus_tag LOCUS_03730 3378 2794 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_03730 4133 3534 gene locus_tag LOCUS_03740 4133 3534 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917951.1 protein_id gnl|my_center|LOCUS_03740 4478 5377 gene locus_tag LOCUS_03750 4478 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5516 5370 gene locus_tag LOCUS_03760 5516 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7792 5618 gene locus_tag LOCUS_03770 7792 5618 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_03770 7963 9477 gene locus_tag LOCUS_03780 7963 9477 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_03780 9821 11470 gene locus_tag LOCUS_03790 9821 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence0033 3184 3633 gene locus_tag LOCUS_03800 3184 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6217 3698 gene locus_tag LOCUS_03810 gene fecA 6217 3698 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_03810 6909 6400 gene locus_tag LOCUS_03820 6909 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6984 7631 gene locus_tag LOCUS_03830 6984 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_03830 8550 7852 gene locus_tag LOCUS_03840 gene clpP 8550 7852 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_03840 >Feature sequence0034 987 3494 gene locus_tag LOCUS_03850 987 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3541 4410 gene locus_tag LOCUS_03860 3541 4410 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_03860 5867 4500 gene locus_tag LOCUS_03870 gene hemN 5867 4500 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_03870 6035 7231 gene locus_tag LOCUS_03880 gene nuoD 6035 7231 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_03880 8171 7236 gene locus_tag LOCUS_03890 gene ribF 8171 7236 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_03890 8403 8942 gene locus_tag LOCUS_03900 8403 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 9895 8990 gene locus_tag LOCUS_03910 gene corA 9895 8990 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE82 protein_id gnl|my_center|LOCUS_03910 10736 10059 gene locus_tag LOCUS_03920 10736 10059 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_03920 10875 11360 gene locus_tag LOCUS_03930 10875 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0035 320 631 gene locus_tag LOCUS_03940 320 631 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_03940 1839 703 gene locus_tag LOCUS_03950 1839 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2331 1903 gene locus_tag LOCUS_03960 2331 1903 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_03960 4850 2436 gene locus_tag LOCUS_03970 4850 2436 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 protein_id gnl|my_center|LOCUS_03970 5498 4863 gene locus_tag LOCUS_03980 5498 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 6154 5621 gene locus_tag LOCUS_03990 6154 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6995 6279 gene locus_tag LOCUS_04000 6995 6279 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_04000 7186 7581 gene locus_tag LOCUS_04010 7186 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8000 7590 gene locus_tag LOCUS_04020 8000 7590 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_04020 9160 8090 gene locus_tag LOCUS_04030 9160 8090 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_04030 9575 9165 gene locus_tag LOCUS_04040 9575 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10501 9680 gene locus_tag LOCUS_04050 gene panB 10501 9680 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_04050 <11441 10679 gene locus_tag LOCUS_04060 <11441 10679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64QN4:thiamine-monophosphate kinase >Feature sequence0036 2144 564 gene locus_tag LOCUS_04070 2144 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2437 2901 gene locus_tag LOCUS_04080 2437 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4550 3135 gene locus_tag LOCUS_04090 4550 3135 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_04090 7119 4723 gene locus_tag LOCUS_04100 7119 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 8580 7243 gene locus_tag LOCUS_04110 8580 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9570 8731 gene locus_tag LOCUS_04120 9570 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 11196 9742 gene locus_tag LOCUS_04130 11196 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence0037 1130 906 gene locus_tag LOCUS_04140 1130 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2193 1387 gene locus_tag LOCUS_04150 gene rpsB 2193 1387 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_04150 2852 2463 gene locus_tag LOCUS_04160 2852 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3333 2884 gene locus_tag LOCUS_04170 gene rplM 3333 2884 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_04170 4083 3595 gene locus_tag LOCUS_04180 4083 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4896 4192 gene locus_tag LOCUS_04190 4896 4192 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_04190 5012 6016 gene locus_tag LOCUS_04200 5012 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6210 8441 gene locus_tag LOCUS_04210 6210 8441 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107156.1 protein_id gnl|my_center|LOCUS_04210 8538 9176 gene locus_tag LOCUS_04220 8538 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9342 9683 gene locus_tag LOCUS_04230 9342 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence0038 866 1345 gene locus_tag LOCUS_04240 866 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2438 1431 gene locus_tag LOCUS_04250 2438 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3020 2610 gene locus_tag LOCUS_04260 3020 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3083 3463 gene locus_tag LOCUS_04270 3083 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3882 3472 gene locus_tag LOCUS_04280 3882 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4269 6947 gene locus_tag LOCUS_04290 gene gyrA 4269 6947 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_04290 7023 8315 gene locus_tag LOCUS_04300 7023 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9088 9756 gene locus_tag LOCUS_04310 9088 9756 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_04310 9988 10971 gene locus_tag LOCUS_04320 9988 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence0039 443 1306 gene locus_tag LOCUS_04330 443 1306 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015900.1 protein_id gnl|my_center|LOCUS_04330 1428 2132 gene locus_tag LOCUS_04340 1428 2132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_04340 2634 3911 gene locus_tag LOCUS_04350 2634 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_04350 4333 5514 gene locus_tag LOCUS_04360 4333 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5613 5936 gene locus_tag LOCUS_04370 5613 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6151 7608 gene locus_tag LOCUS_04380 6151 7608 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769206.1 protein_id gnl|my_center|LOCUS_04380 8263 7676 gene locus_tag LOCUS_04390 8263 7676 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_04390 9616 8399 gene locus_tag LOCUS_04400 gene mraY 9616 8399 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_04400 10475 9753 gene locus_tag LOCUS_04410 10475 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence0040 <1 3831 gene locus_tag LOCUS_04420 <1 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 3999 5837 gene locus_tag LOCUS_04430 3999 5837 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_04430 5838 7754 gene locus_tag LOCUS_04440 5838 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8318 9550 gene locus_tag LOCUS_04450 8318 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence0041 343 924 gene locus_tag LOCUS_04460 gene adk 343 924 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_04460 1793 1011 gene locus_tag LOCUS_04470 1793 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2102 3334 gene locus_tag LOCUS_04480 2102 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3552 4427 gene locus_tag LOCUS_04490 gene lgt 3552 4427 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_04490 4495 4860 gene locus_tag LOCUS_04500 4495 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_04500 4955 5776 gene locus_tag LOCUS_04510 gene dinD 4955 5776 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_04510 6971 5781 gene locus_tag LOCUS_04520 6971 5781 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_04520 10453 7427 gene locus_tag LOCUS_04530 10453 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence0042 3994 4239 gene locus_tag LOCUS_04540 3994 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4271 5527 gene locus_tag LOCUS_04550 4271 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5969 6790 gene locus_tag LOCUS_04560 gene dinD 5969 6790 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_04560 7517 7197 gene locus_tag LOCUS_04570 7517 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8375 7572 gene locus_tag LOCUS_04580 8375 7572 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_04580 8750 10246 gene locus_tag LOCUS_04590 8750 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence0043 1263 370 gene locus_tag LOCUS_04600 1263 370 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_04600 1648 3165 gene locus_tag LOCUS_04610 gene rpoN 1648 3165 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_04610 3378 4247 gene locus_tag LOCUS_04620 gene uspA 3378 4247 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_04620 4463 6382 gene locus_tag LOCUS_04630 4463 6382 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203287.1 protein_id gnl|my_center|LOCUS_04630 6476 7123 gene locus_tag LOCUS_04640 gene udk 6476 7123 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSB2 protein_id gnl|my_center|LOCUS_04640 7335 8027 gene locus_tag LOCUS_04650 7335 8027 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393255.1 protein_id gnl|my_center|LOCUS_04650 8152 8706 gene locus_tag LOCUS_04660 8152 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8843 10090 gene locus_tag LOCUS_04670 gene ribBA 8843 10090 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_04670 >Feature sequence0044 2312 1653 gene locus_tag LOCUS_04680 2312 1653 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_04680 2467 3600 gene locus_tag LOCUS_04690 2467 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4184 3627 gene locus_tag LOCUS_04700 4184 3627 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_04700 4658 4197 gene locus_tag LOCUS_04710 gene smpB 4658 4197 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_04710 5687 4719 gene locus_tag LOCUS_04720 5687 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_04720 6134 6913 gene locus_tag LOCUS_04730 6134 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8390 6960 gene locus_tag LOCUS_04740 8390 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9048 8371 gene locus_tag LOCUS_04750 9048 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 9961 9542 gene locus_tag LOCUS_04760 9961 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence0045 101 1507 gene locus_tag LOCUS_04770 101 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2094 1534 gene locus_tag LOCUS_04780 2094 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2855 2523 gene locus_tag LOCUS_04790 gene clpS 2855 2523 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_04790 3103 3933 gene locus_tag LOCUS_04800 3103 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4476 3937 gene locus_tag LOCUS_04810 4476 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4650 5237 gene locus_tag LOCUS_04820 4650 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 5336 7768 gene locus_tag LOCUS_04830 5336 7768 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_04830 7950 9128 gene locus_tag LOCUS_04840 7950 9128 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence0046 2186 1155 gene locus_tag LOCUS_04850 2186 1155 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HBH6 protein_id gnl|my_center|LOCUS_04850 2615 2268 gene locus_tag LOCUS_04860 2615 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4560 2617 gene locus_tag LOCUS_04870 4560 2617 CDS product tryptophan 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267081.1 protein_id gnl|my_center|LOCUS_04870 5638 4613 gene locus_tag LOCUS_04880 gene ruvB 5638 4613 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_04880 6789 5695 gene locus_tag LOCUS_04890 6789 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7066 8343 gene locus_tag LOCUS_04900 gene eno2 7066 8343 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_04900 9329 8568 gene locus_tag LOCUS_04910 9329 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 9547 9326 gene locus_tag LOCUS_04920 9547 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence0047 2950 1445 gene locus_tag LOCUS_04930 2950 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4392 3229 gene locus_tag LOCUS_04940 4392 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5229 4696 gene locus_tag LOCUS_04950 5229 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6585 5299 gene locus_tag LOCUS_04960 6585 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7778 6798 gene locus_tag LOCUS_04970 7778 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8771 7866 gene locus_tag LOCUS_04980 8771 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9510 9097 gene locus_tag LOCUS_04990 9510 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence0048 4139 2814 gene locus_tag LOCUS_05000 4139 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4428 5291 gene locus_tag LOCUS_05010 4428 5291 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_05010 5416 6258 gene locus_tag LOCUS_05020 5416 6258 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_05020 6442 7044 gene locus_tag LOCUS_05030 gene nfnB 6442 7044 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021632.1 protein_id gnl|my_center|LOCUS_05030 7107 7493 gene locus_tag LOCUS_05040 7107 7493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_05040 8361 7600 gene locus_tag LOCUS_05050 8361 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 <9632 8540 gene locus_tag LOCUS_05060 <9632 8540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030230.1:methylmalonyl-CoA mutase >Feature sequence0049 <1 3105 gene locus_tag LOCUS_05070 <1 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001882068.1:glutamate synthase 3173 4675 gene locus_tag LOCUS_05080 gene gltD 3173 4675 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_05080 4770 5255 gene locus_tag LOCUS_05090 4770 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6356 5259 gene locus_tag LOCUS_05100 6356 5259 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_05100 6911 6408 gene locus_tag LOCUS_05110 6911 6408 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_05110 7151 7753 gene locus_tag LOCUS_05120 7151 7753 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_05120 7836 8768 gene locus_tag LOCUS_05130 7836 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence0050 1592 2125 gene locus_tag LOCUS_05140 1592 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_05140 2171 2992 gene locus_tag LOCUS_05150 2171 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3124 3954 gene locus_tag LOCUS_05160 3124 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4129 4656 gene locus_tag LOCUS_05170 4129 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4764 5432 gene locus_tag LOCUS_05180 4764 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5620 6591 gene locus_tag LOCUS_05190 5620 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7102 6593 gene locus_tag LOCUS_05200 7102 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8772 7363 gene locus_tag LOCUS_05210 8772 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence0051 409 1083 gene locus_tag LOCUS_05220 409 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1787 1143 gene locus_tag LOCUS_05230 1787 1143 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_05230 1946 3034 gene locus_tag LOCUS_05240 gene apbE 1946 3034 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44550 protein_id gnl|my_center|LOCUS_05240 3354 3806 gene locus_tag LOCUS_05250 3354 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3977 4705 gene locus_tag LOCUS_05260 3977 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4717 5439 gene locus_tag LOCUS_05270 4717 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6010 5429 gene locus_tag LOCUS_05280 6010 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6725 6018 gene locus_tag LOCUS_05290 6725 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8078 6846 gene locus_tag LOCUS_05300 gene ald 8078 6846 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_05300 8551 8075 gene locus_tag LOCUS_05310 8551 8075 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence0052 121 1032 gene locus_tag LOCUS_05320 121 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_05320 2581 1127 gene locus_tag LOCUS_05330 gene speE1 2581 1127 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_05330 3141 4397 gene locus_tag LOCUS_05340 gene trpB 3141 4397 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_05340 4532 5140 gene locus_tag LOCUS_05350 4532 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5783 5331 gene locus_tag LOCUS_05360 5783 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 protein_id gnl|my_center|LOCUS_05360 6572 5814 gene locus_tag LOCUS_05370 6572 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7470 6634 gene locus_tag LOCUS_05380 7470 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_05380 7738 9135 gene locus_tag LOCUS_05390 7738 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0053 1445 1750 gene locus_tag LOCUS_05400 1445 1750 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_05400 2898 1831 gene locus_tag LOCUS_05410 2898 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3477 6083 gene locus_tag LOCUS_05420 3477 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6087 6644 gene locus_tag LOCUS_05430 6087 6644 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence0054 1740 91 gene locus_tag LOCUS_05440 1740 91 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_05440 2004 2687 gene locus_tag LOCUS_05450 gene rsmI 2004 2687 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_05450 2899 3774 gene locus_tag LOCUS_05460 2899 3774 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_05460 4089 4550 gene locus_tag LOCUS_05470 4089 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6555 4699 gene locus_tag LOCUS_05480 6555 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8206 7502 gene locus_tag LOCUS_05490 8206 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8405 8797 gene locus_tag LOCUS_05500 8405 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0055 290 799 gene locus_tag LOCUS_05510 290 799 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_05510 885 1364 gene locus_tag LOCUS_05520 885 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1461 2981 gene locus_tag LOCUS_05530 1461 2981 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_05530 3455 3042 gene locus_tag LOCUS_05540 3455 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4609 3641 gene locus_tag LOCUS_05550 gene accA 4609 3641 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_05550 5169 7220 gene locus_tag LOCUS_05560 5169 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8204 7329 gene locus_tag LOCUS_05570 8204 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8902 8327 gene locus_tag LOCUS_05580 gene ftnA 8902 8327 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0056 331 516 gene locus_tag LOCUS_05590 331 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 634 1938 gene locus_tag LOCUS_05600 634 1938 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_05600 2425 2763 gene locus_tag LOCUS_05610 2425 2763 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_05610 3046 3963 gene locus_tag LOCUS_05620 3046 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4635 6200 gene locus_tag LOCUS_05630 4635 6200 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_05630 7159 6392 gene locus_tag LOCUS_05640 7159 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8658 7297 gene locus_tag LOCUS_05650 8658 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence0057 508 903 gene locus_tag LOCUS_05660 508 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1189 1743 gene locus_tag LOCUS_05670 1189 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1840 2130 gene locus_tag LOCUS_05680 1840 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2147 3451 gene locus_tag LOCUS_05690 2147 3451 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_05690 3606 5888 gene locus_tag LOCUS_05700 3606 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6191 6715 gene locus_tag LOCUS_05710 6191 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6946 7377 gene locus_tag LOCUS_05720 6946 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7409 8218 gene locus_tag LOCUS_05730 7409 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8350 8892 gene locus_tag LOCUS_05740 8350 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence0058 2085 340 gene locus_tag LOCUS_05750 2085 340 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_05750 2428 2763 gene locus_tag LOCUS_05760 2428 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3004 8403 gene locus_tag LOCUS_05770 3004 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence0059 1664 507 gene locus_tag LOCUS_05780 1664 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2336 3703 gene locus_tag LOCUS_05790 gene hemA 2336 3703 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_05790 5161 3899 gene locus_tag LOCUS_05800 5161 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5317 5940 gene locus_tag LOCUS_05810 5317 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6033 6464 gene locus_tag LOCUS_05820 6033 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6699 8804 gene locus_tag LOCUS_05830 6699 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence0060 <1 919 gene locus_tag LOCUS_05840 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815393.1:integrase 2454 988 gene locus_tag LOCUS_05850 2454 988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_05850 2751 2839 gene locus_tag LOCUS_t00050 2751 2839 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3268 4113 gene locus_tag LOCUS_05860 3268 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4254 4781 gene locus_tag LOCUS_05870 4254 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 4794 5369 gene locus_tag LOCUS_05880 4794 5369 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_05880 5426 5881 gene locus_tag LOCUS_05890 5426 5881 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108110.1 protein_id gnl|my_center|LOCUS_05890 5996 6421 gene locus_tag LOCUS_05900 5996 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6512 7138 gene locus_tag LOCUS_05910 6512 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_05910 7396 8328 gene locus_tag LOCUS_05920 gene hemC 7396 8328 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_05920 8358 8489 gene locus_tag LOCUS_05930 8358 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence0061 1282 287 gene locus_tag LOCUS_05940 gene nrdB 1282 287 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_05940 1696 2265 gene locus_tag LOCUS_05950 1696 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2819 2274 gene locus_tag LOCUS_05960 2819 2274 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964804.1 protein_id gnl|my_center|LOCUS_05960 4246 2846 gene locus_tag LOCUS_05970 4246 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4676 4353 gene locus_tag LOCUS_05980 4676 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_05980 5106 6059 gene locus_tag LOCUS_05990 5106 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6242 7141 gene locus_tag LOCUS_06000 6242 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932850.1 protein_id gnl|my_center|LOCUS_06000 7812 7213 gene locus_tag LOCUS_06010 7812 7213 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_06010 <8884 8280 gene locus_tag LOCUS_06020 <8884 8280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW32:adenosylhomocysteinase >Feature sequence0062 762 2123 gene locus_tag LOCUS_06030 762 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2884 2213 gene locus_tag LOCUS_06040 2884 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3151 3708 gene locus_tag LOCUS_06050 3151 3708 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_06050 5899 3977 gene locus_tag LOCUS_06060 5899 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6114 6710 gene locus_tag LOCUS_06070 6114 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 7095 6697 gene locus_tag LOCUS_06080 7095 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8172 7183 gene locus_tag LOCUS_06090 8172 7183 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0063 677 162 gene locus_tag LOCUS_06100 gene rpsE 677 162 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_06100 1055 699 gene locus_tag LOCUS_06110 gene rplR 1055 699 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J26 protein_id gnl|my_center|LOCUS_06110 1705 1154 gene locus_tag LOCUS_06120 gene rplF 1705 1154 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_06120 2263 1865 gene locus_tag LOCUS_06130 gene rpsH 2263 1865 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_06130 2670 2383 gene locus_tag LOCUS_06140 gene rpsN 2670 2383 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIG9 protein_id gnl|my_center|LOCUS_06140 3346 2801 gene locus_tag LOCUS_06150 gene rplE 3346 2801 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_06150 3691 3350 gene locus_tag LOCUS_06160 gene rplX 3691 3350 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_06160 4129 3761 gene locus_tag LOCUS_06170 gene rplN 4129 3761 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_06170 4536 4264 gene locus_tag LOCUS_06180 gene rpsQ 4536 4264 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q5 protein_id gnl|my_center|LOCUS_06180 4784 4572 gene locus_tag LOCUS_06190 4784 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5289 4864 gene locus_tag LOCUS_06200 gene rplP 5289 4864 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_06200 7430 6075 gene locus_tag LOCUS_06210 gene gdhA 7430 6075 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_06210 7622 8338 gene locus_tag LOCUS_06220 7622 8338 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence0064 390 4 gene locus_tag LOCUS_06230 390 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1080 424 gene locus_tag LOCUS_06240 1080 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1529 1107 gene locus_tag LOCUS_06250 1529 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1971 1609 gene locus_tag LOCUS_06260 1971 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2380 2036 gene locus_tag LOCUS_06270 2380 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2576 2385 gene locus_tag LOCUS_06280 2576 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3007 2600 gene locus_tag LOCUS_06290 3007 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3444 3016 gene locus_tag LOCUS_06300 3444 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3848 3450 gene locus_tag LOCUS_06310 3848 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4460 3855 gene locus_tag LOCUS_06320 4460 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5121 4600 gene locus_tag LOCUS_06330 5121 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5827 5126 gene locus_tag LOCUS_06340 5827 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6531 5797 gene locus_tag LOCUS_06350 6531 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7311 6574 gene locus_tag LOCUS_06360 7311 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7713 7324 gene locus_tag LOCUS_06370 7713 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7973 7692 gene locus_tag LOCUS_06380 7973 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8445 7978 gene locus_tag LOCUS_06390 8445 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence0065 405 1595 gene locus_tag LOCUS_06400 405 1595 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_06400 1818 1612 gene locus_tag LOCUS_06410 1818 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1943 2221 gene locus_tag LOCUS_06420 1943 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2323 3117 gene locus_tag LOCUS_06430 2323 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_06430 3208 3435 gene locus_tag LOCUS_06440 3208 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3567 5033 gene locus_tag LOCUS_06450 3567 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_06450 5037 5705 gene locus_tag LOCUS_06460 5037 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence0066 2635 2021 gene locus_tag LOCUS_06470 gene nqrE 2635 2021 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ3 protein_id gnl|my_center|LOCUS_06470 3369 2689 gene locus_tag LOCUS_06480 gene nqrD 3369 2689 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_06480 4256 3456 gene locus_tag LOCUS_06490 gene nqrC 4256 3456 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_06490 5451 4249 gene locus_tag LOCUS_06500 gene nqrB 5451 4249 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_06500 6935 5571 gene locus_tag LOCUS_06510 gene nqrA 6935 5571 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_06510 7438 7917 gene locus_tag LOCUS_06520 7438 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 protein_id gnl|my_center|LOCUS_06520 8048 8563 gene locus_tag LOCUS_06530 8048 8563 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497611.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0067 2128 365 gene locus_tag LOCUS_06540 2128 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2919 2152 gene locus_tag LOCUS_06550 2919 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4757 3120 gene locus_tag LOCUS_06560 4757 3120 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706476.1 protein_id gnl|my_center|LOCUS_06560 5858 4770 gene locus_tag LOCUS_06570 gene capA 5858 4770 CDS product PGA biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96738 protein_id gnl|my_center|LOCUS_06570 6154 5894 gene locus_tag LOCUS_06580 6154 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7133 6258 gene locus_tag LOCUS_06590 gene folD 7133 6258 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_06590 7510 7226 gene locus_tag LOCUS_06600 7510 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 8051 7584 gene locus_tag LOCUS_06610 8051 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06610 8240 8632 gene locus_tag LOCUS_06620 8240 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0068 <1 905 gene locus_tag LOCUS_06630 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962802.1:acyl-CoA reductase 990 2021 gene locus_tag LOCUS_06640 990 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2120 3022 gene locus_tag LOCUS_06650 gene lipA 2120 3022 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_06650 3066 4280 gene locus_tag LOCUS_06660 3066 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_06660 4402 4797 gene locus_tag LOCUS_06670 4402 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4883 5512 gene locus_tag LOCUS_06680 4883 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_06680 5514 6005 gene locus_tag LOCUS_06690 5514 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6034 6753 gene locus_tag LOCUS_06700 gene truB 6034 6753 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U2 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0069 658 215 gene locus_tag LOCUS_06710 658 215 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_06710 1200 2567 gene locus_tag LOCUS_06720 1200 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403553.1 protein_id gnl|my_center|LOCUS_06720 2788 4377 gene locus_tag LOCUS_06730 2788 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_06730 4619 5851 gene locus_tag LOCUS_06740 4619 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404922.1 protein_id gnl|my_center|LOCUS_06740 5968 6696 gene locus_tag LOCUS_06750 5968 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7615 6788 gene locus_tag LOCUS_06760 7615 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 <8560 7715 gene locus_tag LOCUS_06770 <8560 7715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103978.1:radical SAM domain-containing protein >Feature sequence0070 757 2244 gene locus_tag LOCUS_06780 gene miaB 757 2244 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_06780 3545 2319 gene locus_tag LOCUS_06790 3545 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4016 4768 gene locus_tag LOCUS_06800 4016 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4785 5663 gene locus_tag LOCUS_06810 4785 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_06810 5663 6406 gene locus_tag LOCUS_06820 5663 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6481 7242 gene locus_tag LOCUS_06830 6481 7242 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_06830 8269 7292 gene locus_tag LOCUS_06840 8269 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence0071 <1 1990 gene locus_tag LOCUS_06850 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 3875 2112 gene locus_tag LOCUS_06860 3875 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4067 4921 gene locus_tag LOCUS_06870 4067 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5269 4958 gene locus_tag LOCUS_06880 5269 4958 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_06880 6162 5410 gene locus_tag LOCUS_06890 6162 5410 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7Q6 protein_id gnl|my_center|LOCUS_06890 6809 6198 gene locus_tag LOCUS_06900 6809 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 7829 6912 gene locus_tag LOCUS_06910 7829 6912 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence0072 1426 935 gene locus_tag LOCUS_06920 1426 935 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_06920 1660 2829 gene locus_tag LOCUS_06930 1660 2829 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_06930 2977 4410 gene locus_tag LOCUS_06940 2977 4410 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_06940 4596 5408 gene locus_tag LOCUS_06950 4596 5408 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_06950 5439 6353 gene locus_tag LOCUS_06960 5439 6353 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_06960 6474 7520 gene locus_tag LOCUS_06970 6474 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 <8481 7589 gene locus_tag LOCUS_06980 <8481 7589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A451:primosomal protein N' >Feature sequence0073 1781 1182 gene locus_tag LOCUS_06990 1781 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2278 1784 gene locus_tag LOCUS_07000 2278 1784 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_07000 3082 2501 gene locus_tag LOCUS_07010 3082 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3634 3215 gene locus_tag LOCUS_07020 3634 3215 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_07020 3928 3677 gene locus_tag LOCUS_07030 3928 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4848 4042 gene locus_tag LOCUS_07040 gene folE2 4848 4042 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_07040 5218 4811 gene locus_tag LOCUS_07050 gene ygcM 5218 4811 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_07050 5484 6104 gene locus_tag LOCUS_07060 5484 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6327 8261 gene locus_tag LOCUS_07070 6327 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence0074 <1 765 gene locus_tag LOCUS_07080 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650K7:tyrosine--tRNA ligase 1661 927 gene locus_tag LOCUS_07090 1661 927 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07090 2828 1770 gene locus_tag LOCUS_07100 gene prfB 2828 1770 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_07100 6819 3037 gene locus_tag LOCUS_07110 6819 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8075 7341 gene locus_tag LOCUS_07120 gene arsC 8075 7341 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0075 3810 2494 gene locus_tag LOCUS_07130 3810 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_07130 4190 3993 gene locus_tag LOCUS_07140 4190 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4117 4644 gene locus_tag LOCUS_07150 4117 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5172 4723 gene locus_tag LOCUS_07160 5172 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 6594 5359 gene locus_tag LOCUS_07170 gene nhaP 6594 5359 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_07170 7008 7859 gene locus_tag LOCUS_07180 7008 7859 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0076 <1 720 gene locus_tag LOCUS_07190 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2E8:ribonuclease 3 784 1008 gene locus_tag LOCUS_07200 784 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1015 1425 gene locus_tag LOCUS_07210 gene vapC 1015 1425 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_07210 1499 2269 gene locus_tag LOCUS_07220 gene folP 1499 2269 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_07220 2378 2758 gene locus_tag LOCUS_07230 2378 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2893 3570 gene locus_tag LOCUS_07240 2893 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4438 3749 gene locus_tag LOCUS_07250 gene uppP 4438 3749 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 4737 5609 gene locus_tag LOCUS_07260 4737 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_07260 5736 6074 gene locus_tag LOCUS_07270 5736 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7152 6148 gene locus_tag LOCUS_07280 7152 6148 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_07280 7767 8240 gene locus_tag LOCUS_07290 7767 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0077 378 1400 gene locus_tag LOCUS_07300 gene fjo19 378 1400 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_07300 1495 1292 gene locus_tag LOCUS_07310 1495 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1538 2482 gene locus_tag LOCUS_07320 1538 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2769 3698 gene locus_tag LOCUS_07330 2769 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3718 4185 gene locus_tag LOCUS_07340 3718 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4235 4735 gene locus_tag LOCUS_07350 4235 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence0078 552 1331 gene locus_tag LOCUS_07360 552 1331 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_07360 1417 2451 gene locus_tag LOCUS_07370 gene lpxD 1417 2451 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_07370 3738 2485 gene locus_tag LOCUS_07380 gene sbcD 3738 2485 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23479 protein_id gnl|my_center|LOCUS_07380 5801 3861 gene locus_tag LOCUS_07390 5801 3861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_07390 5994 7130 gene locus_tag LOCUS_07400 5994 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7201 8061 gene locus_tag LOCUS_07410 7201 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence0079 <1 1157 gene locus_tag LOCUS_07420 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:tetratricopeptide repeat domain protein 1314 2453 gene locus_tag LOCUS_07430 1314 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2742 3377 gene locus_tag LOCUS_07440 2742 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3824 3384 gene locus_tag LOCUS_07450 3824 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5878 3905 gene locus_tag LOCUS_07460 5878 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7764 6511 gene locus_tag LOCUS_07470 7764 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence0080 332 637 gene locus_tag LOCUS_07480 gene rpsJ 332 637 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_07480 759 1136 gene locus_tag LOCUS_07490 759 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1123 2022 gene locus_tag LOCUS_07500 1123 2022 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963662.1 protein_id gnl|my_center|LOCUS_07500 2012 2548 gene locus_tag LOCUS_07510 2012 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5558 2598 gene locus_tag LOCUS_07520 5558 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0081 1305 283 gene locus_tag LOCUS_07530 1305 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2853 1321 gene locus_tag LOCUS_07540 2853 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3457 3122 gene locus_tag LOCUS_07550 3457 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3976 6318 gene locus_tag LOCUS_07560 3976 6318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_07560 6725 6315 gene locus_tag LOCUS_07570 6725 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7148 6729 gene locus_tag LOCUS_07580 7148 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence0082 1059 247 gene locus_tag LOCUS_07590 1059 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2058 1117 gene locus_tag LOCUS_07600 2058 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3433 2282 gene locus_tag LOCUS_07610 3433 2282 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_07610 3784 3575 gene locus_tag LOCUS_07620 3784 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5753 4083 gene locus_tag LOCUS_07630 gene fhs 5753 4083 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U80 protein_id gnl|my_center|LOCUS_07630 6346 5789 gene locus_tag LOCUS_07640 6346 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8223 6352 gene locus_tag LOCUS_07650 8223 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence0083 301 849 gene locus_tag LOCUS_07660 301 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_07660 981 1403 gene locus_tag LOCUS_07670 981 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3192 1468 gene locus_tag LOCUS_07680 3192 1468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_07680 6165 3283 gene locus_tag LOCUS_07690 6165 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7206 6616 gene locus_tag LOCUS_07700 7206 6616 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_07700 7543 7280 gene locus_tag LOCUS_07710 7543 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8072 7536 gene locus_tag LOCUS_07720 8072 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence0084 877 266 gene locus_tag LOCUS_07730 877 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_07730 1183 2169 gene locus_tag LOCUS_07740 gene purC 1183 2169 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_07740 2488 3444 gene locus_tag LOCUS_07750 2488 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3714 4718 gene locus_tag LOCUS_07760 gene xerC 3714 4718 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2F4 protein_id gnl|my_center|LOCUS_07760 4743 5219 gene locus_tag LOCUS_07770 4743 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5393 5728 gene locus_tag LOCUS_07780 5393 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5732 6199 gene locus_tag LOCUS_07790 gene vapC 5732 6199 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_07790 6293 7576 gene locus_tag LOCUS_07800 gene hutI 6293 7576 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_07800 >Feature sequence0085 1093 335 gene locus_tag LOCUS_07810 1093 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1219 3072 gene locus_tag LOCUS_07820 1219 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3475 4617 gene locus_tag LOCUS_07830 3475 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4893 5915 gene locus_tag LOCUS_07840 4893 5915 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_07840 5987 7147 gene locus_tag LOCUS_07850 gene lpxB 5987 7147 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_07850 7291 7986 gene locus_tag LOCUS_07860 7291 7986 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence0086 <1 1465 gene locus_tag LOCUS_07870 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter 1768 2409 gene locus_tag LOCUS_07880 1768 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2735 3832 gene locus_tag LOCUS_07890 2735 3832 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204047.1 protein_id gnl|my_center|LOCUS_07890 5801 4032 gene locus_tag LOCUS_07900 5801 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6354 7379 gene locus_tag LOCUS_07910 gene mvaD 6354 7379 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence0087 718 1299 gene locus_tag LOCUS_07920 718 1299 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCY3 protein_id gnl|my_center|LOCUS_07920 1782 1432 gene locus_tag LOCUS_07930 1782 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3241 1844 gene locus_tag LOCUS_07940 3241 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3562 4329 gene locus_tag LOCUS_07950 gene pssA 3562 4329 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_07950 4560 5810 gene locus_tag LOCUS_07960 4560 5810 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_07960 5874 6803 gene locus_tag LOCUS_07970 5874 6803 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_07970 7836 6808 gene locus_tag LOCUS_07980 7836 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence0088 1120 2379 gene locus_tag LOCUS_07990 1120 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2513 2887 gene locus_tag LOCUS_08000 gene rpsF 2513 2887 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_08000 2945 3202 gene locus_tag LOCUS_08010 gene rpsR 2945 3202 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH8 protein_id gnl|my_center|LOCUS_08010 3263 3706 gene locus_tag LOCUS_08020 gene rplI 3263 3706 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_08020 5067 3979 gene locus_tag LOCUS_08030 5067 3979 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_08030 5498 5238 gene locus_tag LOCUS_08040 5498 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence0089 1 594 gene locus_tag LOCUS_08050 1 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1707 766 gene locus_tag LOCUS_08060 1707 766 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_08060 3042 1900 gene locus_tag LOCUS_08070 3042 1900 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546667.1 protein_id gnl|my_center|LOCUS_08070 3737 5059 gene locus_tag LOCUS_08080 3737 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5750 5148 gene locus_tag LOCUS_08090 5750 5148 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_08090 6281 5865 gene locus_tag LOCUS_08100 6281 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6662 6736 gene locus_tag LOCUS_t00060 6662 6736 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7788 6826 gene locus_tag LOCUS_08110 7788 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0090 1531 2604 gene locus_tag LOCUS_08120 1531 2604 CDS product tRNA (guanine-N2)-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 protein_id gnl|my_center|LOCUS_08120 2626 2934 gene locus_tag LOCUS_08130 2626 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2990 3799 gene locus_tag LOCUS_08140 2990 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3873 6335 gene locus_tag LOCUS_08150 3873 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6339 6605 gene locus_tag LOCUS_08160 6339 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6637 7140 gene locus_tag LOCUS_08170 6637 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence0091 1392 127 gene locus_tag LOCUS_08180 gene mscS2 1392 127 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_08180 3136 1565 gene locus_tag LOCUS_08190 3136 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3254 3667 gene locus_tag LOCUS_08200 3254 3667 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295281.1 protein_id gnl|my_center|LOCUS_08200 3800 4699 gene locus_tag LOCUS_08210 3800 4699 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_08210 4807 6243 gene locus_tag LOCUS_08220 gene gatA2 4807 6243 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX8 protein_id gnl|my_center|LOCUS_08220 6273 6599 gene locus_tag LOCUS_08230 6273 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6820 7398 gene locus_tag LOCUS_08240 6820 7398 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence0092 468 1532 gene locus_tag LOCUS_08250 468 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1882 3126 gene locus_tag LOCUS_08260 1882 3126 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_08260 3559 3753 gene locus_tag LOCUS_08270 3559 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4774 3833 gene locus_tag LOCUS_08280 4774 3833 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_08280 5306 6778 gene locus_tag LOCUS_08290 5306 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7951 6782 gene locus_tag LOCUS_08300 7951 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence0093 2823 1669 gene locus_tag LOCUS_08310 2823 1669 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_08310 4349 2937 gene locus_tag LOCUS_08320 4349 2937 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_08320 5068 4397 gene locus_tag LOCUS_08330 5068 4397 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_08330 5811 6368 gene locus_tag LOCUS_08340 5811 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_08340 6391 6768 gene locus_tag LOCUS_08350 6391 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence0094 763 41 gene locus_tag LOCUS_08360 763 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 951 1328 gene locus_tag LOCUS_08370 951 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1442 2623 gene locus_tag LOCUS_08380 gene ftsW 1442 2623 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_08380 3140 2628 gene locus_tag LOCUS_08390 gene ndhG 3140 2628 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_08390 4007 6436 gene locus_tag LOCUS_08400 4007 6436 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_08400 6580 7077 gene locus_tag LOCUS_08410 6580 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7077 7595 gene locus_tag LOCUS_08420 7077 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence0095 886 272 gene locus_tag LOCUS_08430 886 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1317 1520 gene locus_tag LOCUS_08440 1317 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1693 1950 gene locus_tag LOCUS_08450 1693 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2025 2774 gene locus_tag LOCUS_08460 gene scpA 2025 2774 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_08460 2819 3562 gene locus_tag LOCUS_08470 2819 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3620 4123 gene locus_tag LOCUS_08480 3620 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4271 5317 gene locus_tag LOCUS_08490 4271 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5589 7058 gene locus_tag LOCUS_08500 5589 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0096 57 914 gene locus_tag LOCUS_08510 57 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 982 1773 gene locus_tag LOCUS_08520 gene kdsA 982 1773 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 protein_id gnl|my_center|LOCUS_08520 2002 2700 gene locus_tag LOCUS_08530 2002 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2967 6599 gene locus_tag LOCUS_08540 2967 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6707 7444 gene locus_tag LOCUS_08550 6707 7444 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence0097 100 1473 gene locus_tag LOCUS_08560 gene kmo 100 1473 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_08560 1557 1961 gene locus_tag LOCUS_08570 1557 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2471 2289 gene locus_tag LOCUS_08580 2471 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2620 2991 gene locus_tag LOCUS_08590 2620 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3277 4383 gene locus_tag LOCUS_08600 3277 4383 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_08600 4790 5578 gene locus_tag LOCUS_08610 gene frdC 4790 5578 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_08610 5762 7696 gene locus_tag LOCUS_08620 gene sdhA 5762 7696 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence0098 1847 2794 gene locus_tag LOCUS_08630 1847 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2852 4138 gene locus_tag LOCUS_08640 2852 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4155 4865 gene locus_tag LOCUS_08650 4155 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4882 5625 gene locus_tag LOCUS_08660 4882 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5629 6486 gene locus_tag LOCUS_08670 5629 6486 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817145.1 protein_id gnl|my_center|LOCUS_08670 6470 7393 gene locus_tag LOCUS_08680 6470 7393 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence0099 2227 158 gene locus_tag LOCUS_08690 2227 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4470 2329 gene locus_tag LOCUS_08700 gene pepX1 4470 2329 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_08700 4824 5024 gene locus_tag LOCUS_08710 4824 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5180 5392 gene locus_tag LOCUS_08720 5180 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5397 5744 gene locus_tag LOCUS_08730 5397 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5806 6162 gene locus_tag LOCUS_08740 5806 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 6440 7216 gene locus_tag LOCUS_08750 6440 7216 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_08750 7357 7608 gene locus_tag LOCUS_08760 gene yeaQ 7357 7608 CDS product UPF0410 protein YeaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64487 protein_id gnl|my_center|LOCUS_08760 >Feature sequence0100 1550 351 gene locus_tag LOCUS_08770 1550 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_08770 4368 1738 gene locus_tag LOCUS_08780 4368 1738 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_08780 5791 4421 gene locus_tag LOCUS_08790 5791 4421 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229821.1 protein_id gnl|my_center|LOCUS_08790 7697 5892 gene locus_tag LOCUS_08800 7697 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0101 1716 184 gene locus_tag LOCUS_08810 1716 184 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_08810 2473 1886 gene locus_tag LOCUS_08820 2473 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_08820 2926 2528 gene locus_tag LOCUS_08830 2926 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3502 3044 gene locus_tag LOCUS_08840 3502 3044 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_08840 4134 3538 gene locus_tag LOCUS_08850 4134 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4203 4568 gene locus_tag LOCUS_08860 4203 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4731 6602 gene locus_tag LOCUS_08870 4731 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6922 7746 gene locus_tag LOCUS_08880 6922 7746 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE15 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0102 328 2364 gene locus_tag LOCUS_08890 328 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3808 2579 gene locus_tag LOCUS_08900 3808 2579 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_08900 4271 6232 gene locus_tag LOCUS_08910 gene dcp1 4271 6232 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_08910 7704 7291 gene locus_tag LOCUS_08920 7704 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08920 >Feature sequence0103 706 1323 gene locus_tag LOCUS_08930 706 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1535 3688 gene locus_tag LOCUS_08940 1535 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4015 3848 gene locus_tag LOCUS_08950 4015 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5146 4247 gene locus_tag LOCUS_08960 5146 4247 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_08960 5584 6183 gene locus_tag LOCUS_08970 gene recR 5584 6183 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_08970 6706 6197 gene locus_tag LOCUS_08980 6706 6197 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_08980 7642 6752 gene locus_tag LOCUS_08990 7642 6752 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459937.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence0104 1808 258 gene locus_tag LOCUS_09000 1808 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2177 2683 gene locus_tag LOCUS_09010 2177 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2816 3346 gene locus_tag LOCUS_09020 2816 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3655 4134 gene locus_tag LOCUS_09030 3655 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5062 4271 gene locus_tag LOCUS_09040 5062 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7621 5210 gene locus_tag LOCUS_09050 7621 5210 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence0105 479 1297 gene locus_tag LOCUS_09060 479 1297 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_09060 1457 2110 gene locus_tag LOCUS_09070 1457 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2209 3051 gene locus_tag LOCUS_09080 2209 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4088 3171 gene locus_tag LOCUS_09090 4088 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5340 4336 gene locus_tag LOCUS_09100 gene argK 5340 4336 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_09100 5821 7104 gene locus_tag LOCUS_09110 5821 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0106 2023 1235 gene locus_tag LOCUS_09120 2023 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3005 2085 gene locus_tag LOCUS_09130 3005 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_09130 3919 3173 gene locus_tag LOCUS_09140 3919 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6806 4173 gene locus_tag LOCUS_09150 gene alaS 6806 4173 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0107 <1 810 gene locus_tag LOCUS_09160 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403153.1:sodium:solute symporter 949 2697 gene locus_tag LOCUS_09170 949 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2712 3533 gene locus_tag LOCUS_09180 2712 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3869 5551 gene locus_tag LOCUS_09190 3869 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6010 5624 gene locus_tag LOCUS_09200 6010 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6891 6334 gene locus_tag LOCUS_09210 6891 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6928 7206 gene locus_tag LOCUS_09220 6928 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7420 7217 gene locus_tag LOCUS_09230 7420 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0108 1751 651 gene locus_tag LOCUS_09240 1751 651 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_09240 1923 2129 gene locus_tag LOCUS_09250 1923 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2946 2074 gene locus_tag LOCUS_09260 2946 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3289 3846 gene locus_tag LOCUS_09270 3289 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3898 4461 gene locus_tag LOCUS_09280 3898 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4556 7393 gene locus_tag LOCUS_09290 4556 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence0109 1051 1641 gene locus_tag LOCUS_09300 gene pdxH 1051 1641 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_09300 1695 3095 gene locus_tag LOCUS_09310 1695 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3099 4502 gene locus_tag LOCUS_09320 3099 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4966 4499 gene locus_tag LOCUS_09330 4966 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5941 5195 gene locus_tag LOCUS_09340 5941 5195 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_09340 6958 6071 gene locus_tag LOCUS_09350 6958 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0110 118 1368 gene locus_tag LOCUS_09360 118 1368 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 protein_id gnl|my_center|LOCUS_09360 2110 3711 gene locus_tag LOCUS_09370 gene rny 2110 3711 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_09370 3790 5775 gene locus_tag LOCUS_09380 3790 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5855 6895 gene locus_tag LOCUS_09390 gene murB 5855 6895 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0111 1381 626 gene locus_tag LOCUS_09400 1381 626 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261705.1 protein_id gnl|my_center|LOCUS_09400 2489 1578 gene locus_tag LOCUS_09410 2489 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3029 2538 gene locus_tag LOCUS_09420 3029 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3675 5288 gene locus_tag LOCUS_09430 gene pckA2 3675 5288 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_09430 5744 6514 gene locus_tag LOCUS_09440 5744 6514 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0112 315 2018 gene locus_tag LOCUS_09450 gene ade 315 2018 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_09450 2072 2479 gene locus_tag LOCUS_09460 2072 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_09460 2521 3606 gene locus_tag LOCUS_09470 2521 3606 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203064.1 protein_id gnl|my_center|LOCUS_09470 3773 4456 gene locus_tag LOCUS_09480 3773 4456 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_09480 5900 4464 gene locus_tag LOCUS_09490 5900 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6828 6250 gene locus_tag LOCUS_09500 6828 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0113 91 969 gene locus_tag LOCUS_09510 91 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1718 1260 gene locus_tag LOCUS_09520 gene tadA 1718 1260 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_09520 2055 2729 gene locus_tag LOCUS_09530 2055 2729 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_09530 2824 3090 gene locus_tag LOCUS_09540 2824 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence0114 728 1411 gene locus_tag LOCUS_09550 728 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1513 2019 gene locus_tag LOCUS_09560 1513 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2348 3097 gene locus_tag LOCUS_09570 2348 3097 CDS product lipoprotein signal peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975911.1 protein_id gnl|my_center|LOCUS_09570 3360 3680 gene locus_tag LOCUS_09580 3360 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3862 7362 gene locus_tag LOCUS_09590 3862 7362 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D7 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0115 436 1095 gene locus_tag LOCUS_09600 436 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3827 1275 gene locus_tag LOCUS_09610 3827 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7279 4172 gene locus_tag LOCUS_09620 7279 4172 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0116 720 151 gene locus_tag LOCUS_09630 720 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1110 730 gene locus_tag LOCUS_09640 1110 730 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09640 2084 1197 gene locus_tag LOCUS_09650 2084 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2424 2588 gene locus_tag LOCUS_09660 2424 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3090 3299 gene locus_tag LOCUS_09670 3090 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5037 3352 gene locus_tag LOCUS_09680 5037 3352 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_09680 <7258 5131 gene locus_tag LOCUS_09690 <7258 5131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5DYQ1:histidine kinase >Feature sequence0117 2010 1042 gene locus_tag LOCUS_09700 gene pfkA 2010 1042 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_09700 2922 2035 gene locus_tag LOCUS_09710 2922 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3038 3322 gene locus_tag LOCUS_09720 3038 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4405 3314 gene locus_tag LOCUS_09730 gene ydcC 4405 3314 CDS product H repeat-associated protein YdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28917 protein_id gnl|my_center|LOCUS_09730 4932 4429 gene locus_tag LOCUS_09740 4932 4429 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_09740 <7245 5314 gene locus_tag LOCUS_09750 <7245 5314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000610086.1:ATP-dependent helicase >Feature sequence0118 899 87 gene locus_tag LOCUS_09760 899 87 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106129.1 protein_id gnl|my_center|LOCUS_09760 1465 917 gene locus_tag LOCUS_09770 1465 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1780 3333 gene locus_tag LOCUS_09780 1780 3333 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_09780 5632 3500 gene locus_tag LOCUS_09790 5632 3500 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_09790 6026 6223 gene locus_tag LOCUS_09800 6026 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6837 6271 gene locus_tag LOCUS_09810 6837 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0119 3504 328 gene locus_tag LOCUS_09820 3504 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3870 3703 gene locus_tag LOCUS_09830 3870 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3913 4488 gene locus_tag LOCUS_09840 3913 4488 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_09840 4544 5359 gene locus_tag LOCUS_09850 4544 5359 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_09850 5529 6818 gene locus_tag LOCUS_09860 gene glyA 5529 6818 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_09860 >Feature sequence0120 2826 3479 gene locus_tag LOCUS_09870 2826 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3599 4411 gene locus_tag LOCUS_09880 3599 4411 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_09880 4434 5351 gene locus_tag LOCUS_09890 4434 5351 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_09890 5451 5927 gene locus_tag LOCUS_09900 5451 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6881 5967 gene locus_tag LOCUS_09910 6881 5967 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0121 3082 737 gene locus_tag LOCUS_09920 3082 737 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_09920 3350 4120 gene locus_tag LOCUS_09930 3350 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4176 4679 gene locus_tag LOCUS_09940 4176 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4736 5185 gene locus_tag LOCUS_09950 4736 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5139 5840 gene locus_tag LOCUS_09960 5139 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5833 6489 gene locus_tag LOCUS_09970 5833 6489 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24891 protein_id gnl|my_center|LOCUS_09970 6486 6782 gene locus_tag LOCUS_09980 6486 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence0122 243 1493 gene locus_tag LOCUS_09990 243 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1620 1751 gene locus_tag LOCUS_10000 1620 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2001 5822 gene locus_tag LOCUS_10010 2001 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 <7151 5971 gene locus_tag LOCUS_10020 <7151 5971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZ77:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0123 <1 783 gene locus_tag LOCUS_10030 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 945 2459 gene locus_tag LOCUS_10040 945 2459 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_10040 2437 3429 gene locus_tag LOCUS_10050 2437 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_10050 3558 4511 gene locus_tag LOCUS_10060 3558 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4541 5239 gene locus_tag LOCUS_10070 4541 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5257 5835 gene locus_tag LOCUS_10080 5257 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_10080 6226 6651 gene locus_tag LOCUS_10090 6226 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0124 628 3519 gene locus_tag LOCUS_10100 628 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3698 4354 gene locus_tag LOCUS_10110 3698 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_10110 5014 4421 gene locus_tag LOCUS_10120 5014 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6695 5181 gene locus_tag LOCUS_10130 6695 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0125 2559 2152 gene locus_tag LOCUS_10140 2559 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3072 2689 gene locus_tag LOCUS_10150 3072 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3283 3062 gene locus_tag LOCUS_10160 3283 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4411 3407 gene locus_tag LOCUS_10170 4411 3407 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_10170 5672 4671 gene locus_tag LOCUS_10180 5672 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5816 6334 gene locus_tag LOCUS_10190 5816 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6500 6850 gene locus_tag LOCUS_10200 6500 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0126 1446 715 gene locus_tag LOCUS_10210 1446 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2801 1593 gene locus_tag LOCUS_10220 2801 1593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 protein_id gnl|my_center|LOCUS_10220 3755 3291 gene locus_tag LOCUS_10230 3755 3291 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289415.1 protein_id gnl|my_center|LOCUS_10230 4973 4092 gene locus_tag LOCUS_10240 4973 4092 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_10240 6904 5066 gene locus_tag LOCUS_10250 6904 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0127 <1 1923 gene locus_tag LOCUS_10260 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme 2092 2694 gene locus_tag LOCUS_10270 2092 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3119 2721 gene locus_tag LOCUS_10280 3119 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3085 3252 gene locus_tag LOCUS_10290 3085 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3961 3227 gene locus_tag LOCUS_10300 3961 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4528 3986 gene locus_tag LOCUS_10310 4528 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5078 4518 gene locus_tag LOCUS_10320 5078 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5293 6285 gene locus_tag LOCUS_10330 5293 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0128 1634 1434 gene locus_tag LOCUS_10340 1634 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2213 1638 gene locus_tag LOCUS_10350 2213 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_10350 3928 2231 gene locus_tag LOCUS_10360 gene pyrG 3928 2231 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_10360 3810 4025 gene locus_tag LOCUS_10370 3810 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4555 4079 gene locus_tag LOCUS_10380 4555 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5513 4686 gene locus_tag LOCUS_10390 5513 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 <7074 5658 gene locus_tag LOCUS_10400 <7074 5658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868765.1:peptide ABC transporter substrate-binding protein >Feature sequence0129 142 1407 gene locus_tag LOCUS_10410 142 1407 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_10410 5467 1673 gene locus_tag LOCUS_10420 5467 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5766 5605 gene locus_tag LOCUS_10430 5766 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6198 6656 gene locus_tag LOCUS_10440 6198 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0130 822 2054 gene locus_tag LOCUS_10450 822 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4335 2221 gene locus_tag LOCUS_10460 gene mutL 4335 2221 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_10460 4800 5093 gene locus_tag LOCUS_10470 4800 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5994 5122 gene locus_tag LOCUS_10480 gene mauG 5994 5122 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_10480 6073 6909 gene locus_tag LOCUS_10490 6073 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0131 213 698 gene locus_tag LOCUS_10500 213 698 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q8 protein_id gnl|my_center|LOCUS_10500 1023 703 gene locus_tag LOCUS_10510 1023 703 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_10510 1569 1060 gene locus_tag LOCUS_10520 1569 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2066 1566 gene locus_tag LOCUS_10530 2066 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3691 2270 gene locus_tag LOCUS_10540 3691 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_10540 4208 3876 gene locus_tag LOCUS_10550 4208 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4544 4834 gene locus_tag LOCUS_10560 4544 4834 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_10560 5653 5063 gene locus_tag LOCUS_10570 5653 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5957 6139 gene locus_tag LOCUS_10580 5957 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6129 6638 gene locus_tag LOCUS_10590 6129 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0132 189 1244 gene locus_tag LOCUS_10600 gene galE 189 1244 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_10600 1622 1305 gene locus_tag LOCUS_10610 1622 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2149 3165 gene locus_tag LOCUS_10620 gene pheS 2149 3165 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_10620 3257 3661 gene locus_tag LOCUS_10630 3257 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3745 4539 gene locus_tag LOCUS_10640 gene trpA 3745 4539 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_10640 4562 5221 gene locus_tag LOCUS_10650 4562 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5382 5633 gene locus_tag LOCUS_10660 5382 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5590 6000 gene locus_tag LOCUS_10670 5590 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 6253 6762 gene locus_tag LOCUS_10680 6253 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0133 1860 1111 gene locus_tag LOCUS_10690 1860 1111 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_10690 4348 1862 gene locus_tag LOCUS_10700 4348 1862 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_10700 5299 4406 gene locus_tag LOCUS_10710 5299 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6205 5480 gene locus_tag LOCUS_10720 6205 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence0134 1400 546 gene locus_tag LOCUS_10730 1400 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2409 3599 gene locus_tag LOCUS_10740 2409 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3892 5268 gene locus_tag LOCUS_10750 3892 5268 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_10750 5539 6090 gene locus_tag LOCUS_10760 5539 6090 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0135 663 929 gene locus_tag LOCUS_10770 gene rpmB 663 929 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_10770 1017 1199 gene locus_tag LOCUS_10780 gene rpmG 1017 1199 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_10780 1346 1504 gene locus_tag LOCUS_10790 1346 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1781 2737 gene locus_tag LOCUS_10800 gene ftsY 1781 2737 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_10800 3067 4434 gene locus_tag LOCUS_10810 3067 4434 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_10810 4578 5372 gene locus_tag LOCUS_10820 4578 5372 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_10820 5459 5704 gene locus_tag LOCUS_10830 5459 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5707 6192 gene locus_tag LOCUS_10840 5707 6192 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249869.1 protein_id gnl|my_center|LOCUS_10840 6278 6577 gene locus_tag LOCUS_10850 6278 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence0136 861 1313 gene locus_tag LOCUS_10860 861 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2400 1315 gene locus_tag LOCUS_10870 2400 1315 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_10870 3152 2517 gene locus_tag LOCUS_10880 3152 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4746 3349 gene locus_tag LOCUS_10890 4746 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5166 5363 gene locus_tag LOCUS_10900 5166 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6431 5478 gene locus_tag LOCUS_10910 gene queG 6431 5478 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_10910 >Feature sequence0137 2171 1239 gene locus_tag LOCUS_10920 2171 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10920 4108 2435 gene locus_tag LOCUS_10930 gene gatA 4108 2435 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_10930 4757 4146 gene locus_tag LOCUS_10940 4757 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_10940 5536 4808 gene locus_tag LOCUS_10950 5536 4808 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0138 102 635 gene locus_tag LOCUS_10960 102 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 659 2434 gene locus_tag LOCUS_10970 659 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4394 2511 gene locus_tag LOCUS_10980 4394 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_10980 4579 5022 gene locus_tag LOCUS_10990 4579 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 5607 5029 gene locus_tag LOCUS_11000 5607 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170923.1 protein_id gnl|my_center|LOCUS_11000 6174 5788 gene locus_tag LOCUS_11010 6174 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence0139 737 96 gene locus_tag LOCUS_11020 737 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1790 837 gene locus_tag LOCUS_11030 1790 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2011 3003 gene locus_tag LOCUS_11040 2011 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4260 3007 gene locus_tag LOCUS_11050 4260 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4444 4785 gene locus_tag LOCUS_11060 4444 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4865 5776 gene locus_tag LOCUS_11070 gene kcnb2 4865 5776 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_11070 5794 6663 gene locus_tag LOCUS_11080 5794 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence0140 243 689 gene locus_tag LOCUS_11090 243 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 703 1512 gene locus_tag LOCUS_11100 703 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2099 1557 gene locus_tag LOCUS_11110 2099 1557 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_11110 3190 2279 gene locus_tag LOCUS_11120 gene ykuF 3190 2279 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_11120 4098 3379 gene locus_tag LOCUS_11130 4098 3379 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404628.1 protein_id gnl|my_center|LOCUS_11130 5764 4226 gene locus_tag LOCUS_11140 5764 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence0141 662 937 gene locus_tag LOCUS_11150 662 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 940 1458 gene locus_tag LOCUS_11160 940 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2175 1432 gene locus_tag LOCUS_11170 2175 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2640 3932 gene locus_tag LOCUS_11180 2640 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5994 3979 gene locus_tag LOCUS_11190 5994 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <6659 6138 gene locus_tag LOCUS_11200 <6659 6138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0Z9:pseudouridine synthase >Feature sequence0142 30 752 gene locus_tag LOCUS_11210 gene comB 30 752 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_11210 808 1581 gene locus_tag LOCUS_11220 gene truA 808 1581 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_11220 2021 1584 gene locus_tag LOCUS_11230 2021 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3340 2129 gene locus_tag LOCUS_11240 3340 2129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931892.1 protein_id gnl|my_center|LOCUS_11240 4015 3491 gene locus_tag LOCUS_11250 4015 3491 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0143 811 206 gene locus_tag LOCUS_11260 811 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1644 847 gene locus_tag LOCUS_11270 gene lpxA 1644 847 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_11270 2561 1854 gene locus_tag LOCUS_11280 2561 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3413 2781 gene locus_tag LOCUS_11290 3413 2781 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_11290 3657 4454 gene locus_tag LOCUS_11300 3657 4454 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_11300 5557 4535 gene locus_tag LOCUS_11310 5557 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence0144 1658 1209 gene locus_tag LOCUS_11320 1658 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2590 1619 gene locus_tag LOCUS_11330 2590 1619 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_11330 4712 3141 gene locus_tag LOCUS_11340 4712 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5043 4789 gene locus_tag LOCUS_11350 5043 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5320 5036 gene locus_tag LOCUS_11360 5320 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5716 5477 gene locus_tag LOCUS_11370 5716 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5924 5679 gene locus_tag LOCUS_11380 5924 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6103 5921 gene locus_tag LOCUS_11390 6103 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6492 6319 gene locus_tag LOCUS_11400 6492 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0145 259 1554 gene locus_tag LOCUS_11410 259 1554 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_11410 2223 1555 gene locus_tag LOCUS_11420 2223 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2674 2231 gene locus_tag LOCUS_11430 2674 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3328 2696 gene locus_tag LOCUS_11440 3328 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_11440 4562 3483 gene locus_tag LOCUS_11450 gene phbC 4562 3483 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_11450 6227 4773 gene locus_tag LOCUS_11460 6227 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0146 1698 529 gene locus_tag LOCUS_11470 gene mccB 1698 529 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05394 protein_id gnl|my_center|LOCUS_11470 4430 1815 gene locus_tag LOCUS_11480 4430 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5358 4528 gene locus_tag LOCUS_11490 5358 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 <6608 5359 gene locus_tag LOCUS_11500 <6608 5359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846352.1:AAA family ATPase >Feature sequence0147 <1 932 gene locus_tag LOCUS_11510 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080773.1:sensor histidine kinase 1187 1441 gene locus_tag LOCUS_11520 1187 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1629 2948 gene locus_tag LOCUS_11530 1629 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3902 2958 gene locus_tag LOCUS_11540 3902 2958 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_11540 4818 3853 gene locus_tag LOCUS_11550 4818 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6184 4820 gene locus_tag LOCUS_11560 gene hemG 6184 4820 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881319.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence0148 994 1920 gene locus_tag LOCUS_11570 994 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2828 2214 gene locus_tag LOCUS_11580 gene ctaE 2828 2214 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_11580 3831 2884 gene locus_tag LOCUS_11590 gene ctaB 3831 2884 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_11590 4919 3855 gene locus_tag LOCUS_11600 4919 3855 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064815.1 protein_id gnl|my_center|LOCUS_11600 6092 5145 gene locus_tag LOCUS_11610 6092 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 <6595 6079 gene locus_tag LOCUS_11620 <6595 6079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1I7:cytosine-specific methyltransferase >Feature sequence0149 478 3117 gene locus_tag LOCUS_11630 478 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3864 3106 gene locus_tag LOCUS_11640 3864 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4300 3854 gene locus_tag LOCUS_11650 4300 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4477 4794 gene locus_tag LOCUS_11660 4477 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4901 5944 gene locus_tag LOCUS_11670 4901 5944 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence0150 656 1810 gene locus_tag LOCUS_11680 656 1810 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_11680 3974 1896 gene locus_tag LOCUS_11690 3974 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4819 4220 gene locus_tag LOCUS_11700 4819 4220 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0151 665 318 gene locus_tag LOCUS_11710 665 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2978 708 gene locus_tag LOCUS_11720 2978 708 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_11720 3536 3102 gene locus_tag LOCUS_11730 3536 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3795 4634 gene locus_tag LOCUS_11740 gene terC 3795 4634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_11740 4720 5766 gene locus_tag LOCUS_11750 4720 5766 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_11750 6434 5790 gene locus_tag LOCUS_11760 6434 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0152 2669 1299 gene locus_tag LOCUS_11770 2669 1299 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_11770 3530 4855 gene locus_tag LOCUS_11780 gene cysD 3530 4855 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_11780 5052 5513 gene locus_tag LOCUS_11790 5052 5513 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence0153 3977 2508 gene locus_tag LOCUS_11800 3977 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4449 4042 gene locus_tag LOCUS_11810 4449 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5939 4584 gene locus_tag LOCUS_11820 5939 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence0154 <1 683 gene locus_tag LOCUS_11830 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31820:thioredoxin-like protein YneN 770 1804 gene locus_tag LOCUS_11840 770 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_11840 4143 1900 gene locus_tag LOCUS_11850 gene katG 4143 1900 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C4 protein_id gnl|my_center|LOCUS_11850 4430 5473 gene locus_tag LOCUS_11860 4430 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_11860 6026 5520 gene locus_tag LOCUS_11870 6026 5520 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0155 411 2162 gene locus_tag LOCUS_11880 411 2162 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_11880 2258 3013 gene locus_tag LOCUS_11890 2258 3013 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_11890 5273 3075 gene locus_tag LOCUS_11900 5273 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence0156 2928 1534 gene locus_tag LOCUS_11910 gene tilS 2928 1534 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_11910 3573 2974 gene locus_tag LOCUS_11920 3573 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3789 5174 gene locus_tag LOCUS_11930 3789 5174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443134.1 protein_id gnl|my_center|LOCUS_11930 5406 6452 gene locus_tag LOCUS_11940 5406 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0157 37 1926 gene locus_tag LOCUS_11950 37 1926 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_11950 2032 3114 gene locus_tag LOCUS_11960 gene aroC 2032 3114 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_11960 3289 5370 gene locus_tag LOCUS_11970 3289 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5766 5419 gene locus_tag LOCUS_11980 gene panD 5766 5419 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0158 1453 380 gene locus_tag LOCUS_11990 1453 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1790 2584 gene locus_tag LOCUS_12000 1790 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2610 3377 gene locus_tag LOCUS_12010 2610 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 5370 3436 gene locus_tag LOCUS_12020 5370 3436 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_12020 5729 5484 gene locus_tag LOCUS_12030 5729 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 <6328 5744 gene locus_tag LOCUS_12040 <6328 5744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27643:stage V sporulation protein K >Feature sequence0159 1532 603 gene locus_tag LOCUS_12050 1532 603 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_12050 1798 2496 gene locus_tag LOCUS_12060 1798 2496 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_12060 4113 2641 gene locus_tag LOCUS_12070 4113 2641 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_12070 5282 4161 gene locus_tag LOCUS_12080 5282 4161 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0160 2548 839 gene locus_tag LOCUS_12090 2548 839 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_12090 3720 2815 gene locus_tag LOCUS_12100 3720 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_12100 4854 3832 gene locus_tag LOCUS_12110 4854 3832 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5W3 protein_id gnl|my_center|LOCUS_12110 5060 6085 gene locus_tag LOCUS_12120 gene fni 5060 6085 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0161 567 169 gene locus_tag LOCUS_12130 567 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_12130 2844 718 gene locus_tag LOCUS_12140 2844 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4405 3107 gene locus_tag LOCUS_12150 gene rocD 4405 3107 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0162 268 828 gene locus_tag LOCUS_12160 268 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1013 2260 gene locus_tag LOCUS_12170 1013 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2703 3836 gene locus_tag LOCUS_12180 2703 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4191 3943 gene locus_tag LOCUS_12190 4191 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4309 5397 gene locus_tag LOCUS_12200 4309 5397 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_12200 5872 5417 gene locus_tag LOCUS_12210 5872 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence0163 <1 900 gene locus_tag LOCUS_12220 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW2:uroporphyrinogen decarboxylase 904 1299 gene locus_tag LOCUS_12230 904 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2031 1342 gene locus_tag LOCUS_12240 2031 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2772 2245 gene locus_tag LOCUS_12250 2772 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3654 3106 gene locus_tag LOCUS_12260 3654 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3770 4429 gene locus_tag LOCUS_12270 gene trmB 3770 4429 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0164 1393 2280 gene locus_tag LOCUS_12280 gene sucD 1393 2280 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_12280 4296 2359 gene locus_tag LOCUS_12290 4296 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5532 4576 gene locus_tag LOCUS_12300 5532 4576 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_12300 >Feature sequence0165 534 1967 gene locus_tag LOCUS_12310 gene mnmE 534 1967 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_12310 3159 2104 gene locus_tag LOCUS_12320 3159 2104 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_12320 3929 3327 gene locus_tag LOCUS_12330 3929 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4172 5491 gene locus_tag LOCUS_12340 gene natB 4172 5491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0166 2117 2581 gene locus_tag LOCUS_12350 2117 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4047 2917 gene locus_tag LOCUS_12360 4047 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5244 4162 gene locus_tag LOCUS_12370 5244 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5950 5522 gene locus_tag LOCUS_12380 5950 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence0167 <1 901 gene locus_tag LOCUS_12390 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963079.1:hemolysin D 1004 4198 gene locus_tag LOCUS_12400 1004 4198 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_12400 4287 5738 gene locus_tag LOCUS_12410 4287 5738 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0168 37 480 gene locus_tag LOCUS_12420 37 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 506 748 gene locus_tag LOCUS_12430 506 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 786 1205 gene locus_tag LOCUS_12440 786 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2218 1214 gene locus_tag LOCUS_12450 2218 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2249 2803 gene locus_tag LOCUS_12460 gene ruvC 2249 2803 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_12460 3675 2875 gene locus_tag LOCUS_12470 3675 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3891 4682 gene locus_tag LOCUS_12480 3891 4682 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0169 971 5194 gene locus_tag LOCUS_12490 971 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5337 5867 gene locus_tag LOCUS_12500 gene ppa 5337 5867 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0170 471 1268 gene locus_tag LOCUS_12510 471 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1276 2073 gene locus_tag LOCUS_12520 1276 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2152 3384 gene locus_tag LOCUS_12530 2152 3384 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_12530 3876 4196 gene locus_tag LOCUS_12540 3876 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4321 4563 gene locus_tag LOCUS_12550 gene acpP 4321 4563 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_12550 4839 6098 gene locus_tag LOCUS_12560 4839 6098 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E7 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0171 1377 448 gene locus_tag LOCUS_12570 1377 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1921 1574 gene locus_tag LOCUS_12580 1921 1574 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_12580 3420 2005 gene locus_tag LOCUS_12590 3420 2005 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_12590 4246 3566 gene locus_tag LOCUS_12600 4246 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4639 6000 gene locus_tag LOCUS_12610 4639 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0172 <1 2592 gene locus_tag LOCUS_12620 <1 2592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558138.1:PAS domain-containing sensor histidine kinase >Feature sequence0173 753 49 gene locus_tag LOCUS_12630 753 49 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_12630 1494 835 gene locus_tag LOCUS_12640 1494 835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_12640 2796 1546 gene locus_tag LOCUS_12650 gene hemA 2796 1546 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_12650 3288 2815 gene locus_tag LOCUS_12660 gene ccoH 3288 2815 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_12660 4858 3401 gene locus_tag LOCUS_12670 gene ccoG 4858 3401 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_12670 5942 5049 gene locus_tag LOCUS_12680 gene ccoP 5942 5049 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence0174 197 778 gene locus_tag LOCUS_12690 197 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1179 2225 gene locus_tag LOCUS_12700 gene cobT 1179 2225 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_12700 2312 2761 gene locus_tag LOCUS_12710 2312 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2784 3110 gene locus_tag LOCUS_12720 2784 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3556 3161 gene locus_tag LOCUS_12730 3556 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3852 5780 gene locus_tag LOCUS_12740 3852 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6106 5777 gene locus_tag LOCUS_12750 6106 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence0175 1766 471 gene locus_tag LOCUS_12760 1766 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2779 1967 gene locus_tag LOCUS_12770 2779 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4109 3183 gene locus_tag LOCUS_12780 4109 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5136 4261 gene locus_tag LOCUS_12790 gene rimK 5136 4261 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_12790 5879 5271 gene locus_tag LOCUS_12800 5879 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence0176 1849 557 gene locus_tag LOCUS_12810 1849 557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109422.1 protein_id gnl|my_center|LOCUS_12810 2008 2913 gene locus_tag LOCUS_12820 2008 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_12820 4877 2997 gene locus_tag LOCUS_12830 gene pepN 4877 2997 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0177 591 1514 gene locus_tag LOCUS_12840 gene rsmH 591 1514 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_12840 3680 1614 gene locus_tag LOCUS_12850 3680 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4281 5813 gene locus_tag LOCUS_12860 4281 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence0178 1552 572 gene locus_tag LOCUS_12870 gene corA 1552 572 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 protein_id gnl|my_center|LOCUS_12870 2356 1613 gene locus_tag LOCUS_12880 2356 1613 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_12880 2552 2926 gene locus_tag LOCUS_12890 2552 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4916 3000 gene locus_tag LOCUS_12900 4916 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5319 5020 gene locus_tag LOCUS_12910 5319 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5222 5497 gene locus_tag LOCUS_12920 5222 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence0179 301 2685 gene locus_tag LOCUS_12930 301 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3409 2963 gene locus_tag LOCUS_12940 3409 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4362 3406 gene locus_tag LOCUS_12950 4362 3406 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_12950 5508 4456 gene locus_tag LOCUS_12960 5508 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence0180 783 1241 gene locus_tag LOCUS_12970 783 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4075 1334 gene locus_tag LOCUS_12980 4075 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4432 5187 gene locus_tag LOCUS_12990 4432 5187 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_12990 <5966 5323 gene locus_tag LOCUS_13000 <5966 5323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E005:threonylcarbamoyl-AMP synthase >Feature sequence0181 1057 644 gene locus_tag LOCUS_13010 1057 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2034 1195 gene locus_tag LOCUS_13020 2034 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2249 3466 gene locus_tag LOCUS_13030 2249 3466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence0182 1931 252 gene locus_tag LOCUS_13040 1931 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_13040 2422 3603 gene locus_tag LOCUS_13050 2422 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5448 3760 gene locus_tag LOCUS_13060 5448 3760 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence0183 485 198 gene locus_tag LOCUS_13070 485 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963064.1 protein_id gnl|my_center|LOCUS_13070 1112 690 gene locus_tag LOCUS_13080 1112 690 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_13080 3135 1132 gene locus_tag LOCUS_13090 3135 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3949 3227 gene locus_tag LOCUS_13100 3949 3227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_13100 4846 3968 gene locus_tag LOCUS_13110 4846 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0184 744 1478 gene locus_tag LOCUS_13120 744 1478 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_13120 1522 2502 gene locus_tag LOCUS_13130 gene fbp 1522 2502 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_13130 2643 3482 gene locus_tag LOCUS_13140 2643 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3517 4206 gene locus_tag LOCUS_13150 3517 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0185 3092 1698 gene locus_tag LOCUS_13160 3092 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3859 3206 gene locus_tag LOCUS_13170 gene lolD 3859 3206 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_13170 4313 5125 gene locus_tag LOCUS_13180 4313 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5564 5151 gene locus_tag LOCUS_13190 5564 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763744.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence0186 1051 185 gene locus_tag LOCUS_13200 1051 185 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_13200 1843 1304 gene locus_tag LOCUS_13210 gene rpsP 1843 1304 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ15 protein_id gnl|my_center|LOCUS_13210 2554 1949 gene locus_tag LOCUS_13220 2554 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4053 2806 gene locus_tag LOCUS_13230 4053 2806 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_13230 4785 4162 gene locus_tag LOCUS_13240 4785 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0187 446 1726 gene locus_tag LOCUS_13250 446 1726 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_13250 3718 1832 gene locus_tag LOCUS_13260 3718 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4852 4082 gene locus_tag LOCUS_13270 4852 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4940 5389 gene locus_tag LOCUS_13280 4940 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0188 290 1153 gene locus_tag LOCUS_13290 290 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2467 1205 gene locus_tag LOCUS_13300 gene putA 2467 1205 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_13300 3603 2509 gene locus_tag LOCUS_13310 3603 2509 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_13310 4087 4815 gene locus_tag LOCUS_13320 4087 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5001 5837 gene locus_tag LOCUS_13330 5001 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0189 >Feature sequence0190 <1 662 gene locus_tag LOCUS_13340 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678718.1:zinc ABC transporter ATP-binding protein 1491 679 gene locus_tag LOCUS_13350 1491 679 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_13350 1859 1488 gene locus_tag LOCUS_13360 1859 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2057 3595 gene locus_tag LOCUS_13370 2057 3595 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_13370 3977 4579 gene locus_tag LOCUS_13380 3977 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5580 4876 gene locus_tag LOCUS_13390 5580 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0191 981 909 gene locus_tag LOCUS_t00070 981 909 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1187 1114 gene locus_tag LOCUS_t00080 1187 1114 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1391 1308 gene locus_tag LOCUS_t00090 1391 1308 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2008 1682 gene locus_tag LOCUS_13400 2008 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3643 2354 gene locus_tag LOCUS_13410 3643 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_13410 3828 4415 gene locus_tag LOCUS_13420 3828 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4482 4907 gene locus_tag LOCUS_13430 4482 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 <5856 4932 gene locus_tag LOCUS_13440 <5856 4932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760322.1:glycosyl transferase >Feature sequence0192 283 110 gene locus_tag LOCUS_13450 283 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1119 265 gene locus_tag LOCUS_13460 1119 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1548 1183 gene locus_tag LOCUS_13470 gene ssb-1 1548 1183 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B90 protein_id gnl|my_center|LOCUS_13470 3476 1602 gene locus_tag LOCUS_13480 3476 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5853 3487 gene locus_tag LOCUS_13490 gene metH1 5853 3487 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550945.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence0193 1898 513 gene locus_tag LOCUS_13500 gene murD 1898 513 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_13500 2159 3553 gene locus_tag LOCUS_13510 2159 3553 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_13510 3829 5508 gene locus_tag LOCUS_13520 3829 5508 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence0194 2039 552 gene locus_tag LOCUS_13530 2039 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2853 2119 gene locus_tag LOCUS_13540 2853 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3668 2910 gene locus_tag LOCUS_13550 3668 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4098 4604 gene locus_tag LOCUS_13560 4098 4604 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531034.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0195 786 1247 gene locus_tag LOCUS_13570 786 1247 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_13570 1607 4990 gene locus_tag LOCUS_13580 1607 4990 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_13580 5019 5459 gene locus_tag LOCUS_13590 5019 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence0196 555 2657 gene locus_tag LOCUS_13600 555 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2859 4229 gene locus_tag LOCUS_13610 2859 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5135 4239 gene locus_tag LOCUS_13620 5135 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5422 5264 gene locus_tag LOCUS_13630 5422 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence0197 1630 1037 gene locus_tag LOCUS_13640 1630 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1831 3558 gene locus_tag LOCUS_13650 gene ggt 1831 3558 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_13650 4143 3748 gene locus_tag LOCUS_13660 4143 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5054 5644 gene locus_tag LOCUS_13670 5054 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence0198 163 879 gene locus_tag LOCUS_13680 163 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1139 2080 gene locus_tag LOCUS_13690 gene mdh 1139 2080 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_13690 2217 2840 gene locus_tag LOCUS_13700 2217 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2821 3243 gene locus_tag LOCUS_13710 2821 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3244 4254 gene locus_tag LOCUS_13720 3244 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4996 4262 gene locus_tag LOCUS_13730 4996 4262 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_13730 <5817 5052 gene locus_tag LOCUS_13740 <5817 5052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083804.1:transcriptional regulator >Feature sequence0199 <1 1717 gene locus_tag LOCUS_13750 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 1805 4486 gene locus_tag LOCUS_13760 1805 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5374 4568 gene locus_tag LOCUS_13770 5374 4568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0200 263 1354 gene locus_tag LOCUS_13780 263 1354 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964071.1 protein_id gnl|my_center|LOCUS_13780 1568 2464 gene locus_tag LOCUS_13790 gene coaX 1568 2464 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_13790 2544 3770 gene locus_tag LOCUS_13800 2544 3770 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_13800 4758 3814 gene locus_tag LOCUS_13810 gene dcyD 4758 3814 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_13810 4881 5297 gene locus_tag LOCUS_13820 4881 5297 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence0201 714 2090 gene locus_tag LOCUS_13830 714 2090 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_13830 2348 3256 gene locus_tag LOCUS_13840 2348 3256 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_13840 3417 4526 gene locus_tag LOCUS_13850 gene carA 3417 4526 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0202 1052 462 gene locus_tag LOCUS_13860 1052 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1628 1068 gene locus_tag LOCUS_13870 1628 1068 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_13870 2353 1739 gene locus_tag LOCUS_13880 2353 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2722 2468 gene locus_tag LOCUS_13890 2722 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3792 2941 gene locus_tag LOCUS_13900 3792 2941 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_13900 4461 3955 gene locus_tag LOCUS_13910 4461 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4664 5608 gene locus_tag LOCUS_13920 4664 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence0203 176 1390 gene locus_tag LOCUS_13930 176 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3297 1618 gene locus_tag LOCUS_13940 3297 1618 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_13940 3864 4298 gene locus_tag LOCUS_13950 3864 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4379 4855 gene locus_tag LOCUS_13960 4379 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 5150 5533 gene locus_tag LOCUS_13970 5150 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0204 1891 5043 gene locus_tag LOCUS_13980 1891 5043 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_13980 5584 5168 gene locus_tag LOCUS_13990 gene mscL 5584 5168 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P626 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0205 <1 668 gene locus_tag LOCUS_14000 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001097653.1:histidine kinase 780 1178 gene locus_tag LOCUS_14010 780 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1429 3228 gene locus_tag LOCUS_14020 1429 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3221 4981 gene locus_tag LOCUS_14030 3221 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0206 573 1766 gene locus_tag LOCUS_14040 573 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3389 1791 gene locus_tag LOCUS_14050 3389 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4561 3653 gene locus_tag LOCUS_14060 gene ftsX 4561 3653 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0207 910 2367 gene locus_tag LOCUS_14070 910 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2751 3434 gene locus_tag LOCUS_14080 2751 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4617 3607 gene locus_tag LOCUS_14090 4617 3607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_14090 <5694 4875 gene locus_tag LOCUS_14100 <5694 4875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405472.1:hydroxyglutarate oxidase >Feature sequence0208 <1 543 gene locus_tag LOCUS_14110 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888792.1:protein-tyrosine-phosphatase 1459 545 gene locus_tag LOCUS_14120 1459 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2931 1813 gene locus_tag LOCUS_14130 gene aroB 2931 1813 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_14130 5089 2963 gene locus_tag LOCUS_14140 5089 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0209 1938 1192 gene locus_tag LOCUS_14150 1938 1192 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_14150 2777 2169 gene locus_tag LOCUS_14160 2777 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3422 2907 gene locus_tag LOCUS_14170 3422 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404581.1 protein_id gnl|my_center|LOCUS_14170 3988 3485 gene locus_tag LOCUS_14180 3988 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 <5676 4163 gene locus_tag LOCUS_14190 <5676 4163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931958.1:outer membrane protein assembly factor BamA >Feature sequence0210 54 1157 gene locus_tag LOCUS_14200 54 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1199 1570 gene locus_tag LOCUS_14210 1199 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1687 4035 gene locus_tag LOCUS_14220 gene mrcA 1687 4035 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence0211 384 2450 gene locus_tag LOCUS_14230 384 2450 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_14230 2562 3167 gene locus_tag LOCUS_14240 2562 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3697 3197 gene locus_tag LOCUS_14250 3697 3197 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_14250 3802 4635 gene locus_tag LOCUS_14260 3802 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5188 4703 gene locus_tag LOCUS_14270 5188 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0212 2086 1799 gene locus_tag LOCUS_14280 2086 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3492 2224 gene locus_tag LOCUS_14290 3492 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4286 4843 gene locus_tag LOCUS_14300 4286 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5107 4922 gene locus_tag LOCUS_14310 5107 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0213 1554 898 gene locus_tag LOCUS_14320 gene trpF 1554 898 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_14320 2001 1696 gene locus_tag LOCUS_14330 2001 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2241 2026 gene locus_tag LOCUS_14340 2241 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3963 2248 gene locus_tag LOCUS_14350 3963 2248 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_14350 4546 4172 gene locus_tag LOCUS_14360 4546 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941748.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0214 952 2136 gene locus_tag LOCUS_14370 952 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4011 2194 gene locus_tag LOCUS_14380 4011 2194 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_14380 4892 4245 gene locus_tag LOCUS_14390 4892 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14390 <5552 4929 gene locus_tag LOCUS_14400 <5552 4929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114327.1:hybrid sensor histidine kinase/response regulator >Feature sequence0215 1137 463 gene locus_tag LOCUS_14410 1137 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1596 2453 gene locus_tag LOCUS_14420 1596 2453 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202571.1 protein_id gnl|my_center|LOCUS_14420 2925 2533 gene locus_tag LOCUS_14430 2925 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3081 3539 gene locus_tag LOCUS_14440 3081 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3610 3945 gene locus_tag LOCUS_14450 3610 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5201 4479 gene locus_tag LOCUS_14460 5201 4479 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence0216 1977 1129 gene locus_tag LOCUS_14470 1977 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5332 1970 gene locus_tag LOCUS_14480 5332 1970 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0217 563 2065 gene locus_tag LOCUS_14490 563 2065 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_14490 2052 2441 gene locus_tag LOCUS_14500 2052 2441 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_14500 2548 2952 gene locus_tag LOCUS_14510 2548 2952 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_14510 3036 3440 gene locus_tag LOCUS_14520 3036 3440 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_14520 4419 3442 gene locus_tag LOCUS_14530 4419 3442 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143760.1 protein_id gnl|my_center|LOCUS_14530 4865 4650 gene locus_tag LOCUS_14540 4865 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 <5538 5029 gene locus_tag LOCUS_14550 <5538 5029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:multidrug transporter AcrB >Feature sequence0218 1909 1040 gene locus_tag LOCUS_14560 gene prmC 1909 1040 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_14560 2712 1924 gene locus_tag LOCUS_14570 gene map 2712 1924 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_14570 4255 2915 gene locus_tag LOCUS_14580 gene secY 4255 2915 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_14580 4844 4398 gene locus_tag LOCUS_14590 gene rplO 4844 4398 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_14590 5293 5114 gene locus_tag LOCUS_14600 gene rpmD 5293 5114 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0219 136 2337 gene locus_tag LOCUS_14610 136 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3735 2341 gene locus_tag LOCUS_14620 3735 2341 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_14620 <5531 3975 gene locus_tag LOCUS_14630 <5531 3975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947391.1:penicillin-binding protein 1C >Feature sequence0220 63 251 gene locus_tag LOCUS_14640 63 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 160 465 gene locus_tag LOCUS_14650 160 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 446 733 gene locus_tag LOCUS_14660 446 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 762 1046 gene locus_tag LOCUS_14670 762 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1073 1771 gene locus_tag LOCUS_14680 1073 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2281 2844 gene locus_tag LOCUS_14690 2281 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3121 3291 gene locus_tag LOCUS_14700 3121 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence0221 794 375 gene locus_tag LOCUS_14710 794 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2107 1271 gene locus_tag LOCUS_14720 gene surE 2107 1271 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_14720 3061 2189 gene locus_tag LOCUS_14730 3061 2189 CDS product Ndr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_14730 3154 3786 gene locus_tag LOCUS_14740 3154 3786 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_14740 4674 3823 gene locus_tag LOCUS_14750 4674 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 <5495 4773 gene locus_tag LOCUS_14760 <5495 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797826.1:WYL domain-containing protein >Feature sequence0222 1309 362 gene locus_tag LOCUS_14770 gene ltd 1309 362 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_14770 2213 1458 gene locus_tag LOCUS_14780 2213 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2740 2267 gene locus_tag LOCUS_14790 2740 2267 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_14790 3548 2802 gene locus_tag LOCUS_14800 3548 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4541 3708 gene locus_tag LOCUS_14810 gene mscS 4541 3708 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence0223 187 939 gene locus_tag LOCUS_14820 187 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1304 4069 gene locus_tag LOCUS_14830 1304 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4665 4066 gene locus_tag LOCUS_14840 gene tesA 4665 4066 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576212.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence0224 5040 1756 gene locus_tag LOCUS_14850 5040 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence0225 2763 37 gene locus_tag LOCUS_14860 2763 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3263 2988 gene locus_tag LOCUS_14870 3263 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4191 3268 gene locus_tag LOCUS_14880 gene gldA 4191 3268 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_14880 4297 4629 gene locus_tag LOCUS_14890 4297 4629 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_14890 5337 4636 gene locus_tag LOCUS_14900 5337 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence0226 1923 880 gene locus_tag LOCUS_14910 1923 880 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_14910 2925 2047 gene locus_tag LOCUS_14920 2925 2047 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_14920 3173 3748 gene locus_tag LOCUS_14930 gene gmk 3173 3748 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_14930 3761 4333 gene locus_tag LOCUS_14940 gene nadD 3761 4333 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_14940 >Feature sequence0227 1425 217 gene locus_tag LOCUS_14950 gene gltP 1425 217 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_14950 1863 2288 gene locus_tag LOCUS_14960 1863 2288 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_14960 2518 4068 gene locus_tag LOCUS_14970 gene purH 2518 4068 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_14970 4250 5122 gene locus_tag LOCUS_14980 gene rmlD 4250 5122 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence0228 444 46 gene locus_tag LOCUS_14990 444 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1393 617 gene locus_tag LOCUS_15000 1393 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2258 1554 gene locus_tag LOCUS_15010 2258 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2724 2984 gene locus_tag LOCUS_15020 2724 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3039 3557 gene locus_tag LOCUS_15030 gene pyrR2 3039 3557 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence0229 1656 1991 gene locus_tag LOCUS_15040 gene gldC 1656 1991 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_15040 2049 4148 gene locus_tag LOCUS_15050 2049 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4412 4236 gene locus_tag LOCUS_15060 4412 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence0230 631 107 gene locus_tag LOCUS_15070 631 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_15070 2603 687 gene locus_tag LOCUS_15080 2603 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2860 3369 gene locus_tag LOCUS_15090 2860 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_15090 3498 4991 gene locus_tag LOCUS_15100 3498 4991 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence0231 683 1105 gene locus_tag LOCUS_15110 683 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1531 1163 gene locus_tag LOCUS_15120 gene folA 1531 1163 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUG0 protein_id gnl|my_center|LOCUS_15120 1757 4915 gene locus_tag LOCUS_15130 1757 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5123 5326 gene locus_tag LOCUS_15140 5123 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0232 344 937 gene locus_tag LOCUS_15150 344 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1013 1435 gene locus_tag LOCUS_15160 1013 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1736 2020 gene locus_tag LOCUS_15170 1736 2020 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_15170 3191 2082 gene locus_tag LOCUS_15180 gene mauG 3191 2082 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_15180 3320 3520 gene locus_tag LOCUS_15190 3320 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4295 4981 gene locus_tag LOCUS_15200 4295 4981 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence0233 936 2924 gene locus_tag LOCUS_15210 936 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3141 3320 gene locus_tag LOCUS_15220 3141 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3716 3390 gene locus_tag LOCUS_15230 3716 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4772 3855 gene locus_tag LOCUS_15240 4772 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 <5344 4763 gene locus_tag LOCUS_15250 <5344 4763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947316.1:thioredoxin family protein >Feature sequence0234 1291 968 gene locus_tag LOCUS_15260 1291 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_15260 1444 2823 gene locus_tag LOCUS_15270 1444 2823 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_15270 2842 3636 gene locus_tag LOCUS_15280 2842 3636 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_15280 3714 5096 gene locus_tag LOCUS_15290 3714 5096 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_15290 5167 5241 gene locus_tag LOCUS_t00100 5167 5241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0235 791 375 gene locus_tag LOCUS_15300 gene fadM 791 375 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77712 protein_id gnl|my_center|LOCUS_15300 1586 846 gene locus_tag LOCUS_15310 1586 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3287 1698 gene locus_tag LOCUS_15320 3287 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 <5325 3639 gene locus_tag LOCUS_15330 <5325 3639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence0236 <1 538 gene locus_tag LOCUS_15340 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920731.1:methyltransferase 600 1178 gene locus_tag LOCUS_15350 600 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1168 2337 gene locus_tag LOCUS_15360 gene bioF 1168 2337 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_15360 2754 2455 gene locus_tag LOCUS_15370 2754 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 <5322 2933 gene locus_tag LOCUS_15380 <5322 2933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943545.1:two-component sensor histidine kinase >Feature sequence0237 1265 765 gene locus_tag LOCUS_15390 1265 765 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_15390 1946 1566 gene locus_tag LOCUS_15400 1946 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963525.1 protein_id gnl|my_center|LOCUS_15400 2250 2957 gene locus_tag LOCUS_15410 2250 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2962 3678 gene locus_tag LOCUS_15420 2962 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3754 4461 gene locus_tag LOCUS_15430 3754 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0238 438 968 gene locus_tag LOCUS_15440 438 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_15440 1220 2881 gene locus_tag LOCUS_15450 1220 2881 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_15450 3404 2943 gene locus_tag LOCUS_15460 3404 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3801 5195 gene locus_tag LOCUS_15470 3801 5195 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence0239 1323 37 gene locus_tag LOCUS_15480 gene argH 1323 37 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_15480 2477 1416 gene locus_tag LOCUS_15490 2477 1416 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_15490 3253 2474 gene locus_tag LOCUS_15500 gene argB 3253 2474 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_15500 4306 3359 gene locus_tag LOCUS_15510 gene argF' 4306 3359 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_15510 <5234 4504 gene locus_tag LOCUS_15520 <5234 4504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YZ6:acetylornithine aminotransferase >Feature sequence0240 <1 1262 gene locus_tag LOCUS_15530 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790944.1:alkaline serine protease >Feature sequence0241 3053 2538 gene locus_tag LOCUS_15540 gene ribH 3053 2538 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_15540 3934 3158 gene locus_tag LOCUS_15550 3934 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 <5219 4103 gene locus_tag LOCUS_15560 <5219 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962253.1:serine--tRNA ligase >Feature sequence0242 587 69 gene locus_tag LOCUS_15570 587 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1360 824 gene locus_tag LOCUS_15580 gene dcd 1360 824 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_15580 1275 1514 gene locus_tag LOCUS_15590 1275 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2612 1533 gene locus_tag LOCUS_15600 gene ribD 2612 1533 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_15600 3854 2664 gene locus_tag LOCUS_15610 3854 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4006 4749 gene locus_tag LOCUS_15620 4006 4749 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_15620 4834 5001 gene locus_tag LOCUS_15630 4834 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0243 264 683 gene locus_tag LOCUS_15640 264 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 791 1159 gene locus_tag LOCUS_15650 791 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1204 1617 gene locus_tag LOCUS_15660 1204 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1626 2276 gene locus_tag LOCUS_15670 1626 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2277 2780 gene locus_tag LOCUS_15680 2277 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2788 3345 gene locus_tag LOCUS_15690 2788 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3317 5131 gene locus_tag LOCUS_15700 3317 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0244 2887 329 gene locus_tag LOCUS_15710 2887 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4364 3408 gene locus_tag LOCUS_15720 4364 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5015 4389 gene locus_tag LOCUS_15730 5015 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence0245 203 637 gene locus_tag LOCUS_15740 203 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2924 639 gene locus_tag LOCUS_15750 2924 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence0246 389 186 gene locus_tag LOCUS_15760 389 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1353 748 gene locus_tag LOCUS_15770 1353 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1781 1356 gene locus_tag LOCUS_15780 1781 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2246 1839 gene locus_tag LOCUS_15790 2246 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0247 1931 2494 gene locus_tag LOCUS_15800 1931 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2944 2558 gene locus_tag LOCUS_15810 2944 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_15810 3470 2958 gene locus_tag LOCUS_15820 3470 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_15820 4653 3769 gene locus_tag LOCUS_15830 4653 3769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0248 2222 1113 gene locus_tag LOCUS_15840 2222 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2949 2371 gene locus_tag LOCUS_15850 2949 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_15850 3427 3008 gene locus_tag LOCUS_15860 3427 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4539 3610 gene locus_tag LOCUS_15870 4539 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence0249 211 1182 gene locus_tag LOCUS_15880 gene tktC 211 1182 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_15880 1299 2291 gene locus_tag LOCUS_15890 1299 2291 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_15890 2518 3420 gene locus_tag LOCUS_15900 2518 3420 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_15900 4427 3495 gene locus_tag LOCUS_15910 4427 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0250 1554 589 gene locus_tag LOCUS_15920 1554 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1829 4024 gene locus_tag LOCUS_15930 1829 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4230 4051 gene locus_tag LOCUS_15940 4230 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4401 4231 gene locus_tag LOCUS_15950 4401 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0251 95 2302 gene locus_tag LOCUS_15960 95 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3337 2669 gene locus_tag LOCUS_15970 3337 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3994 3503 gene locus_tag LOCUS_15980 3994 3503 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_15980 4650 4243 gene locus_tag LOCUS_15990 4650 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0252 <1 1249 gene locus_tag LOCUS_16000 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404851.1:acetyltransferase 1253 1753 gene locus_tag LOCUS_16010 1253 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3566 2202 gene locus_tag LOCUS_16020 3566 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4045 4341 gene locus_tag LOCUS_16030 4045 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 4310 4897 gene locus_tag LOCUS_16040 4310 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0253 671 756 gene locus_tag LOCUS_t00110 671 756 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1953 805 gene locus_tag LOCUS_16050 1953 805 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_16050 2053 3075 gene locus_tag LOCUS_16060 gene ltaE 2053 3075 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_16060 3205 3711 gene locus_tag LOCUS_16070 3205 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0254 427 1020 gene locus_tag LOCUS_16080 427 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1136 2386 gene locus_tag LOCUS_16090 gene nusA 1136 2386 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_16090 >Feature sequence0255 1551 2303 gene locus_tag LOCUS_16100 gene rprY 1551 2303 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_16100 3072 2635 gene locus_tag LOCUS_16110 3072 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4662 3160 gene locus_tag LOCUS_16120 4662 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence0256 <1 677 gene locus_tag LOCUS_16130 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KBS6:chromosome partition protein Smc 695 1099 gene locus_tag LOCUS_16140 695 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1132 1830 gene locus_tag LOCUS_16150 1132 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1933 2616 gene locus_tag LOCUS_16160 1933 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3345 2779 gene locus_tag LOCUS_16170 3345 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3528 3695 gene locus_tag LOCUS_16180 3528 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3711 3953 gene locus_tag LOCUS_16190 3711 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0257 3350 129 gene locus_tag LOCUS_16200 3350 129 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_16200 4716 3559 gene locus_tag LOCUS_16210 4716 3559 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence0258 921 331 gene locus_tag LOCUS_16220 921 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2262 1081 gene locus_tag LOCUS_16230 2262 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2403 4754 gene locus_tag LOCUS_16240 2403 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0259 3751 3014 gene locus_tag LOCUS_16250 3751 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4577 3924 gene locus_tag LOCUS_16260 gene yvbH 4577 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32245 protein_id gnl|my_center|LOCUS_16260 >Feature sequence0260 <1 867 gene locus_tag LOCUS_16270 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889585.1:naringenin-chalcone synthase 1738 875 gene locus_tag LOCUS_16280 gene udp 1738 875 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_16280 1948 3045 gene locus_tag LOCUS_16290 1948 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_16290 3332 4849 gene locus_tag LOCUS_16300 3332 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0261 2068 2733 gene locus_tag LOCUS_16310 2068 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3478 2882 gene locus_tag LOCUS_16320 3478 2882 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_16320 4325 3549 gene locus_tag LOCUS_16330 gene phnP 4325 3549 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_16330 <5024 4404 gene locus_tag LOCUS_16340 <5024 4404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404072.1:peptidase S9 >Feature sequence0262 694 1749 gene locus_tag LOCUS_16350 694 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1983 2453 gene locus_tag LOCUS_16360 1983 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_16360 2426 2599 gene locus_tag LOCUS_16370 2426 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4552 3041 gene locus_tag LOCUS_16380 4552 3041 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence0263 1559 654 gene locus_tag LOCUS_16390 1559 654 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_16390 4525 1817 gene locus_tag LOCUS_16400 4525 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence0264 500 1225 gene locus_tag LOCUS_16410 gene menG 500 1225 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_16410 1212 2060 gene locus_tag LOCUS_16420 1212 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2273 2899 gene locus_tag LOCUS_16430 2273 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3163 3675 gene locus_tag LOCUS_16440 3163 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3856 4341 gene locus_tag LOCUS_16450 gene purE 3856 4341 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_16450 >Feature sequence0265 546 764 gene locus_tag LOCUS_16460 546 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1100 1026 gene locus_tag LOCUS_t00120 1100 1026 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1772 1425 gene locus_tag LOCUS_16470 1772 1425 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_16470 2087 3130 gene locus_tag LOCUS_16480 gene menC 2087 3130 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_16480 3132 3644 gene locus_tag LOCUS_16490 3132 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3701 4210 gene locus_tag LOCUS_16500 3701 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_16500 4833 4207 gene locus_tag LOCUS_16510 4833 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence0266 1238 333 gene locus_tag LOCUS_16520 1238 333 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R62 protein_id gnl|my_center|LOCUS_16520 3245 1431 gene locus_tag LOCUS_16530 3245 1431 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_16530 4590 3412 gene locus_tag LOCUS_16540 4590 3412 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence0267 1187 579 gene locus_tag LOCUS_16550 1187 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_16550 1409 1197 gene locus_tag LOCUS_16560 1409 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_16560 1562 2011 gene locus_tag LOCUS_16570 1562 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2662 2042 gene locus_tag LOCUS_16580 2662 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2661 2858 gene locus_tag LOCUS_16590 2661 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3867 3076 gene locus_tag LOCUS_16600 gene rpsC 3867 3076 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_16600 4325 3879 gene locus_tag LOCUS_16610 4325 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4655 4374 gene locus_tag LOCUS_16620 gene rpsS 4655 4374 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_16620 >Feature sequence0268 2359 1289 gene locus_tag LOCUS_16630 2359 1289 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_16630 2721 3977 gene locus_tag LOCUS_16640 2721 3977 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256627.1 protein_id gnl|my_center|LOCUS_16640 4077 4607 gene locus_tag LOCUS_16650 4077 4607 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0269 <1 1692 gene locus_tag LOCUS_16660 <1 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109412.1:histidine kinase 1710 2864 gene locus_tag LOCUS_16670 1710 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2845 3591 gene locus_tag LOCUS_16680 2845 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0270 450 2732 gene locus_tag LOCUS_16690 450 2732 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_16690 2943 4397 gene locus_tag LOCUS_16700 2943 4397 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_16700 <4961 4426 gene locus_tag LOCUS_16710 <4961 4426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766770.1:transcriptional regulator >Feature sequence0271 2755 1547 gene locus_tag LOCUS_16720 2755 1547 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 protein_id gnl|my_center|LOCUS_16720 4347 2755 gene locus_tag LOCUS_16730 gene hsdM 4347 2755 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_16730 4673 4425 gene locus_tag LOCUS_16740 4673 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0272 281 1597 gene locus_tag LOCUS_16750 281 1597 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118881.1 protein_id gnl|my_center|LOCUS_16750 1609 2643 gene locus_tag LOCUS_16760 1609 2643 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_16760 2640 3365 gene locus_tag LOCUS_16770 2640 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3389 4648 gene locus_tag LOCUS_16780 3389 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence0273 354 860 gene locus_tag LOCUS_16790 354 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 891 2735 gene locus_tag LOCUS_16800 gene aspS 891 2735 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_16800 2883 3098 gene locus_tag LOCUS_16810 2883 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3110 3535 gene locus_tag LOCUS_16820 3110 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4236 3613 gene locus_tag LOCUS_16830 4236 3613 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_16830 <4951 4388 gene locus_tag LOCUS_16840 <4951 4388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0274 526 20 gene locus_tag LOCUS_16850 526 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1265 537 gene locus_tag LOCUS_16860 1265 537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_16860 2108 1464 gene locus_tag LOCUS_16870 2108 1464 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_16870 2218 2760 gene locus_tag LOCUS_16880 2218 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3267 2821 gene locus_tag LOCUS_16890 3267 2821 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_16890 3524 3598 gene locus_tag LOCUS_t00130 3524 3598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3717 4763 gene locus_tag LOCUS_16900 3717 4763 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence0275 1573 2829 gene locus_tag LOCUS_16910 1573 2829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_16910 2983 3759 gene locus_tag LOCUS_16920 gene pcbD 2983 3759 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_16920 4124 4822 gene locus_tag LOCUS_16930 4124 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence0276 1821 118 gene locus_tag LOCUS_16940 1821 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2192 2818 gene locus_tag LOCUS_16950 gene ribE 2192 2818 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_16950 2919 3605 gene locus_tag LOCUS_16960 2919 3605 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_16960 3708 4277 gene locus_tag LOCUS_16970 3708 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence0277 1515 463 gene locus_tag LOCUS_16980 gene hemH 1515 463 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_16980 1715 2350 gene locus_tag LOCUS_16990 1715 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_16990 2876 2370 gene locus_tag LOCUS_17000 2876 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3285 2896 gene locus_tag LOCUS_17010 3285 2896 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_17010 3518 3291 gene locus_tag LOCUS_17020 3518 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 <4897 3593 gene locus_tag LOCUS_17030 <4897 3593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:ATP-dependent DNA helicase RecQ >Feature sequence0278 1149 1850 gene locus_tag LOCUS_17040 1149 1850 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_17040 2615 1854 gene locus_tag LOCUS_17050 2615 1854 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_17050 3672 2596 gene locus_tag LOCUS_17060 3672 2596 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_17060 4174 3683 gene locus_tag LOCUS_17070 4174 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0279 223 672 gene locus_tag LOCUS_17080 gene ybeY 223 672 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_17080 844 2139 gene locus_tag LOCUS_17090 844 2139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_17090 2922 2239 gene locus_tag LOCUS_17100 2922 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0280 203 1063 gene locus_tag LOCUS_17110 gene accD 203 1063 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_17110 1145 2923 gene locus_tag LOCUS_17120 1145 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3129 4859 gene locus_tag LOCUS_17130 3129 4859 CDS product sodium/hydrogen exchanger family/TrkA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0281 1810 1424 gene locus_tag LOCUS_17140 1810 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1916 2332 gene locus_tag LOCUS_17150 1916 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2319 3188 gene locus_tag LOCUS_17160 2319 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17160 >Feature sequence0282 2121 427 gene locus_tag LOCUS_17170 2121 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3200 2187 gene locus_tag LOCUS_17180 3200 2187 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_17180 4665 3466 gene locus_tag LOCUS_17190 4665 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence0283 684 373 gene locus_tag LOCUS_17200 684 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1651 2886 gene locus_tag LOCUS_17210 1651 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3122 4573 gene locus_tag LOCUS_17220 3122 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence0284 <1 1208 gene locus_tag LOCUS_17230 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYJ5:sulfate adenylyltransferase subunit 1 1864 1271 gene locus_tag LOCUS_17240 gene ppiA 1864 1271 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH4 protein_id gnl|my_center|LOCUS_17240 2053 2826 gene locus_tag LOCUS_17250 2053 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3715 2906 gene locus_tag LOCUS_17260 3715 2906 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_17260 3931 4473 gene locus_tag LOCUS_17270 3931 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4613 4540 gene locus_tag LOCUS_t00140 4613 4540 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4741 4657 gene locus_tag LOCUS_t00150 4741 4657 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0285 551 4732 gene locus_tag LOCUS_17280 551 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0286 1798 2721 gene locus_tag LOCUS_17290 1798 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2879 4216 gene locus_tag LOCUS_17300 2879 4216 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0287 2156 1101 gene locus_tag LOCUS_17310 gene rfaF 2156 1101 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_17310 2386 4155 gene locus_tag LOCUS_17320 2386 4155 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence0288 191 490 gene locus_tag LOCUS_17330 191 490 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_17330 1008 568 gene locus_tag LOCUS_17340 1008 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1669 1268 gene locus_tag LOCUS_17350 1669 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_17350 2780 1986 gene locus_tag LOCUS_17360 2780 1986 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_17360 <4774 2790 gene locus_tag LOCUS_17370 <4774 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0289 443 1393 gene locus_tag LOCUS_17380 443 1393 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_17380 1412 2749 gene locus_tag LOCUS_17390 1412 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2931 4166 gene locus_tag LOCUS_17400 2931 4166 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202365.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence0290 364 4581 gene locus_tag LOCUS_17410 364 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0291 1135 512 gene locus_tag LOCUS_17420 1135 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2237 1257 gene locus_tag LOCUS_17430 gene pdhB 2237 1257 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence0292 76 651 gene locus_tag LOCUS_17440 76 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 769 1254 gene locus_tag LOCUS_17450 769 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2105 1437 gene locus_tag LOCUS_17460 2105 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2663 2160 gene locus_tag LOCUS_17470 2663 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4559 2919 gene locus_tag LOCUS_17480 4559 2919 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0293 1255 35 gene locus_tag LOCUS_17490 1255 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1583 3724 gene locus_tag LOCUS_17500 1583 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4730 3816 gene locus_tag LOCUS_17510 4730 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17510 >Feature sequence0294 1367 153 gene locus_tag LOCUS_17520 gene sucC 1367 153 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_17520 1881 1537 gene locus_tag LOCUS_17530 gene fdx1 1881 1537 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_17530 2082 2633 gene locus_tag LOCUS_17540 gene guaA 2082 2633 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_17540 3550 2795 gene locus_tag LOCUS_17550 3550 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0295 173 1084 gene locus_tag LOCUS_17560 173 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3064 1166 gene locus_tag LOCUS_17570 3064 1166 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_17570 3705 4130 gene locus_tag LOCUS_17580 3705 4130 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0296 <1 1688 gene locus_tag LOCUS_17590 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814149.1:RNA degradosome polyphosphate kinase 1780 2187 gene locus_tag LOCUS_17600 1780 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2843 2190 gene locus_tag LOCUS_17610 2843 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3033 3845 gene locus_tag LOCUS_17620 3033 3845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_17620 3916 4488 gene locus_tag LOCUS_17630 3916 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0297 212 1312 gene locus_tag LOCUS_17640 212 1312 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_17640 1539 1928 gene locus_tag LOCUS_17650 1539 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1940 2665 gene locus_tag LOCUS_17660 1940 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0298 <1 881 gene locus_tag LOCUS_17670 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963881.1:aspartate aminotransferase family protein 2274 886 gene locus_tag LOCUS_17680 2274 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0299 1829 336 gene locus_tag LOCUS_17690 1829 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 3543 1795 gene locus_tag LOCUS_17700 3543 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4253 3759 gene locus_tag LOCUS_17710 4253 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0300 <1 1311 gene locus_tag LOCUS_17720 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000615086.1:cholesterol oxidase 1675 2766 gene locus_tag LOCUS_17730 1675 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0301 <1 832 gene locus_tag LOCUS_17740 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter 1229 1486 gene locus_tag LOCUS_17750 gene rpsT 1229 1486 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_17750 1596 3521 gene locus_tag LOCUS_17760 gene dxs 1596 3521 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0302 144 917 gene locus_tag LOCUS_17770 144 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 919 1671 gene locus_tag LOCUS_17780 919 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2236 2907 gene locus_tag LOCUS_17790 2236 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3405 2980 gene locus_tag LOCUS_17800 3405 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3588 4067 gene locus_tag LOCUS_17810 3588 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence0303 141 974 gene locus_tag LOCUS_17820 141 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1586 1131 gene locus_tag LOCUS_17830 1586 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2586 1786 gene locus_tag LOCUS_17840 2586 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2856 4316 gene locus_tag LOCUS_17850 gene glcD 2856 4316 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0304 <1 1780 gene locus_tag LOCUS_17860 <1 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 1868 2995 gene locus_tag LOCUS_17870 1868 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3458 4477 gene locus_tag LOCUS_17880 3458 4477 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence0305 <1 597 gene locus_tag LOCUS_17890 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963163.1:histidine kinase 688 1818 gene locus_tag LOCUS_17900 688 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1830 2609 gene locus_tag LOCUS_17910 1830 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2745 3674 gene locus_tag LOCUS_17920 gene fjo11 2745 3674 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0306 <1 656 gene locus_tag LOCUS_17930 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 1098 733 gene locus_tag LOCUS_17940 1098 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_17940 1434 3236 gene locus_tag LOCUS_17950 1434 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0307 1349 189 gene locus_tag LOCUS_17960 1349 189 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_17960 2161 1694 gene locus_tag LOCUS_17970 2161 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2367 2651 gene locus_tag LOCUS_17980 2367 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2620 2823 gene locus_tag LOCUS_17990 2620 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2823 3104 gene locus_tag LOCUS_18000 2823 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3349 4212 gene locus_tag LOCUS_18010 3349 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence0308 <1 745 gene locus_tag LOCUS_18020 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XXZ8:histidine kinase 1048 1230 gene locus_tag LOCUS_18030 1048 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2308 1517 gene locus_tag LOCUS_18040 2308 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2589 3383 gene locus_tag LOCUS_18050 gene coxP 2589 3383 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_18050 3458 3796 gene locus_tag LOCUS_18060 3458 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0309 371 1558 gene locus_tag LOCUS_18070 371 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1804 2604 gene locus_tag LOCUS_18080 1804 2604 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_18080 2733 3278 gene locus_tag LOCUS_18090 2733 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3284 4087 gene locus_tag LOCUS_18100 3284 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4295 4155 gene locus_tag LOCUS_18110 4295 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0310 1122 2063 gene locus_tag LOCUS_18120 1122 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3133 2546 gene locus_tag LOCUS_18130 3133 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3625 3188 gene locus_tag LOCUS_18140 3625 3188 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_18140 3875 4342 gene locus_tag LOCUS_18150 3875 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence0311 541 1482 gene locus_tag LOCUS_18160 541 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1876 1589 gene locus_tag LOCUS_18170 1876 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3374 1881 gene locus_tag LOCUS_18180 gene crtI 3374 1881 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_18180 3553 4005 gene locus_tag LOCUS_18190 gene aroQ 3553 4005 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_18190 4075 4509 gene locus_tag LOCUS_18200 4075 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence0312 1103 33 gene locus_tag LOCUS_18210 1103 33 CDS product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_18210 1647 1180 gene locus_tag LOCUS_18220 gene nuoA 1647 1180 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 protein_id gnl|my_center|LOCUS_18220 2262 1735 gene locus_tag LOCUS_18230 2262 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3483 2347 gene locus_tag LOCUS_18240 3483 2347 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0313 1569 1225 gene locus_tag LOCUS_18250 1569 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2540 1806 gene locus_tag LOCUS_18260 2540 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3949 2672 gene locus_tag LOCUS_18270 gene lysC 3949 2672 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_18270 >Feature sequence0314 1274 303 gene locus_tag LOCUS_18280 gene miaA1 1274 303 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_18280 <4574 1284 gene locus_tag LOCUS_18290 <4574 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase >Feature sequence0315 590 1570 gene locus_tag LOCUS_18300 590 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1636 2088 gene locus_tag LOCUS_18310 1636 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2495 3796 gene locus_tag LOCUS_18320 2495 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence0316 2380 368 gene locus_tag LOCUS_18330 2380 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_18330 2627 3238 gene locus_tag LOCUS_18340 2627 3238 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0317 3 278 gene locus_tag LOCUS_18350 3 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 362 1957 gene locus_tag LOCUS_18360 362 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3384 2032 gene locus_tag LOCUS_18370 3384 2032 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y98 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0318 1465 176 gene locus_tag LOCUS_18380 1465 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_18380 1844 1536 gene locus_tag LOCUS_18390 1844 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2157 3485 gene locus_tag LOCUS_18400 gene murA 2157 3485 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_18400 3623 4171 gene locus_tag LOCUS_18410 gene kptA 3623 4171 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R5N7 protein_id gnl|my_center|LOCUS_18410 >Feature sequence0319 <1 2294 gene locus_tag LOCUS_18420 <1 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 4309 2513 gene locus_tag LOCUS_18430 gene lepA 4309 2513 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0320 <1 1180 gene locus_tag LOCUS_18440 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 1236 1799 gene locus_tag LOCUS_18450 1236 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_18450 1833 2231 gene locus_tag LOCUS_18460 1833 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_18460 3181 2285 gene locus_tag LOCUS_18470 gene crtB 3181 2285 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_18470 3843 3331 gene locus_tag LOCUS_18480 3843 3331 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence0321 2584 1400 gene locus_tag LOCUS_18490 gene pdxA 2584 1400 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_18490 3617 2697 gene locus_tag LOCUS_18500 3617 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 <4503 3741 gene locus_tag LOCUS_18510 <4503 3741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K1N1:pyrroline-5-carboxylate reductase >Feature sequence0322 1889 495 gene locus_tag LOCUS_18520 1889 495 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_18520 2154 3014 gene locus_tag LOCUS_18530 2154 3014 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_18530 3126 3404 gene locus_tag LOCUS_18540 gene nuoK 3126 3404 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB6 protein_id gnl|my_center|LOCUS_18540 >Feature sequence0323 605 1657 gene locus_tag LOCUS_18550 605 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1675 2430 gene locus_tag LOCUS_18560 1675 2430 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984852.1 protein_id gnl|my_center|LOCUS_18560 2865 2425 gene locus_tag LOCUS_18570 2865 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4456 3077 gene locus_tag LOCUS_18580 4456 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0324 780 145 gene locus_tag LOCUS_18590 780 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_18590 1641 817 gene locus_tag LOCUS_18600 1641 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2556 1678 gene locus_tag LOCUS_18610 2556 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_18610 3363 2617 gene locus_tag LOCUS_18620 3363 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3703 4041 gene locus_tag LOCUS_18630 3703 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence0325 1057 2400 gene locus_tag LOCUS_18640 gene pyrC1 1057 2400 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_18640 2484 3644 gene locus_tag LOCUS_18650 gene alr 2484 3644 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_18650 4049 3648 gene locus_tag LOCUS_18660 4049 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0326 1290 136 gene locus_tag LOCUS_18670 1290 136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_18670 1796 3067 gene locus_tag LOCUS_18680 gene hisD 1796 3067 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_18680 3867 3334 gene locus_tag LOCUS_18690 3867 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence0327 1927 371 gene locus_tag LOCUS_18700 1927 371 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_18700 1995 4196 gene locus_tag LOCUS_18710 1995 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0328 453 1367 gene locus_tag LOCUS_18720 453 1367 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_18720 1439 2035 gene locus_tag LOCUS_18730 1439 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2135 3160 gene locus_tag LOCUS_18740 2135 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 3414 3196 gene locus_tag LOCUS_18750 3414 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0329 1069 254 gene locus_tag LOCUS_18760 gene rsmA 1069 254 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_18760 1137 2225 gene locus_tag LOCUS_18770 1137 2225 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_18770 <4430 2208 gene locus_tag LOCUS_18780 <4430 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0330 402 1493 gene locus_tag LOCUS_18790 gene nptA 402 1493 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_18790 1532 2629 gene locus_tag LOCUS_18800 1532 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3125 2748 gene locus_tag LOCUS_18810 3125 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 <4420 3263 gene locus_tag LOCUS_18820 <4420 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1B0:DNA primase >Feature sequence0331 1214 1035 gene locus_tag LOCUS_18830 1214 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 3605 1344 gene locus_tag LOCUS_18840 gene pnp 3605 1344 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_18840 4118 3831 gene locus_tag LOCUS_18850 gene rpsO 4118 3831 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0332 942 205 gene locus_tag LOCUS_18860 gene lytT 942 205 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_18860 4074 1054 gene locus_tag LOCUS_18870 4074 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0333 502 1284 gene locus_tag LOCUS_18880 502 1284 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_18880 1308 2072 gene locus_tag LOCUS_18890 1308 2072 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_18890 2765 2094 gene locus_tag LOCUS_18900 2765 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3955 2957 gene locus_tag LOCUS_18910 3955 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence0334 1052 579 gene locus_tag LOCUS_18920 1052 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2969 1212 gene locus_tag LOCUS_18930 gene lysS 2969 1212 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_18930 3129 3902 gene locus_tag LOCUS_18940 3129 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence0335 309 2318 gene locus_tag LOCUS_18950 gene nadE 309 2318 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_18950 2446 3942 gene locus_tag LOCUS_18960 2446 3942 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence0336 448 1749 gene locus_tag LOCUS_18970 448 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2162 4156 gene locus_tag LOCUS_18980 2162 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0337 841 1995 gene locus_tag LOCUS_18990 841 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 4150 1985 gene locus_tag LOCUS_19000 4150 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0338 1018 2961 gene locus_tag LOCUS_19010 gene thrS 1018 2961 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP2 protein_id gnl|my_center|LOCUS_19010 3097 3627 gene locus_tag LOCUS_19020 3097 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0339 2487 352 gene locus_tag LOCUS_19030 gene metG 2487 352 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_19030 3889 2624 gene locus_tag LOCUS_19040 3889 2624 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence0340 1482 289 gene locus_tag LOCUS_19050 gene porV 1482 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_19050 2775 1831 gene locus_tag LOCUS_19060 2775 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3701 2934 gene locus_tag LOCUS_19070 gene pyrF 3701 2934 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_19070 >Feature sequence0341 1350 46 gene locus_tag LOCUS_19080 gene purA 1350 46 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_19080 1821 1483 gene locus_tag LOCUS_19090 1821 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2422 1922 gene locus_tag LOCUS_19100 2422 1922 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_19100 2656 3216 gene locus_tag LOCUS_19110 2656 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_19110 3209 3739 gene locus_tag LOCUS_19120 3209 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4081 3812 gene locus_tag LOCUS_19130 4081 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence0342 1598 963 gene locus_tag LOCUS_19140 gene ydeI 1598 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_19140 2368 1652 gene locus_tag LOCUS_19150 2368 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence0343 913 134 gene locus_tag LOCUS_19160 913 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1283 1008 gene locus_tag LOCUS_19170 1283 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887737.1 protein_id gnl|my_center|LOCUS_19170 1527 2201 gene locus_tag LOCUS_19180 1527 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2401 3894 gene locus_tag LOCUS_19190 gene cry 2401 3894 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence0344 3511 962 gene locus_tag LOCUS_19200 3511 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0345 339 2279 gene locus_tag LOCUS_19210 339 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2320 2925 gene locus_tag LOCUS_19220 2320 2925 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_19220 3506 2940 gene locus_tag LOCUS_19230 3506 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 <4300 3663 gene locus_tag LOCUS_19240 <4300 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NJ7:DNA-directed RNA polymerase subunit beta >Feature sequence0346 1474 509 gene locus_tag LOCUS_19250 1474 509 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_19250 1683 3953 gene locus_tag LOCUS_19260 1683 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence0347 1467 2249 gene locus_tag LOCUS_19270 1467 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2355 3497 gene locus_tag LOCUS_19280 2355 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3926 4087 gene locus_tag LOCUS_19290 3926 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0348 1267 143 gene locus_tag LOCUS_19300 1267 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1507 2370 gene locus_tag LOCUS_19310 1507 2370 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_19310 2388 2693 gene locus_tag LOCUS_19320 2388 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2726 3412 gene locus_tag LOCUS_19330 gene ftsE 2726 3412 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence0349 1219 644 gene locus_tag LOCUS_19340 1219 644 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_19340 3036 1279 gene locus_tag LOCUS_19350 3036 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 3593 3096 gene locus_tag LOCUS_19360 gene coaD 3593 3096 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_19360 <4274 3626 gene locus_tag LOCUS_19370 <4274 3626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963043.1:RNA pseudouridine synthase >Feature sequence0350 2480 1590 gene locus_tag LOCUS_19380 2480 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_19380 3851 2544 gene locus_tag LOCUS_19390 gene der 3851 2544 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_19390 4025 4177 gene locus_tag LOCUS_19400 4025 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0351 165 920 gene locus_tag LOCUS_19410 165 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2876 1008 gene locus_tag LOCUS_19420 2876 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 <4229 3057 gene locus_tag LOCUS_19430 <4229 3057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence0352 1356 940 gene locus_tag LOCUS_19440 1356 940 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764746.1 protein_id gnl|my_center|LOCUS_19440 1580 2356 gene locus_tag LOCUS_19450 1580 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence0353 259 1596 gene locus_tag LOCUS_19460 259 1596 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_19460 2143 1805 gene locus_tag LOCUS_19470 2143 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3440 2253 gene locus_tag LOCUS_19480 3440 2253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence0354 724 206 gene locus_tag LOCUS_19490 724 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1830 844 gene locus_tag LOCUS_19500 1830 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3796 1889 gene locus_tag LOCUS_19510 3796 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0355 2995 902 gene locus_tag LOCUS_19520 2995 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence0356 226 855 gene locus_tag LOCUS_19530 226 855 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_19530 903 1904 gene locus_tag LOCUS_19540 903 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089839.1 protein_id gnl|my_center|LOCUS_19540 1964 2227 gene locus_tag LOCUS_19550 1964 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2244 3185 gene locus_tag LOCUS_19560 2244 3185 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583997.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0357 802 2961 gene locus_tag LOCUS_19570 802 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3079 3981 gene locus_tag LOCUS_19580 3079 3981 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0358 875 243 gene locus_tag LOCUS_19590 875 243 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_19590 1084 1845 gene locus_tag LOCUS_19600 1084 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1964 2614 gene locus_tag LOCUS_19610 1964 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence0359 <4193 459 gene locus_tag LOCUS_19620 <4193 459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0360 3992 735 gene locus_tag LOCUS_19630 3992 735 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_19630 >Feature sequence0361 2196 1267 gene locus_tag LOCUS_19640 gene thrB 2196 1267 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_19640 <4177 2295 gene locus_tag LOCUS_19650 <4177 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108282.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence0362 1837 1010 gene locus_tag LOCUS_19660 1837 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2502 2254 gene locus_tag LOCUS_19670 2502 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3530 2544 gene locus_tag LOCUS_19680 gene bioB 3530 2544 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0363 2280 1123 gene locus_tag LOCUS_19690 2280 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3989 2394 gene locus_tag LOCUS_19700 3989 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_19700 3946 4143 gene locus_tag LOCUS_19710 3946 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence0364 888 1316 gene locus_tag LOCUS_19720 888 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1372 1992 gene locus_tag LOCUS_19730 gene gpmA 1372 1992 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_19730 2455 2117 gene locus_tag LOCUS_19740 2455 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2825 3661 gene locus_tag LOCUS_19750 2825 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence0365 978 763 gene locus_tag LOCUS_19760 978 763 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970291.1 protein_id gnl|my_center|LOCUS_19760 2228 1155 gene locus_tag LOCUS_19770 gene ilvK 2228 1155 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_19770 2615 3901 gene locus_tag LOCUS_19780 2615 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0366 241 1518 gene locus_tag LOCUS_19790 gene kynU 241 1518 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_19790 3150 1633 gene locus_tag LOCUS_19800 3150 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3999 3343 gene locus_tag LOCUS_19810 3999 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0367 1056 1649 gene locus_tag LOCUS_19820 1056 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 protein_id gnl|my_center|LOCUS_19820 2334 1717 gene locus_tag LOCUS_19830 2334 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2674 2321 gene locus_tag LOCUS_19840 2674 2321 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_19840 3367 2801 gene locus_tag LOCUS_19850 3367 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence0368 1292 2059 gene locus_tag LOCUS_19860 1292 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2056 2802 gene locus_tag LOCUS_19870 2056 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2822 3613 gene locus_tag LOCUS_19880 2822 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence0369 <1 841 gene locus_tag LOCUS_19890 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405054.1:CoA transferase 1138 3144 gene locus_tag LOCUS_19900 1138 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3636 3313 gene locus_tag LOCUS_19910 3636 3313 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0370 457 1197 gene locus_tag LOCUS_19920 457 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1197 1709 gene locus_tag LOCUS_19930 1197 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2887 2255 gene locus_tag LOCUS_19940 gene coaE 2887 2255 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E081 protein_id gnl|my_center|LOCUS_19940 3501 2893 gene locus_tag LOCUS_19950 3501 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0371 1890 64 gene locus_tag LOCUS_19960 gene rho 1890 64 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_19960 2743 2438 gene locus_tag LOCUS_19970 2743 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_19970 3298 2816 gene locus_tag LOCUS_19980 3298 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3967 3500 gene locus_tag LOCUS_19990 3967 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence0372 2406 364 gene locus_tag LOCUS_20000 2406 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2587 3402 gene locus_tag LOCUS_20010 2587 3402 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_20010 <4080 3465 gene locus_tag LOCUS_20020 <4080 3465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036382.1:chemotaxis protein CheY >Feature sequence0373 1665 259 gene locus_tag LOCUS_20030 1665 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3770 1695 gene locus_tag LOCUS_20040 3770 1695 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_20040 4063 3938 gene locus_tag LOCUS_20050 4063 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence0374 1632 979 gene locus_tag LOCUS_20060 1632 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1709 2149 gene locus_tag LOCUS_20070 1709 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2167 3195 gene locus_tag LOCUS_20080 2167 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0375 447 2891 gene locus_tag LOCUS_20090 447 2891 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_20090 3843 2992 gene locus_tag LOCUS_20100 3843 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence0376 1138 2037 gene locus_tag LOCUS_20110 1138 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_20110 <4054 2139 gene locus_tag LOCUS_20120 <4054 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0E1:tricorn protease >Feature sequence0377 664 1704 gene locus_tag LOCUS_20130 664 1704 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_20130 2172 1834 gene locus_tag LOCUS_20140 2172 1834 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_20140 3394 2204 gene locus_tag LOCUS_20150 gene fjo17 3394 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_20150 4048 3695 gene locus_tag LOCUS_20160 4048 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence0378 <1 2520 gene locus_tag LOCUS_20170 <1 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267513.1:chemotaxis protein 3124 2540 gene locus_tag LOCUS_20180 3124 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence0379 1117 455 gene locus_tag LOCUS_20190 gene ung2 1117 455 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_20190 1258 1662 gene locus_tag LOCUS_20200 gene apaG 1258 1662 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_20200 3574 1823 gene locus_tag LOCUS_20210 3574 1823 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence0380 693 1304 gene locus_tag LOCUS_20220 693 1304 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_20220 1396 2226 gene locus_tag LOCUS_20230 1396 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 <4043 2310 gene locus_tag LOCUS_20240 <4043 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence0381 1922 2773 gene locus_tag LOCUS_20250 1922 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932420.1 protein_id gnl|my_center|LOCUS_20250 2817 3602 gene locus_tag LOCUS_20260 2817 3602 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence0382 1190 462 gene locus_tag LOCUS_20270 1190 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1882 1442 gene locus_tag LOCUS_20280 1882 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2053 3567 gene locus_tag LOCUS_20290 2053 3567 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A259 protein_id gnl|my_center|LOCUS_20290 >Feature sequence0383 434 1165 gene locus_tag LOCUS_20300 gene etfB 434 1165 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_20300 1287 2240 gene locus_tag LOCUS_20310 gene etfA 1287 2240 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_20310 2805 2389 gene locus_tag LOCUS_20320 2805 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3187 2825 gene locus_tag LOCUS_20330 3187 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3353 3204 gene locus_tag LOCUS_20340 3353 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_20340 4026 3445 gene locus_tag LOCUS_20350 4026 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0384 <1 2118 gene locus_tag LOCUS_20360 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A 2429 2950 gene locus_tag LOCUS_20370 2429 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 <4024 3005 gene locus_tag LOCUS_20380 <4024 3005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964555.1:flavodoxin reductase >Feature sequence0385 410 2728 gene locus_tag LOCUS_20390 410 2728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_20390 <4014 2898 gene locus_tag LOCUS_20400 <4014 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1S7:protein RecA >Feature sequence0386 <1 1281 gene locus_tag LOCUS_20410 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787651.1:carbon-nitrogen hydrolase 1815 1480 gene locus_tag LOCUS_20420 1815 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2859 1999 gene locus_tag LOCUS_20430 gene lplA2 2859 1999 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A5 protein_id gnl|my_center|LOCUS_20430 3986 3117 gene locus_tag LOCUS_20440 3986 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence0387 3065 81 gene locus_tag LOCUS_20450 3065 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence0388 262 3303 gene locus_tag LOCUS_20460 262 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 <3985 3436 gene locus_tag LOCUS_20470 <3985 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203619.1:transposase >Feature sequence0389 1069 533 gene locus_tag LOCUS_20480 1069 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1529 2773 gene locus_tag LOCUS_20490 1529 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0390 612 1442 gene locus_tag LOCUS_20500 612 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1794 2426 gene locus_tag LOCUS_20510 1794 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <3976 2676 gene locus_tag LOCUS_20520 <3976 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964417.1:adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA >Feature sequence0391 1426 383 gene locus_tag LOCUS_20530 1426 383 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_20530 2170 1547 gene locus_tag LOCUS_20540 2170 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3448 2564 gene locus_tag LOCUS_20550 3448 2564 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0392 999 250 gene locus_tag LOCUS_20560 999 250 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_20560 1296 1081 gene locus_tag LOCUS_20570 1296 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1356 1610 gene locus_tag LOCUS_20580 1356 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1952 1614 gene locus_tag LOCUS_20590 1952 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2059 3033 gene locus_tag LOCUS_20600 2059 3033 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence0393 2243 1806 gene locus_tag LOCUS_20610 2243 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3208 2786 gene locus_tag LOCUS_20620 gene rbfA 3208 2786 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFT0 protein_id gnl|my_center|LOCUS_20620 3965 3288 gene locus_tag LOCUS_20630 3965 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence0394 394 1710 gene locus_tag LOCUS_20640 gene mntC 394 1710 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_20640 3165 2050 gene locus_tag LOCUS_20650 3165 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0395 261 2249 gene locus_tag LOCUS_20660 261 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2490 3239 gene locus_tag LOCUS_20670 2490 3239 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_20670 3685 3236 gene locus_tag LOCUS_20680 3685 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence0396 1854 220 gene locus_tag LOCUS_20690 gene aceB 1854 220 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_20690 >Feature sequence0397 649 47 gene locus_tag LOCUS_20700 649 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1204 815 gene locus_tag LOCUS_20710 gene yjgF 1204 815 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_20710 2613 1420 gene locus_tag LOCUS_20720 2613 1420 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_20720 2871 3233 gene locus_tag LOCUS_20730 2871 3233 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence0398 2007 820 gene locus_tag LOCUS_20740 2007 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3128 2118 gene locus_tag LOCUS_20750 3128 2118 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence0399 <1 2030 gene locus_tag LOCUS_20760 <1 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 2105 3382 gene locus_tag LOCUS_20770 gene purD 2105 3382 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_20770 3479 3739 gene locus_tag LOCUS_20780 3479 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence0400 1152 553 gene locus_tag LOCUS_20790 1152 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2178 1255 gene locus_tag LOCUS_20800 gene fmt 2178 1255 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_20800 3539 2298 gene locus_tag LOCUS_20810 3539 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence0401 1496 375 gene locus_tag LOCUS_20820 1496 375 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_20820 1848 3245 gene locus_tag LOCUS_20830 gene hslU 1848 3245 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_20830 >Feature sequence0402 1554 565 gene locus_tag LOCUS_20840 1554 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2084 1614 gene locus_tag LOCUS_20850 2084 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2809 2144 gene locus_tag LOCUS_20860 2809 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3001 3825 gene locus_tag LOCUS_20870 3001 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence0403 206 1261 gene locus_tag LOCUS_20880 206 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20880 1319 2170 gene locus_tag LOCUS_20890 1319 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2550 3902 gene locus_tag LOCUS_20900 2550 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence0404 612 1382 gene locus_tag LOCUS_20910 612 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1507 2736 gene locus_tag LOCUS_20920 1507 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3147 2821 gene locus_tag LOCUS_20930 gene sufA 3147 2821 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence0405 <1 1025 gene locus_tag LOCUS_20940 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF6:ribosomal protein S12 methylthiotransferase RimO 1141 1212 gene locus_tag LOCUS_t00160 1141 1212 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1405 2568 gene locus_tag LOCUS_20950 1405 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3703 2861 gene locus_tag LOCUS_20960 3703 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence0406 984 88 gene locus_tag LOCUS_20970 984 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1339 2124 gene locus_tag LOCUS_20980 1339 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2268 2350 gene locus_tag LOCUS_t00170 2268 2350 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0407 2100 1354 gene locus_tag LOCUS_20990 gene lytT 2100 1354 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814J1 protein_id gnl|my_center|LOCUS_20990 3171 2371 gene locus_tag LOCUS_21000 gene troA 3171 2371 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0408 1931 2539 gene locus_tag LOCUS_21010 1931 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3779 2544 gene locus_tag LOCUS_21020 3779 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0409 <1 928 gene locus_tag LOCUS_21030 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H260:3-oxoacyl-[acyl-carrier-protein] synthase 3 1250 2314 gene locus_tag LOCUS_21040 1250 2314 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583050.1 protein_id gnl|my_center|LOCUS_21040 2393 3613 gene locus_tag LOCUS_21050 2393 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence0410 3332 60 gene locus_tag LOCUS_21060 3332 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0411 1294 2076 gene locus_tag LOCUS_21070 1294 2076 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_21070 2995 2087 gene locus_tag LOCUS_21080 2995 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence0412 90 740 gene locus_tag LOCUS_21090 90 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_21090 956 3490 gene locus_tag LOCUS_21100 gene clpC 956 3490 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_21100 3857 3642 gene locus_tag LOCUS_21110 3857 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0413 2911 2015 gene locus_tag LOCUS_21120 2911 2015 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_21120 3736 3104 gene locus_tag LOCUS_21130 3736 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence0414 750 1517 gene locus_tag LOCUS_21140 750 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962978.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence0415 771 2063 gene locus_tag LOCUS_21150 771 2063 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118881.1 protein_id gnl|my_center|LOCUS_21150 2153 2914 gene locus_tag LOCUS_21160 2153 2914 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0416 >Feature sequence0417 867 646 gene locus_tag LOCUS_21170 867 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1881 1048 gene locus_tag LOCUS_21180 1881 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2435 3616 gene locus_tag LOCUS_21190 2435 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence0418 735 217 gene locus_tag LOCUS_21200 735 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2340 904 gene locus_tag LOCUS_21210 2340 904 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888081.1 protein_id gnl|my_center|LOCUS_21210 2520 2957 gene locus_tag LOCUS_21220 2520 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence0419 1403 1876 gene locus_tag LOCUS_21230 1403 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1876 2223 gene locus_tag LOCUS_21240 1876 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2738 2319 gene locus_tag LOCUS_21250 2738 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0420 670 389 gene locus_tag LOCUS_21260 670 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1085 822 gene locus_tag LOCUS_21270 1085 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1485 1413 gene locus_tag LOCUS_t00180 1485 1413 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1611 1539 gene locus_tag LOCUS_t00190 1611 1539 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2045 1890 gene locus_tag LOCUS_21280 2045 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence0421 439 1401 gene locus_tag LOCUS_21290 gene queA 439 1401 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_21290 1492 1869 gene locus_tag LOCUS_21300 1492 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1883 2713 gene locus_tag LOCUS_21310 1883 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2857 2784 gene locus_tag LOCUS_t00200 2857 2784 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3413 2997 gene locus_tag LOCUS_21320 3413 2997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence0422 <1 1010 gene locus_tag LOCUS_21330 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476086.1:glycosyl transferase 1010 1843 gene locus_tag LOCUS_21340 1010 1843 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_21340 2013 3137 gene locus_tag LOCUS_21350 2013 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence0423 2185 476 gene locus_tag LOCUS_21360 2185 476 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_21360 2415 2678 gene locus_tag LOCUS_21370 2415 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3654 2680 gene locus_tag LOCUS_21380 3654 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0424 1 201 gene locus_tag LOCUS_21390 1 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 331 1461 gene locus_tag LOCUS_21400 331 1461 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7H0 protein_id gnl|my_center|LOCUS_21400 1849 3027 gene locus_tag LOCUS_21410 1849 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence0425 1215 607 gene locus_tag LOCUS_21420 1215 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67112 protein_id gnl|my_center|LOCUS_21420 2075 1218 gene locus_tag LOCUS_21430 2075 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2634 2999 gene locus_tag LOCUS_21440 2634 2999 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_21440 3186 3806 gene locus_tag LOCUS_21450 3186 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0426 1375 857 gene locus_tag LOCUS_21460 1375 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691822.1 protein_id gnl|my_center|LOCUS_21460 1483 3168 gene locus_tag LOCUS_21470 1483 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence0427 3586 125 gene locus_tag LOCUS_21480 3586 125 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0428 938 690 gene locus_tag LOCUS_21490 938 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2372 1227 gene locus_tag LOCUS_21500 gene atpB 2372 1227 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_21500 2864 2445 gene locus_tag LOCUS_21510 2864 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence0429 1168 1938 gene locus_tag LOCUS_21520 1168 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2026 3177 gene locus_tag LOCUS_21530 2026 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0430 44 2548 gene locus_tag LOCUS_21540 44 2548 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence0431 1186 1692 gene locus_tag LOCUS_21550 1186 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1947 2288 gene locus_tag LOCUS_21560 gene ytxJ 1947 2288 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_21560 2520 3659 gene locus_tag LOCUS_21570 2520 3659 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0432 162 821 gene locus_tag LOCUS_21580 162 821 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_21580 988 1980 gene locus_tag LOCUS_21590 gene obg 988 1980 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_21590 2248 2625 gene locus_tag LOCUS_21600 2248 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 <3776 2684 gene locus_tag LOCUS_21610 <3776 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784442.1:ABC transporter ATP-binding protein >Feature sequence0433 556 1827 gene locus_tag LOCUS_21620 gene fahA 556 1827 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_21620 2029 2676 gene locus_tag LOCUS_21630 2029 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0434 <1 528 gene locus_tag LOCUS_21640 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1H2:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 808 1656 gene locus_tag LOCUS_21650 808 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0435 418 840 gene locus_tag LOCUS_21660 418 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1083 1538 gene locus_tag LOCUS_21670 1083 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0436 1001 1747 gene locus_tag LOCUS_21680 1001 1747 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_21680 2367 1753 gene locus_tag LOCUS_21690 2367 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3136 2468 gene locus_tag LOCUS_21700 3136 2468 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence0437 14 658 gene locus_tag LOCUS_21710 14 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_21710 669 911 gene locus_tag LOCUS_21720 669 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1021 2205 gene locus_tag LOCUS_21730 gene mnmA 1021 2205 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_21730 >Feature sequence0438 769 356 gene locus_tag LOCUS_21740 769 356 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_21740 929 1936 gene locus_tag LOCUS_21750 gene gldB 929 1936 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_21750 <3756 2120 gene locus_tag LOCUS_21760 <3756 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein >Feature sequence0439 <1 1472 gene locus_tag LOCUS_21770 <1 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase 1562 2173 gene locus_tag LOCUS_21780 1562 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2230 3108 gene locus_tag LOCUS_21790 2230 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0440 298 996 gene locus_tag LOCUS_21800 298 996 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_21800 >Feature sequence0441 315 1706 gene locus_tag LOCUS_21810 gene fabZ 315 1706 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_21810 3182 1944 gene locus_tag LOCUS_21820 3182 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence0442 <1 1113 gene locus_tag LOCUS_21830 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H141:DNA replication and repair protein RecF 1293 1940 gene locus_tag LOCUS_21840 1293 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2088 3458 gene locus_tag LOCUS_21850 2088 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence0443 1315 8 gene locus_tag LOCUS_21860 1315 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_21860 1916 2422 gene locus_tag LOCUS_21870 1916 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 <3735 2488 gene locus_tag LOCUS_21880 <3735 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:two-component sensor histidine kinase >Feature sequence0444 <3731 212 gene locus_tag LOCUS_21890 <3731 212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMY0:histidine kinase >Feature sequence0445 825 28 gene locus_tag LOCUS_21900 825 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1679 891 gene locus_tag LOCUS_21910 1679 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2298 1870 gene locus_tag LOCUS_21920 2298 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence0446 817 131 gene locus_tag LOCUS_21930 817 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 948 2636 gene locus_tag LOCUS_21940 gene lnt 948 2636 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_21940 2714 3643 gene locus_tag LOCUS_21950 gene menA 2714 3643 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WKJ4 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0447 1452 505 gene locus_tag LOCUS_21960 1452 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2819 1461 gene locus_tag LOCUS_21970 2819 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3674 2973 gene locus_tag LOCUS_21980 gene cmk 3674 2973 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_21980 >Feature sequence0448 1655 624 gene locus_tag LOCUS_21990 1655 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_21990 2559 1789 gene locus_tag LOCUS_22000 2559 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2876 3310 gene locus_tag LOCUS_22010 2876 3310 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence0449 >Feature sequence0450 2263 335 gene locus_tag LOCUS_22020 2263 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3196 2630 gene locus_tag LOCUS_22030 3196 2630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228315.1 protein_id gnl|my_center|LOCUS_22030 3412 3209 gene locus_tag LOCUS_22040 3412 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0451 1314 340 gene locus_tag LOCUS_22050 1314 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2392 1304 gene locus_tag LOCUS_22060 2392 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3338 2685 gene locus_tag LOCUS_22070 gene atoA 3338 2685 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence0452 279 1097 gene locus_tag LOCUS_22080 279 1097 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082133.1 protein_id gnl|my_center|LOCUS_22080 3276 1186 gene locus_tag LOCUS_22090 gene pepO 3276 1186 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0453 <1 2852 gene locus_tag LOCUS_22100 <1 2852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765759.1:membrane protein >Feature sequence0454 209 1657 gene locus_tag LOCUS_22110 209 1657 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203470.1 protein_id gnl|my_center|LOCUS_22110 2299 2060 gene locus_tag LOCUS_22120 2299 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2503 3444 gene locus_tag LOCUS_22130 2503 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence0455 885 3539 gene locus_tag LOCUS_22140 885 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence0456 500 27 gene locus_tag LOCUS_22150 500 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 785 3451 gene locus_tag LOCUS_22160 785 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence0457 423 1334 gene locus_tag LOCUS_22170 423 1334 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_22170 1443 1958 gene locus_tag LOCUS_22180 1443 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2000 2869 gene locus_tag LOCUS_22190 2000 2869 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023954.1 protein_id gnl|my_center|LOCUS_22190 3159 2923 gene locus_tag LOCUS_22200 3159 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0458 287 784 gene locus_tag LOCUS_22210 287 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2781 949 gene locus_tag LOCUS_22220 gene htpG 2781 949 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_22220 <3620 3073 gene locus_tag LOCUS_22230 <3620 3073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase >Feature sequence0459 <3613 2662 gene locus_tag LOCUS_22240 <3613 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794794.1:hemolysin D >Feature sequence0460 2997 1981 gene locus_tag LOCUS_22250 2997 1981 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence0461 2 847 gene locus_tag LOCUS_22260 2 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence0462 819 1889 gene locus_tag LOCUS_22270 819 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1882 2691 gene locus_tag LOCUS_22280 1882 2691 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0463 751 2124 gene locus_tag LOCUS_22290 751 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2096 3436 gene locus_tag LOCUS_22300 2096 3436 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0464 526 1638 gene locus_tag LOCUS_22310 gene gcvT 526 1638 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_22310 1916 2494 gene locus_tag LOCUS_22320 1916 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2768 2923 gene locus_tag LOCUS_22330 gene rpmH 2768 2923 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_22330 >Feature sequence0465 >Feature sequence0466 470 1549 gene locus_tag LOCUS_22340 470 1549 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_22340 1796 2242 gene locus_tag LOCUS_22350 1796 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2478 3356 gene locus_tag LOCUS_22360 2478 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence0467 >Feature sequence0468 369 112 gene locus_tag LOCUS_22370 369 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0469 499 1215 gene locus_tag LOCUS_22380 499 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1665 1883 gene locus_tag LOCUS_22390 gene infA 1665 1883 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN0 protein_id gnl|my_center|LOCUS_22390 2292 2660 gene locus_tag LOCUS_22400 gene rpsM 2292 2660 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_22400 2831 3223 gene locus_tag LOCUS_22410 gene rpsK 2831 3223 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_22410 >Feature sequence0470 <1 1134 gene locus_tag LOCUS_22420 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:cell well associated RhsD protein 1141 1881 gene locus_tag LOCUS_22430 1141 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2072 2194 gene locus_tag LOCUS_22440 2072 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2864 2400 gene locus_tag LOCUS_22450 2864 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2918 3397 gene locus_tag LOCUS_22460 2918 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence0471 458 670 gene locus_tag LOCUS_22470 458 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 813 1610 gene locus_tag LOCUS_22480 813 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1614 1829 gene locus_tag LOCUS_22490 1614 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1839 2237 gene locus_tag LOCUS_22500 1839 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2237 3094 gene locus_tag LOCUS_22510 2237 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0472 1220 723 gene locus_tag LOCUS_22520 1220 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1613 1239 gene locus_tag LOCUS_22530 gene rsfS 1613 1239 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_22530 1847 2698 gene locus_tag LOCUS_22540 1847 2698 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108184.1 protein_id gnl|my_center|LOCUS_22540 3494 2868 gene locus_tag LOCUS_22550 3494 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence0473 >Feature sequence0474 <1 740 gene locus_tag LOCUS_22560 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768221.1:AraC family transcriptional regulator 1000 1365 gene locus_tag LOCUS_22570 1000 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1394 1840 gene locus_tag LOCUS_22580 1394 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976082.1 protein_id gnl|my_center|LOCUS_22580 1914 2441 gene locus_tag LOCUS_22590 1914 2441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543907.1 protein_id gnl|my_center|LOCUS_22590 3501 2494 gene locus_tag LOCUS_22600 3501 2494 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence0475 881 3307 gene locus_tag LOCUS_22610 881 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence0476 581 111 gene locus_tag LOCUS_22620 581 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1937 705 gene locus_tag LOCUS_22630 1937 705 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_22630 2180 2608 gene locus_tag LOCUS_22640 gene rpiB 2180 2608 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0477 1803 790 gene locus_tag LOCUS_22650 1803 790 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_22650 2844 2215 gene locus_tag LOCUS_22660 2844 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 <3490 2966 gene locus_tag LOCUS_22670 <3490 2966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362025.1:transposase >Feature sequence0478 648 1289 gene locus_tag LOCUS_22680 648 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1372 2463 gene locus_tag LOCUS_22690 1372 2463 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_22690 2844 3332 gene locus_tag LOCUS_22700 2844 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence0479 948 607 gene locus_tag LOCUS_22710 948 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2584 1052 gene locus_tag LOCUS_22720 2584 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_22720 3487 2993 gene locus_tag LOCUS_22730 3487 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence0480 1243 164 gene locus_tag LOCUS_22740 1243 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1428 2846 gene locus_tag LOCUS_22750 1428 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 <3485 2895 gene locus_tag LOCUS_22760 <3485 2895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704685.1:MBL fold metallo-hydrolase >Feature sequence0481 3255 1531 gene locus_tag LOCUS_22770 3255 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0482 1710 844 gene locus_tag LOCUS_22780 gene murI 1710 844 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_22780 2199 1822 gene locus_tag LOCUS_22790 2199 1822 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_22790 2649 2263 gene locus_tag LOCUS_22800 2649 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3373 2924 gene locus_tag LOCUS_22810 3373 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence0483 277 1128 gene locus_tag LOCUS_22820 277 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1389 2909 gene locus_tag LOCUS_22830 1389 2909 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence0484 1120 3024 gene locus_tag LOCUS_22840 gene acsA 1120 3024 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence0485 <1 1231 gene locus_tag LOCUS_22850 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 1449 3290 gene locus_tag LOCUS_22860 1449 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence0486 247 729 gene locus_tag LOCUS_22870 247 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 844 2796 gene locus_tag LOCUS_22880 844 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22880 >Feature sequence0487 2209 2895 gene locus_tag LOCUS_22890 gene upp 2209 2895 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence0488 1874 1125 gene locus_tag LOCUS_22900 1874 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2446 1871 gene locus_tag LOCUS_22910 2446 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3398 2436 gene locus_tag LOCUS_22920 3398 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence0489 2745 574 gene locus_tag LOCUS_22930 2745 574 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence0490 3464 2115 gene locus_tag LOCUS_22940 3464 2115 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0491 1637 549 gene locus_tag LOCUS_22950 1637 549 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_22950 1931 1653 gene locus_tag LOCUS_22960 1931 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2782 1946 gene locus_tag LOCUS_22970 2782 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 <3462 2869 gene locus_tag LOCUS_22980 <3462 2869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000575178.1:erythromycin biosynthesis sensory transduction protein EryC1 >Feature sequence0492 3020 126 gene locus_tag LOCUS_22990 gene leuS 3020 126 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_22990 >Feature sequence0493 >Feature sequence0494 338 93 gene locus_tag LOCUS_23000 338 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1680 463 gene locus_tag LOCUS_23010 1680 463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_23010 <3459 1834 gene locus_tag LOCUS_23020 <3459 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056770.1:ABC transporter ATP-binding protein >Feature sequence0495 145 741 gene locus_tag LOCUS_23030 145 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 745 1584 gene locus_tag LOCUS_23040 745 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1581 2528 gene locus_tag LOCUS_23050 1581 2528 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS2 protein_id gnl|my_center|LOCUS_23050 2936 2529 gene locus_tag LOCUS_23060 2936 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence0496 171 246 gene locus_tag LOCUS_t00210 171 246 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 350 985 gene locus_tag LOCUS_23070 gene ybbC 350 985 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence0497 525 1034 gene locus_tag LOCUS_23080 gene accB 525 1034 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_23080 1208 2563 gene locus_tag LOCUS_23090 gene accC 1208 2563 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_23090 3059 2661 gene locus_tag LOCUS_23100 3059 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0498 758 3283 gene locus_tag LOCUS_23110 gene nrdA 758 3283 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_23110 >Feature sequence0499 1452 214 gene locus_tag LOCUS_23120 1452 214 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_23120 2344 1586 gene locus_tag LOCUS_23130 gene sodA 2344 1586 CDS product superoxide dismutase [Mn/Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0Q6 protein_id gnl|my_center|LOCUS_23130 3095 2421 gene locus_tag LOCUS_23140 3095 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0500 267 1142 gene locus_tag LOCUS_23150 267 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_23150 1965 1288 gene locus_tag LOCUS_23160 1965 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2230 2838 gene locus_tag LOCUS_23170 2230 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0501 1288 569 gene locus_tag LOCUS_23180 1288 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2075 1305 gene locus_tag LOCUS_23190 2075 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3000 2065 gene locus_tag LOCUS_23200 3000 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence0502 176 751 gene locus_tag LOCUS_23210 176 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_23210 1325 2884 gene locus_tag LOCUS_23220 gene pcd 1325 2884 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence0503 2224 2556 gene locus_tag LOCUS_23230 2224 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence0504 192 590 gene locus_tag LOCUS_23240 192 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23240 1448 684 gene locus_tag LOCUS_23250 1448 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_23250 2037 1597 gene locus_tag LOCUS_23260 2037 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2192 3298 gene locus_tag LOCUS_23270 2192 3298 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0505 >Feature sequence0506 1362 610 gene locus_tag LOCUS_23280 1362 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1639 2298 gene locus_tag LOCUS_23290 gene pdxH 1639 2298 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_23290 >Feature sequence0507 >Feature sequence0508 231 998 gene locus_tag LOCUS_23300 231 998 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_23300 3048 1087 gene locus_tag LOCUS_23310 3048 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0509 242 448 gene locus_tag LOCUS_23320 242 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 441 629 gene locus_tag LOCUS_23330 441 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 965 1192 gene locus_tag LOCUS_23340 965 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1264 1392 gene locus_tag LOCUS_23350 1264 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1389 2537 gene locus_tag LOCUS_23360 1389 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2746 3063 gene locus_tag LOCUS_23370 2746 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence0510 319 861 gene locus_tag LOCUS_23380 319 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1825 959 gene locus_tag LOCUS_23390 gene mvaB 1825 959 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence0511 521 1729 gene locus_tag LOCUS_23400 521 1729 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016678.1 protein_id gnl|my_center|LOCUS_23400 3066 1804 gene locus_tag LOCUS_23410 3066 1804 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence0512 1644 2069 gene locus_tag LOCUS_23420 1644 2069 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_23420 2203 2763 gene locus_tag LOCUS_23430 2203 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2955 3028 gene locus_tag LOCUS_t00220 2955 3028 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3144 3228 gene locus_tag LOCUS_t00230 3144 3228 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0513 1072 629 gene locus_tag LOCUS_23440 1072 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1780 1085 gene locus_tag LOCUS_23450 gene purQ 1780 1085 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_23450 <3349 2066 gene locus_tag LOCUS_23460 <3349 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291837.1:isocitrate dehydrogenase >Feature sequence0514 <1 2348 gene locus_tag LOCUS_23470 <1 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202406.1:collagen-binding protein 2455 3177 gene locus_tag LOCUS_23480 2455 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence0515 545 129 gene locus_tag LOCUS_23490 545 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 922 587 gene locus_tag LOCUS_23500 922 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1173 2594 gene locus_tag LOCUS_23510 1173 2594 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence0516 2569 1430 gene locus_tag LOCUS_23520 gene phoR 2569 1430 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_23520 <3332 2589 gene locus_tag LOCUS_23530 <3332 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962529.1:DNA-binding response regulator >Feature sequence0517 1237 1821 gene locus_tag LOCUS_23540 1237 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962459.1 protein_id gnl|my_center|LOCUS_23540 1859 2299 gene locus_tag LOCUS_23550 1859 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2446 3030 gene locus_tag LOCUS_23560 2446 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence0518 210 947 gene locus_tag LOCUS_23570 210 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1843 1037 gene locus_tag LOCUS_23580 1843 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1986 3314 gene locus_tag LOCUS_23590 1986 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence0519 1220 765 gene locus_tag LOCUS_23600 1220 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1409 1714 gene locus_tag LOCUS_23610 1409 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1939 2265 gene locus_tag LOCUS_23620 1939 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence0520 1194 1844 gene locus_tag LOCUS_23630 gene gpm 1194 1844 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_23630 2210 1911 gene locus_tag LOCUS_23640 2210 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2744 2941 gene locus_tag LOCUS_23650 gene rpsU 2744 2941 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0521 2658 3119 gene locus_tag LOCUS_23660 2658 3119 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0522 708 343 gene locus_tag LOCUS_23670 gene rplS 708 343 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CH65 protein_id gnl|my_center|LOCUS_23670 1551 1006 gene locus_tag LOCUS_23680 1551 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2088 1669 gene locus_tag LOCUS_23690 2088 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence0523 <1 1528 gene locus_tag LOCUS_23700 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B 1589 1792 gene locus_tag LOCUS_23710 1589 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1829 2449 gene locus_tag LOCUS_23720 1829 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence0524 619 3114 gene locus_tag LOCUS_23730 619 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0525 454 122 gene locus_tag LOCUS_23740 gene csaA 454 122 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708805.1 protein_id gnl|my_center|LOCUS_23740 1135 740 gene locus_tag LOCUS_23750 1135 740 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_23750 1661 1185 gene locus_tag LOCUS_23760 gene greA 1661 1185 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_23760 2578 1898 gene locus_tag LOCUS_23770 2578 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3302 2970 gene locus_tag LOCUS_23780 3302 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence0526 1130 336 gene locus_tag LOCUS_23790 1130 336 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_23790 1044 3104 gene locus_tag LOCUS_23800 1044 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence0527 142 1374 gene locus_tag LOCUS_23810 gene hflX 142 1374 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_23810 >Feature sequence0528 777 3068 gene locus_tag LOCUS_23820 777 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence0529 1016 1537 gene locus_tag LOCUS_23830 gene haaO 1016 1537 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_23830 1753 2046 gene locus_tag LOCUS_23840 1753 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2321 2905 gene locus_tag LOCUS_23850 2321 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence0530 2120 993 gene locus_tag LOCUS_23860 2120 993 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_23860 2588 3001 gene locus_tag LOCUS_23870 2588 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence0531 1919 1548 gene locus_tag LOCUS_23880 1919 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2195 2749 gene locus_tag LOCUS_23890 2195 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence0532 2025 439 gene locus_tag LOCUS_23900 2025 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2265 3077 gene locus_tag LOCUS_23910 2265 3077 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence0533 1129 386 gene locus_tag LOCUS_23920 1129 386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_23920 1284 2480 gene locus_tag LOCUS_23930 gene kbl 1284 2480 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_23930 2676 3197 gene locus_tag LOCUS_23940 2676 3197 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0534 689 195 gene locus_tag LOCUS_23950 689 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1297 710 gene locus_tag LOCUS_23960 1297 710 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_23960 1671 2315 gene locus_tag LOCUS_23970 1671 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2516 3040 gene locus_tag LOCUS_23980 2516 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence0535 532 1332 gene locus_tag LOCUS_23990 gene hindIIIR 532 1332 CDS product type-2 restriction enzyme HindIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43870 protein_id gnl|my_center|LOCUS_23990 1386 1553 gene locus_tag LOCUS_24000 1386 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24000 1689 2354 gene locus_tag LOCUS_24010 1689 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24010 >Feature sequence0536 2746 2591 gene locus_tag LOCUS_24020 2746 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence0537 276 2753 gene locus_tag LOCUS_24030 276 2753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence0538 2470 1019 gene locus_tag LOCUS_24040 2470 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 <3210 2656 gene locus_tag LOCUS_24050 <3210 2656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UES1:pyruvate carboxylase >Feature sequence0539 541 20 gene locus_tag LOCUS_24060 541 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1560 652 gene locus_tag LOCUS_24070 1560 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_24070 2130 1618 gene locus_tag LOCUS_24080 2130 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence0540 969 463 gene locus_tag LOCUS_24090 969 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1636 962 gene locus_tag LOCUS_24100 1636 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1871 1629 gene locus_tag LOCUS_24110 1871 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2899 1868 gene locus_tag LOCUS_24120 2899 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 3010 3186 gene locus_tag LOCUS_24130 3010 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence0541 150 2177 gene locus_tag LOCUS_24140 gene ligA 150 2177 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_24140 2249 2779 gene locus_tag LOCUS_24150 2249 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence0542 2303 1605 gene locus_tag LOCUS_24160 2303 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <3188 2412 gene locus_tag LOCUS_24170 <3188 2412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494262.1:ATP-dependent DNA helicase RecQ >Feature sequence0543 >Feature sequence0544 119 958 gene locus_tag LOCUS_24180 119 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1070 2182 gene locus_tag LOCUS_24190 1070 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2523 2999 gene locus_tag LOCUS_24200 2523 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence0545 260 703 gene locus_tag LOCUS_24210 260 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2363 1089 gene locus_tag LOCUS_24220 2363 1089 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0546 >Feature sequence0547 2252 2716 gene locus_tag LOCUS_24230 2252 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence0548 <1 1215 gene locus_tag LOCUS_24240 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792058.1:penicillin-binding protein 2 1271 2680 gene locus_tag LOCUS_24250 1271 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence0549 <3168 1159 gene locus_tag LOCUS_24260 <3168 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein >Feature sequence0550 2821 1514 gene locus_tag LOCUS_24270 2821 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0551 1309 497 gene locus_tag LOCUS_24280 1309 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1954 1376 gene locus_tag LOCUS_24290 1954 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2097 2561 gene locus_tag LOCUS_24300 2097 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence0552 627 2975 gene locus_tag LOCUS_24310 627 2975 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0553 <1 587 gene locus_tag LOCUS_24320 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263036.1:restriction endonuclease 719 1033 gene locus_tag LOCUS_24330 719 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1126 2388 gene locus_tag LOCUS_24340 1126 2388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_24340 3012 2488 gene locus_tag LOCUS_24350 3012 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence0554 374 111 gene locus_tag LOCUS_24360 374 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1258 404 gene locus_tag LOCUS_24370 1258 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 <3149 1476 gene locus_tag LOCUS_24380 <3149 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963774.1:T9SS C-terminal target domain-containing protein >Feature sequence0555 181 834 gene locus_tag LOCUS_24390 181 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1000 1467 gene locus_tag LOCUS_24400 gene dut 1000 1467 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_24400 1659 2654 gene locus_tag LOCUS_24410 1659 2654 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence0556 525 1634 gene locus_tag LOCUS_24420 525 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 <3138 1603 gene locus_tag LOCUS_24430 <3138 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103522.1:DNA helicase >Feature sequence0557 431 1570 gene locus_tag LOCUS_24440 431 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1635 2831 gene locus_tag LOCUS_24450 1635 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence0558 2108 264 gene locus_tag LOCUS_24460 2108 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence0559 442 101 gene locus_tag LOCUS_24470 gene ogt2 442 101 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_24470 2559 454 gene locus_tag LOCUS_24480 2559 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence0560 <1 1872 gene locus_tag LOCUS_24490 <1 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932655.1:sodium:proline symporter 1950 2495 gene locus_tag LOCUS_24500 1950 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 <3123 2536 gene locus_tag LOCUS_24510 <3123 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784757.1:magnesium chelatase subunit I >Feature sequence0561 682 2007 gene locus_tag LOCUS_24520 682 2007 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence0562 317 1096 gene locus_tag LOCUS_24530 gene aroE 317 1096 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_24530 1146 1733 gene locus_tag LOCUS_24540 1146 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_24540 2070 3083 gene locus_tag LOCUS_24550 2070 3083 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence0563 <1 1004 gene locus_tag LOCUS_24560 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828556.1:methylmalonyl-CoA mutase 1226 2017 gene locus_tag LOCUS_24570 1226 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence0564 <3087 176 gene locus_tag LOCUS_24580 <3087 176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0565 484 2070 gene locus_tag LOCUS_24590 484 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2959 2156 gene locus_tag LOCUS_24600 gene murQ 2959 2156 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_24600 >Feature sequence0566 364 828 gene locus_tag LOCUS_24610 364 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 926 1378 gene locus_tag LOCUS_24620 926 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2661 1447 gene locus_tag LOCUS_24630 2661 1447 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence0567 817 119 gene locus_tag LOCUS_24640 817 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1043 2155 gene locus_tag LOCUS_24650 gene murG 1043 2155 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A258 protein_id gnl|my_center|LOCUS_24650 2765 2169 gene locus_tag LOCUS_24660 2765 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence0568 1152 481 gene locus_tag LOCUS_24670 gene psd 1152 481 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_24670 1377 1967 gene locus_tag LOCUS_24680 1377 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2085 2834 gene locus_tag LOCUS_24690 2085 2834 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence0569 246 614 gene locus_tag LOCUS_24700 246 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 637 1347 gene locus_tag LOCUS_24710 637 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1548 1799 gene locus_tag LOCUS_24720 1548 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1870 2448 gene locus_tag LOCUS_24730 1870 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2521 2910 gene locus_tag LOCUS_24740 2521 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence0570 569 60 gene locus_tag LOCUS_24750 569 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0571 <1 1197 gene locus_tag LOCUS_24760 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase 1346 1804 gene locus_tag LOCUS_24770 1346 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence0572 <1 558 gene locus_tag LOCUS_24780 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU8:UPF0056 inner membrane protein 565 1758 gene locus_tag LOCUS_24790 565 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1883 2026 gene locus_tag LOCUS_24800 1883 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2115 2681 gene locus_tag LOCUS_24810 2115 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence0573 721 347 gene locus_tag LOCUS_24820 721 347 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_24820 1340 729 gene locus_tag LOCUS_24830 gene rnhB 1340 729 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_24830 1564 2748 gene locus_tag LOCUS_24840 gene hisC 1564 2748 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_24840 >Feature sequence0574 592 383 gene locus_tag LOCUS_24850 592 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1049 795 gene locus_tag LOCUS_24860 1049 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1255 1061 gene locus_tag LOCUS_24870 1255 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1724 1260 gene locus_tag LOCUS_24880 1724 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1978 1694 gene locus_tag LOCUS_24890 1978 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2162 2004 gene locus_tag LOCUS_24900 2162 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2893 2456 gene locus_tag LOCUS_24910 2893 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence0575 144 1292 gene locus_tag LOCUS_24920 gene porV 144 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_24920 2085 1618 gene locus_tag LOCUS_24930 2085 1618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_24930 2327 2791 gene locus_tag LOCUS_24940 2327 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0576 303 974 gene locus_tag LOCUS_24950 303 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 <3020 1062 gene locus_tag LOCUS_24960 <3020 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor >Feature sequence0577 34 345 gene locus_tag LOCUS_24970 34 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 375 1175 gene locus_tag LOCUS_24980 375 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1179 1394 gene locus_tag LOCUS_24990 1179 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1404 1802 gene locus_tag LOCUS_25000 1404 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1815 2678 gene locus_tag LOCUS_25010 1815 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence0578 <1 893 gene locus_tag LOCUS_25020 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase 2092 905 gene locus_tag LOCUS_25030 2092 905 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence0579 1508 471 gene locus_tag LOCUS_25040 1508 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2272 1748 gene locus_tag LOCUS_25050 2272 1748 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQA5 protein_id gnl|my_center|LOCUS_25050 2580 2374 gene locus_tag LOCUS_25060 2580 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence0580 1297 1716 gene locus_tag LOCUS_25070 1297 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1811 2644 gene locus_tag LOCUS_25080 1811 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence0581 1202 150 gene locus_tag LOCUS_25090 gene aguA 1202 150 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_25090 1479 2168 gene locus_tag LOCUS_25100 1479 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2676 2494 gene locus_tag LOCUS_25110 2676 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25110 >Feature sequence0582 2344 1088 gene locus_tag LOCUS_25120 2344 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence0583 544 741 gene locus_tag LOCUS_25130 544 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 966 2129 gene locus_tag LOCUS_25140 966 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2323 2607 gene locus_tag LOCUS_25150 2323 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence0584 <1 866 gene locus_tag LOCUS_25160 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000966303.1:acetyltransferase 869 1777 gene locus_tag LOCUS_25170 869 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1762 2898 gene locus_tag LOCUS_25180 1762 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence0585 <1 631 gene locus_tag LOCUS_25190 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T26:membrane protein insertase YidC 1525 746 gene locus_tag LOCUS_25200 1525 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1724 2053 gene locus_tag LOCUS_25210 1724 2053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_25210 2852 2169 gene locus_tag LOCUS_25220 2852 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence0586 552 1307 gene locus_tag LOCUS_25230 552 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1628 2347 gene locus_tag LOCUS_25240 1628 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2901 2350 gene locus_tag LOCUS_25250 2901 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence0587 1286 291 gene locus_tag LOCUS_25260 gene gapA 1286 291 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_25260 2737 1448 gene locus_tag LOCUS_25270 2737 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence0588 770 1897 gene locus_tag LOCUS_25280 770 1897 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence0589 836 1972 gene locus_tag LOCUS_25290 836 1972 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_25290 2170 2433 gene locus_tag LOCUS_25300 2170 2433 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence0590 1173 358 gene locus_tag LOCUS_25310 1173 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence0591 616 1071 gene locus_tag LOCUS_25320 616 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence0592 1 570 gene locus_tag LOCUS_25330 1 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 730 2166 gene locus_tag LOCUS_25340 730 2166 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0593 276 1025 gene locus_tag LOCUS_25350 276 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2073 1078 gene locus_tag LOCUS_25360 2073 1078 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence0594 275 775 gene locus_tag LOCUS_25370 275 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1001 1477 gene locus_tag LOCUS_25380 1001 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0595 1611 76 gene locus_tag LOCUS_25390 1611 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2016 1711 gene locus_tag LOCUS_25400 2016 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence0596 <1 2322 gene locus_tag LOCUS_25410 <1 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763369.1:aminopeptidase 2431 2925 gene locus_tag LOCUS_25420 2431 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence0597 2115 133 gene locus_tag LOCUS_25430 2115 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence0598 630 112 gene locus_tag LOCUS_25440 630 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 786 2126 gene locus_tag LOCUS_25450 786 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0599 1224 274 gene locus_tag LOCUS_25460 1224 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_25460 1641 1345 gene locus_tag LOCUS_25470 1641 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1658 1822 gene locus_tag LOCUS_25480 1658 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2466 1837 gene locus_tag LOCUS_25490 2466 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence0600 495 1628 gene locus_tag LOCUS_25500 495 1628 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_25500 1634 2452 gene locus_tag LOCUS_25510 1634 2452 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082133.1 protein_id gnl|my_center|LOCUS_25510 2671 2525 gene locus_tag LOCUS_25520 2671 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence0601 >Feature sequence0602 1348 434 gene locus_tag LOCUS_25530 1348 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence0603 45 2369 gene locus_tag LOCUS_25540 45 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence0604 931 1656 gene locus_tag LOCUS_25550 931 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2029 2631 gene locus_tag LOCUS_25560 2029 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence0605 1267 1476 gene locus_tag LOCUS_25570 1267 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1958 1542 gene locus_tag LOCUS_25580 1958 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2270 2845 gene locus_tag LOCUS_25590 2270 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence0606 211 1278 gene locus_tag LOCUS_25600 211 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1286 2596 gene locus_tag LOCUS_25610 1286 2596 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence0607 32 2104 gene locus_tag LOCUS_25620 32 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2177 2734 gene locus_tag LOCUS_25630 2177 2734 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence0608 <2895 407 gene locus_tag LOCUS_25640 <2895 407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:type II endonuclease-methyltransferasefusion protein >Feature sequence0609 730 233 gene locus_tag LOCUS_25650 730 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1165 746 gene locus_tag LOCUS_25660 1165 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2589 1204 gene locus_tag LOCUS_25670 2589 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0610 893 2167 gene locus_tag LOCUS_25680 893 2167 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686815.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence0611 325 2484 gene locus_tag LOCUS_25690 325 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0612 >Feature sequence0613 1794 388 gene locus_tag LOCUS_25700 gene speA 1794 388 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_25700 2873 1965 gene locus_tag LOCUS_25710 2873 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence0614 2177 852 gene locus_tag LOCUS_25720 2177 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 <2873 2265 gene locus_tag LOCUS_25730 <2873 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964076.1:arginase >Feature sequence0615 421 20 gene locus_tag LOCUS_25740 421 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 743 459 gene locus_tag LOCUS_25750 743 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2284 740 gene locus_tag LOCUS_25760 2284 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence0616 2601 1657 gene locus_tag LOCUS_25770 2601 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence0617 344 1057 gene locus_tag LOCUS_25780 344 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1095 1814 gene locus_tag LOCUS_25790 1095 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence0618 641 225 gene locus_tag LOCUS_25800 641 225 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_25800 2358 847 gene locus_tag LOCUS_25810 2358 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence0619 275 1420 gene locus_tag LOCUS_25820 275 1420 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 protein_id gnl|my_center|LOCUS_25820 2059 1544 gene locus_tag LOCUS_25830 2059 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2511 2284 gene locus_tag LOCUS_25840 2511 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0620 <1 841 gene locus_tag LOCUS_25850 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001170714.1:glycosyl transferase 851 1624 gene locus_tag LOCUS_25860 851 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1639 2445 gene locus_tag LOCUS_25870 1639 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67771 protein_id gnl|my_center|LOCUS_25870 >Feature sequence0621 1027 1608 gene locus_tag LOCUS_25880 1027 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1895 2770 gene locus_tag LOCUS_25890 1895 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence0622 507 1679 gene locus_tag LOCUS_25900 507 1679 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_25900 1851 2471 gene locus_tag LOCUS_25910 1851 2471 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence0623 840 94 gene locus_tag LOCUS_25920 840 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1768 833 gene locus_tag LOCUS_25930 1768 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2351 1776 gene locus_tag LOCUS_25940 2351 1776 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0624 2380 53 gene locus_tag LOCUS_25950 2380 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence0625 <1 1773 gene locus_tag LOCUS_25960 <1 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG 1818 2216 gene locus_tag LOCUS_25970 1818 2216 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0626 <1 897 gene locus_tag LOCUS_25980 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA95:UvrABC system protein B 916 1395 gene locus_tag LOCUS_25990 916 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1439 1807 gene locus_tag LOCUS_26000 1439 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence0627 974 279 gene locus_tag LOCUS_26010 974 279 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968036.1 protein_id gnl|my_center|LOCUS_26010 1228 1920 gene locus_tag LOCUS_26020 1228 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1976 2755 gene locus_tag LOCUS_26030 1976 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence0628 <1 933 gene locus_tag LOCUS_26040 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 2739 1024 gene locus_tag LOCUS_26050 2739 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0629 370 843 gene locus_tag LOCUS_26060 370 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_26060 973 1581 gene locus_tag LOCUS_26070 973 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1609 2034 gene locus_tag LOCUS_26080 1609 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2118 2597 gene locus_tag LOCUS_26090 2118 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence0630 294 1013 gene locus_tag LOCUS_26100 294 1013 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_26100 1029 1670 gene locus_tag LOCUS_26110 1029 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1857 2624 gene locus_tag LOCUS_26120 gene bdhA1 1857 2624 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886667.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0631 1050 1268 gene locus_tag LOCUS_26130 1050 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1329 1625 gene locus_tag LOCUS_26140 1329 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1618 2052 gene locus_tag LOCUS_26150 1618 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2049 2348 gene locus_tag LOCUS_26160 2049 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence0632 1348 38 gene locus_tag LOCUS_26170 1348 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence0633 1468 179 gene locus_tag LOCUS_26180 gene metK 1468 179 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T6 protein_id gnl|my_center|LOCUS_26180 1926 2576 gene locus_tag LOCUS_26190 1926 2576 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0634 >Feature sequence0635 367 1335 gene locus_tag LOCUS_26200 367 1335 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence0636 1865 2287 gene locus_tag LOCUS_26210 1865 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0637 1030 2067 gene locus_tag LOCUS_26220 1030 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_26220 2075 2497 gene locus_tag LOCUS_26230 2075 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence0638 723 541 gene locus_tag LOCUS_26240 723 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 988 2499 gene locus_tag LOCUS_26250 gene accC 988 2499 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence0639 2116 1457 gene locus_tag LOCUS_26260 2116 1457 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence0640 1271 99 gene locus_tag LOCUS_26270 gene dacB 1271 99 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_26270 1551 1961 gene locus_tag LOCUS_26280 1551 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 <2730 2178 gene locus_tag LOCUS_26290 <2730 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WBS2:peptide methionine sulfoxide reductase MsrA >Feature sequence0641 1466 387 gene locus_tag LOCUS_26300 gene rlmN 1466 387 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_26300 >Feature sequence0642 203 598 gene locus_tag LOCUS_26310 203 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1878 604 gene locus_tag LOCUS_26320 1878 604 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence0643 305 15 gene locus_tag LOCUS_26330 305 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1027 536 gene locus_tag LOCUS_26340 1027 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1390 2025 gene locus_tag LOCUS_26350 gene ylbE 1390 2025 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905761.1 protein_id gnl|my_center|LOCUS_26350 2193 2708 gene locus_tag LOCUS_26360 2193 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence0644 >Feature sequence0645 952 410 gene locus_tag LOCUS_26370 952 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1207 1428 gene locus_tag LOCUS_26380 1207 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1481 2362 gene locus_tag LOCUS_26390 1481 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence0646 751 1527 gene locus_tag LOCUS_26400 751 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1678 2133 gene locus_tag LOCUS_26410 1678 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 <2711 2136 gene locus_tag LOCUS_26420 <2711 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963344.1:DUF2279 domain-containing protein >Feature sequence0647 >Feature sequence0648 869 132 gene locus_tag LOCUS_26430 869 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 964 2547 gene locus_tag LOCUS_26440 964 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence0649 193 582 gene locus_tag LOCUS_26450 193 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 583 1086 gene locus_tag LOCUS_26460 583 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <2697 1915 gene locus_tag LOCUS_26470 <2697 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVN4:coproporphyrinogen oxidase >Feature sequence0650 1650 2627 gene locus_tag LOCUS_26480 1650 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence0651 83 961 gene locus_tag LOCUS_26490 83 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 952 1024 gene locus_tag LOCUS_t00240 952 1024 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1685 1059 gene locus_tag LOCUS_26500 1685 1059 CDS product fluoroquinolones export permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJB3 protein_id gnl|my_center|LOCUS_26500 2500 1814 gene locus_tag LOCUS_26510 2500 1814 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258570.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence0652 >Feature sequence0653 2333 150 gene locus_tag LOCUS_26520 gene glnA 2333 150 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence0654 889 2202 gene locus_tag LOCUS_26530 gene amt 889 2202 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH08 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0655 401 2005 gene locus_tag LOCUS_26540 401 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence0656 929 432 gene locus_tag LOCUS_26550 929 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2162 1206 gene locus_tag LOCUS_26560 2162 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence0657 1206 478 gene locus_tag LOCUS_26570 1206 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_26570 1718 1296 gene locus_tag LOCUS_26580 1718 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2392 1955 gene locus_tag LOCUS_26590 2392 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence0658 445 1581 gene locus_tag LOCUS_26600 gene ansA 445 1581 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_26600 1795 1592 gene locus_tag LOCUS_26610 1795 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2055 1783 gene locus_tag LOCUS_26620 2055 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <2655 2105 gene locus_tag LOCUS_26630 <2655 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS0:Na(+)-translocating NADH-quinone reductase subunit F >Feature sequence0659 1692 487 gene locus_tag LOCUS_26640 1692 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0660 >Feature sequence0661 1774 2019 gene locus_tag LOCUS_26650 1774 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2043 2414 gene locus_tag LOCUS_26660 2043 2414 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence0662 969 91 gene locus_tag LOCUS_26670 969 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1576 1418 gene locus_tag LOCUS_26680 1576 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence0663 807 1457 gene locus_tag LOCUS_26690 807 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1653 1865 gene locus_tag LOCUS_26700 gene rpmF 1653 1865 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_26700 2010 2591 gene locus_tag LOCUS_26710 2010 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence0664 <1 626 gene locus_tag LOCUS_26720 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0P8:S-adenosylmethionine:tRNA ribosyltransferase-isomerase 797 1768 gene locus_tag LOCUS_26730 797 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 <2640 1930 gene locus_tag LOCUS_26740 <2640 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Z22:UPF0365 protein >Feature sequence0665 276 1145 gene locus_tag LOCUS_26750 276 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1677 1240 gene locus_tag LOCUS_26760 1677 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2543 1902 gene locus_tag LOCUS_26770 2543 1902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence0666 811 1245 gene locus_tag LOCUS_26780 811 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1267 1923 gene locus_tag LOCUS_26790 1267 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence0667 1921 383 gene locus_tag LOCUS_26800 1921 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0668 >Feature sequence0669 1 456 gene locus_tag LOCUS_26810 1 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 466 1974 gene locus_tag LOCUS_26820 466 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1978 2343 gene locus_tag LOCUS_26830 1978 2343 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence0670 771 1940 gene locus_tag LOCUS_26840 771 1940 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_26840 1949 2341 gene locus_tag LOCUS_26850 1949 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence0671 890 2515 gene locus_tag LOCUS_26860 890 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence0672 211 594 gene locus_tag LOCUS_26870 211 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1617 652 gene locus_tag LOCUS_26880 1617 652 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_26880 2375 1794 gene locus_tag LOCUS_26890 gene queE 2375 1794 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_26890 2392 2514 gene locus_tag LOCUS_26900 2392 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence0673 438 707 gene locus_tag LOCUS_26910 438 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 845 1714 gene locus_tag LOCUS_26920 gene hisG 845 1714 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_26920 <2609 1810 gene locus_tag LOCUS_26930 <2609 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0674 1086 187 gene locus_tag LOCUS_26940 1086 187 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_26940 2430 1483 gene locus_tag LOCUS_26950 2430 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence0675 2059 2499 gene locus_tag LOCUS_26960 2059 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0676 1552 1037 gene locus_tag LOCUS_26970 1552 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2594 1926 gene locus_tag LOCUS_26980 gene mtnN 2594 1926 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67657 protein_id gnl|my_center|LOCUS_26980 >Feature sequence0677 2211 1579 gene locus_tag LOCUS_26990 2211 1579 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence0678 2071 1817 gene locus_tag LOCUS_27000 2071 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence0679 298 1422 gene locus_tag LOCUS_27010 gene ydjI 298 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537911.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence0680 1008 1796 gene locus_tag LOCUS_27020 gene plsC 1008 1796 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_27020 2299 1799 gene locus_tag LOCUS_27030 2299 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence0681 246 2288 gene locus_tag LOCUS_27040 246 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence0682 <1 828 gene locus_tag LOCUS_27050 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:transporter 818 1585 gene locus_tag LOCUS_27060 818 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence0683 595 1968 gene locus_tag LOCUS_27070 gene rhlE 595 1968 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_27070 >Feature sequence0684 984 76 gene locus_tag LOCUS_27080 984 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1616 1080 gene locus_tag LOCUS_27090 1616 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 <2568 1744 gene locus_tag LOCUS_27100 <2568 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z9R5:UPF0246 protein YaaA >Feature sequence0685 <1 1705 gene locus_tag LOCUS_27110 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase 1718 2122 gene locus_tag LOCUS_27120 1718 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence0686 988 665 gene locus_tag LOCUS_27130 988 665 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_27130 1263 1691 gene locus_tag LOCUS_27140 gene sufE 1263 1691 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_27140 1769 2119 gene locus_tag LOCUS_27150 1769 2119 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404134.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence0687 88 1698 gene locus_tag LOCUS_27160 88 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2534 1722 gene locus_tag LOCUS_27170 gene cobS 2534 1722 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_27170 >Feature sequence0688 207 404 gene locus_tag LOCUS_27180 207 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 531 2255 gene locus_tag LOCUS_27190 531 2255 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence0689 463 2337 gene locus_tag LOCUS_27200 463 2337 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence0690 261 740 gene locus_tag LOCUS_27210 261 740 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081029.1 protein_id gnl|my_center|LOCUS_27210 846 1472 gene locus_tag LOCUS_27220 846 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1532 1960 gene locus_tag LOCUS_27230 1532 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2550 2131 gene locus_tag LOCUS_27240 2550 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0691 480 1073 gene locus_tag LOCUS_27250 480 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2110 1148 gene locus_tag LOCUS_27260 2110 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence0692 <1 554 gene locus_tag LOCUS_27270 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088800.1:cyclase 674 2302 gene locus_tag LOCUS_27280 674 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0693 >Feature sequence0694 1249 2136 gene locus_tag LOCUS_27290 gene xapG 1249 2136 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_27290 >Feature sequence0695 262 978 gene locus_tag LOCUS_27300 262 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1324 1052 gene locus_tag LOCUS_27310 1324 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1697 1431 gene locus_tag LOCUS_27320 1697 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2001 1735 gene locus_tag LOCUS_27330 2001 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence0696 1260 67 gene locus_tag LOCUS_27340 1260 67 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_27340 1548 1474 gene locus_tag LOCUS_t00250 1548 1474 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1714 1639 gene locus_tag LOCUS_t00260 1714 1639 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1916 1829 gene locus_tag LOCUS_t00270 1916 1829 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0697 697 62 gene locus_tag LOCUS_27350 697 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_27350 2098 824 gene locus_tag LOCUS_27360 2098 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence0698 294 1772 gene locus_tag LOCUS_27370 294 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence0699 996 97 gene locus_tag LOCUS_27380 996 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1427 1146 gene locus_tag LOCUS_27390 1427 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_27390 2389 1496 gene locus_tag LOCUS_27400 2389 1496 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0700 <1 804 gene locus_tag LOCUS_27410 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 2318 1533 gene locus_tag LOCUS_27420 gene srtN 2318 1533 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence0701 302 84 gene locus_tag LOCUS_27430 302 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 759 310 gene locus_tag LOCUS_27440 759 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 975 808 gene locus_tag LOCUS_27450 975 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27450 1257 991 gene locus_tag LOCUS_27460 1257 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1526 1254 gene locus_tag LOCUS_27470 1526 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 <2511 1543 gene locus_tag LOCUS_27480 <2511 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthetase B >Feature sequence0702 367 2286 gene locus_tag LOCUS_27490 367 2286 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0703 >Feature sequence0704 >Feature sequence0705 772 2190 gene locus_tag LOCUS_27500 gene trpE 772 2190 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence0706 1967 456 gene locus_tag LOCUS_27510 1967 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence0707 41 1075 gene locus_tag LOCUS_27520 41 1075 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_27520 2356 1154 gene locus_tag LOCUS_27530 2356 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence0708 <1 2008 gene locus_tag LOCUS_27540 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor 2021 2254 gene locus_tag LOCUS_27550 2021 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0709 577 212 gene locus_tag LOCUS_27560 577 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 993 796 gene locus_tag LOCUS_27570 993 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence0710 767 51 gene locus_tag LOCUS_27580 767 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1407 871 gene locus_tag LOCUS_27590 1407 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2210 1443 gene locus_tag LOCUS_27600 2210 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2401 2474 gene locus_tag LOCUS_t00280 2401 2474 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0711 >Feature sequence0712 158 619 gene locus_tag LOCUS_27610 158 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2278 1130 gene locus_tag LOCUS_27620 2278 1130 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0713 >Feature sequence0714 >Feature sequence0715 903 502 gene locus_tag LOCUS_27630 903 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2093 1032 gene locus_tag LOCUS_27640 2093 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence0716 1687 407 gene locus_tag LOCUS_27650 1687 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence0717 >Feature sequence0718 224 907 gene locus_tag LOCUS_27660 224 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951353.1 protein_id gnl|my_center|LOCUS_27660 1021 2271 gene locus_tag LOCUS_27670 gene rsmB 1021 2271 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence0719 332 75 gene locus_tag LOCUS_27680 332 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 904 368 gene locus_tag LOCUS_27690 904 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1589 1362 gene locus_tag LOCUS_27700 1589 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 <2427 1619 gene locus_tag LOCUS_27710 <2427 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein note possible pseudo, frameshifted >Feature sequence0720 1722 436 gene locus_tag LOCUS_27720 gene yeiM 1722 436 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence0721 1 213 gene locus_tag LOCUS_27730 1 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1345 263 gene locus_tag LOCUS_27740 1345 263 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_27740 1530 2168 gene locus_tag LOCUS_27750 gene bioD 1530 2168 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_27750 >Feature sequence0722 <1 647 gene locus_tag LOCUS_27760 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NRB5:protein deglycase HchA 670 1161 gene locus_tag LOCUS_27770 670 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1168 1989 gene locus_tag LOCUS_27780 1168 1989 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0723 1002 196 gene locus_tag LOCUS_27790 1002 196 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_27790 1539 1027 gene locus_tag LOCUS_27800 1539 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2250 1741 gene locus_tag LOCUS_27810 2250 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence0724 1573 500 gene locus_tag LOCUS_27820 gene prfA 1573 500 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y2 protein_id gnl|my_center|LOCUS_27820 <2410 1727 gene locus_tag LOCUS_27830 <2410 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490863.1:membrane protein >Feature sequence0725 >Feature sequence0726 <2406 1275 gene locus_tag LOCUS_27840 <2406 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905972.1:two-component sensor histidine kinase >Feature sequence0727 >Feature sequence0728 148 1122 gene locus_tag LOCUS_27850 148 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence0729 <1 936 gene locus_tag LOCUS_27860 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H199:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 984 1580 gene locus_tag LOCUS_27870 984 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_27870 1577 1999 gene locus_tag LOCUS_27880 1577 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence0730 344 111 gene locus_tag LOCUS_27890 344 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 836 1513 gene locus_tag LOCUS_27900 836 1513 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0731 >Feature sequence0732 573 1349 gene locus_tag LOCUS_27910 573 1349 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_27910 1693 1926 gene locus_tag LOCUS_27920 1693 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence0733 662 1801 gene locus_tag LOCUS_27930 gene mutY 662 1801 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence0734 <1 1052 gene locus_tag LOCUS_27940 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H092:valine--tRNA ligase 1139 2008 gene locus_tag LOCUS_27950 1139 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2377 2054 gene locus_tag LOCUS_27960 2377 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0735 123 1520 gene locus_tag LOCUS_27970 123 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_27970 1523 1723 gene locus_tag LOCUS_27980 1523 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1745 2047 gene locus_tag LOCUS_27990 1745 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence0736 1516 2232 gene locus_tag LOCUS_28000 1516 2232 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0737 1271 261 gene locus_tag LOCUS_28010 1271 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1619 2110 gene locus_tag LOCUS_28020 1619 2110 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0738 1794 445 gene locus_tag LOCUS_28030 1794 445 CDS product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_28030 <2370 1837 gene locus_tag LOCUS_28040 <2370 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence0739 173 466 gene locus_tag LOCUS_28050 173 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28050 >Feature sequence0740 <1 1992 gene locus_tag LOCUS_28060 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001005173.1:DNA recombination protein RecF >Feature sequence0741 1378 1953 gene locus_tag LOCUS_28070 1378 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0742 2166 94 gene locus_tag LOCUS_28080 2166 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence0743 169 1491 gene locus_tag LOCUS_28090 169 1491 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_28090 1633 1908 gene locus_tag LOCUS_28100 1633 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence0744 1504 185 gene locus_tag LOCUS_28110 gene mvaA 1504 185 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_28110 2292 2032 gene locus_tag LOCUS_28120 2292 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence0745 1350 67 gene locus_tag LOCUS_28130 1350 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1546 2100 gene locus_tag LOCUS_28140 1546 2100 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence0746 <1 922 gene locus_tag LOCUS_28150 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34319:putative glycosyltransferase YkcC 1043 1693 gene locus_tag LOCUS_28160 1043 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence0747 >Feature sequence0748 2100 778 gene locus_tag LOCUS_28170 2100 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence0749 <1 1051 gene locus_tag LOCUS_28180 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase 1118 1906 gene locus_tag LOCUS_28190 1118 1906 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence0750 <1 2322 gene locus_tag LOCUS_28200 <1 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase >Feature sequence0751 1248 67 gene locus_tag LOCUS_28210 1248 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_28210 2176 1268 gene locus_tag LOCUS_28220 2176 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence0752 1398 250 gene locus_tag LOCUS_28230 1398 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1464 2000 gene locus_tag LOCUS_28240 1464 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence0753 <1 1140 gene locus_tag LOCUS_28250 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:glucose-1-phosphate thymidylyltransferase >Feature sequence0754 1128 202 gene locus_tag LOCUS_28260 1128 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 <2320 1238 gene locus_tag LOCUS_28270 <2320 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117742.1:cysteine proteinase >Feature sequence0755 <1 651 gene locus_tag LOCUS_28280 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764714.1:DNA-binding response regulator >Feature sequence0756 294 842 gene locus_tag LOCUS_28290 294 842 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_28290 992 1831 gene locus_tag LOCUS_28300 992 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0757 <1 2012 gene locus_tag LOCUS_28310 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MY0:DNA topoisomerase 1 >Feature sequence0758 291 1064 gene locus_tag LOCUS_28320 291 1064 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_28320 1166 1942 gene locus_tag LOCUS_28330 1166 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence0759 >Feature sequence0760 265 957 gene locus_tag LOCUS_28340 gene recO 265 957 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_28340 1131 2147 gene locus_tag LOCUS_28350 1131 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence0761 68 361 gene locus_tag LOCUS_28360 68 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 374 781 gene locus_tag LOCUS_28370 374 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 794 925 gene locus_tag LOCUS_28380 794 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1025 2194 gene locus_tag LOCUS_28390 1025 2194 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence0762 479 1063 gene locus_tag LOCUS_28400 479 1063 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_28400 1556 1134 gene locus_tag LOCUS_28410 1556 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1684 2151 gene locus_tag LOCUS_28420 1684 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence0763 >Feature sequence0764 1326 814 gene locus_tag LOCUS_28430 gene aroK 1326 814 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 protein_id gnl|my_center|LOCUS_28430 1965 1453 gene locus_tag LOCUS_28440 1965 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence0765 401 1021 gene locus_tag LOCUS_28450 401 1021 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_28450 1042 2256 gene locus_tag LOCUS_28460 1042 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0766 <2291 1712 gene locus_tag LOCUS_28470 <2291 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963625.1:membrane protein >Feature sequence0767 758 276 gene locus_tag LOCUS_28480 758 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1798 794 gene locus_tag LOCUS_28490 1798 794 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_28490 >Feature sequence0768 >Feature sequence0769 553 990 gene locus_tag LOCUS_28500 553 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0770 1819 1196 gene locus_tag LOCUS_28510 1819 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence0771 446 838 gene locus_tag LOCUS_28520 446 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0772 546 241 gene locus_tag LOCUS_28530 546 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1188 634 gene locus_tag LOCUS_28540 1188 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence0773 1882 458 gene locus_tag LOCUS_28550 1882 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2275 2006 gene locus_tag LOCUS_28560 2275 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence0774 197 270 gene locus_tag LOCUS_t00290 197 270 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 879 1742 gene locus_tag LOCUS_28570 879 1742 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence0775 470 2176 gene locus_tag LOCUS_28580 470 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence0776 1326 772 gene locus_tag LOCUS_28590 1326 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_28590 2162 1581 gene locus_tag LOCUS_28600 2162 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence0777 850 200 gene locus_tag LOCUS_28610 850 200 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL4 protein_id gnl|my_center|LOCUS_28610 1345 1914 gene locus_tag LOCUS_28620 1345 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence0778 1494 736 gene locus_tag LOCUS_28630 1494 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence0779 3 251 gene locus_tag LOCUS_28640 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 306 899 gene locus_tag LOCUS_28650 306 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence0780 285 2201 gene locus_tag LOCUS_28660 285 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0781 4 497 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aattaatcgtacccattgtggaattgaaact 762 1007 gene locus_tag LOCUS_28670 762 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 2173 962 gene locus_tag LOCUS_28680 2173 962 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence0782 >Feature sequence0783 >Feature sequence0784 850 164 gene locus_tag LOCUS_28690 850 164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0785 >Feature sequence0786 <1 1090 gene locus_tag LOCUS_28700 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962729.1:cytochrome-c peroxidase 1616 1128 gene locus_tag LOCUS_28710 1616 1128 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_28710 1950 1627 gene locus_tag LOCUS_28720 1950 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence0787 392 1168 gene locus_tag LOCUS_28730 392 1168 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0788 823 392 gene locus_tag LOCUS_28740 823 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1290 2051 gene locus_tag LOCUS_28750 1290 2051 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence0789 >Feature sequence0790 1740 1030 gene locus_tag LOCUS_28760 1740 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence0791 1711 1022 gene locus_tag LOCUS_28770 1711 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0792 <2197 996 gene locus_tag LOCUS_28780 <2197 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A123:peptidylprolyl isomerase >Feature sequence0793 572 96 gene locus_tag LOCUS_28790 gene ndhJ 572 96 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC1 protein_id gnl|my_center|LOCUS_28790 2195 711 gene locus_tag LOCUS_28800 2195 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0794 <1 979 gene locus_tag LOCUS_28810 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963429.1:epimerase 1081 1644 gene locus_tag LOCUS_28820 1081 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence0795 1877 663 gene locus_tag LOCUS_28830 gene aspC1 1877 663 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_28830 >Feature sequence0796 2023 1091 gene locus_tag LOCUS_28840 2023 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence0797 799 1437 gene locus_tag LOCUS_28850 799 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 <2190 1485 gene locus_tag LOCUS_28860 <2190 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence0798 >Feature sequence0799 1134 826 gene locus_tag LOCUS_28870 1134 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105163.1 protein_id gnl|my_center|LOCUS_28870 1761 1135 gene locus_tag LOCUS_28880 1761 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121049.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence0800 584 192 gene locus_tag LOCUS_28890 584 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1398 751 gene locus_tag LOCUS_28900 gene rpe 1398 751 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_28900 <2185 1539 gene locus_tag LOCUS_28910 <2185 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase >Feature sequence0801 1468 986 gene locus_tag LOCUS_28920 1468 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence0802 659 96 gene locus_tag LOCUS_28930 659 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_28930 1052 780 gene locus_tag LOCUS_28940 1052 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 <2181 1111 gene locus_tag LOCUS_28950 <2181 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase >Feature sequence0803 >Feature sequence0804 2114 93 gene locus_tag LOCUS_28960 2114 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence0805 476 907 gene locus_tag LOCUS_28970 476 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1030 1422 gene locus_tag LOCUS_28980 1030 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence0806 <1 743 gene locus_tag LOCUS_28990 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762697.1:argininosuccinate synthase 896 1879 gene locus_tag LOCUS_29000 gene argC 896 1879 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_29000 >Feature sequence0807 214 1497 gene locus_tag LOCUS_29010 214 1497 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_29010 1540 1830 gene locus_tag LOCUS_29020 1540 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence0808 >Feature sequence0809 1211 435 gene locus_tag LOCUS_29030 1211 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence0810 302 682 gene locus_tag LOCUS_29040 302 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 783 1655 gene locus_tag LOCUS_29050 783 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence0811 1330 1019 gene locus_tag LOCUS_29060 1330 1019 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_29060 <2145 1359 gene locus_tag LOCUS_29070 <2145 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965473.1:glycosyl transferase >Feature sequence0812 252 776 gene locus_tag LOCUS_29080 252 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1864 809 gene locus_tag LOCUS_29090 1864 809 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence0813 392 904 gene locus_tag LOCUS_29100 392 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1827 916 gene locus_tag LOCUS_29110 1827 916 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence0814 >Feature sequence0815 834 37 gene locus_tag LOCUS_29120 834 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1215 913 gene locus_tag LOCUS_29130 1215 913 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_29130 1954 1334 gene locus_tag LOCUS_29140 1954 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence0816 384 1598 gene locus_tag LOCUS_29150 384 1598 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_29150 1591 2010 gene locus_tag LOCUS_29160 1591 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence0817 970 1995 gene locus_tag LOCUS_29170 970 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0818 >Feature sequence0819 223 489 gene locus_tag LOCUS_29180 223 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence0820 625 915 gene locus_tag LOCUS_29190 625 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1007 1294 gene locus_tag LOCUS_29200 1007 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1298 1594 gene locus_tag LOCUS_29210 1298 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0821 <1 738 gene locus_tag LOCUS_29220 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939580.1:O-unit flippase 755 1561 gene locus_tag LOCUS_29230 755 1561 CDS product methyltransferase FkbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389846.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence0822 <2102 111 gene locus_tag LOCUS_29240 <2102 111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence0823 326 1354 gene locus_tag LOCUS_29250 326 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence0824 >Feature sequence0825 <2099 315 gene locus_tag LOCUS_29260 <2099 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:periplasmic amidohydrolase >Feature sequence0826 984 265 gene locus_tag LOCUS_29270 984 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence0827 188 1015 gene locus_tag LOCUS_29280 188 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence0828 <1 1911 gene locus_tag LOCUS_29290 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA >Feature sequence0829 <1 894 gene locus_tag LOCUS_29300 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962829.1:ABC transporter ATP-binding protein <2078 913 gene locus_tag LOCUS_29310 <2078 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CGD8:homoserine dehydrogenase >Feature sequence0830 604 68 gene locus_tag LOCUS_29320 gene hslV 604 68 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 protein_id gnl|my_center|LOCUS_29320 1457 693 gene locus_tag LOCUS_29330 gene lptB 1457 693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_29330 1894 1541 gene locus_tag LOCUS_29340 1894 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0831 1 798 gene locus_tag LOCUS_29350 1 798 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_29350 <2062 1032 gene locus_tag LOCUS_29360 <2062 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073038.1:amidohydrolase >Feature sequence0832 1619 144 gene locus_tag LOCUS_29370 gene proS 1619 144 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_29370 >Feature sequence0833 >Feature sequence0834 >Feature sequence0835 769 251 gene locus_tag LOCUS_29380 769 251 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_29380 <2058 959 gene locus_tag LOCUS_29390 <2058 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFQ4:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence0836 1868 984 gene locus_tag LOCUS_29400 1868 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence0837 585 19 gene locus_tag LOCUS_29410 585 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2052 1183 gene locus_tag LOCUS_29420 2052 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence0838 8 1324 gene locus_tag LOCUS_29430 8 1324 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence0839 885 1238 gene locus_tag LOCUS_29440 885 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_29440 1293 1964 gene locus_tag LOCUS_29450 1293 1964 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence0840 1839 1102 gene locus_tag LOCUS_29460 1839 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence0841 1653 742 gene locus_tag LOCUS_29470 1653 742 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence0842 1887 1090 gene locus_tag LOCUS_29480 1887 1090 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002093008.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0843 989 543 gene locus_tag LOCUS_29490 989 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1718 1158 gene locus_tag LOCUS_29500 1718 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2009 1938 gene locus_tag LOCUS_t00300 2009 1938 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0844 316 1473 gene locus_tag LOCUS_29510 316 1473 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 protein_id gnl|my_center|LOCUS_29510 <2041 1475 gene locus_tag LOCUS_29520 <2041 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962301.1:acyltransferase >Feature sequence0845 725 1354 gene locus_tag LOCUS_29530 725 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_29530 1475 1789 gene locus_tag LOCUS_29540 1475 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence0846 1673 774 gene locus_tag LOCUS_29550 1673 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence0847 >Feature sequence0848 >Feature sequence0849 >Feature sequence0850 >Feature sequence0851 1745 804 gene locus_tag LOCUS_29560 1745 804 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_29560 2026 1859 gene locus_tag LOCUS_29570 2026 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence0852 596 934 gene locus_tag LOCUS_29580 596 934 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_29580 990 1868 gene locus_tag LOCUS_29590 gene arsM 990 1868 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence0853 <1 515 gene locus_tag LOCUS_29600 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967150.1:membrane protein 644 1444 gene locus_tag LOCUS_29610 644 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence0854 854 1852 gene locus_tag LOCUS_29620 854 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence0855 >Feature sequence0856 735 421 gene locus_tag LOCUS_29630 735 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1359 964 gene locus_tag LOCUS_29640 1359 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence0857 >Feature sequence0858 <1990 636 gene locus_tag LOCUS_29650 <1990 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0859 1259 33 gene locus_tag LOCUS_29660 1259 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 1846 1304 gene locus_tag LOCUS_29670 1846 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence0860 1148 255 gene locus_tag LOCUS_29680 1148 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 1498 1773 gene locus_tag LOCUS_29690 1498 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence0861 438 44 gene locus_tag LOCUS_tm00010 438 44 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 889 530 gene locus_tag LOCUS_29700 889 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence0862 783 301 gene locus_tag LOCUS_29710 gene rpsG 783 301 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_29710 1356 949 gene locus_tag LOCUS_29720 gene rpsL 1356 949 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_29720 >Feature sequence0863 <1 793 gene locus_tag LOCUS_29730 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39126:isocitrate dehydrogenase [NADP] 993 1565 gene locus_tag LOCUS_29740 993 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0864 288 638 gene locus_tag LOCUS_29750 288 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 642 878 gene locus_tag LOCUS_29760 642 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 868 1305 gene locus_tag LOCUS_29770 868 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1277 1534 gene locus_tag LOCUS_29780 1277 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0865 405 208 gene locus_tag LOCUS_29790 gene rpmI 405 208 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_29790 587 426 gene locus_tag LOCUS_29800 587 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1146 649 gene locus_tag LOCUS_29810 gene infC 1146 649 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_29810 1752 1573 gene locus_tag LOCUS_29820 1752 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence0866 >Feature sequence0867 >Feature sequence0868 209 1162 gene locus_tag LOCUS_29830 209 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1570 1253 gene locus_tag LOCUS_29840 1570 1253 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_29840 >Feature sequence0869 464 1495 gene locus_tag LOCUS_29850 464 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence0870 <1 1007 gene locus_tag LOCUS_29860 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase note possible pseudo, frameshifted >Feature sequence0871 <1 753 gene locus_tag LOCUS_29870 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:type I restriction endonuclease subunit R >Feature sequence0872 <1942 262 gene locus_tag LOCUS_29880 <1942 262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0873 726 1325 gene locus_tag LOCUS_29890 726 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence0874 >Feature sequence0875 1054 407 gene locus_tag LOCUS_29900 1054 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence0876 1681 665 gene locus_tag LOCUS_29910 gene trpD 1681 665 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_29910 >Feature sequence0877 632 1294 gene locus_tag LOCUS_29920 632 1294 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 protein_id gnl|my_center|LOCUS_29920 1759 1340 gene locus_tag LOCUS_29930 1759 1340 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence0878 1731 574 gene locus_tag LOCUS_29940 1731 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0879 265 191 gene locus_tag LOCUS_t00310 265 191 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 508 912 gene locus_tag LOCUS_29950 508 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence0880 <1 1710 gene locus_tag LOCUS_29960 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence0881 650 1000 gene locus_tag LOCUS_29970 650 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1133 1828 gene locus_tag LOCUS_29980 1133 1828 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence0882 1106 183 gene locus_tag LOCUS_29990 1106 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29990 >Feature sequence0883 494 78 gene locus_tag LOCUS_30000 494 78 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_30000 676 1161 gene locus_tag LOCUS_30010 676 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1262 1795 gene locus_tag LOCUS_30020 gene kdsC 1262 1795 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence0884 <1909 1403 gene locus_tag LOCUS_30030 <1909 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YW6:chaperone protein DnaK >Feature sequence0885 >Feature sequence0886 118 897 gene locus_tag LOCUS_30040 118 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_30040 887 1270 gene locus_tag LOCUS_30050 887 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_30050 1417 1884 gene locus_tag LOCUS_30060 1417 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence0887 1301 1849 gene locus_tag LOCUS_30070 gene pyrR1 1301 1849 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence0888 >Feature sequence0889 <1898 1307 gene locus_tag LOCUS_30080 <1898 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYZ5:Sec-independent protein translocase protein TatC >Feature sequence0890 <1 765 gene locus_tag LOCUS_30090 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966194.1:glycosyl transferase 1638 1063 gene locus_tag LOCUS_30100 1638 1063 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence0891 1629 769 gene locus_tag LOCUS_30110 gene menB 1629 769 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence0892 96 731 gene locus_tag LOCUS_30120 96 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 946 1530 gene locus_tag LOCUS_30130 946 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_30130 1517 1666 gene locus_tag LOCUS_30140 1517 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 >Feature sequence0893 1888 1649 gene locus_tag LOCUS_30150 1888 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence0894 1584 895 gene locus_tag LOCUS_30160 1584 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0895 717 1277 gene locus_tag LOCUS_30170 gene terD 717 1277 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence0896 <1886 609 gene locus_tag LOCUS_30180 <1886 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67365:polyamine aminopropyltransferase 2 >Feature sequence0897 1523 1125 gene locus_tag LOCUS_30190 1523 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1880 1737 gene locus_tag LOCUS_30200 1880 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence0898 1084 395 gene locus_tag LOCUS_30210 1084 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 <1879 1324 gene locus_tag LOCUS_30220 <1879 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963365.1:ATP-dependent DNA helicase RecQ >Feature sequence0899 91 1230 gene locus_tag LOCUS_30230 91 1230 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence0900 985 413 gene locus_tag LOCUS_30240 985 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1522 1004 gene locus_tag LOCUS_30250 1522 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence0901 285 809 gene locus_tag LOCUS_30260 285 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence0902 1565 96 gene locus_tag LOCUS_30270 gene asnS 1565 96 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_30270 >Feature sequence0903 750 1760 gene locus_tag LOCUS_30280 750 1760 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z38 protein_id gnl|my_center|LOCUS_30280 >Feature sequence0904 1172 465 gene locus_tag LOCUS_30290 1172 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence0905 <1 733 gene locus_tag LOCUS_30300 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0906 1572 37 gene locus_tag LOCUS_30310 1572 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence0907 868 272 gene locus_tag LOCUS_30320 868 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence0908 208 687 gene locus_tag LOCUS_30330 208 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 700 999 gene locus_tag LOCUS_30340 700 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1021 1803 gene locus_tag LOCUS_30350 1021 1803 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence0909 1661 564 gene locus_tag LOCUS_30360 gene ychF 1661 564 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_30360 >Feature sequence0910 92 862 gene locus_tag LOCUS_30370 92 862 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_30370 >Feature sequence0911 530 1213 gene locus_tag LOCUS_30380 530 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence0912 755 901 gene locus_tag LOCUS_30390 755 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1698 964 gene locus_tag LOCUS_30400 1698 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0913 901 1764 gene locus_tag LOCUS_30410 901 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence0914 <1 1143 gene locus_tag LOCUS_30420 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0915 >Feature sequence0916 <1 1715 gene locus_tag LOCUS_30430 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:cation transporter >Feature sequence0917 119 1135 gene locus_tag LOCUS_30440 gene cas1 119 1135 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_30440 1210 1473 gene locus_tag LOCUS_30450 gene cas2 1210 1473 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_30450 >Feature sequence0918 110 1048 gene locus_tag LOCUS_30460 110 1048 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_30460 1060 1578 gene locus_tag LOCUS_30470 1060 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence0919 <1 524 gene locus_tag LOCUS_30480 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226301.1:NAD-dependent epimerase 533 1390 gene locus_tag LOCUS_30490 533 1390 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0920 1242 796 gene locus_tag LOCUS_30500 1242 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence0921 1318 878 gene locus_tag LOCUS_30510 1318 878 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004417824.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence0922 1130 720 gene locus_tag LOCUS_30520 1130 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1426 1145 gene locus_tag LOCUS_30530 1426 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0923 1432 209 gene locus_tag LOCUS_30540 1432 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence0924 >Feature sequence0925 <1794 196 gene locus_tag LOCUS_30550 <1794 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P15005:5-methylcytosine-specific restriction enzyme B >Feature sequence0926 <1 1010 gene locus_tag LOCUS_30560 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJQ9:putative cytosol aminopeptidase >Feature sequence0927 >Feature sequence0928 270 1667 gene locus_tag LOCUS_30570 270 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence0929 >Feature sequence0930 1098 19 gene locus_tag LOCUS_30580 1098 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence0931 <1 1267 gene locus_tag LOCUS_30590 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118661.1:D-aminoacylase >Feature sequence0932 <1770 115 gene locus_tag LOCUS_30600 <1770 115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0933 767 1402 gene locus_tag LOCUS_30610 gene rplC 767 1402 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 protein_id gnl|my_center|LOCUS_30610 >Feature sequence0934 <1760 346 gene locus_tag LOCUS_30620 <1760 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476565.1:type III restriction endonuclease subunit R >Feature sequence0935 885 109 gene locus_tag LOCUS_30630 gene dltE 885 109 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence0936 1670 681 gene locus_tag LOCUS_30640 1670 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence0937 257 883 gene locus_tag LOCUS_30650 257 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence0938 >Feature sequence0939 1168 671 gene locus_tag LOCUS_30660 gene folK 1168 671 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence0940 279 1049 gene locus_tag LOCUS_30670 279 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence0941 1145 9 gene locus_tag LOCUS_30680 1145 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1340 >1749 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccaaaatgggtacgattaatt >Feature sequence0942 <1 805 gene locus_tag LOCUS_30690 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761420.1:zinc protease 891 1418 gene locus_tag LOCUS_30700 891 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence0943 827 949 gene locus_tag LOCUS_30710 827 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence0944 822 535 gene locus_tag LOCUS_30720 822 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1141 1467 gene locus_tag LOCUS_30730 1141 1467 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence0945 >Feature sequence0946 802 350 gene locus_tag LOCUS_30740 802 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1071 799 gene locus_tag LOCUS_30750 1071 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1383 1078 gene locus_tag LOCUS_30760 1383 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence0947 414 962 gene locus_tag LOCUS_30770 414 962 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence0948 20 1402 gene locus_tag LOCUS_30780 20 1402 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence0949 >Feature sequence0950 1500 88 gene locus_tag LOCUS_30790 1500 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0951 35 709 gene locus_tag LOCUS_30800 35 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1503 874 gene locus_tag LOCUS_30810 gene hisH 1503 874 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0952 537 160 gene locus_tag LOCUS_30820 gene gcvH 537 160 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N36 protein_id gnl|my_center|LOCUS_30820 >Feature sequence0953 991 578 gene locus_tag LOCUS_30830 991 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence0954 <1728 577 gene locus_tag LOCUS_30840 <1728 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A455:glutamate--tRNA ligase >Feature sequence0955 327 734 gene locus_tag LOCUS_30850 327 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1605 814 gene locus_tag LOCUS_30860 1605 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence0956 1207 569 gene locus_tag LOCUS_30870 1207 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0957 >Feature sequence0958 <1718 1215 gene locus_tag LOCUS_30880 <1718 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2I6:signal peptidase I >Feature sequence0959 1256 354 gene locus_tag LOCUS_30890 gene cysD 1256 354 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0960 >Feature sequence0961 1707 631 gene locus_tag LOCUS_30900 1707 631 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence0962 >Feature sequence0963 >Feature sequence0964 >Feature sequence0965 >Feature sequence0966 >Feature sequence0967 120 1118 gene locus_tag LOCUS_30910 120 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964022.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence0968 1 126 gene locus_tag LOCUS_30920 1 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 612 115 gene locus_tag LOCUS_30930 612 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1130 657 gene locus_tag LOCUS_30940 1130 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1553 1242 gene locus_tag LOCUS_30950 1553 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0969 1107 316 gene locus_tag LOCUS_30960 1107 316 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence0970 81 365 gene locus_tag LOCUS_30970 81 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 362 1180 gene locus_tag LOCUS_30980 362 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1241 1492 gene locus_tag LOCUS_30990 1241 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence0971 <1689 910 gene locus_tag LOCUS_31000 <1689 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter >Feature sequence0972 1105 101 gene locus_tag LOCUS_31010 1105 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0973 >Feature sequence0974 101 1216 gene locus_tag LOCUS_31020 101 1216 CDS product anticodon nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0975 543 692 gene locus_tag LOCUS_31030 543 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 742 948 gene locus_tag LOCUS_31040 742 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 <1676 996 gene locus_tag LOCUS_31050 <1676 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875552.1:type I restriction endonuclease subunit S >Feature sequence0976 112 184 gene locus_tag LOCUS_t00320 112 184 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 342 1142 gene locus_tag LOCUS_31060 342 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1417 1145 gene locus_tag LOCUS_31070 1417 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence0977 548 1504 gene locus_tag LOCUS_31080 548 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence0978 1212 1051 gene locus_tag LOCUS_31090 1212 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 1326 1640 gene locus_tag LOCUS_31100 1326 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 1424 789 gene locus_tag LOCUS_31110 1424 789 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence0982 946 794 gene locus_tag LOCUS_31120 946 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence0983 1454 378 gene locus_tag LOCUS_31130 1454 378 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence0984 >Feature sequence0985 <1 1533 gene locus_tag LOCUS_31140 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q08408:sensor protein RprX >Feature sequence0986 >Feature sequence0987 194 895 gene locus_tag LOCUS_31150 194 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 898 1371 gene locus_tag LOCUS_31160 898 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence0988 <1 1116 gene locus_tag LOCUS_31170 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0989 336 1262 gene locus_tag LOCUS_31180 336 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0990 <1 695 gene locus_tag LOCUS_31190 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964437.1:FAD-dependent oxidoreductase 986 699 gene locus_tag LOCUS_31200 986 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1520 1041 gene locus_tag LOCUS_31210 1520 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0991 1401 64 gene locus_tag LOCUS_31220 gene ffh 1401 64 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_31220 >Feature sequence0992 <1 517 gene locus_tag LOCUS_31230 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920504.1:DNA mismatch repair protein MutT 1461 901 gene locus_tag LOCUS_31240 gene terD 1461 901 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence0993 452 664 gene locus_tag LOCUS_31250 452 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 720 1112 gene locus_tag LOCUS_31260 720 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence0994 94 417 gene locus_tag LOCUS_31270 94 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 448 966 gene locus_tag LOCUS_31280 448 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31280 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 92 901 gene locus_tag LOCUS_31290 92 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence0998 246 932 gene locus_tag LOCUS_31300 246 932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence0999 <1 582 gene locus_tag LOCUS_31310 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU1:elongation factor Ts 847 1131 gene locus_tag LOCUS_31320 847 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1131 1571 gene locus_tag LOCUS_31330 1131 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence1000 1301 339 gene locus_tag LOCUS_31340 1301 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence1001 343 501 gene locus_tag LOCUS_31350 343 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 664 1425 gene locus_tag LOCUS_31360 664 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31360 >Feature sequence1002 <1618 127 gene locus_tag LOCUS_31370 <1618 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:two-component system response regulator >Feature sequence1003 >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 1428 115 gene locus_tag LOCUS_31380 1428 115 CDS product glycosyl transferase group 1/2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546575.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence1008 >Feature sequence1009 1099 521 gene locus_tag LOCUS_31390 1099 521 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_31390 1610 1215 gene locus_tag LOCUS_31400 1610 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 440 1318 gene locus_tag LOCUS_31410 440 1318 CDS product putative ABC transporter antibiotic-transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702595.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence1013 780 1439 gene locus_tag LOCUS_31420 780 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 918 34 gene locus_tag LOCUS_31430 918 34 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_31430 <1599 919 gene locus_tag LOCUS_31440 <1599 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097863.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase >Feature sequence1017 1432 833 gene locus_tag LOCUS_31450 1432 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence1018 1300 578 gene locus_tag LOCUS_31460 1300 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence1019 <1594 1001 gene locus_tag LOCUS_31470 <1594 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082491.1:phospholipase >Feature sequence1020 712 1314 gene locus_tag LOCUS_31480 712 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence1021 457 612 gene locus_tag LOCUS_31490 457 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1161 667 gene locus_tag LOCUS_31500 1161 667 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence1022 1551 256 gene locus_tag LOCUS_31510 gene pepP 1551 256 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence1023 56 529 gene locus_tag LOCUS_31520 56 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence1024 1308 10 gene locus_tag LOCUS_31530 gene pabB 1308 10 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence1025 307 837 gene locus_tag LOCUS_31540 307 837 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709479.1 protein_id gnl|my_center|LOCUS_31540 1042 1536 gene locus_tag LOCUS_31550 1042 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence1026 <1 1259 gene locus_tag LOCUS_31560 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071882.1:membrane protein >Feature sequence1027 <1 1121 gene locus_tag LOCUS_31570 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108281.1:threonine synthase 1575 1162 gene locus_tag LOCUS_31580 1575 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence1028 99 923 gene locus_tag LOCUS_31590 gene cheR 99 923 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence1029 >Feature sequence1030 1445 252 gene locus_tag LOCUS_31600 1445 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence1031 376 1389 gene locus_tag LOCUS_31610 376 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence1032 <1 1009 gene locus_tag LOCUS_31620 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405148.1:peptidyl-prolyl cis-trans isomerase >Feature sequence1033 <1 981 gene locus_tag LOCUS_31630 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44414:putative modification methylase HindII >Feature sequence1034 200 400 gene locus_tag LOCUS_31640 200 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 <1 969 gene locus_tag LOCUS_31650 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963433.1:sodium:solute symporter <1567 971 gene locus_tag LOCUS_31660 <1567 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404681.1:TIGR00159 family protein >Feature sequence1038 <1 1341 gene locus_tag LOCUS_31670 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962336.1:ATP-dependent helicase >Feature sequence1039 2 349 gene locus_tag LOCUS_31680 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 <1563 577 gene locus_tag LOCUS_31690 <1563 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A100:adenylosuccinate lyase >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 1318 503 gene locus_tag LOCUS_31700 1318 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence1044 250 29 gene locus_tag LOCUS_31710 250 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1234 482 gene locus_tag LOCUS_31720 1234 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence1045 <1 552 gene locus_tag LOCUS_31730 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence1046 633 998 gene locus_tag LOCUS_31740 633 998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_31740 1019 1471 gene locus_tag LOCUS_31750 1019 1471 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence1047 291 968 gene locus_tag LOCUS_31760 291 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence1048 46 816 gene locus_tag LOCUS_31770 gene kdsB 46 816 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_31770 <1518 895 gene locus_tag LOCUS_31780 <1518 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098369.1:XRE family transcriptional regulator >Feature sequence1049 >Feature sequence1050 1253 1026 gene locus_tag LOCUS_31790 1253 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1442 1368 gene locus_tag LOCUS_t00330 1442 1368 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1051 921 349 gene locus_tag LOCUS_31800 921 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1434 997 gene locus_tag LOCUS_31810 1434 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence1052 <1 1157 gene locus_tag LOCUS_31820 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388424.1:histidine kinase 1512 1375 gene locus_tag LOCUS_31830 1512 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence1053 <1 680 gene locus_tag LOCUS_31840 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence1054 309 767 gene locus_tag LOCUS_31850 309 767 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_31850 1211 996 gene locus_tag LOCUS_31860 1211 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence1055 795 337 gene locus_tag LOCUS_31870 795 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence1056 >Feature sequence1057 702 1244 gene locus_tag LOCUS_31880 702 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence1058 322 125 gene locus_tag LOCUS_31890 322 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 606 421 gene locus_tag LOCUS_31900 606 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1090 620 gene locus_tag LOCUS_31910 1090 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence1059 >Feature sequence1060 <1500 713 gene locus_tag LOCUS_31920 <1500 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase >Feature sequence1061 682 23 gene locus_tag LOCUS_31930 682 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 1249 845 gene locus_tag LOCUS_31940 1249 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940