COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..55833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1439..2134) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(2792..2983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3255..3737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 4045..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 6489..7379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7366..8394 product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 8401..9177 product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQ69 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene hmuV CDS complement(9703..12564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(12564..14168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(14161..15378) product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(15391..16581) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene aspC CDS complement(16698..18143) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(18196..21180) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 21348..22472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(22589..23944) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene RspA CDS complement(24566..25504) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(25507..26904) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(26919..27677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 note possible pseudo, frameshifted CDS complement(27713..30373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 note possible pseudo, frameshifted CDS complement(30591..31631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(31838..32428) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(32567..32791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(32701..33462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 34007..34648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 34716..35852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(35953..37221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(37222..39033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(39052..42231) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 42456..43070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 43242..43841 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 43929..44951 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 45169..48573 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 48678..50201 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 50861..51421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(51466..51801) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 51933..52355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 52632..52991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 note possible pseudo, frameshifted CDS 53075..53473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 note possible pseudo, frameshifted CDS 53629..53991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 54008..54589 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 54836..55459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 sequence002 source 1..48506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(894..967) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 1172..2455 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 2455..3324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 3447..3650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 3924..6287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 6673..7011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 7080..7400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 7390..7629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 8017..8265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 8258..8512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 8512..8886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 8940..11390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 11633..12091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 12110..12688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(12864..13028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(13221..14129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(14138..14356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(14852..15667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(15834..16145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(16203..16376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(16436..16663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 16824..17522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 17683..17868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 tRNA complement(17944..18020) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 18179..19150 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene accA CDS 19297..20076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 20170..20643 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 20742..21122 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(21218..22528) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene tyrS CDS 22763..23908 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(23917..25209) product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(25287..25877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(25890..26864) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene etfA CDS complement(26999..27736) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene etfB CDS 27827..28147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 28262..28816 product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(28825..29574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 29799..31064 product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 31110..32420 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene bfmBB CDS complement(32586..33095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 33494..33781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 33839..35707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 35744..37678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(37718..38581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(38706..40325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(40315..41010) product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(41070..41741) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(41946..42551) product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HD0 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 42718..43551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 44040..44330 product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 44475..47492 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 47593..48129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 sequence003 source 1..41506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1929..2375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 2599..3606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 3711..4547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(4554..5336) product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(5503..7494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 7811..8809 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 8938..9585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 9985..13086 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 13105..14601 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 15240..16667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 16859..17080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 17530..18027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(18032..19804) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene glnS CDS 20910..21947 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(21982..22362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 22525..24330 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene lepA CDS 24375..24545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, internal stop codon CDS 24606..25256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 note possible pseudo, internal stop codon CDS 25257..25877 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene queE CDS 25979..26878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 26994..27239 product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene rpmE2 CDS 27350..28531 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 28528..29448 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ26 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene hemC CDS 29522..30376 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 30422..31339 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(31451..32476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 33169..34695 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 34856..36379 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(36383..38314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(38612..39235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 tRNA 39444..39519 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 39805..40056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 40163..40396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 40595..41068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 sequence004 source 1..40464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1163 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122409.1:9-O-acetylesterase locus_tag LOCUS_01250 CDS 1560..2687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 2746..4113 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene xylE CDS 4190..5215 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 5255..6592 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene xylE CDS 6765..8321 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(8338..8499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 note possible pseudo, frameshifted CDS complement(8486..8827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(8847..9962) product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene nagX CDS 10381..12975 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122368.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 12983..13744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 13756..14016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(14066..14449) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(14653..15198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(15195..15701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 15944..16924 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(17011..18633) product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(18722..20428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(20446..23859) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(24019..25041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(25210..25890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(26095..27582) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(27585..29225) product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(29240..32623) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 33995..34222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 34288..34554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 34840..35127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 35570..37759 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 37761..39794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 39797..40456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 sequence005 source 1..37928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..1493 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 1490..2392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 2467..3036 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(3094..3432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(3644..4417) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(4570..6237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(6970..7977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(7994..8365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 8872..10506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(12434..14164) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(14779..15183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(15326..15607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 note possible pseudo, frameshifted CDS complement(15600..16706) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene adh CDS complement(16717..17298) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 17504..18796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 18991..22311 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 22322..23797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 23960..24712 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(25011..25217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(25279..25848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 26238..27707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(27985..30375) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(30616..31008) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(31005..31298) product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(31471..31875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 note possible pseudo, frameshifted CDS complement(32113..32421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 note possible pseudo, internal stop codon, frameshifted CDS complement(32476..32778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 note possible pseudo, internal stop codon, frameshifted CDS complement(32947..35373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(35548..37563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 sequence006 source 1..37614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1206..2660) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(2687..5761) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(6025..9390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(9685..10887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(11208..13004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 13255..14121 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 14218..15507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(15734..16441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(16729..16926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(16967..18421) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(18421..19791) product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(19814..21979) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(22023..22697) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 23574..24806 product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 24799..25056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(25066..25368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 note possible pseudo, internal stop codon CDS complement(25468..26277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 note possible pseudo, internal stop codon CDS complement(26270..28321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(28318..29151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(29151..31895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(32093..33337) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 33768..34607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(34704..35696) product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 36033..36227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 36298..37203 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 sequence007 source 1..37532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 610..1002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 1029..3626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 3751..4173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 4170..4529 product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(4579..5580) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene oruR CDS 5661..6116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(6204..6773) product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(6916..7326) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 7465..8442 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 8816..9523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(9915..10550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(11031..12104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 12467..13309 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 13372..13845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 13983..14882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(14905..15873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(16186..16551) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 16717..17250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 17328..17495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 17485..18222 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 18226..18882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 18879..19247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 19410..20567 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 20648..21475 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 21480..21986 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJU0 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ogt CDS 22133..23152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 23381..24544 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 24621..25208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 25201..26031 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 26043..27104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 27286..27510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 27512..28900 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 29096..29494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 29780..30442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 30509..31558 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(31631..32830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 33073..34170 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(34201..35196) product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 35385..35906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(36379..37254) product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 sequence008 source 1..35742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9491..10225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(10203..11129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 11255..12607 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene rimO CDS 12597..14165 product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene bshC CDS 14162..14749 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene ygfA CDS 15285..16832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 17294..18634 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 18634..20106 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 20259..21029 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN3 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(21165..23993) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(24050..27379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(27538..28968) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 29007..29894 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 30170..33352 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 33356..34942 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 sequence009 source 1..33906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(319..1581) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(1721..2434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(2741..2926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(2916..3575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 3691..4491 product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 4633..6474 product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(6795..7850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 8436..10817 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(10854..11882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(12200..13381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(13378..14193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(14197..15168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(15202..17067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(17084..17521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(17532..19403) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(19489..20022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(20230..20481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(20809..21219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(21240..21728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(21769..23157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(23213..23659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(23748..26222) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 26490..27320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(27344..28018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(28207..30399) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 31420..33528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, frameshifted sequence010 source 1..33665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 1254..2462 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN80 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene uxuA CDS 2587..3312 product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUL8 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene cmoA CDS 3312..4019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(4072..5064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(5271..5999) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(6057..6233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(6251..7657) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene hslU CDS complement(7748..8764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 8863..9771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 9852..10244 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(10277..10678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 10777..12870 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 13285..15750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 15832..16899 product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(16896..17282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 17705..18532 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene panB CDS 18717..19055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 19254..20627 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(20619..23177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 23639..24223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(24230..24604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 24803..26527 product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(26583..27365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(27459..28952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 29578..29712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 29702..30832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 31091..31765 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene msrA sequence011 source 1..31446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..1086) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene cysD CDS complement(1100..1696) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VR1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene cysC CDS complement(1774..2643) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene prmC CDS 2688..3662 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ribD CDS complement(3652..4137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 4345..7761 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene mfd CDS 8117..9238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 9477..10019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 10023..11672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(11697..12374) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 12486..12845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 12852..13616 product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 13702..17001 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 17006..17407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 17407..17847 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene ybeY CDS 18044..19942 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene mnmG CDS 19963..20565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 20722..21294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 21347..23407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 23850..25640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(25927..26769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 tRNA complement(26803..26878) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(26918..27985) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(27987..28697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(28790..30043) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 sequence012 source 1..30711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1728 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_03440 CDS 1769..2311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 2488..2850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 2998..6090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 6196..7101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 7108..7545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 7602..8234 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(8293..9378) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene recA CDS 9702..10658 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 11023..11784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(11781..12227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 12418..12906 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 13028..13810 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 14001..16103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(16163..18700) product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene clpC CDS complement(18814..19449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(19464..20093) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 20238..21272 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 21272..21682 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 tRNA 21763..21848 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(22819..24315) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(24446..25879) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(26058..27500) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(27526..30006) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 note possible pseudo, frameshifted misc_feature complement(29961..>30711) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202162.1:SusC/RagA family TonB-linked outer membrane protein note possible pseudo, frameshifted locus_tag LOCUS_03670 sequence013 source 1..30689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..1171) product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(1180..2133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(2215..6357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(6677..6934) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rpmA CDS complement(6965..7798) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P9 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene rplU CDS 8326..9321 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene nrdB CDS 9350..11800 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene nrdA CDS 12113..13021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 13207..13551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 13551..13955 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene vapC CDS 14021..14296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 14463..14696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(14759..15493) product putative insertion sequence ATP-binding protein y4pL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55617 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(15519..17003) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 17273..17458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 17604..17885 product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 17888..18187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 18401..18820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(18862..19722) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(19827..20438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 20540..22138 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(22202..23227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(23292..23774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(23939..24634) product transcriptional regulatory protein WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37478 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene walR CDS complement(24631..26217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(26274..27758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(27761..29143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 sequence014 source 1..30318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1011..3293 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 3438..4250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 4264..5640 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(6228..7361) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(7992..9023) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(9629..10801) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(10850..11632) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene fabG CDS complement(11663..12931) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(12971..14404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(14466..15896) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(15932..18946) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 19664..22057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(22799..25540) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(25530..25949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 26536..27138 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 27135..27443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 27436..27906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 28334..29266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 29275..29928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 sequence015 source 1..30060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 867..1823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 note possible pseudo, internal stop codon CDS 2064..2393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 2631..3545 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLG7 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(3587..4399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 4669..5232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(5219..6871) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 6955..7530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(7532..8920) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(8993..9442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 9566..10081 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene apt CDS complement(10078..10776) product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene fabG CDS 11107..11406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 note possible pseudo, internal stop codon CDS 11428..13035 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 note possible pseudo, internal stop codon CDS 13104..14396 product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRR9 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 14417..15928 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(15938..16255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(16248..17606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 17753..18379 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 18376..19602 product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 19692..20993 product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 20997..21824 product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(21807..23423) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene lig2 CDS 23931..24200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(24203..26971) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene leuS CDS complement(27036..27962) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(27983..28768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 28847..29341 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 transl_table 11 codon_start 1 locus_tag LOCUS_04400 sequence016 source 1..30003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1188..1700) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(2687..4657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 4942..5571 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 5750..7153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(7185..7649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(7695..8642) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(8648..9820) product poly(glycerol-phosphate) alpha-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(9828..10445) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 10490..10642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(11698..12921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(12946..14190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(14183..15325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(15482..16786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(16764..17648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(17754..20093) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene wzc CDS complement(20100..20750) product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(21455..22189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(22177..23571) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(23574..26543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(26549..29098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(29156..29344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 note possible pseudo, frameshifted misc_feature complement(29275..>30003) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203677.1:membrane protein note possible pseudo, frameshifted locus_tag LOCUS_04620 sequence017 source 1..29492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1153..2280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(2277..2996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(3080..3415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(3432..4202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(4275..5063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(5211..6224) product N-acetylneuraminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(6228..7229) product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(7229..7885) product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(7891..8793) product citrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(8790..9251) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(9233..10060) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(10393..11142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(11120..11902) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(11899..12783) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(12967..13176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(13203..14222) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(14230..15432) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(15436..16446) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(16703..17953) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene xapH CDS complement(17960..18787) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(18791..19804) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene uge CDS complement(19816..21090) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene wbpO CDS complement(21087..22343) product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(22387..24924) product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 25496..28291 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 28403..29350 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 sequence018 source 1..28423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1404 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202376.1:transposase locus_tag LOCUS_04890 CDS 1397..2386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 2603..3211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 3208..3978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 4113..5120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 5136..5957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 5970..6782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 6794..7591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 7603..8166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 8232..9215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(10090..10932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(10945..11799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(11870..12658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(12655..13197) product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(13329..14138) product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene blaA CDS complement(14267..15025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 15157..15831 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 15868..16218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(16244..16840) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(16834..17820) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(17951..18172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(18207..19463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(19836..20291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 21011..21649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 22227..22724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 22902..23813 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 23877..24641 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 24641..25666 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 sequence019 source 1..28375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1512..2540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(2545..3468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 3596..5035 product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(5100..9761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 10410..11735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(11718..11927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(12055..12579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(12920..15529) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene parC CDS complement(15620..17491) product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene parE CDS complement(17625..18386) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene phnP CDS complement(18383..18658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(18718..19095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(19088..22765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 22843..23769 product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene miaA1 CDS 23780..25348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(25387..26130) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(26152..27402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene porV misc_feature complement(27404..>28375) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 locus_tag LOCUS_05340 sequence020 source 1..27155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(594..2276) product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(2855..3805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762717.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(4079..5563) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(5581..9072) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(9179..10132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(10303..10902) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 11168..11728 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene mogA CDS 11768..13027 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene bla CDS 13432..14034 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 14031..15401 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 15420..16520 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 16527..18101 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(18346..18666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(18721..19929) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene moeA CDS complement(20020..20664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 21034..21693 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 21777..22274 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene moaC sequence021 source 1..26630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2259..4523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 4537..7161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(7164..8384) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene der CDS 8349..8540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(8628..9521) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene era tRNA 9598..9671 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(10108..10554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 10654..11106 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(11156..11554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(11566..12387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(12391..13071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 13335..13937 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 14503..15135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 15230..15403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(15461..15778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(15823..16020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 16166..16837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(16914..17240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(17311..18372) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(18738..19724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(19724..21178) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(21435..23171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(23405..25867) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene lon sequence022 source 1..26545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(840..1715) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(1809..3725) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(3900..5348) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 5527..5979 product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CY8 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene bcp CDS complement(6060..6716) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene lolD CDS 6786..7991 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene sucC CDS complement(8051..8917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(9149..9586) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(9700..10170) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene smpB CDS 10434..11690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(11687..12739) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene tsaD CDS 12822..17402 product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(17405..17707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 17785..18207 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 18207..19391 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene metZ CDS complement(19455..19700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(19720..21042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(21507..22301) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene cobA CDS complement(22298..24415) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(24755..25078) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5L0 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(25176..26045) product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene udp misc_feature complement(26045..>26545) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946491.1:acetyltransferase locus_tag LOCUS_05950 sequence023 source 1..26393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2251..2622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(2877..3293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(3290..4498) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BY0 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene csdB CDS complement(4790..5392) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(5634..6098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(6243..8375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(8924..9604) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene pcm CDS 9676..10110 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 10203..11597 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 11818..13479 product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 13589..14512 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(14509..15303) product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(15355..16320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(16374..17225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(17504..18247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(18394..19308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(19461..19823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(20647..21102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 21089..21292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(21414..21938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 22226..23776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 23819..24781 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 sequence024 source 1..26048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4873..5754) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 5905..6945 product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 6966..7409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 7409..7750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(7753..11292) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene smc CDS 11621..12148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 12281..12421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 12445..13113 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 13273..13941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 14189..14851 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 14996..15655 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 15704..16117 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 16114..17091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 17152..18015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 18012..19610 product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 19757..21322 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 21513..21881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(21946..23031) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(23041..24159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(24208..24816) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ruvC sequence025 source 1..25926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7070..7825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 8137..8766 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 8792..10129 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 10153..11343 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 11358..14777 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 14855..16093 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(16090..17550) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene dnaA CDS 18131..19879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 19869..22007 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(22128..24398) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene acn CDS 24498..25436 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 sequence026 source 1..25888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..1764 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 1801..2553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 2641..3531 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 3579..4565 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 4670..5572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(5508..6797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(7037..8158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(8155..9192) product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(9245..10504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(10728..11561) product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(11618..13033) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene wcaJ CDS complement(13644..14432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(14419..15960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(16154..17269) product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(17266..19434) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene ndhF CDS complement(19562..20752) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene hisC CDS 21121..22947 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene ansB CDS 23098..24333 product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(24308..25258) product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene gldB sequence027 source 1..25126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..786 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(847..1287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(1277..1621) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6Z7 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rsbV_2 CDS complement(1665..3749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(3921..5390) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene guaB CDS 5547..6272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 6405..7298 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F132 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene dapA CDS 7361..7723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 7802..8788 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 8858..9640 product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 9784..10866 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 11420..12283 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rpoD CDS complement(13035..14105) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(14621..14812) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 15859..17028 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(17122..19092) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(19099..19992) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene porP CDS complement(19998..24491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 sequence028 source 1..24107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..874 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:RND transporter locus_tag LOCUS_06860 CDS 867..2018 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene ragD CDS 2039..2566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 2585..3022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 3093..3683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(5152..5529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 note possible pseudo, frameshifted CDS complement(5777..5980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(6179..7510) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(7579..10527) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(10922..11695) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(12221..13456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(13521..14192) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(14206..15216) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(15213..16430) product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7G6 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene pfp CDS complement(16553..17590) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(17825..18577) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(18599..19366) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(19386..20678) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(20662..21036) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(21023..23278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(23275..23553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 sequence029 source 1..24075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(517..1152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 1357..3003 product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 3236..4393 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 4453..5508 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31764 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene galT CDS complement(5555..9601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(9749..10150) product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene blaI CDS 10368..10736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(11143..13749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 14130..15374 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 15371..16294 product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene rsgA2 CDS complement(16295..16831) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 17036..17743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(17745..19346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 19498..22449 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(22446..22730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 22893..23672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 sequence030 source 1..24029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..981 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963504.1:glycosyl transferase locus_tag LOCUS_07230 CDS 978..1895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 1917..2921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 3008..3829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(3851..4627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 5230..5649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 6009..7679 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 7694..8803 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 8811..9986 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 9989..11665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 11677..12774 product glycosyl hydrolase family 88 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 12788..14014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 14203..15000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 15115..16215 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 16309..17448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 17474..18988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 19372..20745 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene wcaJ CDS complement(20754..21989) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(22014..22982) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 23098..23898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 sequence031 source 1..23919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2778..2954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 3058..3744 product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 3758..5692 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene sdhA CDS 5694..6455 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene sdhB CDS complement(6617..8257) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene groL CDS complement(8293..8571) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene groS CDS 8823..9539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(9566..10894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(11125..11517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(11518..12486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(12508..12972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(13046..14407) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(14425..15891) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene miaB CDS 16252..16710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(16765..18033) product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(18030..18797) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(18800..19837) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(20028..20618) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene ilvH CDS complement(20671..22458) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene ilvB CDS complement(22493..23911) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene ilvD sequence032 source 1..23808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1924..2259 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 2466..2852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(3006..3467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(3635..4978) product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(5094..5336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 5497..6564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 6726..7097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 7081..7473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(7540..8154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(8515..9282) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(9341..10072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 10360..11430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(11439..12092) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene trmB CDS complement(12096..13403) product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 13942..14676 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene lptB CDS 14683..16218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(16241..16774) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene scpB CDS complement(16875..17255) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(17409..18716) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(19010..20599) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(20635..23655) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 sequence033 source 1..23680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(449..1162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(1159..1950) product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTH1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene maiA CDS complement(2109..3353) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(3416..3763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(4008..4778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 5193..5405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(5762..6241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(6241..7155) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(7273..7431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 7448..10414 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 10491..11732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(11847..12632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(12931..15309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 15584..16054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 16347..19055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 19254..20606 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 20687..21094 product NH2-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(21150..21524) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(21582..22544) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence034 source 1..23460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..504 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D5CE34:putative aminoacrylate peracid reductase RutC locus_tag LOCUS_08030 CDS 716..1657 product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 1899..3827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 note possible pseudo, internal stop codon CDS 3891..4904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 5073..6749 product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 6951..8486 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(8503..9879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(10176..12056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(12123..13550) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(13569..15455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 note possible pseudo, internal stop codon CDS complement(15468..17027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(17176..18201) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(18270..18887) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YK9 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(19171..19386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 19562..20845 product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 21077..21865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(21879..22250) product branched-chain alpha-keto acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 22418..23305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 sequence035 source 1..23306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(516..1181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(1603..1803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(1865..2437) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 2682..3257 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 3354..4418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 4495..7944 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 7944..9476 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(9698..9913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 9806..12817 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 12864..13925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 14001..14852 product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 15060..15854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(15885..17477) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(17725..17919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(18581..19165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(19083..19454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(19471..19947) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(20061..20903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 21166..22284 product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 22516..23112 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 sequence036 source 1..23214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(1633..2337) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 2436..3404 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 3382..4266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 4377..5039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 5043..6173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 6192..7178 product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 7178..8509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 8827..9954 product cobalt/magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ31 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene corA CDS 10043..11269 product fosmidomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 11364..11975 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(11982..12737) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(13057..14202) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 14418..15749 product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 15784..16539 product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 16599..16964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 16982..18451 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(18465..19964) product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(20375..21061) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene trmD CDS 21175..21936 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene tpiA CDS 21989..22819 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene prmA sequence037 source 1..23010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 749..2035 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(2104..2727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(2871..3557) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(3563..4579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 4825..5601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 5673..6458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 6465..7169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(7197..8180) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(8171..8626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 8842..9753 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 9761..10753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 10781..12076 product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene gci CDS complement(12090..13052) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 13392..14339 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 14413..14967 product ribosomal protein S5 alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene rimJ CDS 15113..18451 product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 18585..19451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 19575..20912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 21126..22646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 sequence038 source 1..22844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108894.1:dehydrogenase locus_tag LOCUS_08820 CDS complement(984..1268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(1481..2011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 2471..3037 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 3105..5501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 tRNA 5556..5630 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(5769..6752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(6745..8658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 8811..9710 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 9721..10365 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(10376..10795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 11536..11784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 12143..12610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 12591..13676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 note possible pseudo, frameshifted CDS 13760..14977 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FK0 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene sbcD CDS 15014..18091 product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSF5 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene sbcC CDS 18234..20084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(20081..21409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(21522..21971) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(22107..22553) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 sequence039 source 1..22752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..825 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_09010 CDS complement(826..1296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(1467..2234) product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(2324..3688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(3801..5111) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(5104..5637) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(5750..6430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(6993..9347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(9592..10194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 10338..11567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 tRNA complement(11664..11738) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 11994..13472 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 13799..14215 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(14872..16311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(17117..18019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(18171..18770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 tRNA complement(19594..19668) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(19710..20315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 20381..20719 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ogt2 CDS 20773..21531 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 misc_feature complement(21589..>22752) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF locus_tag LOCUS_09190 sequence040 source 1..22687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109196.1:zinc protease locus_tag LOCUS_09200 CDS complement(1033..4209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 4629..5141 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 5398..6273 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 6387..7235 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 7276..8679 product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(8748..10385) product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(10417..12072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 note possible pseudo, frameshifted CDS complement(12138..13655) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(13714..15456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(15531..16973) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(17065..20442) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(20469..21479) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(21683..22297) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 sequence041 source 1..22527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..1549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1804..2373 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTP9 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 2456..3814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(3975..5585) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene rny CDS complement(5702..5989) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(6000..6299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(6404..8827) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene pheT CDS complement(9055..9621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 10015..11043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 11360..11761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 11777..12421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 12435..13895 product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 14102..14368 product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 14508..14741 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 14748..15425 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rsmI CDS 15433..17049 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene lnt CDS 17049..17855 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 17978..18535 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene tag CDS complement(18537..18833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(18871..21699) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene carB sequence042 source 1..22484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1500..2879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 note possible pseudo, frameshifted CDS 2946..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 note possible pseudo, frameshifted CDS 4834..5388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 5385..6458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 6462..7172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 7322..8806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 8883..13895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(13940..14893) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene pyrB CDS complement(14897..15445) product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene pyrR1 CDS complement(15568..17085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 17328..18344 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 18690..20099 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 sequence043 source 1..22370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..1066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1379..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 2088..4040 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 4197..5408 product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(5410..6135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(6422..7516) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene ychF CDS complement(7529..8572) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(8719..9108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 9369..10271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(10349..10693) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene fdx1 CDS 10877..11908 product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(11918..13519) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 13677..14102 product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 misc_feature complement(14162..>22370) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_09790 sequence044 source 1..22169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1703..2668) product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(2874..3236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 3609..4952 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(4957..6264) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene phrB1 CDS 6406..7632 product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene icd CDS complement(7709..8071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 8522..9478 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAV8 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene sua5 CDS complement(9513..9704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 10075..11376 product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene nqrF CDS 11471..12643 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene fjo29 CDS 12659..13276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(13376..15232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(15257..16744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(16840..18282) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(18410..18865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 19473..19814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(19871..20320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 20789..20986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 sequence045 source 1..21932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(660..2096) product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene gntP CDS complement(2253..3608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(3748..4488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, internal stop codon CDS complement(4546..5115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 note possible pseudo, internal stop codon CDS complement(5210..6772) product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(6777..10160) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(10373..11365) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(11522..12079) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 tRNA 12457..12532 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(12759..13349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(13418..14680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(14682..15287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(15481..15666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 16306..16749 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 16770..17702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 18023..19495 product methylmalonate-semialdehyde dehydrogenase (CoA acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 19559..20332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 20349..21425 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 21412..21813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 sequence046 source 1..21878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2493 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin locus_tag LOCUS_10170 CDS 2539..2838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 2944..4185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 4251..5108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 5444..8326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(8987..9457) product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUI7 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene cheD CDS complement(9494..10393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(10390..11235) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E21 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene cheR34H CDS complement(11313..13013) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene mcp34H-6 CDS complement(13047..14339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(14363..14866) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene cheW34H-1 CDS 15419..16153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 16146..17696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 17686..18321 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 18463..19158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 19158..19952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 19955..20245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 20258..20623 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene cheY34H-1 sequence047 source 1..21875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1204..2181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 2696..3838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 4379..5749 product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 5860..6672 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 6777..8957 product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(9234..10019) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene glpQ CDS complement(10468..10917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 11546..11725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 11722..12984 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(13104..13397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(13777..15567) product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 15863..16474 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 16515..18383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 18506..19261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 19329..20216 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(20213..21289) product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene cydB sequence048 source 1..21763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1408..2322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(2329..2853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 3177..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 4204..4779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 4804..5529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 5549..6319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(6356..9352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(9648..10649) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 11068..14751 product two-component system sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, internal stop codon, frameshifted CDS 14766..15371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 note possible pseudo, frameshifted CDS 15706..18852 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 18873..19739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 19755..20441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 sequence049 source 1..21392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1421 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1609..2949) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(2953..4167) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A684 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene dxr CDS complement(4142..5569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(5697..6206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 note possible pseudo, frameshifted CDS complement(6206..8599) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 note possible pseudo, frameshifted CDS complement(8596..9669) product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene agxT CDS complement(9941..11617) product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(11931..12275) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene rplT CDS complement(12369..12563) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rpmI CDS complement(12661..13263) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene infC CDS complement(13346..15274) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene thrS CDS complement(15277..16422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(16486..17442) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene aspG CDS 17554..19533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 19613..20221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 sequence050 source 1..21379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1172..2419 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 2511..2687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(2744..3289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(3294..3968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, frameshifted CDS complement(4003..5310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 note possible pseudo, frameshifted CDS complement(5487..6530) product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 7008..7388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(7443..10124) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0M6 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene alaS CDS 10243..11217 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 11321..13057 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene menD CDS 13136..13345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(13348..13971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(14252..15454) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene mnmA CDS 15549..16100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(16112..16354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 16488..17870 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(18046..19518) product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene citT sequence051 source 1..21320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 634..1992 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 2307..5624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(6292..7788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 8050..8808 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 8931..10955 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene uvrB CDS 11083..11514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(11568..12077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 12278..13102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(13103..14152) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 14264..15574 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(15776..16741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 tmRNA 17659..18064 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 18247..19458 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(20034..20747) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(20744..21319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 sequence052 source 1..20998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1279..2295) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(2445..3056) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(3223..5376) product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 5758..10332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 10482..11582 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(11904..12317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 12888..13541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 13688..15004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 15175..16080 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(16092..18248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(18337..20244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 misc_feature complement(20216..>20998) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942953.1:mechanosensitive ion channel protein MscS locus_tag LOCUS_11240 sequence053 source 1..20945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(753..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1970..2659 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ylcA CDS 2656..4038 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 4250..5026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 5130..6089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(6188..8431) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581323.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(8935..11076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 11359..12690 product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 12742..13101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 13338..15749 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 15832..18225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 18299..20746 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 sequence054 source 1..20914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1978..2859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 3071..4510 product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(4546..5247) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene npdA CDS 5340..6698 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 6773..8023 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 8177..8806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 9217..9483 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(9525..10817) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene pepP CDS 11040..11900 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE6 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene hisG CDS 11897..13222 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene hisD CDS 13227..14309 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene hisC CDS complement(14354..15187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(15202..17586) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 17806..18903 product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene hisB CDS complement(18910..19908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 misc_feature complement(20049..>20914) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1S3:glutamate-1-semialdehyde 2,1-aminomutase locus_tag LOCUS_11520 sequence055 source 1..20355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..1471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1730..2176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(2245..5508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(6028..6204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 6889..7086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 7300..7764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 7878..8321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 8393..9250 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 9336..9983 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(10124..11566) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(11550..14711) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(14737..15822) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(15993..16397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(17317..17508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 17560..18351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 18329..18712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(18767..19222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(19388..19933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 sequence056 source 1..20264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..764 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338938.1:beta-Ig-H3/fasciclin locus_tag LOCUS_11710 CDS complement(943..1695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1852..4263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 4387..4989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(5151..6842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(6929..7525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(7614..10190) product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(10283..12286) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 12659..13321 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene upp CDS 13331..14287 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 14318..15040 product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 15322..18318 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 18409..19014 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(19030..19614) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 sequence057 source 1..19766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1111..1437) product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene sufA CDS 1634..2047 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 2105..3172 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene thiL CDS complement(3491..3853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 4245..6992 product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 7161..8426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 8462..9808 product iron-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 9814..10416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 10464..11801 product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45161 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dacB CDS 12003..13040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 13044..13739 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 13750..15240 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 15243..16610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 16588..18252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(18249..19235) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 sequence058 source 1..19339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(320..871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1216..1767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1886..2095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(2788..4272) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(4890..5879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 6204..8816 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene clpB CDS complement(8886..11147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(11377..11901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 12245..12865 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BE2 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene ruvA sequence059 source 1..19259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(465..1223) product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene pcrB CDS complement(1216..1641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1696..2835) product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene nptA CDS 3150..3911 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene truA CDS 3920..5683 product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 5701..6396 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(6397..8700) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene maeB CDS complement(8922..9899) product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(10126..10854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(10861..11454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, internal stop codon CDS complement(11616..13010) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene gatA CDS complement(13051..13263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(13472..14674) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(14697..15392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(15478..17199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(17345..18334) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(18517..18954) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene dut sequence060 source 1..19223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1231..1755) product DUF4943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1894..2388 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 2395..3075 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KY2 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(3174..3509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(3583..4566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(4571..6919) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 7049..9277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 9270..10673 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene hisS CDS 10703..12382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 12462..12794 product nucleoid-associated protein YbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ7 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene YbaB CDS 12795..13949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 14278..15978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 16069..17049 product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene pdhB CDS complement(17123..18451) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene ffh sequence061 source 1..19003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..596 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404915.1:heme exporter protein C locus_tag LOCUS_12410 CDS 574..789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 817..1218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1296..3887 product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(3973..4377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(4340..7714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(7668..11021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(11284..12741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(12823..15795) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(16204..17559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 sequence062 source 1..18856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(688..3930) product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 4272..4601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(4720..6459) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene lysS CDS 6768..8756 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 8788..9705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 9719..11050 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 11152..12117 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(12194..12709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(12709..13101) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(13101..13703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(13774..14814) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene pheS CDS 15043..15852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(15867..16478) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(16594..17370) product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(17363..17980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 sequence063 source 1..18813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1035..1535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1770..3068) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(3200..4687) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(4821..6320) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(6324..9674) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(9826..10872) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(11029..11742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(12141..12338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(12340..13287) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 note possible pseudo, frameshifted CDS complement(13262..14575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(15100..15489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 note possible pseudo, frameshifted CDS 16401..17636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 17908..18168 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene cas2 repeat_region 18386..18810 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcttaatagcaccatagtggaattgaaat sequence064 source 1..18641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZR4:translation initiation factor IF-2 locus_tag LOCUS_12800 CDS complement(3111..3698) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 4050..5096 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene fjo19 CDS 5093..5992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 6028..6999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 7002..7574 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 7589..8221 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene udk CDS 8218..8901 product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 8956..9573 product putative ADP-ribose pyrophosphatase YjhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPC3 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene yjhB CDS 9628..10401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 10694..11821 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene tal CDS complement(11861..12580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 12693..13370 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 13703..13954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 sequence065 source 1..18613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1514 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120793.1:L-sorbosone dehydrogenase locus_tag LOCUS_12940 CDS complement(1669..2634) product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(2687..3628) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010891.2 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 4006..5319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(5329..6738) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene arsA CDS 7003..7311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 7575..9221 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 9741..10859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 11070..12020 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene lolI CDS 12187..14037 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 14080..15738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 15858..16757 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 16962..17894 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 17920..18543 product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 sequence066 source 1..18399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..1556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1872..2963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 3012..4910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 4925..6037 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(6074..7435) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(7494..10613) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(10636..11742) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 12082..12657 product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 12854..13924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 14030..17515 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 sequence067 source 1..18391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1536 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P05656:levanase locus_tag LOCUS_13180 CDS 1654..2793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(2774..3373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(3373..4815) product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255398.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 5014..6684 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 7281..8978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 9826..10131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 note possible pseudo, internal stop codon CDS 10183..11031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 11035..11487 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 11494..12105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 12135..15428 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 15611..16015 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 16668..17015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 sequence068 source 1..18138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB locus_tag LOCUS_13310 CDS complement(869..1726) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1829..2662) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(2664..3758) product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene nuoH CDS 3957..4334 product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene groES-2 CDS 4467..6155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 6303..6953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 6955..7638 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 7649..7924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 note possible pseudo, internal stop codon CDS 8095..8910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 9035..9688 product oxygen regulatory protein NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN75 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene nreC CDS 9774..11009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 11166..12305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(12258..12644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(12741..13490) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(13523..14251) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 14327..15037 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 15159..17153 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4T0 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene ispG CDS complement(17189..17479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 misc_feature complement(17561..>18138) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224283.1:DNA-binding response regulator locus_tag LOCUS_13500 sequence069 source 1..18115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..1069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1124..1909) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene map CDS complement(2038..2850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(3197..3763) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(3944..4333) product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 4945..5130 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 5190..5648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 5726..6883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(6999..8051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(8238..9917) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 10112..11578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 11780..12001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(12040..12663) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U8 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene ispD CDS complement(12752..13804) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene queA CDS 13969..15216 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(15251..16537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(16629..17468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 sequence070 source 1..18084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4809..5912 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 tRNA complement(5992..6076) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(6125..6198) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 6340..6882 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dcd CDS 6912..7637 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 7808..9988 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rnr CDS complement(10223..11437) product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(11655..14615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(14674..15489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 15735..16718 product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 16819..17445 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 17673..17960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 sequence071 source 1..17940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1051..1455 product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene osmC CDS complement(1467..1823) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene ytxJ CDS complement(1828..2904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 3415..3924 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 3914..4684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 4720..5493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 5569..6255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(6402..7352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(7514..8548) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(8541..9461) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 9584..12058 product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene mur/alr CDS complement(12331..13080) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(13077..15023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 15273..15971 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 sequence072 source 1..17839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1707..1865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(2009..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(3925..4305) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(4349..5071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(5117..5506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(5571..7376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(7403..8734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(8810..9505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(9584..10264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(10298..10600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(10748..14260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(14444..14935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(15098..15388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(15666..16196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 16425..16814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 16977..17459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 sequence073 source 1..17806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..2681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(2737..3312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(3317..5026) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(5143..5850) product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 6114..9497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 9629..10045 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 10078..11574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 11579..11989 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 12198..13604 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene lpdA2 CDS complement(13682..14344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 14541..15680 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 sequence074 source 1..17795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..5191 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin locus_tag LOCUS_14210 CDS complement(5256..7031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(7715..8098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(8337..8870) product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(8926..12219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(12352..14025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(14043..15257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 15477..17528 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene yyaL sequence075 source 1..17783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(945..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1609..2481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(2538..4091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(4150..6672) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 note possible pseudo, frameshifted CDS complement(6726..7370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, frameshifted CDS 7975..9018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(9086..9715) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(9772..13608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(13896..14288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(14746..15276) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 15506..17053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 sequence076 source 1..17747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 785..1429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1599..2141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(2203..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3609..4586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 4711..5265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 note possible pseudo, internal stop codon CDS 5293..6393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, internal stop codon CDS complement(6459..7412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 7549..8643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(8660..8833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(8838..9539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 9652..10521 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 10611..11330 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(11445..12668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 12937..13371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 13504..14454 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(14479..15084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(15389..16372) product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJN4 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene hldD sequence077 source 1..17629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..1247 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1382..2614 product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 2797..4656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 4640..5584 product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 5599..9750 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(9747..10235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 10439..11839 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene degP/Q CDS complement(11872..12657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(12715..13560) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 13790..16768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 16851..17405 product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 sequence078 source 1..17300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..1586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1674..2663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(2847..3188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(3185..4570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(4572..4985) product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene csgF CDS complement(5078..5551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(5796..7466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 7938..8198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(8568..9401) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(9943..11541) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI86 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene glsA CDS complement(12079..12423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(13012..13380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(13583..14344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(14496..14738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(15382..16002) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_14830 misc_feature complement(16037..>17300) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362015.1:sulfate permease locus_tag LOCUS_14840 sequence079 source 1..17219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 649..1428 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1442..1774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1861..2670) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(2670..3587) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene rnz CDS complement(3591..3989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(4031..4966) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene purC CDS complement(5677..6567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(6573..7112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(7351..7761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(7797..8456) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(8514..9053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(9219..9929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 10772..11809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 11830..14652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(14745..15605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(15598..16215) product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 16364..17002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 sequence080 source 1..17015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2426..4486) product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene pepO CDS complement(4679..5314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 5729..7720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(8349..8975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 9335..10495 product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(10562..12106) product organophopsphate acid anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(12484..12957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(13716..14729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(14741..16372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 misc_feature complement(16385..>17015) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203657.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_15110 sequence081 source 1..16699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 note possible pseudo, frameshifted CDS 1400..2032 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 2195..3190 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 3430..6852 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 6864..8291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 8284..9813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 10028..11554 product putative Na(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57007 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 11601..12788 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(12929..14332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(14404..15000) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(15001..15318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(15318..16070) product putative HTH-type transcriptional regulator YbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31459 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ybgA sequence082 source 1..16615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1382..2461) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene aroC CDS complement(2519..2815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(2842..3120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(3255..4727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 4884..5123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(5179..6102) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene queG CDS 6371..6943 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 7013..8104 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 8287..9132 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(9280..10788) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 10846..12969 product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(13085..16615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 sequence083 source 1..16578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(498..1121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1881..2603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 2834..3388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 3869..4621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(4766..4972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(4929..5321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(5715..5963) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene yeaQ CDS complement(6087..9152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(9365..9544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 9793..10959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(10971..11786) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene nucA CDS complement(11798..12679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(12672..16082) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene secA CDS complement(16338..16505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 sequence084 source 1..16531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(622..1104) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene ribH CDS complement(1183..1866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(2076..3122) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene pdhA CDS 3313..4503 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene recF CDS complement(4414..5949) product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 6170..6916 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene coaX CDS 6903..8171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 8479..9807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 9913..10443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 10847..12130 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 12302..14407 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(14482..16203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 sequence085 source 1..16440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962915.1:Fe-S oxidoreductase locus_tag LOCUS_15620 CDS complement(600..1991) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 2070..2585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 2794..4689 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 4760..5929 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(5930..6478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 6730..8076 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene pyrC1 CDS 8176..9186 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 tRNA 9239..9315 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 9506..9757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(9775..10317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(10377..10991) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene coaE CDS complement(10981..11967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(11970..12284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(12306..12869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(12927..13226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(13305..14486) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene nusB CDS complement(14605..15654) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene vdh sequence086 source 1..16410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1893..4430 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene priA CDS 4487..4834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(4894..5607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(5744..8458) product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 8636..10468 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene atsG CDS 10617..10823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 10960..11292 product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 11827..12969 product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 13052..14824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 sequence087 source 1..16150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..1240 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1524..2435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 2432..3421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(3423..4022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 4456..5487 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 5710..7233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 7234..7806 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 7875..8291 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 8458..9792 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 9803..11101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 11425..11676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 11673..12092 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 12112..15411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(15408..16109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 sequence088 source 1..16119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1429) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1524..2102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(2092..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(2510..3100) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 3480..4931 product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(4971..5312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(5335..6294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 6376..7194 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 7383..7865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 7871..9433 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene cht1 CDS 9426..9599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(9696..10163) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(10163..10735) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(10737..11069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(11091..11966) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 tRNA complement(12047..12138) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(12410..13483) product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene ansA CDS complement(13808..14578) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene tatD CDS complement(14685..15326) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 sequence089 source 1..16096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..1714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1829..2500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(2673..2840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 2797..3204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 3259..4179 product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 4501..5895 product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene betC CDS complement(5906..6958) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(7147..7605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(7657..8796) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(8955..10349) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(10418..10648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 10770..11576 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 11935..12741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 sequence090 source 1..16087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1079 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMC1:ribulokinase locus_tag LOCUS_16330 CDS 1175..1873 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1990..3606 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 3770..5275 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMB6 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene araA CDS 5423..6196 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 6371..7810 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 8020..9060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 9171..12617 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 12625..14163 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 14395..14808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 sequence091 source 1..15968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962636.1:universal stress protein UspA locus_tag LOCUS_16430 CDS complement(593..1861) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1988..2299) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(2309..3643) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(3812..4138) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(4184..4846) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(4974..6383) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(6522..7820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(7975..8388) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(8402..8977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(9237..10949) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(11047..11676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(11772..12701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(13592..14473) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(14933..15301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 sequence092 source 1..15925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3066..5105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(5123..5794) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932754.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(5999..6664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 6923..10186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 10314..11495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 11690..12910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 12986..13999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 14200..15168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 15341..15565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 sequence093 source 1..15914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2387..3451 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene prfA CDS 3528..4880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 4884..5312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(5517..6410) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(6423..7229) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(7231..9111) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene mutL CDS complement(9168..9530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 9607..12513 product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 12605..13747 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(13744..14904) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 14985..15677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 sequence094 source 1..15909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..805) product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1043..2044) product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(2058..3053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(3175..4452) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 4935..7673 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene sucA CDS 7692..9302 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene sucB CDS 9574..10170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 10296..13466 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 13622..14947 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 15247..15432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 15515..15682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 sequence095 source 1..15901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(357..1337) product sugar transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1334..2851) product putative ribose/galactose/methyl galactoside import ATP-binding protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBN2 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(2853..3863) product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(4152..5717) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene yidK CDS 6071..7096 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 7238..10627 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 10647..12185 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 12394..12861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 note possible pseudo, internal stop codon CDS 12871..15528 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 note possible pseudo, internal stop codon sequence096 source 1..15892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1170..2540) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene mnmE CDS complement(2605..3105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(3325..3663) product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene gldC CDS complement(3793..4554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(4618..5112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(5151..6116) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene ribF CDS complement(6083..6808) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene truB CDS complement(6796..7593) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene uppP CDS complement(7654..7860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(7954..8853) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(8863..10710) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene yidC CDS complement(10806..12443) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene pyrG CDS complement(12523..13590) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 sequence097 source 1..15696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..691 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Z22:UPF0365 protein locus_tag LOCUS_17120 CDS complement(695..3028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 3864..5912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 6025..6783 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene menG CDS 6843..7487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(7724..8797) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene pdxA CDS complement(8794..10236) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene pepA CDS 10334..11110 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene rsmA CDS 11098..12471 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y98 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 12485..13420 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 13525..14364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 sequence098 source 1..15675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 855..1490 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1714..2289 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene msrA CDS complement(2370..2747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(3121..6027) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(6141..7802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(8028..9017) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(9068..10015) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(10015..10791) product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(10792..12189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(12304..12699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 note possible pseudo, frameshifted CDS complement(12700..13293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 note possible pseudo, internal stop codon CDS 13426..15198 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 sequence099 source 1..15590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..1021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1142..1672 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1669..2271 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(2385..3191) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 3341..3895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 4076..6019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(5982..7337) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(7420..8844) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 9006..10229 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(10278..12158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 12452..13726 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 13754..14812 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(14813..15166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence100 source 1..15587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..945 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c locus_tag LOCUS_17490 CDS 949..2394 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(2455..3426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 3814..5148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 5540..6808 product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 6849..8276 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 8273..9667 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 9985..13212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(13240..14178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(14397..15338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 sequence101 source 1..15567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2778..6002 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 6022..7650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(7722..9209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(9375..9764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(9819..11150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(11302..12852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 13131..14417 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 sequence102 source 1..15551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(432..1370) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1718..2197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 2239..4335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(4496..4717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 4807..5508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(5544..6116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(6167..7015) product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(7096..8439) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(8742..9077) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene csaA CDS complement(9143..10579) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene aslA CDS complement(10650..14090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 sequence103 source 1..15508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..560 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene mgsA CDS complement(612..1535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1699..2838) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(3021..3668) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(3783..4826) product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(4830..5180) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene panD CDS complement(5311..6156) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene panC CDS 6281..7093 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 7077..8429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 8531..9037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 9100..9681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 9706..10587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 10593..11045 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene coaD CDS complement(11033..11713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 11821..12213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 12330..13046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 13094..13729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(13733..14374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 14431..14874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 misc_feature complement(14974..>15508) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963270.1:short-chain dehydrogenase locus_tag LOCUS_17970 sequence104 source 1..15459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2595..3617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(3786..4424) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 4696..5355 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 5634..6734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 6815..10330 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 10461..11855 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 12028..13068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 13099..14772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 sequence105 source 1..15433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..2936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(3158..3598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(3698..4537) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene accD CDS complement(4670..7504) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Y6 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 7687..9201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 9553..10152 product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 10127..10372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 10385..11026 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene nth CDS 11137..12561 product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene cry CDS complement(12565..13017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140845.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(13329..14282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 sequence106 source 1..15417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..1941) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1961..3388) product N-sulfoglucosamine sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(3435..4877) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(4892..8404) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(8460..9410) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(9646..10254) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 10841..13957 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 13976..15403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 sequence107 source 1..15343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1319 product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1445..1882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2045..2626 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 2750..3784 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 3840..7364 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 7377..9146 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 9223..11172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 11771..13570 product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 13783..14835 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 sequence108 source 1..15320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..976 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWZ4:anthranilate phosphoribosyltransferase locus_tag LOCUS_18340 CDS 976..1662 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene aat CDS 1877..4111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(4120..5064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(5097..6584) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I261 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene arcA2 CDS 6879..8957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 8957..9556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 9876..10415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 10556..11512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 11791..12876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 12961..13770 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene trpC CDS 13767..14399 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene trpF sequence109 source 1..15282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1629..2291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 2483..3067 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 3232..4257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 4293..7892 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 7914..9779 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 10002..13265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 13391..14602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 14700..14957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 sequence110 source 1..15220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1631 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0C2:1-deoxy-D-xylulose-5-phosphate synthase locus_tag LOCUS_18540 CDS complement(1642..2571) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2589..3194) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(3363..3545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(3624..4556) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene fcl CDS complement(4586..5698) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene gmd CDS complement(5707..6756) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(6851..7645) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 7761..8282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(8272..8802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 8921..9676 product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(9660..10898) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 11080..12333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 12407..13315 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene fmt CDS 13312..13803 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(13800..14039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 14197..14658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 14669..15046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 sequence111 source 1..15195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..2967) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2960..3682) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 3780..4487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 note possible pseudo, internal stop codon CDS complement(4587..7769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(7841..9244) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(9323..12295) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 sequence112 source 1..15191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1491 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962729.1:cytochrome-c peroxidase locus_tag LOCUS_18780 CDS 1737..2765 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(2905..4083) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(4114..4620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(4817..6025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(6081..7442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 note possible pseudo, frameshifted CDS complement(7333..8487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 note possible pseudo, frameshifted CDS complement(8524..8784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(8997..11207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(11222..11707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(11714..13162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 misc_feature complement(13950..>15191) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918700.1:TonB-dependent receptor locus_tag LOCUS_18890 sequence113 source 1..15180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1162 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 1169..1471 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1571..2389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2501..2776 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2845..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(3599..4069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 4515..5309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 5318..7318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 7315..8403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 8555..12574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 misc_feature complement(12625..>15180) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974031.1:acriflavine resistance protein B locus_tag LOCUS_19000 sequence114 source 1..15173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 9..1859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 1852..2073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2051..2242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2938..4053) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(4799..5683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(5793..6578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(6873..7322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(7381..8283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 8551..9093 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 9164..10153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 10232..13726 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 sequence115 source 1..15089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1871 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:membrane protein locus_tag LOCUS_19120 CDS 1871..2803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2835..4304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 4478..5401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 5382..5933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 6045..6680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 6673..7683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 7688..8518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 8522..9901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 9910..10887 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene pseB CDS 10906..12387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(12362..13459) product erythromycin biosynthesis sensory transduction protein EryC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461012.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 13691..14662 product ATP-dependent 6-phosphofructokinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A624 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene pfkA2 sequence116 source 1..15085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 310..2751 product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2826..3131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(3128..3448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(3504..3692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(3789..4193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 4457..4867 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene ygcM CDS 4864..5583 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene folE2 CDS 5573..6283 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 6459..6722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 6748..7197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 7199..7840 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 7873..8904 product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 9311..11536 product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene hppA1 CDS complement(11542..12588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(12633..13403) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(13400..14506) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene menC CDS 14567..15073 product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ppa sequence117 source 1..15071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(999..1916) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(1932..2819) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(3329..3868) product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene ftnA CDS complement(3888..4220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(4421..5584) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(5591..9931) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(10256..11626) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(11623..12291) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(12378..12875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(12923..13843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(13848..14927) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 sequence118 source 1..15014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1240..2307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2407..4638) product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 4824..4958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(4959..5219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(5223..5843) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(6001..6540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(6579..7250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 7483..9495 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene tkt CDS 9568..10026 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene rpiB CDS 10085..11500 product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYQ5 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene gnd CDS 11643..13940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 sequence119 source 1..15014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(773..1342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(1414..1791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(1781..6358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 6616..7566 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(7611..8084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 8284..10059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(10124..11218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(11232..13190) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 misc_feature complement(14008..>15014) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932103.1:iron(III) ABC transporter ATP-binding protein locus_tag LOCUS_19720 sequence120 source 1..14850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 1127..2533 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene fumC CDS 2650..3321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 3451..3954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 3962..4525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 4533..6245 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene recJ CDS complement(6270..7568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(7726..9051) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene murA CDS complement(9055..9693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(9863..12112) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene uvrD CDS 12426..12680 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM9 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene rpsT CDS 12937..14280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 sequence121 source 1..14672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(363..1397) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 1483..2220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2262..3026) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 3095..4129 product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene rfaF CDS complement(4132..5220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(5434..6306) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(6411..7907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 8270..9529 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 9630..10658 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene holA CDS 10762..13908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 sequence122 source 1..14627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 876..2165 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2319..2777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2887..3918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 4197..4949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 5099..6166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 6292..7140 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 7236..7655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(7823..10201) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 10694..11578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(11583..12743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(12747..13895) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 sequence123 source 1..14606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 187..969 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 1029..1880 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene hpaG CDS 1975..2307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 2320..3171 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 3206..3991 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(3992..4225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(4325..4732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(5007..5837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(5904..6530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(6520..7521) product iron/ascorbate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(7748..8572) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(8721..9965) product natural resistance-associated macrophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 10279..11460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 11544..12062 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 12180..12518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(12599..13978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 sequence124 source 1..14606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 1440..2441 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2531..3088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(3451..4782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(5236..7335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(7420..8472) product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(8469..10382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(10379..10858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(10878..11786) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(11889..13184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(13157..14218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 sequence125 source 1..14558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3773..7087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 7114..8121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 8121..8948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 8941..9600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(9637..11328) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene fadD CDS 11782..12249 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 12404..13849 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene ycf24 sequence126 source 1..14556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..594 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118593.1:oxidoreductase locus_tag LOCUS_20410 CDS 759..2477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2875..4248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 4454..5086 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(5137..8340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 8748..9929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 9933..10994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 sequence127 source 1..14543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..1720 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 1707..4145 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene fecA CDS 4241..4771 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(4789..6351) product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHG0 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene treA CDS 6550..6834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 6844..7578 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(7559..8917) product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(9026..9502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 9771..10874 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 11050..12705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 12763..14367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 sequence128 source 1..14539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(459..1316) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene pldB CDS complement(1412..1873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(2048..3556) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 3652..4599 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 4641..5024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 5100..7052 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 7149..7916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(7973..8749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 9119..10162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 10234..11451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(11522..12631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 12834..13802 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene trpS misc_feature complement(13953..>14539) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase locus_tag LOCUS_20710 sequence129 source 1..14477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1060..3501) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene wzc CDS complement(3557..4312) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(4558..6774) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene purL CDS complement(6870..7841) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene hemB CDS complement(7935..8912) product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(8952..10268) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(10478..11404) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(11436..12611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 12857..13633 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 sequence130 source 1..14422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..1380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 1680..3257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(3968..4249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(4450..5760) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(5757..7949) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(7957..10920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 11664..12752 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 sequence131 source 1..14395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 969..1460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 1381..2694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, frameshifted CDS 2927..4024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 4312..5829 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 5904..7196 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(7680..9020) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene ygiK CDS complement(9057..9470) product 2,3-diketo-L-gulonate TRAP transporter small permease protein YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37674 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene yiaM CDS complement(9502..10536) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(10715..11491) product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(11508..12677) product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 misc_feature complement(12719..>14395) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920215.1:beta-xylosidase locus_tag LOCUS_20980 sequence132 source 1..14354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 360..1946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 2026..3189 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 3433..4023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(4122..4694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(4862..5737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 5942..6445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(6488..7756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(7861..8505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 8959..9180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(9462..10334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(10368..13352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(13701..13952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 sequence133 source 1..14337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1754..2770) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2809..4020) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene aspC1 CDS complement(4354..4968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(5096..5572) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(5599..5982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(5996..7384) product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 7946..9208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(9259..9822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 10243..10704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 10814..12244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(12391..13557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(13706..14167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 sequence134 source 1..14329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..2005) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 note possible pseudo, internal stop codon CDS complement(2077..4494) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 4752..5087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(5103..6014) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(6039..7406) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 7675..10038 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(10129..10650) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 10823..11653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 11650..12342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(12299..12739) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(13056..13802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 sequence135 source 1..14257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..3260 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene cphA CDS complement(3322..4281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(4449..5486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 5714..6997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 7217..8068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 8131..8322 product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(8458..9276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(9345..11858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 misc_feature complement(12983..>14257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ1:chaperone protein DnaK locus_tag LOCUS_21430 sequence136 source 1..14173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122793.1:dehydrogenase locus_tag LOCUS_21440 CDS 1253..2149 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2608..4026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 4260..4826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 4724..4930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 5933..7309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(7280..7492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 8025..8498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 8742..10247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 10244..12691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(13308..14054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 sequence137 source 1..14157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(763..1662) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene natA CDS 1821..3395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 3564..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(4554..5243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(5438..7519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 7809..11846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 sequence138 source 1..14097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 747..1541 product semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 1654..3651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533061.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 3766..4617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 4862..5320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(5519..6616) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(7078..7611) product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene yfiT CDS 7909..8391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(8447..9355) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 9494..9913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(10217..11710) product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(11927..12844) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103816.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 sequence139 source 1..13931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 711..1985 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene arsA CDS 2069..4156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 4250..5227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 5520..5939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(6117..6524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 6608..7162 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 7159..7572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 7835..9817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(9846..10625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(10694..12226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(12359..12805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 misc_feature complement(12890..>13931) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109138.1:beta-galactosidase locus_tag LOCUS_21840 sequence140 source 1..13929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1670) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(1677..4367) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(4711..6444) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(6520..7698) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene paaE CDS 7828..9180 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene purB CDS 9397..9876 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene greA CDS 9897..10334 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 10762..11175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 sequence141 source 1..13910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..3280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(3686..5500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(5522..8692) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 9187..9897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 10183..11010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 11076..11735 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 11735..12337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(12443..13321) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW9 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene atpG sequence142 source 1..13877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(509..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2323..2817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2801..4081) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(4117..4392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(4419..6515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(6548..7393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(7717..10431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(10561..11538) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(11591..12001) product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSV9 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene mscL CDS complement(12239..13564) product xylose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T9 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene xylA1 sequence143 source 1..13871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..2386) product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene htpG CDS complement(2564..3049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 3224..3889 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 3950..4201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 4202..4783 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene gmk CDS 4847..5722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 5861..6256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 6627..7652 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene mreB CDS 7654..8565 product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 8558..9085 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene mreD CDS 9082..10890 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 10898..12169 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene rodA sequence144 source 1..13844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1919..4894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 5473..6876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 7122..7283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 7352..7846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 7917..8132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 8211..8816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 8971..9525 product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 9689..10018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 9972..10424 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(10640..11185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 12724..12984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 note possible pseudo, frameshifted CDS complement(13041..13793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 sequence145 source 1..13818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2776..3465 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene phoP CDS 3482..4582 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene phoR CDS 4660..5376 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 5479..5928 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene rplM CDS 5932..6318 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z5 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rpsI CDS 6349..7131 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rpsB CDS 7262..8092 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene tsf CDS 8280..9410 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene dnaN CDS 9511..10509 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene fbp CDS complement(10674..11804) product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(11801..13183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 misc_feature complement(13190..>13818) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972373.1:dipeptidase locus_tag LOCUS_22460 sequence146 source 1..13742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(907..3372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 3518..3898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 3901..4275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 4300..5538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 5556..6047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(7450..8250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(8271..8996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 9498..9881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 10078..10986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 11211..13052 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHI0 transl_table 11 codon_start 1 locus_tag LOCUS_22560 sequence147 source 1..13635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..1010 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 1206..4682 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 4718..6175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 6324..8315 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ00 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 8484..9851 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(9973..11022) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 tRNA 11973..12047 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 12338..12835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 sequence148 source 1..13579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1887..2309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(3270..3974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 4685..5494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 5442..6092 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 6220..7800 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 8170..8823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 8965..9954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(10057..11382) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(11434..12276) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(12396..12827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 misc_feature complement(12923..>13579) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974020.1:mannonate dehydratase locus_tag LOCUS_22740 sequence149 source 1..13554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1268 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase locus_tag LOCUS_22750 CDS 1574..2704 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2794..3351 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 3359..4168 product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 4173..6557 product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(6554..7165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(7394..10384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(11294..12028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 misc_feature complement(12178..>13554) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943441.1:PAS domain-containing sensor histidine kinase locus_tag LOCUS_22830 sequence150 source 1..13469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..689) product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(736..1257) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(1318..2688) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(3167..4177) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(4237..4407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(5036..5497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(5621..6781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(6880..8169) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(8512..9153) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(9158..11005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(11141..11944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(12115..13200) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene proB sequence151 source 1..13343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..2078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2091..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2727..3314 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene rnhB CDS 3430..4167 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene uppS CDS 4167..6854 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 6877..7449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 7486..8043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 8629..9867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 sequence152 source 1..13278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(728..1402) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG97 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene nth CDS 1569..2453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2509..5748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(5850..7142) product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(7217..7672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(7699..9096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(9225..12287) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 sequence153 source 1..13162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1445..2236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96719 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ywqG CDS 2425..3501 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 3710..4627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(4666..5799) product glycerate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene glxK CDS complement(5949..8264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 8508..10349 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(10333..10821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 10993..12258 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene erg3 CDS 12287..12721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 sequence154 source 1..13142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 429..1424 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A137 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene fabH2 CDS 1662..2054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 note possible pseudo, internal stop codon CDS 2060..2578 product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene accB CDS 2615..3976 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene accC CDS complement(3973..4572) product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(4569..6050) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 6420..6758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 7019..8749 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(8752..9147) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(9302..10288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(10436..11098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(11186..11830) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 11983..12471 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 sequence155 source 1..13141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 511..3537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 3675..5282 product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 5312..6133 product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene liuC CDS 6123..8096 product acyl CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 8125..9264 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene acdA CDS 9266..10129 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene mvaB CDS 10254..11216 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene ddl CDS 11241..12113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 sequence156 source 1..13133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..3929) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(4349..5092) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(5422..7668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(8212..8952) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(9340..10155) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene chd1 CDS complement(10223..10798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(10863..11423) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 sequence157 source 1..13104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 884..1648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(1763..2242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2885..3835) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 4034..4945 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene ppx CDS complement(4932..5645) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(5746..7650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(7647..8132) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(8129..8989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(9150..9515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(9519..10136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 10431..11435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 misc_feature complement(11432..>13104) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q034N6:polyphosphate kinase locus_tag LOCUS_23590 sequence158 source 1..13089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(477..1583) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene carA CDS complement(1684..2256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2358..3329) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene rpoA CDS complement(3387..3998) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene rpsD CDS complement(4026..4418) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene rpsK CDS complement(4433..4810) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene rpsM CDS complement(4935..5153) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene infA CDS complement(5171..6490) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene secY CDS complement(6497..6943) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene rplO CDS complement(6945..7139) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene rpmD CDS complement(7132..7647) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene rpsE CDS complement(7651..8004) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene rplR CDS complement(8014..8565) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene rplF CDS complement(8576..8977) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene rpsH CDS complement(9058..9327) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66420 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene rpsN CDS complement(9330..9902) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene rplE CDS complement(9905..10237) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene rplX CDS complement(10242..10610) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene rplN CDS complement(10613..10876) product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene rpsQ1 CDS complement(10885..11079) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A484 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene rpmC CDS complement(11081..11503) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH9 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene rplP CDS complement(11527..12264) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene rpsC CDS complement(12280..12663) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene rplV CDS complement(12665..12943) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene rpsS sequence159 source 1..12922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1686..2744) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2770..4182) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(4237..4713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 4835..5404 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(5485..7884) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(8118..8450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(8573..10492) product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene gcd CDS complement(10623..11822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 misc_feature complement(12076..>12922) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767349.1:glycosyl hydrolase family 31 locus_tag LOCUS_23920 sequence160 source 1..12837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..754 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964075.1:gliding motility lipoprotein GldK locus_tag LOCUS_23930 CDS 803..1606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 1647..3233 product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene gldM CDS 3347..4267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(4319..6112) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene uvrC CDS complement(6398..6586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 6710..7390 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 7392..7769 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(7772..8299) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UM9 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene recR CDS complement(8464..8745) product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene clpS CDS 8962..10305 product sodium/iodide co-transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(10302..10691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 10891..11487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 misc_feature complement(11496..>12837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FDN6:high molecular weight rubredoxin locus_tag LOCUS_24060 sequence161 source 1..12812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..3039 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 3249..4604 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene xylE CDS 4591..5508 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 5723..8827 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 8844..9671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 note possible pseudo, internal stop codon CDS 9750..10574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 note possible pseudo, internal stop codon CDS 10721..12439 product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 sequence162 source 1..12811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1424..1732 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 1783..2577 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2589..2978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 3011..4438 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 4679..5092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 5101..5574 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(5682..6542) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene pyrF CDS 6680..7267 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 7316..8722 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene lpdA1 CDS 8722..9474 product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene dltE CDS 9594..10028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 10139..10993 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDV5 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 11010..11435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 11508..11891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32161 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene yurT CDS 11918..12496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 sequence163 source 1..12784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 502..897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 962..2278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2265..2930) product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene sirR CDS 3108..3671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 3754..4635 product haloalkane dehalogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene dhmA2 CDS 4925..5650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 5681..6505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 6603..6950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(6971..8887) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene asnB CDS complement(8972..9457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(9523..11319) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 11582..12394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence164 source 1..12776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..994 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:isoquinoline 1-oxidoreductase subunit beta locus_tag LOCUS_24410 CDS complement(1147..1656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(1677..5105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(5119..5529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(5947..9111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(9465..9848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(10000..10632) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(10629..12356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(12590..12775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 sequence165 source 1..12754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2549..3124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(3153..6674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(6832..8463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(8489..11488) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 sequence166 source 1..12737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 539..1105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 1308..2780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 2910..4148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(4165..5478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 5688..8750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 8824..9954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 10015..10893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 11038..11565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 11562..11987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 11977..12672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 sequence167 source 1..12704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..549 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962828.1:ABC transporter permease locus_tag LOCUS_24650 CDS complement(650..1036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(1178..2035) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971218.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2063..2740) product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene trmH CDS 2930..4117 product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 4219..5532 product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 5591..6808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(6825..10610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 sequence168 source 1..12620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(718..4101) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(4280..5383) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(5612..7039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 7434..9716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 9798..10802 product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(10803..11444) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 sequence169 source 1..12518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 641..1948 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L298 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene ackA CDS 2010..2444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 2450..3064 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 3277..4188 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 4386..4937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 5208..6506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 6610..6933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 6938..7846 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(7850..8590) product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene glpF CDS complement(8600..10168) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene glpA CDS complement(10183..11676) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2I6 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene glpK CDS 11942..12274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 sequence170 source 1..12503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..1104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 1200..2048 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene bamD CDS 2045..2368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 2383..3585 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 3575..4471 product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 4693..6345 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene recN CDS 6633..9263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 9330..9743 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 sequence171 source 1..12496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1826..2767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(2925..4100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(4489..5286) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(5549..6163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(6328..6672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(6972..8966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(9175..10770) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 11265..12029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 sequence172 source 1..12368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1056 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030661.1:microcystin degradation protein MlrC locus_tag LOCUS_25080 CDS complement(1244..1888) product NADH-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2132..2716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2973..4160 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(4211..4753) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM24 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 5537..6004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(6036..6647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(6704..8443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(8573..9943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 10116..10550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(10540..11223) product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene rprY misc_feature complement(11204..>12368) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759736.1:two-component sensor histidine kinase locus_tag LOCUS_25190 sequence173 source 1..12353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 692..2878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 2898..3971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 4056..4952 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 5232..5966 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(5980..6390) product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(6573..7925) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(7977..8687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(8783..9265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(9268..10167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(10520..11719) product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene kbl sequence174 source 1..12346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(712..9750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 misc_feature complement(10184..>12346) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YG7:DNA-directed DNA polymerase locus_tag LOCUS_25310 sequence175 source 1..12316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1007 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227769.1:sodium-coupled permease locus_tag LOCUS_25320 CDS 1022..1786 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene nagB CDS 1770..2963 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WS59 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene nagA CDS 3640..4851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 note possible pseudo, frameshifted CDS 4848..5714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 5789..6058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 6096..7520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 7627..10644 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 sequence176 source 1..12267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 887..1516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 1618..3099 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1B9 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene gatB CDS 3132..4301 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(4336..5664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(6048..6722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(6880..7494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 misc_feature complement(7574..>12267) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:polyketide synthase locus_tag LOCUS_25470 sequence177 source 1..12252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1561..3213) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(3335..4582) product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(4671..5546) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(5771..6805) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 6877..7806 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene dcyD CDS 7886..8566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(8568..9167) product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(9267..10652) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene radA CDS 10801..11940 product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 sequence178 source 1..12231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(445..906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(1097..2080) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(2132..3484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(3650..4792) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene ragD CDS complement(4801..8022) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(8131..9525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 9673..10350 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 10347..11618 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 misc_feature complement(11627..>12231) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403495.1:membrane protein locus_tag LOCUS_25650 sequence179 source 1..12221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1412..1810 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 2122..3417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 3513..4883 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA80 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene trpB CDS 4946..5386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 5437..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 5870..6415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(6400..6990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(7103..7858) product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(8043..9710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(9815..11398) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 misc_feature complement(11422..>12221) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_25760 sequence180 source 1..12204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..667) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(698..1270) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS79 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene gmhA CDS complement(1267..1641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(1720..3552) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 3878..4045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(4158..4757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 4952..5443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 5440..6435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 7020..7619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 7671..9035 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 9366..9983 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 10133..11167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 sequence181 source 1..12197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(595..1653) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(1650..2807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2992..3606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 3590..3946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 4308..4703 product RNA polymerase-binding protein Rnk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene rnk-1 CDS 4758..5951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(6312..6506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(6521..6745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(6849..7406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(7753..9417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(9946..11679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 sequence182 source 1..12132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..1806) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(1829..4795) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(6191..7774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(7851..11027) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 11221..11466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 sequence183 source 1..12115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 482..2575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 2577..2957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(3056..3679) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 4153..5196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 5615..8902 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 9007..10470 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 sequence184 source 1..12066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2758..3009) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y6 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene purS CDS complement(3051..3761) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 3813..4877 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene fjo30 CDS 4877..8290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 8343..8954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(9000..10175) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene glpT CDS 10339..10896 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(10933..11856) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene prfB sequence185 source 1..11993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(750..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 2510..2962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2993..3535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 3547..4398 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(5150..5995) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 7166..8407 product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403845.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 8407..9132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 9220..9507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 9504..11666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 sequence186 source 1..11906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2374..3831 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 4111..7335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 7342..8793 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 8864..9358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 9477..10547 product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene pam CDS complement(10619..11743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence187 source 1..11905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase locus_tag LOCUS_26340 CDS complement(918..1535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(1982..2542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(3085..4572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(4581..5060) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 5453..5923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 note possible pseudo, internal stop codon CDS complement(5895..6470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(6477..7286) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene murQ CDS complement(7363..8214) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 8300..9022 product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807002.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 9019..10884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 10888..11805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 sequence188 source 1..11863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..879) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene hisA CDS 1077..2132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(2137..3093) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(3150..3638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(3727..4308) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene hisH CDS complement(4422..5171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(5206..6108) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(6105..7343) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene hmgB CDS complement(7346..8644) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(8720..9877) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(9974..11104) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene hppD CDS 11394..11810 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 sequence189 source 1..11769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 733..1887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 1884..3158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 3237..3971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(4123..4401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(5369..5968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(5980..6561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(6566..9283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(9324..10112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(10365..11645) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 sequence190 source 1..11711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..686) product osteoblast specific factor 2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 814..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 1227..4010 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, internal stop codon CDS 4047..4556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 note possible pseudo, internal stop codon CDS 4568..6013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 6016..6237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 6230..6871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 note possible pseudo, frameshifted CDS 6872..8227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(8434..9693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 9951..11573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 sequence191 source 1..11686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 963..2006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 2131..3195 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 3424..3906 product acetyltransferase CD1211 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B70 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 4103..4594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 4993..5613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(5615..7147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(7501..8868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(8905..10956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 misc_feature complement(11075..>11686) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108195.1:SusC/RagA family TonB-linked outer membrane protein note possible pseudo, frameshifted locus_tag LOCUS_26850 sequence192 source 1..11683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..1008 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(1064..1804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 3142..3462 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 3511..4464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 4889..5260 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CH65 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene rplS CDS complement(5339..5881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(6059..7342) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(7486..8202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(8320..9828) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(10027..11133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 sequence193 source 1..11661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(803..2281) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ6 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene proS CDS 2427..3758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 3851..5428 product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(5418..5921) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZU2 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene aroK CDS complement(5923..6990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(7103..7468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 note possible pseudo, frameshifted CDS 7534..8568 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene folP CDS 8588..9544 product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(9531..9788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 9914..10942 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene murB CDS 11182..11601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 sequence194 source 1..11603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(577..1419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 1622..2071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(2096..2860) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2998..3798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(3863..4561) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(4726..5388) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(5375..7177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(7213..7674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(7749..8573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 8806..9414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(9720..9932) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 10230..11081 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 11085..11339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 sequence195 source 1..11596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(705..3998) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(4509..7388) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(7584..8714) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(8891..9508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 9799..10941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 sequence196 source 1..11492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..494) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene frr CDS complement(583..1287) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene pyrH CDS complement(1410..1910) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene pycA CDS 1970..4552 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 tRNA 4692..4774 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 4932..5005 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 5076..5148 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 5227..6414 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene tuf tRNA 6474..6547 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 6567..6758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 6777..7361 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene nusG CDS 7354..7806 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene rplK CDS 7817..8515 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene rplA CDS 8521..9060 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 9118..9495 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene rplL sequence197 source 1..11471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(635..1612) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene pyrD CDS complement(1710..2636) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene xerC CDS 2719..3150 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene aroQ CDS 3166..4236 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Y1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene serC CDS 4272..4805 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 4914..5396 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene rnhA CDS 5442..5813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(5893..7365) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 7918..9288 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene guaA CDS 9341..11068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 sequence198 source 1..11424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3152..4924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 note possible pseudo, frameshifted CDS complement(4878..6701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(6709..7959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(8181..9359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(9459..10949) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 sequence199 source 1..11414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(664..4224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(4614..6161) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(6188..9679) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 sequence200 source 1..11398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..907 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 1236..2816 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 2825..3943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 4022..4579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 4753..5673 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 6135..6458 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 6465..6929 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 6936..7328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 7325..7888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 7995..8570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene ydeI note possible pseudo, frameshifted CDS 8842..9231 product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 9224..10774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 misc_feature complement(10886..>11398) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123110.1:multidrug resistance protein locus_tag LOCUS_27670 sequence201 source 1..11357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(916..1587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 1899..4262 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(4407..5459) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(5459..6100) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene arsC CDS complement(6111..7001) product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene arsM CDS complement(7053..7388) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(7593..9467) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene nadE CDS complement(9512..10252) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E8 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene rnc misc_feature complement(10312..>11357) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW44:3-oxoacyl-[acyl-carrier-protein] synthase 2 locus_tag LOCUS_27760 sequence202 source 1..11354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1742 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001882904.1:chitinase locus_tag LOCUS_27770 CDS 1763..2266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 2542..2898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 2942..3232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3311..4906 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene prfC CDS 4975..6111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 6186..6701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 6705..7169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 7237..7938 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 7958..8281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(8336..8581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(8670..10175) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene atpD sequence203 source 1..11338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1603..2859) product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(2989..4014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 4381..9876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(10027..10281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(10447..10617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(10749..11207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 sequence204 source 1..11302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1112..1903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 1887..4928 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 5064..7496 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 7502..8674 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228462.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(8729..11104) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 sequence205 source 1..11291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(869..1633) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 1894..2268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 2265..2555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 2673..3857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 4074..4502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 5801..9055 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109122.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 9067..10992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 sequence206 source 1..11249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..1666) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(1663..2241) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(2310..2921) product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWW6 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene nqrE CDS complement(2939..3616) product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene nqrD CDS complement(3670..4440) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene nqrC CDS complement(4427..5620) product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene nqrB CDS complement(5622..6992) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene nqrA CDS complement(7122..8021) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene ispH CDS complement(8045..8734) product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene cmk sequence207 source 1..11231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..3243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 3626..4267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 4568..5602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ywcH CDS complement(5703..7049) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(7197..7499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(7588..9795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 10408..10863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 sequence208 source 1..11179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1957 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114327.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_28230 CDS 2206..3054 product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(3112..3504) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 4014..4580 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene nbaC CDS 4936..5448 product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(5539..6192) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 6484..7347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 7515..8858 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 8870..10792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 sequence209 source 1..11110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..1313 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(2104..4641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(4915..5556) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939951.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(5620..6822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(6873..7853) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(7857..8984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(8981..10183) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 misc_feature complement(10232..>11110) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405140.1:glucosyltransferase locus_tag LOCUS_28390 sequence210 source 1..11096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962636.1:universal stress protein UspA locus_tag LOCUS_28400 CDS complement(840..1493) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene pyrE CDS 1707..5093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 5099..5869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(5854..8436) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene mutS CDS 8617..9204 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 9384..9941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 sequence211 source 1..11057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..1486) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(2120..2812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(2815..5985) product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102936.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(6032..7300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(7297..8322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 note possible pseudo, frameshifted CDS complement(8382..8855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 note possible pseudo, frameshifted CDS complement(8909..10966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 sequence212 source 1..11048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..1418 product putative pyridine nucleotide-disulphide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(2304..3785) product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 4232..4471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 5091..7226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 7238..7885 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(8820..9203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(10065..10220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(10460..11035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 sequence213 source 1..11044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(704..1993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(1977..2216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(2204..3070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(3054..3347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(3980..5464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(6267..6932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 7054..7296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(7319..8542) product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403845.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 8906..10117 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 misc_feature complement(10114..>11044) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765688.1:RNA helicase locus_tag LOCUS_28720 sequence214 source 1..10997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..1799) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(1822..2196) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene rnpA CDS 2681..5170 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene thrA CDS complement(5246..5854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 6109..6795 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CD4 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene deoC CDS 6835..7122 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE87 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene acyP CDS complement(7110..10997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 sequence215 source 1..10995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..916 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR2:enolase locus_tag LOCUS_28800 CDS 1091..1312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 1287..1865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(1862..2941) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(2989..3927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 4017..5606 product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene pccB CDS 5696..6658 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 6749..7276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 7425..7667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 misc_feature complement(7829..>10995) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122788.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_28890 sequence216 source 1..10990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(532..942) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(923..1324) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene rsbS CDS complement(1331..2200) product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene rsbR CDS complement(2632..3975) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(4084..7203) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(7258..8346) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 8678..9478 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(9747..9896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(10711..10944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 sequence217 source 1..10941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(952..1422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(1652..3298) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 4440..6557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 6565..7497 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 7502..9901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 sequence218 source 1..10927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..503 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963235.1:phospholipase locus_tag LOCUS_29050 CDS complement(599..1639) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 1931..4129 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 4335..4670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 note possible pseudo, frameshifted CDS 4657..5646 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene purD note possible pseudo, frameshifted CDS 5835..6863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 6927..7457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 sequence219 source 1..10913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2367..4136) product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene sglT CDS complement(4276..6234) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene gpi2 CDS complement(6665..7069) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(7258..8487) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(8685..8858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 9155..10354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 10386..10619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 sequence220 source 1..10874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein locus_tag LOCUS_29190 CDS complement(1334..2638) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene ahcY CDS complement(2775..3551) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 3598..3960 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene rsfS CDS 4040..6121 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene ftsH CDS 6174..6992 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene lpxH CDS 6994..7767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 7788..8264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(8342..8812) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 8995..9237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 sequence221 source 1..10850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1821..2714 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767320.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(2721..5201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(5198..5575) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 6034..6693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(6794..8323) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 misc_feature complement(8350..>10850) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_29340 sequence222 source 1..10838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2145..3650) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3655..6993) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(7098..8144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(8334..9029) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene rpsH CDS complement(9116..9784) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 misc_feature complement(10170..>10838) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326180.1:oxidoreductase locus_tag LOCUS_29400 sequence223 source 1..10772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1267 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(1284..2717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(2733..3707) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709532.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3796..4461) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 4547..6502 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 6615..6779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(6848..8746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 sequence224 source 1..10769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1823..2839) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene fadB5 CDS complement(2975..3766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3905..4390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(4507..7167) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(7181..7537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 note possible pseudo, frameshifted CDS complement(7522..9603) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 note possible pseudo, frameshifted CDS complement(9810..10148) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 sequence225 source 1..10759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 326..523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(599..1318) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 1420..1629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(1653..3287) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene ggt CDS 3576..4424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 4626..5765 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 6077..7690 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 sequence226 source 1..10710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..715) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene drrA CDS complement(880..1554) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 1866..2477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 2618..3085 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 3277..4104 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A337 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene lgt CDS 4194..6599 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene mutS2 CDS complement(6649..7140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(7209..7829) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(7844..8623) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene lpxA CDS complement(8620..10017) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene fabZ misc_feature complement(10045..>10710) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY99:UDP-3-O-acylglucosamine N-acyltransferase locus_tag LOCUS_29720 sequence227 source 1..10691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..556 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene ndhG CDS complement(567..3476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 3550..4335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 4433..5413 product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 5508..6365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(6360..7844) product gluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(7871..8272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(8269..9018) product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene lipB CDS complement(9120..10103) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 sequence228 source 1..10516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1319 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_29820 CDS 1396..3792 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 3941..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(5168..7111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 7272..8810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 8878..9648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 sequence229 source 1..10431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(467..1381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(1374..2141) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(2159..3514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 4347..5327 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 6378..6902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(7604..8050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 misc_feature complement(8129..>10431) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108535.1:cell wall-associated protein locus_tag LOCUS_29940 sequence230 source 1..10380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1816..2217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 2759..3391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3470..4081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 4177..4857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 4884..5666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 5791..6045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 6137..7648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 7905..8183 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 8180..9097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 9114..9815 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 sequence231 source 1..10310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..3244 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 3323..5773 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 5849..6577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 note possible pseudo, internal stop codon CDS 6653..8275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 note possible pseudo, internal stop codon sequence232 source 1..10273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(665..1375) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(1444..6498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 6564..7367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 7367..9445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 9602..10252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 sequence233 source 1..10204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..782 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein locus_tag LOCUS_30140 CDS 789..1634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 1681..3600 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3638..3892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(4135..5601) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(5602..7116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 7246..7803 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(7824..8537) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(8558..9835) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 sequence234 source 1..10162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 739..1725 product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(1735..3300) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(3358..6132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(6328..7773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(7976..8503) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene pyrR2 CDS complement(8556..9053) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 sequence235 source 1..10157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1885 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932956.1:multidrug transporter AcrB locus_tag LOCUS_30290 CDS 1965..3383 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(3596..4705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(5036..5863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(6085..7197) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(7372..8742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(9292..9729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 sequence236 source 1..10154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1058..1651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(1665..2765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(2999..3529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(4755..5351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(5348..5941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(5958..7070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 misc_feature complement(7133..>10154) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein locus_tag LOCUS_30420 sequence237 source 1..10134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 1002..1838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 1831..4293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 4348..5328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(5342..6634) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 6735..7085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(7078..7602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(7599..8282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 8433..9968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 sequence238 source 1..10100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 625..1455 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(1488..2792) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene hemA CDS 3325..6816 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE8 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene pyc CDS complement(6832..7959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0V1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(8169..10091) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene recQ sequence239 source 1..10084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 765..1475 product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene comB CDS complement(1463..1936) product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene recX CDS 2138..3406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 3601..3834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 4025..6106 product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene dsbD CDS 6119..6706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 6843..9077 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(9134..9355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 sequence240 source 1..9979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(1406..3514) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene pta CDS complement(3603..4148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 note possible pseudo, frameshifted CDS complement(4103..4786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 note possible pseudo, frameshifted CDS complement(4916..6139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(6203..7792) product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(7824..8660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 8884..9384 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene defA sequence241 source 1..9968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(936..3911) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 4390..5688 product idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966868.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene gntP CDS 5694..6152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 6262..7365 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 8086..8415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 note possible pseudo, frameshifted CDS 8439..9524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 note possible pseudo, frameshifted sequence242 source 1..9944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..681 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853131.1:molybdopterin containing oxidoreductase locus_tag LOCUS_30800 CDS 693..1196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 1200..2093 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 2396..3424 product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YX1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 3446..3742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 5115..5705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 5797..6375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 6570..8846 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 8957..9670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 sequence243 source 1..9901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 510..1604 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 1845..4235 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(4241..6445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 6783..9149 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 sequence244 source 1..9878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2095..2790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 3015..6425 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783448.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 6485..8215 product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 8540..9016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 9090..9359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 9504..9869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 sequence245 source 1..9842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..1009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(1021..1644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 1744..2805 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(2858..4153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(4299..5510) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(5663..6274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 6770..8470 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene opuE CDS 8482..9222 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene nagB sequence246 source 1..9807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..2692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(2749..4182) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(4239..5678) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(5747..9745) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 sequence247 source 1..9805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1299 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583203.1:secretion protein HlyD locus_tag LOCUS_31110 CDS 1292..2644 product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 2637..4112 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(4166..5341) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(5507..6574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(6555..7490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(7483..8376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 sequence248 source 1..9793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..1539 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene ctaC CDS 1571..3448 product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene ctaD CDS 3582..4529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 4516..5409 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene ctaB CDS 5416..6024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 6179..6838 product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 6865..7194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 7240..7869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 7874..8455 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228315.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 8864..9133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 sequence249 source 1..9738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..673 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963079.1:hemolysin D locus_tag LOCUS_31280 CDS 697..3867 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 3971..5299 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 5514..5942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 6539..7723 product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 7783..8985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 sequence250 source 1..9725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..1886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 1948..2385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(2508..3926) product 4,5-dihydroxyphthalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 4352..5575 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(5638..6357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(6915..9077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 sequence251 source 1..9705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(653..1198) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene nuoB CDS complement(1202..1729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(1852..2484) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(2691..3857) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 4004..4720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 4717..5310 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 5428..5904 product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 5888..8062 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 8110..8550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(8643..9011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 sequence252 source 1..9623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 504..737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 724..1044 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 1045..2022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 2382..3224 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene thrB CDS 3467..4819 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 5123..7864 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBZ2 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene ppc CDS complement(7984..9051) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene fbaA sequence253 source 1..9614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2168 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765900.1:cell envelope biogenesis protein OmpA locus_tag LOCUS_31590 CDS complement(2220..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(3645..5129) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(5342..5986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 6568..6897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 7035..7532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 7750..9450 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 sequence254 source 1..9582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..2170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 2314..2493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(2502..4661) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 4924..5484 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 5582..6682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(6880..7359) product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 8129..8968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 sequence255 source 1..9559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1078..1947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(1959..4133) product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene aguA CDS complement(4148..5176) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 5467..7410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 7494..8948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 sequence256 source 1..9539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..1036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(1093..1410) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 1569..2636 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene mutY CDS 2792..3268 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M7 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene ssb CDS 3291..4679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 4681..5448 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(5441..5650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 5677..6399 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 6476..7783 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T6 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene metK CDS complement(7844..8143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(8231..9115) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene xerC CDS complement(9175..9369) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene rpsU sequence257 source 1..9529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1122..2075 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 2102..2623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 2753..3664 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 3964..4887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 4881..5801 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 6717..7934 product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 8119..8523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 8675..9241 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 sequence258 source 1..9502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..1283 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106511.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 1270..2577 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 2593..3498 product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 3492..4151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 4161..4682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 4685..5788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 5798..6886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 sequence259 source 1..9437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..518 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122600.1:hydroxyglutarate oxidase locus_tag LOCUS_32050 CDS 714..1655 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 1662..2075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 2250..2528 product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 2578..3741 product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(3777..4280) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 4605..6386 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 6817..7278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 7461..8150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 8283..9191 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene ephA sequence260 source 1..9428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1393..2718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 2943..3695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 3816..5918 product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 5915..6838 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(6877..7293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(7369..9186) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 sequence261 source 1..9419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..2587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(2652..3806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(3815..6589) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(6586..7338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(7529..8434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 8605..9003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 sequence262 source 1..9414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..3594 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 3600..5051 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 5229..6617 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene GALNS CDS 6680..8032 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene GALNS CDS 8140..9048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 sequence263 source 1..9414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 441..525 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 797..1645 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 1731..2504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 2518..2895 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 2907..3596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 3637..4455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 5103..5738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 6422..6781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 6896..7720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 7874..8203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 8337..8666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 8823..9314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 sequence264 source 1..9406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..852 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene hisF CDS 954..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 2145..2618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 2908..3543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3716..4921) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 5135..6169 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 6437..7159 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 7277..7897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 sequence265 source 1..9402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1787..2599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(2955..4157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(4265..4816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(5180..7639) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 sequence266 source 1..9379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..1360) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 1550..2122 product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 2115..2621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 2809..5103 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 5133..6083 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 6121..7065 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 7173..8933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 sequence267 source 1..9362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1210..2559) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(2549..3946) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 4314..5567 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 6040..6729 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 7663..8562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence268 source 1..9357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(787..2328) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB3 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene ndhB CDS complement(2348..4054) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene ndhD CDS 4283..5176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 5181..6074 product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 6132..6305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 6312..6986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 7033..7914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 8066..9211 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene aroB sequence269 source 1..9345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..948 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(971..4585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 5011..6021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 sequence270 source 1..9300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3084 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NJ8:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_32780 CDS 3086..3418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 3515..3889 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene rpsL CDS 3905..4372 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene rpsG CDS 4380..6497 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene fusA CDS 6503..6808 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene rpsJ CDS 7034..7666 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene rplC CDS 7671..8318 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene rplD CDS 8321..8608 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene rplW sequence271 source 1..9284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(957..1382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(1643..2182) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(2283..2738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(2855..3307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(3387..4385) product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(4406..5260) product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(5409..6299) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123493.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 6488..7390 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 7569..8024 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 sequence272 source 1..9273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(584..3721) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(3917..5185) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(5266..6300) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 6647..7234 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766735.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 7321..8328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 sequence273 source 1..9254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..817 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203130.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_33010 CDS 899..2413 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 2792..3685 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121362.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(3933..5288) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene argH CDS complement(5355..5810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(5839..6930) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(6927..7730) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene argB CDS complement(7723..8667) product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene argF' sequence274 source 1..9212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 1242..1802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(1890..3719) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYJ7 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene glgB CDS complement(3719..3934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 4325..6349 product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene glgE sequence275 source 1..9196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3997 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582976.1:protease locus_tag LOCUS_33140 CDS 4074..5453 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene GALNS CDS complement(5454..6203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(6378..7643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(7719..8534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 sequence276 source 1..9128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..2624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 2788..4200 product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(4274..4594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(4596..5171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(5336..7690) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene mrcA sequence277 source 1..9087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1567..3063) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(3063..6395) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(6633..7646) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(7733..8320) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 sequence278 source 1..9079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1281..2327 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene gshB CDS 2778..3050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 3081..3290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 3377..3598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 3627..4136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 4175..5317 product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(5954..6430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 sequence279 source 1..9059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1207 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141532.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_33350 CDS 1265..2398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(2586..3227) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(3327..3806) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707090.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(3829..4494) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 4792..5172 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene rpsF CDS 5169..5426 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene rpsR CDS 5518..5961 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene rplI CDS 6192..7016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 sequence280 source 1..9014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..1274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(1271..1735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(1756..2295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(2429..2818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(2900..3250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(3247..4482) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(4479..6104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(6132..7763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 8086..8460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 sequence281 source 1..8961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2471..3844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120083.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 4257..5129 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 5372..5749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 6295..8154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 sequence282 source 1..8949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..1394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(1437..3959) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene gyrA CDS complement(4064..5086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 5308..6204 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(6201..6794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(6850..7662) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene dapD CDS 7695..8846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 sequence283 source 1..8945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 544..705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 955..2472 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(2526..3761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(4049..5086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(5539..8052) product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(8337..8789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 sequence284 source 1..8941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1022..1591) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(1765..2736) product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(2824..4008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(4163..5125) product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(5422..6822) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 misc_feature complement(6833..>8941) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118275.1:peptidase S9 locus_tag LOCUS_33760 sequence285 source 1..8937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..3565 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 3569..5074 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 5292..5975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 5983..7467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 sequence286 source 1..8918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1270..3768 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(3860..6283) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(6406..6885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(7045..8781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 sequence287 source 1..8844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(696..1565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 note possible pseudo, internal stop codon CDS complement(1605..2213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 note possible pseudo, internal stop codon CDS complement(2267..3334) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(3497..4855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(4861..6177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(6308..7654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 misc_feature complement(7730..>8844) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121664.1:N-acetylgalactosamine-6-sulfatase locus_tag LOCUS_33910 sequence288 source 1..8799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 338..514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 tRNA complement(629..701) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(740..1312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 note possible pseudo, internal stop codon CDS 1633..2139 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PR9 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 2179..2985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(2991..4214) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene hflX CDS complement(4297..4944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 tRNA 5118..5191 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 5476..5841 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 5945..6427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 6591..6965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(6946..7698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 misc_feature complement(7991..>8799) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257729.1:histone deacetylase locus_tag LOCUS_34020 sequence289 source 1..8747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 908..2311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 2463..3659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 3728..5338 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036928.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 5669..7174 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 7320..7625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(7648..8340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 sequence290 source 1..8732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3231..4103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 note possible pseudo, internal stop codon CDS complement(4119..4901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 note possible pseudo, internal stop codon CDS complement(4970..5917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(5922..6845) product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B2 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(7109..8647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 sequence291 source 1..8707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2797..3639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(3781..4794) product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108856.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(4914..5951) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(5954..7030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456695.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(7070..8527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 sequence292 source 1..8650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1907 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257049.1:glycoside hydrolase locus_tag LOCUS_34190 CDS 2075..4813 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 4810..6432 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(6439..6858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 misc_feature complement(6887..>8650) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800665.1:ABC transporter permease locus_tag LOCUS_34230 sequence293 source 1..8640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1222..1563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(1694..2698) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(2789..3226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(3196..3651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(3694..5268) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene yidK CDS complement(5354..6388) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(6473..7456) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965473.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(8144..8638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 sequence294 source 1..8608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2561..3118 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 3757..6861 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 6883..8445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 sequence295 source 1..8608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..2640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(2850..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(3233..3817) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(3963..4841) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 4986..8528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 sequence296 source 1..8603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1989..4730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 4736..6223 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 6347..7189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(7205..8128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 sequence297 source 1..8574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..1007 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 1139..2377 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 2453..5416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(5550..5774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 5800..6063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(6146..7450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(7453..8163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 sequence298 source 1..8547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..1626) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene asnS CDS 1816..3270 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene rpoN CDS 3270..3905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(3909..4877) product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene ftsY CDS complement(4964..5116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(5119..5307) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene rpmG CDS complement(5344..5583) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene rpmB CDS 5941..7173 product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene rocD CDS 7209..7994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 sequence299 source 1..8534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..3812 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 3853..5370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 5462..6235 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene cutC CDS 6225..7076 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 7132..8148 product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 transl_table 11 codon_start 1 locus_tag LOCUS_34640 sequence300 source 1..8517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 874..1701 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E4 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene murI CDS 1985..3082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 3075..8189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 sequence301 source 1..8504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2320..2769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(2905..3030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 note possible pseudo, frameshifted CDS complement(3018..3722) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775202.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 note possible pseudo, frameshifted CDS complement(3816..4265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(4305..6605) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(7301..8503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 sequence302 source 1..8502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1028 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0P8:S-adenosylmethionine:tRNA ribosyltransferase-isomerase locus_tag LOCUS_34750 CDS complement(1077..1691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 2257..2919 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(2928..3977) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene metX CDS complement(3980..5302) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene MET17 CDS complement(5755..6474) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107771.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(6636..7379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(7711..8130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 sequence303 source 1..8497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..1575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(2110..3123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(3167..4915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(5005..8220) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 sequence304 source 1..8439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 425..2665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(2623..2796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 2903..6436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 6565..7377 product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 7454..8215 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 sequence305 source 1..8435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..1412) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 1724..3424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 3431..3808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(3805..4434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 4771..5013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 5136..5822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 5806..7467 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 7472..8128 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene rpe sequence306 source 1..8431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..1392) product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 1520..2269 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(2276..2971) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene recO CDS 3121..3504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(3548..4147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(4131..4733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(4830..5603) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 5738..8230 product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene nasB sequence307 source 1..8405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2218 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein locus_tag LOCUS_35080 CDS complement(2285..4645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(4787..5305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 sequence308 source 1..8403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(337..1680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(1754..3076) product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene gltP CDS complement(3314..3670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(3684..3905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 4750..5490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 5493..7286 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(7314..8111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 sequence309 source 1..8389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2718..3719) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(3898..4530) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(4899..6632) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 note possible pseudo, internal stop codon CDS complement(6666..7022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 note possible pseudo, internal stop codon CDS 7333..7923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 7904..8152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 sequence310 source 1..8363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1325 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760507.1:membrane protein locus_tag LOCUS_35240 CDS 1325..2866 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene arsA CDS 2883..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 4733..5965 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(6178..7611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 sequence311 source 1..8347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3871..4941 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(5027..5230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(5313..5465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(5698..7482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 sequence312 source 1..8337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(585..2510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 2650..3702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 3851..5497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(5626..6153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 6559..7521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 sequence313 source 1..8303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1201..2115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 2096..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 2850..3902 product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene rlmN CDS complement(3908..4423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(4425..4898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(4876..5277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(5361..7460) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene ptrB CDS complement(7687..8022) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 sequence314 source 1..8290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2282 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_35460 CDS complement(2428..4398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 4945..5334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(5331..5594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(5631..7013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene yqeZ CDS 7152..7958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 sequence315 source 1..8284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(545..1360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(1428..2234) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(2285..3310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(3354..4577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(4595..5644) product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(5761..6537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 misc_feature complement(6623..>8284) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118043.1:cytochrome c locus_tag LOCUS_35580 sequence316 source 1..8264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1743 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_35590 CDS 1765..3246 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 3243..6620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 sequence317 source 1..8220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..1785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 1782..3563 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 3664..5361 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(5451..6917) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 7312..8103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 sequence318 source 1..8218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 616..1395 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 1471..2880 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(2989..3627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 4558..5088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 5092..5700 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene ychE sequence319 source 1..8217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..536 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW47:pyruvate kinase locus_tag LOCUS_35720 CDS 614..2101 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(2201..3100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(3214..4365) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene dnaJ CDS complement(4370..5011) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene grpE CDS complement(5072..6064) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene obg CDS complement(6185..6775) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene adk CDS complement(6915..7439) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 misc_feature complement(7454..>8217) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583050.1:aminopeptidase locus_tag LOCUS_35800 sequence320 source 1..8200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..2450) product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene gldG CDS complement(2625..3353) product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene gldF CDS complement(3358..4326) product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene gldA CDS complement(4671..5129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(5236..6927) product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene sulP sequence321 source 1..8186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(726..2093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(2743..3927) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(3950..7036) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 misc_feature complement(7048..>8186) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657461.1:cation efflux system protein locus_tag LOCUS_35900 sequence322 source 1..8177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 544..753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 1005..2228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 2258..3049 product methyltransferase FkbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(3109..4080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207633.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 4211..4963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 5736..6395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 6475..7479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 sequence323 source 1..8175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1736 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_35980 CDS 1889..2362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 2519..2851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 2866..5490 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 5483..8158 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 sequence324 source 1..8172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1019..3517) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(3521..4693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(4704..6701) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(6709..7344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(7407..7814) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 sequence325 source 1..8170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(530..796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(837..1094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(1421..1753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(1843..2319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(2485..2661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(2783..5938) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(6008..7078) product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 misc_feature complement(7111..>8170) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765356.1:transporter locus_tag LOCUS_36150 sequence326 source 1..8168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..1041) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(1038..1721) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(1866..2768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(3017..4291) product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(4639..5085) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(5150..6574) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(6663..7253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 sequence327 source 1..8140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(835..1728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(1827..3080) product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 3311..3826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 4075..5301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 sequence328 source 1..8119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..613 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084098.1:isopenicillin-N epimerase locus_tag LOCUS_36280 CDS complement(624..1427) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene proC CDS 1574..1831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(1882..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(2403..3161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(3243..3533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 4110..5114 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(5267..6130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919108.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(6287..7018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 misc_feature complement(7258..>8119) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707740.1:UDP-glucose 4-epimerase locus_tag LOCUS_36370 sequence329 source 1..8112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 676..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(2360..2551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(2811..6194) product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene gdhP CDS complement(6418..7422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 sequence330 source 1..8103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..1705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(2021..3253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142886.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(3433..3579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(3628..4893) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 5021..5374 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 5359..6414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 6477..7550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 sequence331 source 1..8092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2104 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase locus_tag LOCUS_36490 CDS 2269..3375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 3393..4184 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(4192..5520) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 5765..6529 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 sequence332 source 1..8090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 954..1571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 1579..2535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 2528..3493 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 3616..4134 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 4234..5601 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 5820..6182 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 6179..7924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 sequence333 source 1..8089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..948) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(948..1706) product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(1711..2166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(2210..3682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(3980..4435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 4747..4980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 note possible pseudo, frameshifted CDS 5202..6014 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 6120..6926 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene ispE CDS complement(6929..7576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 sequence334 source 1..8082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..2756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 2828..4069 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082285.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 4102..4656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 4676..6388 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(6444..7250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 sequence335 source 1..8054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2229 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_36750 CDS 2254..3711 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 3720..5186 product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 5410..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 6241..7575 product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 sequence336 source 1..8052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 370..666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 734..943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 954..1985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene pslN CDS complement(1975..3441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(3451..3909) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(3906..5402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(5465..6817) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(6943..7308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 sequence337 source 1..8051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1639) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 1782..3341 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene porX CDS 3334..3771 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 3764..5014 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene ald CDS 5290..6450 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 6457..6996 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087958.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(6993..7667) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene psd sequence338 source 1..8037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..1516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 1598..3001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(3033..4280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 5183..6565 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 sequence339 source 1..8025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(301..3009) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(3283..4038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 note possible pseudo, frameshifted CDS complement(3981..4322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 4726..6042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 6504..7379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 sequence340 source 1..7971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 806..988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(1055..1702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(2348..3487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(3468..4118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(4255..5295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 5424..7394 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 misc_feature complement(7381..>7971) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143384.1:Xaa-Pro dipeptidase locus_tag LOCUS_37110 sequence341 source 1..7967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..822 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:multidrug transporter locus_tag LOCUS_37120 CDS 1008..2390 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 2645..2872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 2876..3286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403204.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 3289..5097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 5104..5847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 5867..7384 product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(7381..7782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 sequence342 source 1..7959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(610..1335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(1695..2000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(1981..2751) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(3562..4209) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAW6 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene clpP CDS complement(4760..5029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(5010..5561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(5772..7058) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 misc_feature complement(7214..>7959) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122368.1:cytochrome c locus_tag LOCUS_37270 sequence343 source 1..7929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..658 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203530.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_37280 CDS 679..2163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 2167..3321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 3446..4897 product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118996.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 4897..5844 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969468.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 5986..7281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 note possible pseudo, frameshifted sequence344 source 1..7913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1656) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 1798..2382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 2379..2885 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141969.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 2946..3362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268871.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(3832..4332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 5269..6132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449124.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 6284..6694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 6814..7614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 sequence345 source 1..7908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 372..2234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 2206..2886 product oxygen regulatory protein NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN75 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene nreC CDS 2950..3555 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHS9 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene mobA CDS complement(3564..4043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403315.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 4318..5604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 5682..7043 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene crnA sequence346 source 1..7836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1010) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene ispH CDS complement(1113..1946) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene crtB CDS complement(1980..3455) product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene crtI CDS complement(3455..3967) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(4410..5309) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(5846..6514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(6584..6973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 misc_feature complement(7086..>7836) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZL9:lipoyl synthase locus_tag LOCUS_37550 sequence347 source 1..7811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2764..4998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(4998..5879) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 misc_feature complement(6669..>7811) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804928.1:FAD-linked oxidoreductase locus_tag LOCUS_37580 sequence348 source 1..7789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 401..703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(830..1672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(1732..2274) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 2479..3252 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 3625..6741 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 sequence349 source 1..7759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..3047 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 3204..5594 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(6893..7120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 7275..7616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 sequence350 source 1..7750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1458) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene cysM CDS complement(1508..2338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(2648..3877) product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224536.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(3867..4214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(4334..5749) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 6002..6484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 6481..6867 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 sequence351 source 1..7746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..1545) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(1729..2583) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene ruvB note possible pseudo, frameshifted CDS 2925..3950 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 3954..5048 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 5052..6005 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene ybcH CDS 5923..6720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 misc_feature complement(6794..>7746) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108756.1:peptidase M16 locus_tag LOCUS_37810 sequence352 source 1..7722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..666 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933466.1:cation acetate symporter locus_tag LOCUS_37820 CDS 924..2825 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene acsA CDS complement(2950..3255) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761179.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 3427..4665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(4739..5383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 sequence353 source 1..7709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..2674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(2803..3927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(4521..6155) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene pruA sequence354 source 1..7705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1161) product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 1460..1705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 1705..2334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(2352..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141758.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(3478..5415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(5708..6451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 6972..7700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 sequence355 source 1..7687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..586 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766891.1:DNA-directed RNA polymerase sigma-70 factor locus_tag LOCUS_37970 CDS 680..1735 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 1841..5236 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 5261..6778 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 sequence356 source 1..7649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1539..2723) product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 3065..4402 product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 4443..5324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(5392..6537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 sequence357 source 1..7578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..663) product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706483.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(674..3223) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(3207..3959) product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene ste14 CDS complement(4035..4913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(4969..7269) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence358 source 1..7546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2323..3900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(4163..4975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(5128..5892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(5967..7436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 note possible pseudo, internal stop codon sequence359 source 1..7541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(903..1778) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene nadK CDS complement(1790..2455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(2452..3216) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene pcbD CDS complement(3354..3881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(3884..4336) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 4465..5178 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene pdxJ CDS complement(5187..6146) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(6139..7452) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 sequence360 source 1..7509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1638 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784260.1:sodium:proton antiporter locus_tag LOCUS_38220 CDS complement(2209..3732) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 4305..5450 product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(5655..6158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 misc_feature complement(6662..>7509) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867978.1:malate dehydrogenase locus_tag LOCUS_38260 sequence361 source 1..7494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(889..1722) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 1943..2932 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(3067..3837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(3996..4787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(5054..5431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(5664..7016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 sequence362 source 1..7487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 1458..1871 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(1935..4319) product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 4761..4991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 misc_feature complement(4964..>7487) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_38370 sequence363 source 1..7415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..1573) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene leuB CDS complement(1616..2212) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(2257..3675) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene leuC CDS complement(3713..4879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 5045..6610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(6640..7209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 sequence364 source 1..7404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2182..4023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 note possible pseudo, frameshifted CDS complement(3960..4631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(4972..7404) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 sequence365 source 1..7382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..2442) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene ftsK note possible pseudo, internal stop codon CDS 2798..3142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(3196..3753) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403872.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(4056..5753) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 6115..7089 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 sequence366 source 1..7340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(871..1509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 1843..2091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 2341..2916 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 2982..3422 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 3436..4164 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 4446..4958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 4982..6037 product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 sequence367 source 1..7295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 1392..2324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 2321..3250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(3210..4022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(4214..5029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 5197..5892 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 misc_feature complement(5974..>7295) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118166.1:imidazolonepropionase locus_tag LOCUS_38660 sequence368 source 1..7293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 854..1894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 2076..5423 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 5428..7128 product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 sequence369 source 1..7277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1533 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene sufD CDS 1546..2802 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BY0 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene csdB CDS 2807..3259 product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 3269..3598 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 3695..4111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene yqiW CDS complement(4173..5105) product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(5110..5766) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKH4 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(5923..7092) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269036.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 sequence370 source 1..7266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..2484) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(2496..3350) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene fdhD CDS 4074..4682 product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 4736..6274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 6391..7071 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 sequence371 source 1..7240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 341..1252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 1295..1711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 1796..2692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 2869..3303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 3314..3901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887619.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 3989..4726 product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene bla CDS 4915..6231 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 6691..7032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 sequence372 source 1..7224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(485..3394) product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F937 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene gcvP CDS complement(3745..4722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(5003..5542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(5547..6065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(6162..6683) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 sequence373 source 1..7144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760864.1:chloride channel protein locus_tag LOCUS_38980 CDS 1366..1845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 1853..2470 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 2480..3247 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene purQ CDS complement(3338..3673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404760.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 3943..4305 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860832.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 4470..5471 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene fabH2 CDS complement(5440..5694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(5833..6039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 misc_feature complement(5987..>7144) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0Y1:exodeoxyribonuclease 7 large subunit locus_tag LOCUS_39070 sequence374 source 1..7131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..1563 product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 1852..2736 product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene cheR CDS 2760..3353 product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene cheB2 CDS 3358..4176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 sequence375 source 1..7126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 554..2383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 2529..3113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 3178..3624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 3798..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 4403..4987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 sequence376 source 1..7075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(303..1640) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(1668..2567) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(2752..3744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(3921..6086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 misc_feature complement(6286..>7075) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:membrane protein locus_tag LOCUS_39210 sequence377 source 1..7073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(989..1582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(1611..3041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(3048..3971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(3971..4432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 4935..5708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 5698..6597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 sequence378 source 1..7067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..1731 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 1874..2758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 2906..3298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 3402..3791 product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(4007..4546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(4716..5159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 5327..5692 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 6032..6412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 sequence379 source 1..7001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2535 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter locus_tag LOCUS_39370 CDS 2569..2940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 2937..4241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 4330..5553 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 5556..6086 product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene yneN sequence380 source 1..6991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 698..1420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 1451..1777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 1781..2080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 2077..3708 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 4107..6461 product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140357.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 sequence381 source 1..6973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..731 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34484:methionine aminopeptidase 2 locus_tag LOCUS_39470 CDS 890..1636 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 1811..3274 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120375.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 3451..3858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 4682..5134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 5151..5753 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 5884..6453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 sequence382 source 1..6971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 896..1483 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143043.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(1410..2561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143044.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 2527..2709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(2899..5004) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGZ9 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(5539..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 misc_feature complement(6060..>6971) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34733:putative membrane protein YdjJ locus_tag LOCUS_39600 sequence383 source 1..6969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 195..647 product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 651..1595 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(1608..2792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(2798..3547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 5076..5696 product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6B5 transl_table 11 codon_start 1 locus_tag LOCUS_39650 misc_feature complement(5763..>6969) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368619.1:IQ calmodulin-binding- domain protein locus_tag LOCUS_39660 sequence384 source 1..6966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 957..2264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(2253..3122) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 3340..3573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 3579..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 4213..5280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 5309..5761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 sequence385 source 1..6956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..1658 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 1941..2963 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 3024..3653 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 3800..4831 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 sequence386 source 1..6952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 1485..2240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 2231..2686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(2695..4962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(5075..5554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(5715..6131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 sequence387 source 1..6952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(2453..3805) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 misc_feature complement(4002..>6952) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_39850 sequence388 source 1..6945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1639..2862 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 2852..3706 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973969.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 3696..4469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 4469..5239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 5255..6172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 sequence389 source 1..6926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..1538) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 1680..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 2489..3205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 note possible pseudo, frameshifted CDS complement(3202..3447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(4192..4395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(4450..4665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 5084..6130 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 sequence390 source 1..6925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1525..4911) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(5019..6104) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(6195..6821) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 sequence391 source 1..6921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2863..6129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 sequence392 source 1..6904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1017..1913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525382.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 2104..2838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 2857..3705 product UPF0719 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67364 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 3696..5288 product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene speE2 CDS complement(5421..6446) product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene ltaE sequence393 source 1..6888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1598 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 1649..3073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 3589..6678 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 sequence394 source 1..6887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(927..1547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 2401..3039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 3808..4230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 4313..4615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 4619..4930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 5023..5613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 6495..6719 product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 sequence395 source 1..6876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..1426) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(1470..2147) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(2178..2810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(2890..3708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(4002..4643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268696.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(4714..5481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 6264..6512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 sequence396 source 1..6866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 1429..1830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(1920..2750) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 2955..4022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 4019..4246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(4374..4580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(4647..5003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(5017..6312) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DRM0 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene purD CDS complement(6320..6769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 sequence397 source 1..6860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 1323..3722 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(3788..4210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 4240..6726 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 sequence398 source 1..6844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..1088) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene ldhA CDS 1235..1825 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(2171..2743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(2874..3401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(3592..4242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 4695..5048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(6074..6268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 misc_feature complement(6279..>6844) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877143.1:aryldialkylphosphatase locus_tag LOCUS_40440 sequence399 source 1..6824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 330..3587 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 3607..5010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(5140..6360) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201946.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 sequence400 source 1..6822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..571 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107135.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_40480 CDS 676..2481 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760460.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 2768..4363 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123733.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 4556..6346 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 sequence401 source 1..6815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 47..2356 product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene relA CDS 2367..2927 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 3006..4298 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene purA CDS complement(4295..5116) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene porP misc_feature complement(5283..>6815) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin locus_tag LOCUS_40560 sequence402 source 1..6791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 301..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 500..1645 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(1622..2179) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(2212..3582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(3621..4193) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H7 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene plsY sequence403 source 1..6744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2916..3983) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(4120..4740) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107550.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 misc_feature complement(5110..>6744) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027188.1:hydrolase locus_tag LOCUS_40640 sequence404 source 1..6721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3337 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_40650 CDS 3356..5107 product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 5343..6035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 sequence405 source 1..6715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 938..3283 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 3276..3716 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 3730..4845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(5114..6580) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045809.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 sequence406 source 1..6690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 372..1400 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 1397..1732 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(1808..2953) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(3105..3755) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(3865..4932) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(5057..5611) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(5621..6682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 sequence407 source 1..6655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 1568..4732 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 sequence408 source 1..6649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..3439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 3454..4509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(4506..5597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(5641..6399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 sequence409 source 1..6608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..2880 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 3046..3759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 sequence410 source 1..6594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 462..869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 1325..2476 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene dctD CDS complement(2716..3705) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 3807..4508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 4557..5258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(5255..6217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 sequence411 source 1..6591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2836..3855) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(4031..4612) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254439.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 5481..5738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(5847..6059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 note possible pseudo, internal stop codon sequence412 source 1..6584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1985 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764740.1:alpha-glucosidase locus_tag LOCUS_40980 CDS 2157..3440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(3434..3790) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 3964..5613 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene pgi CDS 5771..6445 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 sequence413 source 1..6571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..863 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403533.1:N-acyl-L-amino acid amidohydrolase locus_tag LOCUS_41030 CDS 1217..2074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(2064..3209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 3434..4672 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(4761..5750) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(5906..6382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 sequence414 source 1..6556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460338.1:DNA mismatch repair protein locus_tag LOCUS_41090 CDS 1989..3770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 3939..4928 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 5063..6016 product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229250.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene qor sequence415 source 1..6556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..2018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(2124..3797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(3873..4547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(5040..5609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(5610..6077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 sequence416 source 1..6546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(404..476) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(514..586) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 817..1812 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene gapA CDS complement(1851..2495) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870185.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 2634..5864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 5881..6345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 sequence417 source 1..6545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..1437) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(1434..2111) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(2108..2728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(2733..3641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 3973..5052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 sequence418 source 1..6540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2972..3976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(4182..4790) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 misc_feature complement(5131..>6540) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66936:1,4-alpha-glucan branching enzyme GlgB locus_tag LOCUS_41290 sequence419 source 1..6531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(546..1628) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766605.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(1778..3115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(3703..4335) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876687.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 4558..5814 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 sequence420 source 1..6509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(507..1715) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene trpB CDS 1960..2952 product oxidoreductase/dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602267.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 3031..3582 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 3655..4863 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene fabF CDS complement(4913..5755) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene menB misc_feature complement(5847..>6509) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005678712.1:DNA-binding response regulator locus_tag LOCUS_41390 sequence421 source 1..6509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3665..4402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 misc_feature complement(4432..>6509) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor locus_tag LOCUS_41410 sequence422 source 1..6508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1036..4263) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(4805..5863) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1W0 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene hemE sequence423 source 1..6495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(657..2156) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 2315..3364 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene gnl CDS 3451..5802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(5799..6401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 sequence424 source 1..6491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(574..2550) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene gyrB CDS complement(2692..3066) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(3218..5113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(5299..5901) product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene miaE CDS complement(5898..6230) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 sequence425 source 1..6488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..2142) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(2178..5267) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 sequence426 source 1..6486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1354 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase locus_tag LOCUS_41550 CDS 1657..2244 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 2360..3376 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 sequence427 source 1..6460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..1613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205701.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 1689..4217 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(4250..4702) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(4795..4989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 5121..6137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 sequence428 source 1..6459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024073.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 1239..1691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 1804..2583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(2591..2836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 3070..3840 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 3917..4690 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 4694..5629 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601375.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 sequence429 source 1..6447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(707..1570) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 1801..2952 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene galM CDS complement(3747..4046) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(4374..5807) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 sequence430 source 1..6418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..2977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(2988..3983) product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS 4370..4855 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJX5 transl_table 11 codon_start 1 locus_tag LOCUS_41760 gene rimP CDS 4859..6106 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene nusA sequence431 source 1..6396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1779 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765775.1:DNA-binding protein locus_tag LOCUS_41780 CDS 2140..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 2858..3001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 3119..5491 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 sequence432 source 1..6373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1052 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117991.1:arylsulfatase locus_tag LOCUS_41820 CDS 1064..2854 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 gene atsA CDS complement(3227..5176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 sequence433 source 1..6369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2920..3153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(3547..3756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(3768..3962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(4146..4733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(4773..5405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(5417..5773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(5773..6153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 sequence434 source 1..6357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2063..3079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 sequence435 source 1..6345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1286..1543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(1646..2113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(2367..4808) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 misc_feature complement(5036..>6345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_41960 sequence436 source 1..6333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2937..5624 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 sequence437 source 1..6289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1885..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 2878..4689 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 4703..5152 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348730.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(5175..5603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(5838..6170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 sequence438 source 1..6279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1223) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene arsC CDS complement(1256..1981) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene arsC CDS complement(2019..2852) product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene arsM CDS complement(2898..3230) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 4392..4559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 4564..4749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(4888..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42090 misc_feature complement(5763..>6279) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731228.1:AraC family transcriptional regulator locus_tag LOCUS_42100 sequence439 source 1..6277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(1046..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 1871..2803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(2812..3999) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(4409..4948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(4961..6226) product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 sequence440 source 1..6270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(934..1545) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(1623..3143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 3336..4121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 4138..4542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(4656..5444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 misc_feature complement(5454..>6270) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZB5:glycine--tRNA ligase locus_tag LOCUS_42230 sequence441 source 1..6250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..3253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 3437..4450 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 4591..5748 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Y8 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene hisC sequence442 source 1..6235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(453..1436) product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(1482..2786) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene hemL CDS complement(2799..3791) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705190.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(3797..4186) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37552 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene yabJ CDS complement(4315..4767) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene yjaB CDS complement(4845..6233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 sequence443 source 1..6229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2096..2560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 2775..4025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 4204..5295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(5292..6083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 sequence444 source 1..6214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 877..1680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS 1722..3614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(3805..4434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(4437..6176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42410 sequence445 source 1..6198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1299..2117) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene crt CDS 2354..3799 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene leuB CDS complement(3886..4404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(4481..5083) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T4 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene engB CDS complement(5083..5697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 sequence446 source 1..6189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(794..2890) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene recG CDS complement(2900..3502) product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene gldD CDS 3777..4832 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene rmlB CDS 4900..5412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 sequence447 source 1..6165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 523..2742 product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(2781..4151) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 4430..5254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 sequence448 source 1..6119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 917..1696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 1880..2980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 3209..3781 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 3873..4817 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 sequence449 source 1..6085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(785..1819) product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 2015..3859 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene msbA tRNA 3941..4015 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 4196..5119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 5251..5589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 sequence450 source 1..6063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2864 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108101.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_42620 CDS 2881..4326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 sequence451 source 1..6038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 880..1902 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene glnII CDS complement(1975..2295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(2487..3116) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(3191..3664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(3678..3941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 3901..4986 product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene dinB2 sequence452 source 1..5980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..1134) product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(1376..1963) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(1963..2319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(2320..2532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(2638..3210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(3450..4547) product aminotransferase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS 4905..5612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261156.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 sequence453 source 1..5964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1072..3675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 3672..4217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 4356..4874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 sequence454 source 1..5957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..836 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 836..2134 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 2162..2980 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 2982..4187 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24215 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene uxuA CDS 4282..4530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 sequence455 source 1..5928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..1588 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 1622..2860 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 2870..3886 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 3889..4947 product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 sequence456 source 1..5913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3569..4786) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene nuoD sequence457 source 1..5906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2108..2311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 2703..2984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 3141..4238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 4430..4960 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 5058..5522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701514.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 sequence458 source 1..5894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 981..1547 product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071750.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 1623..2360 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 2377..3342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(3463..4761) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 sequence459 source 1..5894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(668..1177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 note possible pseudo, internal stop codon, frameshifted CDS complement(1454..1912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(2206..3234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 3814..4554 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225465.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 4573..5487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 sequence460 source 1..5887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1090..1581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(1581..2090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(2301..2882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(3037..3606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 sequence461 source 1..5885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 448..873 product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149970.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene moaE CDS 880..1599 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS 1606..2511 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene ilvE2 CDS complement(2517..2903) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(3097..3762) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene rrp4 misc_feature complement(3912..>5885) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_43160 sequence462 source 1..5881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1359..2411) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(2572..3177) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(3502..5619) product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(5642..5881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 sequence463 source 1..5880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2767..4344) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 misc_feature complement(4344..>5880) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108634.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_43220 sequence464 source 1..5863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(1723..5391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 sequence465 source 1..5854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..1663 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(1660..3216) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene purH CDS complement(3323..3895) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene purN CDS complement(3921..4808) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 sequence466 source 1..5839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..620 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene purE CDS 689..1990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 1997..2404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 2519..3364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 3366..4835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 5109..5360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 5396..5806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 sequence467 source 1..5819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1323 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461023.1:cell wall-binding protein locus_tag LOCUS_43360 CDS 1526..3517 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene btuB sequence468 source 1..5792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(614..1930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(2010..2465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 note possible pseudo, internal stop codon CDS complement(2523..3422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 note possible pseudo, internal stop codon CDS complement(3447..4949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 misc_feature complement(5130..>5792) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525175.1:dimethylmenaquinone methyltransferase locus_tag LOCUS_43420 sequence469 source 1..5783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..529 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947961.1:glutamine synthetase locus_tag LOCUS_43430 CDS 652..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 888..1205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 1418..2554 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 2551..3306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(3477..3938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198489.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(4115..4684) product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 5171..5749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 sequence470 source 1..5775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1097) product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(1097..2143) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS complement(2744..3805) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBI1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 4049..5137 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 5222..5395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 sequence471 source 1..5752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(605..1642) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(1677..3092) product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene uxaC CDS 3270..4397 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 gene ribBA CDS 4455..5078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 sequence472 source 1..5738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 2266..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 3688..5379 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 sequence473 source 1..5709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..1409 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 1638..2996 product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 transl_table 11 codon_start 1 locus_tag LOCUS_43640 gene nagA CDS 3008..4123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 4128..5708 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 sequence474 source 1..5696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..3339 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 3366..4937 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 sequence475 source 1..5679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..1650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS 1862..2638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 2899..3687 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(3720..4607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 sequence476 source 1..5672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 597..2033 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2K1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 2046..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 2657..5080 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 misc_feature complement(5122..>5672) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009940263.1:MarR family transcriptional regulator locus_tag LOCUS_43760 sequence477 source 1..5669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 704..1591 product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS 1593..2864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 2934..3650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 3640..3951 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene gatC sequence478 source 1..5655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..1909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 1996..2511 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 2580..3824 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 3799..4419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 misc_feature complement(4366..>5655) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762762.1:peptidase S74 locus_tag LOCUS_43850 sequence479 source 1..5643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257658.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 862..1371 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 1358..1903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(1942..2847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(2983..4089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(4132..4809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 sequence480 source 1..5618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..1627 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 transl_table 11 codon_start 1 locus_tag LOCUS_43920 gene dnaB CDS 1642..2286 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Y3 transl_table 11 codon_start 1 locus_tag LOCUS_43930 gene pdxH CDS 2299..3471 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(3579..3785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 4073..5179 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 sequence481 source 1..5611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3142..3516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 3975..4358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43980 sequence482 source 1..5595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201967.1:heparinase locus_tag LOCUS_43990 CDS 1268..1486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 1483..3624 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene feoB CDS 3624..3794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 4323..5498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 sequence483 source 1..5581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2436 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_44040 sequence484 source 1..5580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..787) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L3 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(812..3181) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS complement(3235..4002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(4099..4299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 sequence485 source 1..5560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(487..906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(935..1366) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(1366..1755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 1940..3139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(3229..3369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(3448..3834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 sequence486 source 1..5522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..779 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230189.1:amidohydrolase locus_tag LOCUS_44150 CDS 883..2433 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(2553..5000) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 sequence487 source 1..5518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 238..312 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(786..1022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 1782..2879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 note possible pseudo, internal stop codon CDS 2916..3203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44200 note possible pseudo, internal stop codon CDS complement(3431..4768) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(4853..5074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 sequence488 source 1..5504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1535) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 gene pel CDS complement(1566..2012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 note possible pseudo, frameshifted CDS complement(1942..3030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 note possible pseudo, frameshifted CDS complement(3073..4191) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 sequence489 source 1..5502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..1041 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 1064..2170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 2367..3392 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(3500..4201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(4248..4562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44310 misc_feature complement(4867..>5502) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118811.1:formaldehyde dehydrogenase, glutathione-independent locus_tag LOCUS_44320 sequence490 source 1..5498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1515..4178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 sequence491 source 1..5489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1228..1521) product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 misc_feature complement(1658..>5489) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121034.1:ATPase AAA locus_tag LOCUS_44350 sequence492 source 1..5488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 500..874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS 1000..2214 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Y8 transl_table 11 codon_start 1 locus_tag LOCUS_44370 gene hisC CDS 2378..3478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS 4031..4234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 4234..4953 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene ftsE sequence493 source 1..5459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(893..1306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(1367..1771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(1779..3149) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(3394..4764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(4789..5031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 note possible pseudo, internal stop codon, frameshifted CDS complement(5028..5216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 sequence494 source 1..5458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 734..1135 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 1242..2756 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZY1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 gene cysS CDS 2896..3411 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 transl_table 11 codon_start 1 locus_tag LOCUS_44510 gene dcd CDS 3420..3659 product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67303 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 3740..4231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 4315..5349 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 transl_table 11 codon_start 1 locus_tag LOCUS_44540 gene yceA sequence495 source 1..5455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2544 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_44550 CDS 2553..4250 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS 4455..5216 product rhamnogalacturonan acetylesterase RhgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31523 transl_table 11 codon_start 1 locus_tag LOCUS_44570 gene rhgT sequence496 source 1..5454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1363..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(2129..3388) product xylitol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(3998..5002) product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 transl_table 11 codon_start 1 locus_tag LOCUS_44600 gene abnA sequence497 source 1..5444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1161 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex locus_tag LOCUS_44610 CDS 1202..1795 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 transl_table 11 codon_start 1 locus_tag LOCUS_44620 gene hslV CDS complement(1807..3135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 3318..3950 product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 sequence498 source 1..5436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1290) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(1300..2307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 2721..3188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 3414..4844 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 gene sdaA sequence499 source 1..5434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(612..1244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 1510..5031 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956668.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 sequence500 source 1..5389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..1311) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 transl_table 11 codon_start 1 locus_tag LOCUS_44710 gene uxuA CDS complement(1402..2523) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 transl_table 11 codon_start 1 locus_tag LOCUS_44720 gene uxuA CDS complement(2568..4136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 misc_feature complement(4207..>5389) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_44740 sequence501 source 1..5380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(592..2313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 2618..4333 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 4346..5050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS complement(5071..5244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 sequence502 source 1..5371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1132..2691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(2836..4548) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 misc_feature complement(4561..>5371) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978080.1:NADPH:quinone reductase locus_tag LOCUS_44810 sequence503 source 1..5359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 815..2884 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 transl_table 11 codon_start 1 locus_tag LOCUS_44820 gene metG CDS complement(2881..3441) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene pth CDS complement(3501..4109) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene rplY CDS complement(4120..5061) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202793.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 tRNA complement(5133..5204) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence504 source 1..5338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..804) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(1180..2913) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 3165..3578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44880 sequence505 source 1..5335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..2556) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(2569..3042) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(3156..4220) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 misc_feature complement(4226..>5335) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203640.1:ligand-gated channel locus_tag LOCUS_44920 sequence506 source 1..5328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 1550..2047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 2175..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(2852..5215) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 sequence507 source 1..5319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1025 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681494.1:starch-binding protein locus_tag LOCUS_44970 CDS 1112..3397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 3394..4872 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119648.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 gene arsA sequence508 source 1..5315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 824..1816 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(1887..2708) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 2818..3765 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 3973..4632 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 sequence509 source 1..5313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(858..2243) product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_444230.2 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(2610..3776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 4008..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770281.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 sequence510 source 1..5277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 542..1075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 1284..1940 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 2176..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS 2502..4832 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 sequence511 source 1..5276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..4432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(4448..5275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45130 sequence512 source 1..5257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS complement(581..1294) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(1323..1949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 2268..4007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS 4285..4914 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107550.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 sequence513 source 1..5248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1309) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(1322..1783) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(1997..3031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS complement(3171..3827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(3811..4332) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 sequence514 source 1..5243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..1042) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 1332..2294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(2299..2538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS complement(2574..4106) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 transl_table 11 codon_start 1 locus_tag LOCUS_45270 gene gltX CDS complement(4183..4659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(4661..5041) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 gene yjgF sequence515 source 1..5239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1169..2899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(2931..3755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(3918..4598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044502.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS 4906..5100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45330 sequence516 source 1..5207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1045..2340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS 2346..3455 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963074.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 3455..4717 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene lolC sequence517 source 1..5179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1053..3374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(3801..4466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 misc_feature complement(4477..>5179) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter locus_tag LOCUS_45390 sequence518 source 1..5165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS complement(466..672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(717..1061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 note possible pseudo, frameshifted CDS complement(1659..2999) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919394.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(3002..4444) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 misc_feature complement(4450..>5165) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140317.1:ferrichrome-iron receptor locus_tag LOCUS_45450 sequence519 source 1..5158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 188..688 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 gene rfaY CDS 685..1356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(1454..3847) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 gene mrcA CDS 4341..4712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS 4802..5104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 sequence520 source 1..5156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1422..2195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS complement(2225..3259) product putative membrane protein YdjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34733 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene ydjJ CDS complement(3406..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(4102..5040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45540 sequence521 source 1..5149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1359 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K2Y1:outer membrane protein TolC locus_tag LOCUS_45550 CDS complement(1420..2658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(2659..3075) product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS 3290..3952 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 gene gpm CDS 4064..4456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 sequence522 source 1..5132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1518..2696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 2698..2994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 3190..3750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 sequence523 source 1..5129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence524 source 1..5121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2773 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118589.1:alkaline phosphatase locus_tag LOCUS_45630 CDS 3226..3867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(4070..4822) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 transl_table 11 codon_start 1 locus_tag LOCUS_45650 gene hisA sequence525 source 1..5117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 1054..2559 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635689.2 transl_table 11 codon_start 1 locus_tag LOCUS_45670 gene add CDS 2787..3842 product purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918076.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 sequence526 source 1..5096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 509..1159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 1184..2896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(2920..3141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 sequence527 source 1..5086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 383..1423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS 1484..2794 product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P8 transl_table 11 codon_start 1 locus_tag LOCUS_45730 gene algD CDS 2775..3986 product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 sequence528 source 1..5079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS complement(692..1198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 1559..3739 product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 gene katG CDS complement(4187..5062) product putative dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701467.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 sequence529 source 1..5078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1890) product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS 2142..2513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 2513..3787 product umuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940166.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 gene umuC misc_feature complement(3828..>5078) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UYJ7:1,4-alpha-glucan branching enzyme locus_tag LOCUS_45820 sequence530 source 1..5058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 1482..3269 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(3628..4347) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144011.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 sequence531 source 1..5057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 903..1400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(1411..3126) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 misc_feature complement(3309..>5057) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102178.1:alpha-L-rhamnosidase locus_tag LOCUS_45890 sequence532 source 1..5047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(966..1940) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 transl_table 11 codon_start 1 locus_tag LOCUS_45900 gene argC CDS complement(1933..3153) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(3153..3806) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(4032..4898) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 sequence533 source 1..5041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2198..3319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS 3318..3503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 3602..4297 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 sequence534 source 1..4982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 410..847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(895..1302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(1635..2504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS complement(2615..2830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(2889..3098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(3105..3536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46020 sequence535 source 1..4982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 941..2083 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(2100..2921) product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 gene cheR misc_feature complement(2948..>4982) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104008.1:methyl-accepting chemotaxis protein locus_tag LOCUS_46050 sequence536 source 1..4979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 1113..1622 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS 1744..2115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS complement(2099..2968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 misc_feature complement(3091..>4979) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_46100 sequence537 source 1..4976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(717..1445) product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS complement(1449..2471) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS 2769..2963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(3007..4161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 4335..4499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46150 sequence538 source 1..4963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1465 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964486.1:peptidase M1 locus_tag LOCUS_46160 CDS 1551..2072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 note possible pseudo, frameshifted CDS 2074..2334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS 2419..3858 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 gene ndh CDS complement(3894..4388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 sequence539 source 1..4950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..1501) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 transl_table 11 codon_start 1 locus_tag LOCUS_46210 gene mraY CDS complement(1562..3037) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL7 transl_table 11 codon_start 1 locus_tag LOCUS_46220 gene murE misc_feature complement(3166..>4950) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964161.1:penicillin-binding protein locus_tag LOCUS_46230 sequence540 source 1..4931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..798 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 801..1427 product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 1538..2035 product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163512.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene mutX CDS 2160..2654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46270 sequence541 source 1..4906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3840..4043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 misc_feature complement(4139..>4906) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:peptidase S9 locus_tag LOCUS_46290 sequence542 source 1..4902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(1260..2606) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551092.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(2741..3244) product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 3379..4104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46330 misc_feature complement(4223..>4902) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002024041.1:phosphoglycolate phosphatase locus_tag LOCUS_46340 sequence543 source 1..4897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..895 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCE9:gamma-glutamyl phosphate reductase locus_tag LOCUS_46350 CDS complement(905..1354) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS complement(1498..2169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 2589..3074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 3114..4493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46390 sequence544 source 1..4897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1976..2659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 2656..3384 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 3641..4045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(4058..4495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46430 sequence545 source 1..4882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2616..3857) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 misc_feature complement(3868..>4882) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123112.1:membrane protein locus_tag LOCUS_46450 sequence546 source 1..4879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1053..1625 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(1674..3626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 sequence547 source 1..4863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS complement(1783..2169) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 2259..3803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS 3953..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 sequence548 source 1..4862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2464..3048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 sequence549 source 1..4851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(644..1714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS complement(1734..2147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222812.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS complement(2202..4538) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 sequence550 source 1..4849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(498..1535) product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 gene gfo CDS 1828..3447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS complement(3535..4416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 sequence551 source 1..4847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(585..1979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS complement(2112..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS complement(2310..2429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 2723..3904 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 sequence552 source 1..4841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..3308 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119791.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 3402..4796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 sequence553 source 1..4834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 815..1540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 2093..4078 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 transl_table 11 codon_start 1 locus_tag LOCUS_46670 gene dnaG sequence554 source 1..4832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(472..1860) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H2 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS complement(1879..2193) product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(2199..3311) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 gene pntA CDS complement(3424..4797) product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 gene amaA sequence555 source 1..4750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 928..2139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(2243..2449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(2461..2688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(2839..3063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(3560..4012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 sequence556 source 1..4744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..1272) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS 1445..2560 product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 gene xsa CDS complement(2571..3728) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS 3949..4182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 sequence557 source 1..4710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2643..3881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 gene selA sequence558 source 1..4707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 184..861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 865..1596 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 gene dapB CDS 1671..2774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(2817..3320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS complement(3498..4160) product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 transl_table 11 codon_start 1 locus_tag LOCUS_46860 gene ung2 CDS 4219..4605 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 gene apaG sequence559 source 1..4691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(480..1097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(1106..3025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS complement(3039..4079) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(4093..4449) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 sequence560 source 1..4674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(665..2077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS 2368..3156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 3782..4609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46940 sequence561 source 1..4671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1190..2095 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 transl_table 11 codon_start 1 locus_tag LOCUS_46950 gene hemF CDS 2284..2886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS complement(2896..3963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS complement(3991..4671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 sequence562 source 1..4671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1196 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760893.1:collagen-binding protein locus_tag LOCUS_46990 CDS complement(1281..2522) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS 2745..3434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 note possible pseudo, internal stop codon CDS 3438..4232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47020 note possible pseudo, internal stop codon sequence563 source 1..4670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS complement(176..1570) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 transl_table 11 codon_start 1 locus_tag LOCUS_47040 gene speA CDS 1744..3552 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 transl_table 11 codon_start 1 locus_tag LOCUS_47050 gene argS CDS 3649..4548 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNQ8 transl_table 11 codon_start 1 locus_tag LOCUS_47060 gene menA sequence564 source 1..4664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1376..2701) product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(2717..3511) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(3893..4339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 sequence565 source 1..4661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 514..1143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 1211..2179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888546.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS complement(2529..3041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS complement(3046..3849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(3891..4295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47140 sequence566 source 1..4659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 895..2034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS 2031..3446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417444.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS 3499..4569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47170 sequence567 source 1..4656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(541..2973) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(3188..4651) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 sequence568 source 1..4650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS complement(895..3408) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(3576..3755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47220 sequence569 source 1..4634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(488..820) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(822..1319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 1472..3796 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X7 transl_table 11 codon_start 1 locus_tag LOCUS_47250 gene topA sequence570 source 1..4613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(520..1821) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 transl_table 11 codon_start 1 locus_tag LOCUS_47260 gene ftsA CDS complement(1833..2585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(2582..3718) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene murG misc_feature complement(3725..>4613) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403335.1:cell division protein FtsW locus_tag LOCUS_47290 sequence571 source 1..4602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..1865 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 tRNA 1948..2019 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 2357..3691 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 gene actA sequence572 source 1..4599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..2815) product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 2982..3980 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS complement(4002..4529) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44562 transl_table 11 codon_start 1 locus_tag LOCUS_47340 gene fldA sequence573 source 1..4598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327631.1:peptide ABC transporter permease locus_tag LOCUS_47350 CDS 1427..1765 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106041.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 1840..3096 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(3437..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 4007..4402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47390 sequence574 source 1..4590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..1339 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 1336..2319 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 2346..3719 product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(3971..4417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47430 sequence575 source 1..4584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..1070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(1063..1401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 1548..2165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 2311..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47470 sequence576 source 1..4581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(723..1790) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS 2423..3601 product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS 3661..4356 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 sequence577 source 1..4570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS 754..3231 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140315.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 3235..4350 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 sequence578 source 1..4569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 623..2404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47550 tRNA complement(2589..2664) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence579 source 1..4542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118046.1:rhamnosidase locus_tag LOCUS_47560 CDS 960..1877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108471.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS 2032..2637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 2634..2939 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 3267..4424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47600 sequence580 source 1..4527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1618 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764306.1:alpha-mannosidase locus_tag LOCUS_47610 CDS 1768..4110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764307.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 sequence581 source 1..4518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 783..1262 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(1430..2197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 sequence582 source 1..4494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1134 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918662.1:sorbosone dehydrogenase locus_tag LOCUS_47650 CDS 1186..2418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 gene selA CDS 2489..3760 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS 3830..4297 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 sequence583 source 1..4490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 1267..1647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(1677..2330) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 transl_table 11 codon_start 1 locus_tag LOCUS_47710 gene lspA misc_feature complement(2343..>4490) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase locus_tag LOCUS_47720 sequence584 source 1..4486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1209..2594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 misc_feature complement(2599..>4486) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119646.1:large multi-functional protein locus_tag LOCUS_47740 sequence585 source 1..4486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..999 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118046.1:rhamnosidase locus_tag LOCUS_47750 CDS 1239..2312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 2500..2832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 sequence586 source 1..4465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..519) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 transl_table 11 codon_start 1 locus_tag LOCUS_47780 gene nuoK CDS complement(524..1039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS complement(1036..1947) product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJU3 transl_table 11 codon_start 1 locus_tag LOCUS_47800 gene nuoH CDS complement(1949..3826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS complement(3830..4192) product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 transl_table 11 codon_start 1 locus_tag LOCUS_47820 gene nuoA1 sequence587 source 1..4463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2105..3445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47830 misc_feature complement(3438..>4463) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405140.1:glucosyltransferase locus_tag LOCUS_47840 sequence588 source 1..4459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1678..3015 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 transl_table 11 codon_start 1 locus_tag LOCUS_47850 gene nhaA CDS complement(3201..3320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47860 note possible pseudo, frameshifted CDS complement(3317..3667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47870 sequence589 source 1..4453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..1106 product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEK1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 gene selD CDS 1234..1719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(1723..2139) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS 2339..2821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 2902..3705 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 sequence590 source 1..4438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(648..3584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47930 sequence591 source 1..4424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 912..1778 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 gene mltR CDS 2215..4065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 sequence592 source 1..4410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 964..2046 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 gene pheA CDS 2107..3222 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 transl_table 11 codon_start 1 locus_tag LOCUS_47970 gene hemH CDS 3294..3599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(3666..4157) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 sequence593 source 1..4408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 320..1225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(1241..2935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(3101..4096) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 sequence594 source 1..4405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(976..1809) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037253.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(1892..2059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 2819..3871 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764889.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS 3946..4305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 sequence595 source 1..4387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..3646 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 sequence596 source 1..4356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1661..3595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 sequence597 source 1..4341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..1487) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 transl_table 11 codon_start 1 locus_tag LOCUS_48100 gene pgk sequence598 source 1..4335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..719 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS 772..2925 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 sequence599 source 1..4333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..1326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS complement(1316..2341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(2342..2734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS 2904..3272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 3277..3708 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 misc_feature complement(3776..>4333) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795082.1:oxidoreductase locus_tag LOCUS_48180 sequence600 source 1..4331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3229 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108774.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_48190 sequence601 source 1..4324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1141..1770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 1704..3524 product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 note possible pseudo, frameshifted CDS complement(3505..3696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(3696..3950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 sequence602 source 1..4298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..1282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 1282..2223 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS complement(2318..2863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(3083..4075) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 sequence603 source 1..4297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..1775) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(1942..2736) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(2714..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 3223..4062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 sequence604 source 1..4297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence605 source 1..4253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1451 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase locus_tag LOCUS_48320 CDS complement(1517..2434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(2445..2927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(2930..3688) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 sequence606 source 1..4249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..853) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 transl_table 11 codon_start 1 locus_tag LOCUS_48360 gene kdsB CDS 1518..2849 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 gene ndh sequence607 source 1..4229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..2782) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(2968..3384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS complement(3390..3935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 sequence608 source 1..4215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS complement(505..771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS complement(1046..1549) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 gene sixA CDS complement(1566..1931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 2131..2532 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 sequence609 source 1..4212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..935) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS complement(1183..3090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(3114..4139) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 sequence610 source 1..4173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..1517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS complement(1932..3059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48500 misc_feature complement(3394..>4173) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108631.1:sulfatase locus_tag LOCUS_48510 sequence611 source 1..4144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence612 source 1..4131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 797..3010 product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(3062..3544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48530 misc_feature complement(3606..>4131) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S289:malate dehydrogenase locus_tag LOCUS_48540 sequence613 source 1..4113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 788..1327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 1698..2552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 2635..3540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48570 sequence614 source 1..4102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(553..1326) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS complement(1323..2372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS complement(2440..3000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48600 misc_feature complement(3204..>4102) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor locus_tag LOCUS_48610 sequence615 source 1..4102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 1456..2598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030365.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 2682..3941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48640 sequence616 source 1..4091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2847 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64UE7:DNA helicase locus_tag LOCUS_48650 CDS complement(2888..3484) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 sequence617 source 1..4077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..2772 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(2786..3490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 sequence618 source 1..4073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..3334) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 sequence619 source 1..4073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 588..1874 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 gene porY CDS 2041..2658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS 2782..3087 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 transl_table 11 codon_start 1 locus_tag LOCUS_48720 gene nuoK misc_feature complement(3285..>4073) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119349.1:calcium sensor EFh locus_tag LOCUS_48730 sequence620 source 1..4062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1300..1893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS complement(1986..3041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS complement(3042..4034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48760 sequence621 source 1..4050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS 1512..2594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS 2899..3252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48790 note possible pseudo, internal stop codon CDS 3319..3555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48800 note possible pseudo, internal stop codon sequence622 source 1..4032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(718..1626) product 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 gene mhpC CDS complement(2349..3224) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 3370..3738 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 sequence623 source 1..4025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..1151) product arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107580.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS complement(1315..2436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(2553..3440) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882364.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(3484..3915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 sequence624 source 1..4025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1884..2927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48880 sequence625 source 1..4022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..565 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS complement(684..1313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 2179..2532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48910 misc_feature complement(3334..>4022) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764714.1:DNA-binding response regulator locus_tag LOCUS_48920 sequence626 source 1..4020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1012..3522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48930 sequence627 source 1..4016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1158..>4016) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_48940 sequence628 source 1..4008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1976) product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 transl_table 11 codon_start 1 locus_tag LOCUS_48950 gene glmS CDS complement(2201..3433) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 sequence629 source 1..4001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 498..1769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 1959..2831 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 transl_table 11 codon_start 1 locus_tag LOCUS_48980 gene sucD sequence630 source 1..3996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2864..3607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031937.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 sequence631 source 1..3993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS complement(690..1484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS complement(1505..2527) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(2582..3496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49030 sequence632 source 1..3987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(549..1406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS complement(1594..1938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49050 sequence633 source 1..3980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..1643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS complement(1761..3290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_49070 misc_feature complement(3303..>3980) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_49080 sequence634 source 1..3965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence635 source 1..3956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..724 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249842.1:glycosyl transferase locus_tag LOCUS_49090 CDS 815..1852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(1864..2727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(2796..3731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49120 sequence636 source 1..3932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..936 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 938..1612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS 1612..2487 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 gene modC sequence637 source 1..3928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2526..>3928) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease locus_tag LOCUS_49160 sequence638 source 1..3911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(803..2098) product polysaccharide pyruvyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 2281..2646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS complement(2643..2921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 sequence639 source 1..3905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 539..628 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 701..776 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 972..1238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS 1242..1529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS 1892..3097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS 3143..3370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS 3497..3802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 sequence640 source 1..3900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence641 source 1..3895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1433 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_49250 CDS 1507..3894 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 sequence642 source 1..3891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(793..1248) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229703.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 gene marR CDS complement(1235..1669) product UPF0310 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCP8 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS complement(1749..2939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 misc_feature complement(2939..>3891) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX07:aspartate-semialdehyde dehydrogenase locus_tag LOCUS_49310 sequence643 source 1..3889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1406 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(1428..2363) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(2363..3436) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 sequence644 source 1..3886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence645 source 1..3878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1320..1910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS 2093..3616 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene gpmI sequence646 source 1..3873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(637..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS 907..1596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681739.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS 2259..2960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49400 sequence647 source 1..3861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(286..1911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(1954..2787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS complement(2791..3621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49430 sequence648 source 1..3854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 951..1394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(1454..2281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107829.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS 3132..3773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49460 sequence649 source 1..3852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..911 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120414.1:aryl-sulfate sulfohydrolase locus_tag LOCUS_49470 CDS complement(920..2515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49480 misc_feature complement(2651..>3852) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403490.1:oxidoreductase locus_tag LOCUS_49490 sequence650 source 1..3828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2879..3337) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 sequence651 source 1..3824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1249..2559 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 gene dbpA CDS complement(2623..3297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49520 sequence652 source 1..3823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1206..2225) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107157.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS complement(2329..2928) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 sequence653 source 1..3814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 692..1810 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS 1877..2917 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 gene aroB CDS complement(2983..3225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49570 sequence654 source 1..3812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..1647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS complement(1909..2331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49590 sequence655 source 1..3812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1226 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase locus_tag LOCUS_49600 CDS 1478..1891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS 2015..2524 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(2609..3526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49630 sequence656 source 1..3808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49640 note possible pseudo, internal stop codon, frameshifted CDS 627..1331 product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(1335..1916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS complement(2088..3344) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 sequence657 source 1..3806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..791 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225007.1:mandelate racemase locus_tag LOCUS_49680 CDS 848..1804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS 1815..3290 product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 sequence658 source 1..3802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..497) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS complement(1355..2059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49720 misc_feature complement(2194..>3802) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_49730 sequence659 source 1..3791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 986..2257 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120628.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 gene fucP CDS complement(2347..2988) product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 sequence660 source 1..3788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(678..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS 1230..1775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS complement(1763..2248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 misc_feature complement(2296..>3788) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976195.1:sulfatase locus_tag LOCUS_49790 sequence661 source 1..3788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 679..3498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 sequence662 source 1..3786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1189..>3786) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582819.1:fibronectin type III domain-containing protein locus_tag LOCUS_49810 sequence663 source 1..3767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1384..1899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49820 note possible pseudo, frameshifted CDS complement(2016..2396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49830 sequence664 source 1..3766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 1246..1806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS complement(1842..2372) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617516.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS complement(2546..3133) product putative isochorismatase family protein YrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07081 transl_table 11 codon_start 1 locus_tag LOCUS_49870 gene yrdC sequence665 source 1..3756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1996..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49880 misc_feature complement(2496..>3756) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203677.1:membrane protein locus_tag LOCUS_49890 sequence666 source 1..3755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..796) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS complement(793..1335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS complement(1460..2044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49920 CDS complement(2103..3248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49930 sequence667 source 1..3736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(822..2654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(2729..3361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49950 sequence668 source 1..3735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1391..2602) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 sequence669 source 1..3728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..2215) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(2328..2915) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964804.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS complement(2957..3598) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 sequence670 source 1..3727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1524) product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(1669..2601) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974650.1 transl_table 11 codon_start 1 locus_tag LOCUS_50010 gene dapA CDS complement(3156..3656) product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228914.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 note possible pseudo, internal stop codon sequence671 source 1..3720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..1360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50030 sequence672 source 1..3686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence673 source 1..3684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..1474) product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS complement(1578..2723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 3260..3424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50060 sequence674 source 1..3678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1266..2648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50070 misc_feature complement(2717..>3678) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461492.1:GTP 3',8-cyclase MoaA locus_tag LOCUS_50080 sequence675 source 1..3663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1143..2351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50090 misc_feature complement(2773..>3663) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931892.1:MFS transporter locus_tag LOCUS_50100 sequence676 source 1..3656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1139..1615) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS 1710..2660 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(2657..3418) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 sequence677 source 1..3654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..806 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 transl_table 11 codon_start 1 locus_tag LOCUS_50140 gene sodA CDS 948..1481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 1636..2241 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS 2313..2942 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 sequence678 source 1..3646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(776..2233) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS complement(2244..2936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50190 note possible pseudo, internal stop codon misc_feature complement(2943..>3646) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118036.1:chromosome segregation protein note possible pseudo, internal stop codon locus_tag LOCUS_50200 sequence679 source 1..3637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1004..1162) product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 gene ccoS misc_feature complement(1539..>3637) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:ATPase locus_tag LOCUS_50220 sequence680 source 1..3634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289351.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS 1049..1789 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 2100..2663 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS complement(2727..3542) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 sequence681 source 1..3624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 350..2116 product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS 2231..2911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS 3312..3605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50290 sequence682 source 1..3617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1043..2299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 misc_feature complement(2364..>3617) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:membrane protein locus_tag LOCUS_50310 sequence683 source 1..3594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1028) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831121.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(1229..2104) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS complement(2242..2541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(2538..3200) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 gene thiE sequence684 source 1..3590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 335..1276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS 1311..1925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS 1944..2969 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225165.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 2998..3201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50390 sequence685 source 1..3587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1602 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404227.1:aconitate hydratase locus_tag LOCUS_50400 CDS complement(1627..2148) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 transl_table 11 codon_start 1 locus_tag LOCUS_50410 gene rimM CDS complement(2155..3156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50420 sequence686 source 1..3577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2370..3269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50430 sequence687 source 1..3560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(616..1161) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403562.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 1734..2255 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 2233..2739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796794.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS 2736..3284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50480 sequence688 source 1..3557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1735..>3557) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107463.1:membrane protein locus_tag LOCUS_50490 sequence689 source 1..3532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(777..1643) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS complement(1851..2651) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 sequence690 source 1..3513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1183..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50520 note possible pseudo, frameshifted CDS complement(1909..2574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50530 sequence691 source 1..3510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(539..1975) product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 gene gntP CDS complement(2088..3302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 sequence692 source 1..3502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence693 source 1..3494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..1494 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 1491..2171 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 2168..2620 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 transl_table 11 codon_start 1 locus_tag LOCUS_50580 gene dtd CDS 2617..2952 product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 misc_feature complement(2949..>3494) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035484.1:isoaspartyl peptidase/L-asparaginase locus_tag LOCUS_50600 sequence694 source 1..3490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1226..2611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50610 sequence695 source 1..3475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2769..3419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50620 sequence696 source 1..3473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(521..1897) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS complement(1946..3160) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_50640 sequence697 source 1..3470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1966..2847 product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 gene rimK sequence698 source 1..3466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1147..2532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 misc_feature complement(2737..>3466) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760507.1:membrane protein locus_tag LOCUS_50670 sequence699 source 1..3457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..667) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 gene tpm CDS 737..1654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS 1656..2552 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 gene glpQ CDS complement(2562..3089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50710 sequence700 source 1..3456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 656..1606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS 1611..2459 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 misc_feature complement(2513..>3456) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389104.1:cation transporter locus_tag LOCUS_50740 sequence701 source 1..3433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS complement(1038..1781) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS complement(1990..3342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 sequence702 source 1..3430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 1073..1324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS 1556..1825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(1865..2455) product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 sequence703 source 1..3419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(277..1329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS complement(1344..2996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(3105..3419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 sequence704 source 1..3417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..1342 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 transl_table 11 codon_start 1 locus_tag LOCUS_50850 gene actC CDS 1349..1870 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 gene actD CDS 1875..2492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 sequence705 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1525..3231) product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 sequence706 source 1..3406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2265 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404926.1:fibronectin type III locus_tag LOCUS_50890 sequence707 source 1..3372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1482..1919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS complement(1989..2411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 sequence708 source 1..3371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1003..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 sequence709 source 1..3355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..1105 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 1224..1799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS complement(1869..2279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 sequence710 source 1..3346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(520..1230) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978899.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS complement(1250..2002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(2031..3176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50980 sequence711 source 1..3339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1382..2518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 2536..3060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51000 sequence712 source 1..3336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1008..2042) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 transl_table 11 codon_start 1 locus_tag LOCUS_51010 gene gpsA misc_feature complement(2026..>3336) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391162.1:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_51020 sequence713 source 1..3321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence714 source 1..3312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1150..1422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS complement(1451..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51040 sequence715 source 1..3307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..853 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107222.1:alpha-L-arabinofuranosidase locus_tag LOCUS_51050 CDS 977..2521 product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 sequence716 source 1..3300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 559..1491 product chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037184.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 gene cheB CDS complement(1463..2335) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WRV3 transl_table 11 codon_start 1 locus_tag LOCUS_51080 gene rfbA CDS 2474..3142 product cytochrome c-type biogenesis heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 sequence717 source 1..3299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1274 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase locus_tag LOCUS_51100 sequence718 source 1..3299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 871..2220 product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 transl_table 11 codon_start 1 locus_tag LOCUS_51110 gene tilS CDS 2255..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 sequence719 source 1..3293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(711..2939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51130 sequence720 source 1..3284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1502..1927) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766754.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS 2017..2220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51150 misc_feature complement(2666..>3284) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975228.1:D-ribose ABC transporter substrate-binding protein locus_tag LOCUS_51160 sequence721 source 1..3270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1424 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein locus_tag LOCUS_51170 CDS 1458..2060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 2183..2641 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 gene tag CDS 2712..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51200 sequence722 source 1..3270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence723 source 1..3263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..1258 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS 1311..1892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS complement(1944..2474) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(2490..3068) product ribosomal-protein-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470149.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 sequence724 source 1..3256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..889 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886873.1:aldo/keto reductase locus_tag LOCUS_51250 CDS 1035..2156 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(2201..2869) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 sequence725 source 1..3255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1127..2185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 sequence726 source 1..3235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(590..2923) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 gene wzc sequence727 source 1..3223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..717 product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 717..1820 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS 1893..2255 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS complement(2621..3109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 sequence728 source 1..3223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..861 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS 922..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 1234..2445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51360 sequence729 source 1..3219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence730 source 1..3210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 770..1780 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 1846..2019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51390 sequence731 source 1..3197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51400 sequence732 source 1..3194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1125..3089) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 sequence733 source 1..3191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..1467) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(1486..1983) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602519.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS complement(2010..2954) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 sequence734 source 1..3183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..2557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51450 sequence735 source 1..3179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS 989..2335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51470 sequence736 source 1..3178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 846..1574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS 1585..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS 2175..2615 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 sequence737 source 1..3171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(947..1294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS complement(1588..1950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 sequence738 source 1..3162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..1077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS 1460..1858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS 1882..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51550 sequence739 source 1..3161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(461..1432) product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 1716..2582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51570 sequence740 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..2050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 2120..2860 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 sequence741 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..701 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208164.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 gene yieF CDS 707..955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS 1073..2209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 2286..2591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51630 sequence742 source 1..3151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(432..1529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51640 sequence743 source 1..3133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..797 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039188.1:hexuronate transporter locus_tag LOCUS_51650 CDS 925..2391 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U88 transl_table 11 codon_start 1 locus_tag LOCUS_51660 sequence744 source 1..3116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW92:aminotransferase locus_tag LOCUS_51670 CDS 896..1771 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 gene tyrA CDS 1829..2887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51690 sequence745 source 1..3106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..2175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51700 sequence746 source 1..3081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS complement(935..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51720 sequence747 source 1..3078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..1415) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(1716..2333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51740 sequence748 source 1..3056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1309 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_51750 CDS 1546..1872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51760 sequence749 source 1..3037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(754..1443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51770 tRNA complement(1644..1718) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 misc_feature complement(1817..>3037) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257170.1:peptidase S10 locus_tag LOCUS_51780 sequence750 source 1..3037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1068..2645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51790 sequence751 source 1..3035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1841..2470) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 transl_table 11 codon_start 1 locus_tag LOCUS_51800 gene tdk sequence752 source 1..3028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(569..>3028) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_51810 sequence753 source 1..3022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..1437 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 transl_table 11 codon_start 1 locus_tag LOCUS_51820 gene wza sequence754 source 1..2991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS 875..1948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS 2205..2747 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 sequence755 source 1..2990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..1462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS complement(1600..2259) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_51870 misc_feature complement(2300..>2990) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1L7:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase locus_tag LOCUS_51880 sequence756 source 1..2977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108996.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_51890 CDS 636..2687 product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 sequence757 source 1..2959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1019..1201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS 1218..1856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS 2070..2651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51930 sequence758 source 1..2954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..843) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS complement(884..1627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366897.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS complement(1705..2874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51960 sequence759 source 1..2952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1284 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767207.1:beta-galactosidase locus_tag LOCUS_51970 CDS 2357..2830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51980 sequence760 source 1..2927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..1114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS complement(1408..1893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52000 misc_feature complement(2031..>2927) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755895.1:mechanosensitive ion channel protein MscS locus_tag LOCUS_52010 sequence761 source 1..2922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(834..1691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS complement(1688..2488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52030 sequence762 source 1..2907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..973 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A4L8:D-mannonate dehydratase CC2812 locus_tag LOCUS_52040 CDS complement(998..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS 2135..2524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52060 sequence763 source 1..2906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS 2336..2740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52080 sequence764 source 1..2896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1469 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme locus_tag LOCUS_52090 CDS 1565..2206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 sequence765 source 1..2895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS 814..1203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS 1200..1649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS complement(1899..2297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52140 sequence766 source 1..2895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52150 sequence767 source 1..2878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1245 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404446.1:acyl-CoA oxidase locus_tag LOCUS_52160 CDS 1323..1475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 2460..2786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52180 sequence768 source 1..2876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1056..2126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52190 sequence769 source 1..2876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..1267) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 transl_table 11 codon_start 1 locus_tag LOCUS_52200 sequence770 source 1..2874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS complement(623..2167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52220 sequence771 source 1..2865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..1303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS complement(1387..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52240 sequence772 source 1..2863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..1164) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS complement(1199..1528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 1638..2165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS 2245..2673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52280 sequence773 source 1..2859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1248..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS 1897..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52300 sequence774 source 1..2858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..2490) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 sequence775 source 1..2857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(796..1557) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS complement(1563..2657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52330 sequence776 source 1..2856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1496..2437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52340 sequence777 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52350 tRNA complement(1071..1143) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1361..2578 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 sequence778 source 1..2846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1847..2737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52370 sequence779 source 1..2845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS complement(811..1353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52390 misc_feature complement(1408..>2845) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963722.1:magnesium chelatase locus_tag LOCUS_52400 sequence780 source 1..2841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2333..>2841) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403493.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit locus_tag LOCUS_52410 sequence781 source 1..2837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1765..>2837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123091.1:arylsulfatase locus_tag LOCUS_52420 sequence782 source 1..2789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence783 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence784 source 1..2781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2466..2675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52430 sequence785 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(347..1606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS 1778..2224 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706247.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 sequence786 source 1..2779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2156 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_52460 sequence787 source 1..2776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..729 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_52470 CDS 757..2385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52480 sequence788 source 1..2768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 614..1588 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181535.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 gene mrsF CDS 1591..2343 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860906.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 gene cdd2 sequence789 source 1..2767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..859 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EM67:galactarate dehydratase (L-threo-forming) locus_tag LOCUS_52510 CDS 894..1832 product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YS6 transl_table 11 codon_start 1 locus_tag LOCUS_52520 misc_feature complement(1883..>2767) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121659.1:sulfatase locus_tag LOCUS_52530 sequence790 source 1..2761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..794 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA locus_tag LOCUS_52540 CDS 936..1316 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 transl_table 11 codon_start 1 locus_tag LOCUS_52550 gene gcvH CDS 1343..1711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS 1818..2492 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 transl_table 11 codon_start 1 locus_tag LOCUS_52570 sequence791 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 9..1871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 2026..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52590 sequence792 source 1..2759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 577..1323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52600 sequence793 source 1..2750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 370..909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS complement(1022..2050) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 2200..2472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52630 sequence794 source 1..2746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 562..1998 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 gene trpE CDS 2125..2697 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 gene pabA sequence795 source 1..2743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 999..1745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS 1878..2303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52670 sequence796 source 1..2742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2642 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:periplasmic amidohydrolase locus_tag LOCUS_52680 sequence797 source 1..2729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(741..1436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52690 note possible pseudo, internal stop codon CDS complement(1500..1976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 note possible pseudo, internal stop codon CDS 2209..2583 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 sequence798 source 1..2699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence799 source 1..2667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..2637 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 sequence800 source 1..2663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1207) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 misc_feature complement(1303..>2663) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080425.1:beta-glucuronidase locus_tag LOCUS_52740 sequence801 source 1..2655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(648..1514) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 sequence802 source 1..2642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..1403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52760 note possible pseudo, frameshifted sequence803 source 1..2642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(805..2208) product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 sequence804 source 1..2633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1175 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYJ5:sulfate adenylyltransferase subunit 1 locus_tag LOCUS_52780 CDS complement(1281..1997) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS complement(2018..2632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52800 sequence805 source 1..2633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 447..1466 product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947921.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 misc_feature complement(1473..>2633) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229807.1:amidohydrolase locus_tag LOCUS_52820 sequence806 source 1..2632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(595..1674) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 transl_table 11 codon_start 1 locus_tag LOCUS_52830 gene ykfB misc_feature complement(1987..>2632) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:membrane protein locus_tag LOCUS_52840 sequence807 source 1..2627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..1466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52850 misc_feature complement(1579..>2627) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141113.1:glucosidase locus_tag LOCUS_52860 sequence808 source 1..2624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 504..1256 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 transl_table 11 codon_start 1 locus_tag LOCUS_52870 gene scpA CDS 1253..2335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(2419..2622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 sequence809 source 1..2618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS 1716..2084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS 2268..2540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52920 sequence810 source 1..2609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(357..1190) product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS complement(1193..2404) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 sequence811 source 1..2607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405560.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_52950 sequence812 source 1..2601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992445.1:penicillin-binding protein 1C locus_tag LOCUS_52960 CDS complement(1847..2332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 sequence813 source 1..2597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence814 source 1..2580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence815 source 1..2577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..1662) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7R9 transl_table 11 codon_start 1 locus_tag LOCUS_52980 gene rtcB CDS complement(1720..2442) product stomatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675424.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 sequence816 source 1..2576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 205..2487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53000 sequence817 source 1..2572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..2060 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 sequence818 source 1..2558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..1207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 tRNA complement(1249..1334) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1498..2256 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096756.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 sequence819 source 1..2503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(332..928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS complement(1085..1774) product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS complement(2077..2466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 sequence820 source 1..2497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence821 source 1..2486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..774 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7Z9:aspartokinase locus_tag LOCUS_53070 CDS 817..1377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 1530..1850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53090 misc_feature complement(1880..>2486) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225007.1:mandelate racemase locus_tag LOCUS_53100 sequence822 source 1..2486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..2485) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 sequence823 source 1..2471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS 713..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS complement(945..1823) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS complement(1835..2266) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 gene yuxK sequence824 source 1..2466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 925..1617 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS 1741..2256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 sequence825 source 1..2466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545057.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS 1745..2383 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAZ5 transl_table 11 codon_start 1 locus_tag LOCUS_53190 gene lolD sequence826 source 1..2465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1123 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYS7:coproporphyrinogen-III oxidase locus_tag LOCUS_53200 CDS 1324..1677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53210 misc_feature complement(1770..>2465) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVJ6:histidine kinase locus_tag LOCUS_53220 sequence827 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS 1064..1780 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 sequence828 source 1..2450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(640..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS complement(969..2324) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 sequence829 source 1..2444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence830 source 1..2440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence831 source 1..2431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(855..1721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53270 misc_feature complement(1718..>2431) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962309.1:BatB protein locus_tag LOCUS_53280 sequence832 source 1..2429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..1737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53290 sequence833 source 1..2425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..924 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001025780.1:CAAX amino protease locus_tag LOCUS_53300 CDS 914..1123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS 1116..1934 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 transl_table 11 codon_start 1 locus_tag LOCUS_53320 sequence834 source 1..2421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..1050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258569.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 sequence835 source 1..2413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1079..1714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53340 sequence836 source 1..2409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..1050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 1084..1914 product cell division initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570134.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS 1922..2284 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PK9 transl_table 11 codon_start 1 locus_tag LOCUS_53370 sequence837 source 1..2397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(734..1297) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 sequence838 source 1..2395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1261..2082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 sequence839 source 1..2386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 sequence840 source 1..2383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence841 source 1..2364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53410 sequence842 source 1..2360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 859..1917 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 sequence843 source 1..2341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..1539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53430 misc_feature complement(1574..>2341) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXP5:glycogen operon protein GlgX homolog locus_tag LOCUS_53440 sequence844 source 1..2339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107709.1:DNA-binding response regulator locus_tag LOCUS_53450 sequence845 source 1..2330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..1259) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 sequence846 source 1..2321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1388..>2321) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease locus_tag LOCUS_53470 sequence847 source 1..2320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..922 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 gene ada CDS 1377..1994 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 sequence848 source 1..2315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(403..>2315) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709573.1:methyl-accepting chemotaxis protein locus_tag LOCUS_53500 sequence849 source 1..2308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 947..1375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53510 sequence850 source 1..2307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53520 misc_feature complement(1215..>2307) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974797.1:quinoprotein glucose dehydrogenase locus_tag LOCUS_53530 sequence851 source 1..2299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2234 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_53540 sequence852 source 1..2287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1600..2286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 sequence853 source 1..2274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II locus_tag LOCUS_53560 sequence854 source 1..2272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1195 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007748760.1:pyridine nucleotide-disulfide oxidoreductase locus_tag LOCUS_53570 sequence855 source 1..2254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..971 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase locus_tag LOCUS_53580 CDS 1116..1706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53590 misc_feature complement(1743..>2254) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546188.1:MBL fold hydrolase locus_tag LOCUS_53600 sequence856 source 1..2253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..1144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53610 note possible pseudo, internal stop codon CDS complement(1214..1849) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397598.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS complement(1976..2251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53630 sequence857 source 1..2249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1024..>2249) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor locus_tag LOCUS_53640 sequence858 source 1..2240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence859 source 1..2235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 548..1654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 sequence860 source 1..2227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 817..1830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 sequence861 source 1..2226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1126..1683 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 transl_table 11 codon_start 1 locus_tag LOCUS_53670 sequence862 source 1..2219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1956 product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 sequence863 source 1..2218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..1199) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 transl_table 11 codon_start 1 locus_tag LOCUS_53690 gene purK CDS 1241..1813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS 1942..2160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53710 sequence864 source 1..2216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..865) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS complement(1458..2120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53730 sequence865 source 1..2215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence866 source 1..2210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence867 source 1..2206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1325 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein locus_tag LOCUS_53740 sequence868 source 1..2203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53750 misc_feature complement(1079..>2203) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase locus_tag LOCUS_53760 sequence869 source 1..2201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(147..>2201) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108535.1:cell wall-associated protein locus_tag LOCUS_53770 sequence870 source 1..2184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53780 note possible pseudo, internal stop codon CDS complement(951..1898) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 transl_table 11 codon_start 1 locus_tag LOCUS_53790 sequence871 source 1..2174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(670..1773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 sequence872 source 1..2163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence873 source 1..2143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(427..>2143) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706489.1:TIGR01666 family membrane protein locus_tag LOCUS_53810 sequence874 source 1..2134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 903..1751 product putative ABC transporter antibiotic-transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702595.1 transl_table 11 codon_start 1 locus_tag LOCUS_53820 sequence875 source 1..2130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109131.1:glycosyl hydrolase family 2 locus_tag LOCUS_53830 CDS 920..1465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53840 sequence876 source 1..2127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence877 source 1..2112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1065 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404904.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_53850 sequence878 source 1..2112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(473..1201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS complement(1155..1751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 sequence879 source 1..2107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence880 source 1..2097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..689 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_53880 CDS 625..1827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 note possible pseudo, frameshifted sequence881 source 1..2091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence882 source 1..2073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(415..1950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 sequence883 source 1..2066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..1574 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 sequence884 source 1..2059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1357..1932 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_53920 sequence885 source 1..2037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1205 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter locus_tag LOCUS_53930 sequence886 source 1..2033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..1325 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDJ2 transl_table 11 codon_start 1 locus_tag LOCUS_53940 gene nfi sequence887 source 1..2028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..543 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460338.1:DNA mismatch repair protein locus_tag LOCUS_53950 tRNA 657..741 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(805..1230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53960 sequence888 source 1..2027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 443..1102 product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 CDS 1258..1695 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 transl_table 11 codon_start 1 locus_tag LOCUS_53980 gene ppi sequence889 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..949) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_53990 gene tatC misc_feature complement(955..>2016) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase locus_tag LOCUS_54000 sequence890 source 1..2004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence891 source 1..2003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence892 source 1..1991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(568..1260) product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS complement(1565..1954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54020 sequence893 source 1..1990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 sequence894 source 1..1977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence895 source 1..1968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1319..>1968) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989646.1:beta-glucosidase locus_tag LOCUS_54040 sequence896 source 1..1967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(472..1263) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 1329..1898 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 transl_table 11 codon_start 1 locus_tag LOCUS_54060 sequence897 source 1..1938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence898 source 1..1900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(538..717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54070 sequence899 source 1..1895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence900 source 1..1881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS 624..1715 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 transl_table 11 codon_start 1 locus_tag LOCUS_54090 gene lpxK sequence901 source 1..1877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000643797.1:NADPH:quinone reductase locus_tag LOCUS_54100 CDS complement(801..1295) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 sequence902 source 1..1860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1079..1261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS 1254..1583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54130 sequence903 source 1..1852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS 620..1135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 sequence904 source 1..1848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:membrane protein locus_tag LOCUS_54160 CDS complement(1275..1847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54170 sequence905 source 1..1842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1805 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108195.1:SusC/RagA family TonB-linked outer membrane protein locus_tag LOCUS_54180 sequence906 source 1..1842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(356..1294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022946.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 sequence907 source 1..1836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 634..1203 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 transl_table 11 codon_start 1 locus_tag LOCUS_54200 sequence908 source 1..1832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1319 product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 transl_table 11 codon_start 1 locus_tag LOCUS_54210 gene gfo sequence909 source 1..1824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence910 source 1..1821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence911 source 1..1820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(477..929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54220 sequence912 source 1..1819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence913 source 1..1810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42435:nitrite reductase [NAD(P)H] locus_tag LOCUS_54230 sequence914 source 1..1789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence915 source 1..1782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence916 source 1..1776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin locus_tag LOCUS_54240 CDS 862..1620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54250 sequence917 source 1..1758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..944 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987042.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS 988..1293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 sequence918 source 1..1754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence919 source 1..1754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(452..1282) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS complement(1400..1693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 sequence920 source 1..1749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence921 source 1..1734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54300 CDS 1041..1331 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 sequence922 source 1..1719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..769 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121659.1:sulfatase locus_tag LOCUS_54320 CDS 770..1384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54330 sequence923 source 1..1709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..1436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 sequence924 source 1..1705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..1313) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920985.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 sequence925 source 1..1704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence926 source 1..1702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(333..>1702) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205766.1:amidase locus_tag LOCUS_54360 sequence927 source 1..1679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence928 source 1..1678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence929 source 1..1672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence930 source 1..1659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(739..1350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54370 sequence931 source 1..1648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(363..668) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS complement(665..1249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54390 sequence932 source 1..1648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(381..>1648) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease locus_tag LOCUS_54400 sequence933 source 1..1644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence934 source 1..1638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..1285) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921559.1 transl_table 11 codon_start 1 locus_tag LOCUS_54410 sequence935 source 1..1620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..1618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54420 sequence936 source 1..1617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence937 source 1..1614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(351..1178) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 transl_table 11 codon_start 1 locus_tag LOCUS_54430 sequence938 source 1..1610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence939 source 1..1607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1429 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0C9:dihydrolipoyl dehydrogenase locus_tag LOCUS_54440 sequence940 source 1..1599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..1498 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946370.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 sequence941 source 1..1597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence942 source 1..1589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..633 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPW1:superoxide dismutase locus_tag LOCUS_54460 CDS complement(832..1491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54470 sequence943 source 1..1584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence944 source 1..1582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..699 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter locus_tag LOCUS_54480 sequence945 source 1..1580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS complement(759..1103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54500 sequence946 source 1..1579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(678..>1579) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108896.1:oxidoreductase locus_tag LOCUS_54510 sequence947 source 1..1576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1339 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202124.1:ATP-dependent endonuclease locus_tag LOCUS_54520 sequence948 source 1..1575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(865..>1575) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor locus_tag LOCUS_54530 sequence949 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 599..1102 product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7T2 transl_table 11 codon_start 1 locus_tag LOCUS_54540 gene tpx sequence950 source 1..1563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(864..>1563) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089482.1:ferredoxin oxidoreductase locus_tag LOCUS_54550 sequence951 source 1..1545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence952 source 1..1529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 570..1127 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 transl_table 11 codon_start 1 locus_tag LOCUS_54560 sequence953 source 1..1515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(814..>1515) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117992.1:arylsulfatase locus_tag LOCUS_54570 sequence954 source 1..1502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 900..1352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54580