>Feature sequence001 <1 1195 gene locus_tag LOCUS_00010 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682296.1:dihydroorotate dehydrogenase 2376 1669 gene locus_tag LOCUS_00020 2376 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5006 2850 gene locus_tag LOCUS_00030 gene fadB 5006 2850 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB2 protein_id gnl|my_center|LOCUS_00030 5125 6519 gene locus_tag LOCUS_00040 5125 6519 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_00040 6952 6527 gene locus_tag LOCUS_00050 6952 6527 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_00050 7188 6949 gene locus_tag LOCUS_00060 7188 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7935 7279 gene locus_tag LOCUS_00070 7935 7279 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074157.1 protein_id gnl|my_center|LOCUS_00070 8092 10458 gene locus_tag LOCUS_00080 8092 10458 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_00080 10652 10728 gene locus_tag LOCUS_t00010 10652 10728 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10748 10824 gene locus_tag LOCUS_t00020 10748 10824 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10880 10955 gene locus_tag LOCUS_t00030 10880 10955 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11201 12055 gene locus_tag LOCUS_00090 gene folD 11201 12055 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_00090 12824 12072 gene locus_tag LOCUS_00100 12824 12072 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_00100 12951 13706 gene locus_tag LOCUS_00110 12951 13706 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832720.1 protein_id gnl|my_center|LOCUS_00110 13747 14973 gene locus_tag LOCUS_00120 gene glpD 13747 14973 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_00120 15298 14963 gene locus_tag LOCUS_00130 15298 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17067 15691 gene locus_tag LOCUS_00140 gene cysS 17067 15691 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_00140 18826 17171 gene locus_tag LOCUS_00150 gene glnS 18826 17171 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_00150 19069 19578 gene locus_tag LOCUS_00160 gene ppiB 19069 19578 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_00160 19613 20359 gene locus_tag LOCUS_00170 gene lpxH 19613 20359 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83M28 protein_id gnl|my_center|LOCUS_00170 20484 21173 gene locus_tag LOCUS_00180 gene yccA 20484 21173 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_00180 21278 21577 gene locus_tag LOCUS_00190 21278 21577 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL9 protein_id gnl|my_center|LOCUS_00190 21635 22738 gene locus_tag LOCUS_00200 gene trmA 21635 22738 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVJ0 protein_id gnl|my_center|LOCUS_00200 23299 22835 gene locus_tag LOCUS_00210 23299 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24669 23305 gene locus_tag LOCUS_00220 24669 23305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24775 27537 gene locus_tag LOCUS_00230 24775 27537 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_00230 27534 30965 gene locus_tag LOCUS_00240 27534 30965 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_00240 31037 32104 gene locus_tag LOCUS_00250 31037 32104 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_00250 32413 32970 gene locus_tag LOCUS_00260 32413 32970 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_00260 33005 34819 gene locus_tag LOCUS_00270 gene atmA 33005 34819 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_00270 35136 35825 gene locus_tag LOCUS_00280 35136 35825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36116 36814 gene locus_tag LOCUS_00290 36116 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37788 36886 gene locus_tag LOCUS_00300 gene smtA 37788 36886 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JML6 protein_id gnl|my_center|LOCUS_00300 37829 39010 gene locus_tag LOCUS_00310 gene dapE 37829 39010 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU0 protein_id gnl|my_center|LOCUS_00310 39033 39920 gene locus_tag LOCUS_00320 39033 39920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244060.1 protein_id gnl|my_center|LOCUS_00320 40793 39942 gene locus_tag LOCUS_00330 gene rsmJ 40793 39942 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886R2 protein_id gnl|my_center|LOCUS_00330 41028 41450 gene locus_tag LOCUS_00340 41028 41450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41606 41755 gene locus_tag LOCUS_00350 41606 41755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42730 41969 gene locus_tag LOCUS_00360 42730 41969 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_00360 43881 42868 gene locus_tag LOCUS_00370 43881 42868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_00370 44815 43937 gene locus_tag LOCUS_00380 gene dapA 44815 43937 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_00380 45882 44923 gene locus_tag LOCUS_00390 gene lpxL 45882 44923 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_00390 47161 45974 gene locus_tag LOCUS_00400 gene fabV 47161 45974 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 protein_id gnl|my_center|LOCUS_00400 47606 48553 gene locus_tag LOCUS_00410 47606 48553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268677.1 protein_id gnl|my_center|LOCUS_00410 49053 48598 gene locus_tag LOCUS_00420 49053 48598 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_00420 50868 49153 gene locus_tag LOCUS_00430 50868 49153 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ35 protein_id gnl|my_center|LOCUS_00430 53582 50934 gene locus_tag LOCUS_00440 gene aceE 53582 50934 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_00440 56673 53839 gene locus_tag LOCUS_00450 56673 53839 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_00450 57894 56773 gene locus_tag LOCUS_00460 57894 56773 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_00460 58353 59687 gene locus_tag LOCUS_00470 58353 59687 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_00470 60884 59820 gene locus_tag LOCUS_00480 gene nadA 60884 59820 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_00480 61072 60935 gene locus_tag LOCUS_00490 61072 60935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 61440 63116 gene locus_tag LOCUS_00500 gene cysI 61440 63116 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_00500 63100 63588 gene locus_tag LOCUS_00510 63100 63588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_00510 63689 64855 gene locus_tag LOCUS_00520 63689 64855 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence002 2067 700 gene locus_tag LOCUS_00530 gene tyrS 2067 700 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_00530 2215 3561 gene locus_tag LOCUS_00540 2215 3561 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 protein_id gnl|my_center|LOCUS_00540 3571 4683 gene locus_tag LOCUS_00550 gene anmK 3571 4683 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_00550 5224 4724 gene locus_tag LOCUS_00560 5224 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 5660 5307 gene locus_tag LOCUS_00570 gene erpA 5660 5307 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_00570 6178 5759 gene locus_tag LOCUS_00580 6178 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963941.1 protein_id gnl|my_center|LOCUS_00580 6886 6182 gene locus_tag LOCUS_00590 6886 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 7938 6886 gene locus_tag LOCUS_00600 gene argC 7938 6886 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_00600 8064 8492 gene locus_tag LOCUS_00610 8064 8492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_00610 8711 10003 gene locus_tag LOCUS_00620 gene hemL 8711 10003 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_00620 10153 11169 gene locus_tag LOCUS_00630 gene hemB 10153 11169 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_00630 11169 11876 gene locus_tag LOCUS_00640 gene rsuA 11169 11876 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6H1 protein_id gnl|my_center|LOCUS_00640 11873 12934 gene locus_tag LOCUS_00650 11873 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14209 12995 gene locus_tag LOCUS_00660 14209 12995 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_00660 15452 14199 gene locus_tag LOCUS_00670 gene ubiH 15452 14199 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_00670 16790 15477 gene locus_tag LOCUS_00680 gene pepP 16790 15477 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_00680 17399 16854 gene locus_tag LOCUS_00690 17399 16854 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US2 protein_id gnl|my_center|LOCUS_00690 17566 17766 gene locus_tag LOCUS_00700 17566 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17775 18071 gene locus_tag LOCUS_00710 gene zapA 17775 18071 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_00710 18345 18133 gene locus_tag LOCUS_00720 18345 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18346 18939 gene locus_tag LOCUS_00730 18346 18939 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_00730 18921 20330 gene locus_tag LOCUS_00740 gene pykF 18921 20330 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 protein_id gnl|my_center|LOCUS_00740 21933 20419 gene locus_tag LOCUS_00750 gene ilvA1 21933 20419 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_00750 22066 22758 gene locus_tag LOCUS_00760 gene rpiA 22066 22758 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_00760 22777 23781 gene locus_tag LOCUS_00770 22777 23781 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_00770 26374 23801 gene locus_tag LOCUS_00780 26374 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 27514 26444 gene locus_tag LOCUS_00790 27514 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_00790 28056 27511 gene locus_tag LOCUS_00800 28056 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 28246 29967 gene locus_tag LOCUS_00810 28246 29967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 30246 30683 gene locus_tag LOCUS_00820 gene aroQ1 30246 30683 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_00820 30742 31197 gene locus_tag LOCUS_00830 30742 31197 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369456.1 protein_id gnl|my_center|LOCUS_00830 31218 32558 gene locus_tag LOCUS_00840 gene accC 31218 32558 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_00840 32609 33490 gene locus_tag LOCUS_00850 gene prmA 32609 33490 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_00850 33702 34334 gene locus_tag LOCUS_00860 33702 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 34430 35419 gene locus_tag LOCUS_00870 gene dusB 34430 35419 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_00870 35416 35697 gene locus_tag LOCUS_00880 35416 35697 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_00880 35715 37289 gene locus_tag LOCUS_00890 gene purH 35715 37289 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KT0 protein_id gnl|my_center|LOCUS_00890 38780 37443 gene locus_tag LOCUS_00900 gene phrB 38780 37443 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179955.1 protein_id gnl|my_center|LOCUS_00900 39031 40338 gene locus_tag LOCUS_00910 gene purD 39031 40338 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_00910 40346 41074 gene locus_tag LOCUS_00920 40346 41074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_00920 41166 41816 gene locus_tag LOCUS_00930 gene coq7 41166 41816 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R6 protein_id gnl|my_center|LOCUS_00930 42920 41946 gene locus_tag LOCUS_00940 gene yidZ 42920 41946 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260920.1 protein_id gnl|my_center|LOCUS_00940 43050 43172 gene locus_tag LOCUS_00950 43050 43172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 44005 43586 gene locus_tag LOCUS_00960 44005 43586 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_00960 44159 44794 gene locus_tag LOCUS_00970 gene vfr 44159 44794 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_00970 45591 44791 gene locus_tag LOCUS_00980 gene trpC 45591 44791 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_00980 46648 45611 gene locus_tag LOCUS_00990 gene trpD 46648 45611 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_00990 47220 46651 gene locus_tag LOCUS_01000 gene trpG 47220 46651 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_01000 48716 47226 gene locus_tag LOCUS_01010 48716 47226 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_01010 49617 48949 gene locus_tag LOCUS_01020 gene rpe 49617 48949 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_01020 50103 49789 gene locus_tag LOCUS_01030 50103 49789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 51856 50234 gene locus_tag LOCUS_01040 gene alkK 51856 50234 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 protein_id gnl|my_center|LOCUS_01040 52502 52026 gene locus_tag LOCUS_01050 52502 52026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 52713 53672 gene locus_tag LOCUS_01060 gene gshB 52713 53672 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_01060 53733 54527 gene locus_tag LOCUS_01070 gene tonB3 53733 54527 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_01070 54634 55155 gene locus_tag LOCUS_01080 54634 55155 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXZ4 protein_id gnl|my_center|LOCUS_01080 55148 55585 gene locus_tag LOCUS_01090 55148 55585 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT8 protein_id gnl|my_center|LOCUS_01090 55778 55614 gene locus_tag LOCUS_01100 55778 55614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 56762 55785 gene locus_tag LOCUS_01110 gene pilU 56762 55785 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01110 57808 56774 gene locus_tag LOCUS_01120 gene pilT 57808 56774 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_01120 57874 58572 gene locus_tag LOCUS_01130 57874 58572 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266427.1 protein_id gnl|my_center|LOCUS_01130 58572 59387 gene locus_tag LOCUS_01140 gene proC 58572 59387 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_01140 59471 60043 gene locus_tag LOCUS_01150 59471 60043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_01150 61120 60077 gene locus_tag LOCUS_01160 61120 60077 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence003 147 722 gene locus_tag LOCUS_01170 gene rnfA 147 722 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_01170 723 1352 gene locus_tag LOCUS_01180 gene rnfB 723 1352 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_01180 1349 3142 gene locus_tag LOCUS_01190 1349 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3142 4206 gene locus_tag LOCUS_01200 gene rsxD 3142 4206 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6Q8 protein_id gnl|my_center|LOCUS_01200 4206 4868 gene locus_tag LOCUS_01210 4206 4868 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_01210 4865 5608 gene locus_tag LOCUS_01220 4865 5608 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_01220 5718 7430 gene locus_tag LOCUS_01230 5718 7430 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP69 protein_id gnl|my_center|LOCUS_01230 7882 7436 gene locus_tag LOCUS_01240 7882 7436 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_01240 8615 8064 gene locus_tag LOCUS_01250 8615 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9330 8740 gene locus_tag LOCUS_01260 gene aqpZ 9330 8740 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 10083 9763 gene locus_tag LOCUS_01270 10083 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 10724 10044 gene locus_tag LOCUS_01280 10724 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01280 10608 10817 gene locus_tag LOCUS_01290 10608 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11327 11025 gene locus_tag LOCUS_01300 11327 11025 CDS product chaperone-modulator protein CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173425.1 protein_id gnl|my_center|LOCUS_01300 12298 11330 gene locus_tag LOCUS_01310 gene cbpA 12298 11330 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VN8 protein_id gnl|my_center|LOCUS_01310 12554 13516 gene locus_tag LOCUS_01320 gene corA 12554 13516 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA41 protein_id gnl|my_center|LOCUS_01320 13507 14358 gene locus_tag LOCUS_01330 13507 14358 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 protein_id gnl|my_center|LOCUS_01330 14703 14383 gene locus_tag LOCUS_01340 14703 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16175 14958 gene locus_tag LOCUS_01350 gene argG 16175 14958 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_01350 17020 16235 gene locus_tag LOCUS_01360 17020 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 17115 18149 gene locus_tag LOCUS_01370 gene pyrC 17115 18149 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72170 protein_id gnl|my_center|LOCUS_01370 18149 18832 gene locus_tag LOCUS_01380 gene rnt 18149 18832 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_01380 20377 18929 gene locus_tag LOCUS_01390 20377 18929 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072961.1 protein_id gnl|my_center|LOCUS_01390 21495 20515 gene locus_tag LOCUS_01400 21495 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22814 21486 gene locus_tag LOCUS_01410 22814 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 23011 25281 gene locus_tag LOCUS_01420 gene maeB 23011 25281 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_01420 26247 25402 gene locus_tag LOCUS_01430 gene rsmI 26247 25402 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 protein_id gnl|my_center|LOCUS_01430 26270 28111 gene locus_tag LOCUS_01440 26270 28111 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_01440 28138 28539 gene locus_tag LOCUS_01450 28138 28539 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_01450 28567 29139 gene locus_tag LOCUS_01460 28567 29139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 29140 29706 gene locus_tag LOCUS_01470 29140 29706 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_01470 30914 29736 gene locus_tag LOCUS_01480 30914 29736 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_01480 31382 30939 gene locus_tag LOCUS_01490 31382 30939 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_01490 31989 31384 gene locus_tag LOCUS_01500 gene sspA 31989 31384 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_01500 34221 32185 gene locus_tag LOCUS_01510 34221 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 34826 34221 gene locus_tag LOCUS_01520 34826 34221 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_01520 35412 35020 gene locus_tag LOCUS_01530 gene rpsI 35412 35020 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR92 protein_id gnl|my_center|LOCUS_01530 35856 35428 gene locus_tag LOCUS_01540 gene rplM 35856 35428 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_01540 37065 35968 gene locus_tag LOCUS_01550 gene zapE 37065 35968 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_01550 37376 37822 gene locus_tag LOCUS_01560 37376 37822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 38155 38658 gene locus_tag LOCUS_01570 38155 38658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 38665 39516 gene locus_tag LOCUS_01580 38665 39516 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_01580 40560 39604 gene locus_tag LOCUS_01590 gene poxA 40560 39604 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B8 protein_id gnl|my_center|LOCUS_01590 41173 40601 gene locus_tag LOCUS_01600 gene efp 41173 40601 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_01600 41396 42085 gene locus_tag LOCUS_01610 41396 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 42236 43057 gene locus_tag LOCUS_01620 42236 43057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 43081 43998 gene locus_tag LOCUS_01630 43081 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 44172 45146 gene locus_tag LOCUS_01640 44172 45146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01640 46405 45185 gene locus_tag LOCUS_01650 46405 45185 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_01650 46514 47713 gene locus_tag LOCUS_01660 46514 47713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 48241 47726 gene locus_tag LOCUS_01670 48241 47726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 49104 48316 gene locus_tag LOCUS_01680 gene cysE 49104 48316 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456939.1 protein_id gnl|my_center|LOCUS_01680 49827 49144 gene locus_tag LOCUS_01690 49827 49144 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 protein_id gnl|my_center|LOCUS_01690 50029 50922 gene locus_tag LOCUS_01700 gene htpX 50029 50922 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_01700 50912 51319 gene locus_tag LOCUS_01710 50912 51319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_01710 52047 51316 gene locus_tag LOCUS_01720 gene sfsA 52047 51316 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRD4 protein_id gnl|my_center|LOCUS_01720 52419 52784 gene locus_tag LOCUS_01730 gene dksA 52419 52784 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP03 protein_id gnl|my_center|LOCUS_01730 52875 53786 gene locus_tag LOCUS_01740 gene gluQ 52875 53786 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ME2 protein_id gnl|my_center|LOCUS_01740 54068 56935 gene locus_tag LOCUS_01750 gene cbrA 54068 56935 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_01750 57013 58311 gene locus_tag LOCUS_01760 gene cbrB 57013 58311 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence004 175 918 gene locus_tag LOCUS_01770 175 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 974 1447 gene locus_tag LOCUS_01780 gene nrdR 974 1447 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889R0 protein_id gnl|my_center|LOCUS_01780 1447 2568 gene locus_tag LOCUS_01790 gene ribD 1447 2568 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX83 protein_id gnl|my_center|LOCUS_01790 2733 3347 gene locus_tag LOCUS_01800 2733 3347 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_01800 3445 4563 gene locus_tag LOCUS_01810 gene ribB 3445 4563 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_01810 4579 5061 gene locus_tag LOCUS_01820 gene ribH 4579 5061 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU4 protein_id gnl|my_center|LOCUS_01820 5062 5502 gene locus_tag LOCUS_01830 gene nusB 5062 5502 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_01830 5641 6558 gene locus_tag LOCUS_01840 gene thiL 5641 6558 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHG6 protein_id gnl|my_center|LOCUS_01840 6524 7045 gene locus_tag LOCUS_01850 6524 7045 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU1 protein_id gnl|my_center|LOCUS_01850 7137 8330 gene locus_tag LOCUS_01860 7137 8330 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_01860 8338 10638 gene locus_tag LOCUS_01870 8338 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01870 10642 11511 gene locus_tag LOCUS_01880 10642 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01880 11598 12194 gene locus_tag LOCUS_01890 11598 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12191 12961 gene locus_tag LOCUS_01900 gene hisF1 12191 12961 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_01900 13358 13062 gene locus_tag LOCUS_01910 13358 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768817.1 protein_id gnl|my_center|LOCUS_01910 14841 13375 gene locus_tag LOCUS_01920 gene gatB 14841 13375 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_01920 16295 14841 gene locus_tag LOCUS_01930 gene gatA 16295 14841 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_01930 16594 16307 gene locus_tag LOCUS_01940 gene gatC 16594 16307 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS8 protein_id gnl|my_center|LOCUS_01940 16698 16970 gene locus_tag LOCUS_01950 16698 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 16919 17953 gene locus_tag LOCUS_01960 16919 17953 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_01960 18105 18950 gene locus_tag LOCUS_01970 gene mreC 18105 18950 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_01970 18950 19426 gene locus_tag LOCUS_01980 18950 19426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 19436 20074 gene locus_tag LOCUS_01990 19436 20074 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_01990 20221 21714 gene locus_tag LOCUS_02000 gene cafA 20221 21714 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_02000 21727 25737 gene locus_tag LOCUS_02010 21727 25737 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_02010 25724 26566 gene locus_tag LOCUS_02020 25724 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_02020 27200 26676 gene locus_tag LOCUS_02030 27200 26676 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAU5 protein_id gnl|my_center|LOCUS_02030 28543 27200 gene locus_tag LOCUS_02040 28543 27200 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP45 protein_id gnl|my_center|LOCUS_02040 28930 28661 gene locus_tag LOCUS_02050 gene ptsH 28930 28661 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65877 protein_id gnl|my_center|LOCUS_02050 29787 28927 gene locus_tag LOCUS_02060 29787 28927 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_02060 30257 29790 gene locus_tag LOCUS_02070 30257 29790 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_02070 30553 30266 gene locus_tag LOCUS_02080 gene yfiA-2 30553 30266 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_02080 32046 30577 gene locus_tag LOCUS_02090 32046 30577 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU5 protein_id gnl|my_center|LOCUS_02090 32973 32248 gene locus_tag LOCUS_02100 gene lptB 32973 32248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417497.1 protein_id gnl|my_center|LOCUS_02100 33587 32973 gene locus_tag LOCUS_02110 33587 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 34137 33574 gene locus_tag LOCUS_02120 34137 33574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 34682 34134 gene locus_tag LOCUS_02130 34682 34134 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268860.1 protein_id gnl|my_center|LOCUS_02130 35656 34685 gene locus_tag LOCUS_02140 gene kdsD 35656 34685 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_02140 36719 35727 gene locus_tag LOCUS_02150 36719 35727 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_02150 36892 37533 gene locus_tag LOCUS_02160 36892 37533 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 protein_id gnl|my_center|LOCUS_02160 37583 37822 gene locus_tag LOCUS_02170 gene ligA 37583 37822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_02170 37872 39134 gene locus_tag LOCUS_02180 gene murA 37872 39134 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_02180 39201 39836 gene locus_tag LOCUS_02190 gene hisG 39201 39836 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_02190 39833 41146 gene locus_tag LOCUS_02200 gene hisD 39833 41146 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV5 protein_id gnl|my_center|LOCUS_02200 41217 42281 gene locus_tag LOCUS_02210 gene hisC 41217 42281 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW0 protein_id gnl|my_center|LOCUS_02210 43497 42343 gene locus_tag LOCUS_02220 43497 42343 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_02220 43859 43557 gene locus_tag LOCUS_02230 43859 43557 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_02230 43968 44525 gene locus_tag LOCUS_02240 gene rlmE 43968 44525 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ4 protein_id gnl|my_center|LOCUS_02240 44542 46482 gene locus_tag LOCUS_02250 gene ftsH 44542 46482 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP8 protein_id gnl|my_center|LOCUS_02250 46538 47437 gene locus_tag LOCUS_02260 gene folP 46538 47437 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_02260 47440 48795 gene locus_tag LOCUS_02270 gene glmM 47440 48795 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV50 protein_id gnl|my_center|LOCUS_02270 48874 49617 gene locus_tag LOCUS_02280 gene tpiA 48874 49617 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 protein_id gnl|my_center|LOCUS_02280 49620 49970 gene locus_tag LOCUS_02290 gene secG 49620 49970 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_02290 50124 50208 gene locus_tag LOCUS_t00040 50124 50208 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 50446 51081 gene locus_tag LOCUS_02300 50446 51081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 51502 52296 gene locus_tag LOCUS_02310 gene djlA 51502 52296 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUR8 protein_id gnl|my_center|LOCUS_02310 52400 52476 gene locus_tag LOCUS_t00050 52400 52476 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52720 53175 gene locus_tag LOCUS_02320 gene rimP 52720 53175 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_02320 53194 54687 gene locus_tag LOCUS_02330 gene nusA 53194 54687 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_02330 >Feature sequence005 2513 1206 gene locus_tag LOCUS_02340 2513 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2684 3469 gene locus_tag LOCUS_02350 2684 3469 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338914.1 protein_id gnl|my_center|LOCUS_02350 3450 4481 gene locus_tag LOCUS_02360 3450 4481 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918670.1 protein_id gnl|my_center|LOCUS_02360 4504 5133 gene locus_tag LOCUS_02370 4504 5133 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_419601.2 protein_id gnl|my_center|LOCUS_02370 5194 6084 gene locus_tag LOCUS_02380 5194 6084 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_02380 6183 7100 gene locus_tag LOCUS_02390 6183 7100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_02390 7651 7169 gene locus_tag LOCUS_02400 7651 7169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420250.1 protein_id gnl|my_center|LOCUS_02400 9989 7746 gene locus_tag LOCUS_02410 9989 7746 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_02410 12950 10518 gene locus_tag LOCUS_02420 gene fyuA 12950 10518 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_02420 13364 14200 gene locus_tag LOCUS_02430 13364 14200 CDS product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_02430 14205 15104 gene locus_tag LOCUS_02440 gene liuE 14205 15104 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_02440 15198 15578 gene locus_tag LOCUS_02450 15198 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 protein_id gnl|my_center|LOCUS_02450 16700 15675 gene locus_tag LOCUS_02460 gene epmB 16700 15675 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39280 protein_id gnl|my_center|LOCUS_02460 16829 17302 gene locus_tag LOCUS_02470 gene tadA 16829 17302 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_02470 18801 17323 gene locus_tag LOCUS_02480 gene mltF 18801 17323 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 protein_id gnl|my_center|LOCUS_02480 19004 22876 gene locus_tag LOCUS_02490 gene purL 19004 22876 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX02 protein_id gnl|my_center|LOCUS_02490 22959 23222 gene locus_tag LOCUS_02500 22959 23222 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_02500 24383 24778 gene locus_tag LOCUS_02510 gene mraZ 24383 24778 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_02510 24844 25788 gene locus_tag LOCUS_02520 gene rsmH 24844 25788 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY2 protein_id gnl|my_center|LOCUS_02520 25785 26066 gene locus_tag LOCUS_02530 25785 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 26069 27823 gene locus_tag LOCUS_02540 26069 27823 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340692.1 protein_id gnl|my_center|LOCUS_02540 27823 29400 gene locus_tag LOCUS_02550 gene murE 27823 29400 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_02550 29397 30764 gene locus_tag LOCUS_02560 gene murF 29397 30764 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2P6 protein_id gnl|my_center|LOCUS_02560 30764 31846 gene locus_tag LOCUS_02570 gene mraY 30764 31846 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY7 protein_id gnl|my_center|LOCUS_02570 31907 33271 gene locus_tag LOCUS_02580 gene murD 31907 33271 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 protein_id gnl|my_center|LOCUS_02580 33268 34446 gene locus_tag LOCUS_02590 gene ftsW 33268 34446 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_02590 34493 35548 gene locus_tag LOCUS_02600 gene murG 34493 35548 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_02600 35541 36062 gene locus_tag LOCUS_02610 35541 36062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 36055 37512 gene locus_tag LOCUS_02620 gene murC 36055 37512 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY6 protein_id gnl|my_center|LOCUS_02620 37509 38417 gene locus_tag LOCUS_02630 gene ddlB 37509 38417 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_02630 38417 39280 gene locus_tag LOCUS_02640 gene ftsQ 38417 39280 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA7 protein_id gnl|my_center|LOCUS_02640 39304 40539 gene locus_tag LOCUS_02650 gene ftsA 39304 40539 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_02650 40594 41760 gene locus_tag LOCUS_02660 gene ftsZ 40594 41760 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_02660 41870 42775 gene locus_tag LOCUS_02670 gene lpxC 41870 42775 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_02670 42877 43818 gene locus_tag LOCUS_02680 42877 43818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_02680 43936 46683 gene locus_tag LOCUS_02690 gene secA 43936 46683 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_02690 46708 47937 gene locus_tag LOCUS_02700 gene argJ 46708 47937 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_02700 47983 48411 gene locus_tag LOCUS_02710 47983 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 48732 48490 gene locus_tag LOCUS_02720 48732 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 49417 48773 gene locus_tag LOCUS_02730 gene coaE 49417 48773 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U3 protein_id gnl|my_center|LOCUS_02730 50380 49499 gene locus_tag LOCUS_02740 gene pilD 50380 49499 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22610 protein_id gnl|my_center|LOCUS_02740 50744 51940 gene locus_tag LOCUS_02750 50744 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 52366 52076 gene locus_tag LOCUS_02760 52366 52076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 53584 52673 gene locus_tag LOCUS_02770 gene nadC 53584 52673 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_02770 >Feature sequence006 <1 1648 gene locus_tag LOCUS_02780 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104874.1:long-chain-fatty-acid--CoA ligase 1673 2572 gene locus_tag LOCUS_02790 1673 2572 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_02790 4214 2934 gene locus_tag LOCUS_02800 gene atoB 4214 2934 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_02800 4391 5728 gene locus_tag LOCUS_02810 gene fabG 4391 5728 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_02810 6836 5814 gene locus_tag LOCUS_02820 gene dapD 6836 5814 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M78 protein_id gnl|my_center|LOCUS_02820 7209 6865 gene locus_tag LOCUS_02830 7209 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7367 8446 gene locus_tag LOCUS_02840 gene ada 7367 8446 CDS product bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786384.1 protein_id gnl|my_center|LOCUS_02840 8439 9212 gene locus_tag LOCUS_02850 8439 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 9218 9607 gene locus_tag LOCUS_02860 9218 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02860 9674 9919 gene locus_tag LOCUS_02870 9674 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02870 10583 9930 gene locus_tag LOCUS_02880 gene nth 10583 9930 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_02880 11815 10607 gene locus_tag LOCUS_02890 11815 10607 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_02890 14577 11863 gene locus_tag LOCUS_02900 gene glnD 14577 11863 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT0 protein_id gnl|my_center|LOCUS_02900 15359 14580 gene locus_tag LOCUS_02910 gene map 15359 14580 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS9 protein_id gnl|my_center|LOCUS_02910 15764 16603 gene locus_tag LOCUS_02920 gene rpsB 15764 16603 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_02920 16689 17549 gene locus_tag LOCUS_02930 gene tsf 16689 17549 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_02930 17585 18328 gene locus_tag LOCUS_02940 gene pyrH 17585 18328 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS6 protein_id gnl|my_center|LOCUS_02940 18321 18878 gene locus_tag LOCUS_02950 gene frr 18321 18878 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_02950 18898 19680 gene locus_tag LOCUS_02960 gene uppS 18898 19680 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_02960 19673 20503 gene locus_tag LOCUS_02970 gene cdsA-1 19673 20503 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_02970 20513 21697 gene locus_tag LOCUS_02980 gene dxr 20513 21697 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS2 protein_id gnl|my_center|LOCUS_02980 21701 23059 gene locus_tag LOCUS_02990 21701 23059 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS1 protein_id gnl|my_center|LOCUS_02990 23103 25454 gene locus_tag LOCUS_03000 gene opr86 23103 25454 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_03000 25475 25999 gene locus_tag LOCUS_03010 25475 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 26006 27076 gene locus_tag LOCUS_03020 gene lpxD 26006 27076 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_03020 27145 27648 gene locus_tag LOCUS_03030 gene fabZ 27145 27648 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_03030 27645 28412 gene locus_tag LOCUS_03040 gene lpxA 27645 28412 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N1 protein_id gnl|my_center|LOCUS_03040 28416 29585 gene locus_tag LOCUS_03050 gene lpxB 28416 29585 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_03050 29582 30256 gene locus_tag LOCUS_03060 gene rnhB 29582 30256 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR4 protein_id gnl|my_center|LOCUS_03060 30451 31485 gene locus_tag LOCUS_03070 gene fabH 30451 31485 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH32 protein_id gnl|my_center|LOCUS_03070 31554 34994 gene locus_tag LOCUS_03080 gene dnaE 31554 34994 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_03080 35128 36081 gene locus_tag LOCUS_03090 gene accA 35128 36081 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_03090 36944 36174 gene locus_tag LOCUS_03100 36944 36174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 37246 36941 gene locus_tag LOCUS_03110 37246 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 37233 37790 gene locus_tag LOCUS_03120 37233 37790 CDS product transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 protein_id gnl|my_center|LOCUS_03120 37899 38804 gene locus_tag LOCUS_03130 37899 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 38855 39949 gene locus_tag LOCUS_03140 gene pdxB 38855 39949 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL55 protein_id gnl|my_center|LOCUS_03140 41192 39966 gene locus_tag LOCUS_03150 41192 39966 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_03150 41404 42039 gene locus_tag LOCUS_03160 41404 42039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 42117 42192 gene locus_tag LOCUS_t00060 42117 42192 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42223 42297 gene locus_tag LOCUS_t00070 42223 42297 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43571 42438 gene locus_tag LOCUS_03170 43571 42438 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_03170 44032 43574 gene locus_tag LOCUS_03180 44032 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 44189 44683 gene locus_tag LOCUS_03190 44189 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03190 44699 46744 gene locus_tag LOCUS_03200 44699 46744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03200 46824 47441 gene locus_tag LOCUS_03210 46824 47441 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_03210 47451 47870 gene locus_tag LOCUS_03220 47451 47870 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_03220 47875 49725 gene locus_tag LOCUS_03230 gene msbA 47875 49725 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF3 protein_id gnl|my_center|LOCUS_03230 49728 50807 gene locus_tag LOCUS_03240 gene lpxK 49728 50807 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUI0 protein_id gnl|my_center|LOCUS_03240 50856 51623 gene locus_tag LOCUS_03250 gene kdsB 50856 51623 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_03250 51702 52247 gene locus_tag LOCUS_03260 gene ptpA 51702 52247 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_03260 52247 53272 gene locus_tag LOCUS_03270 gene murB 52247 53272 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_03270 53276 53884 gene locus_tag LOCUS_03280 53276 53884 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence007 825 478 gene locus_tag LOCUS_03290 825 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1652 891 gene locus_tag LOCUS_03300 1652 891 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E96 protein_id gnl|my_center|LOCUS_03300 1732 1977 gene locus_tag LOCUS_03310 1732 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_03310 1952 2380 gene locus_tag LOCUS_03320 1952 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4008 2386 gene locus_tag LOCUS_03330 gene nadB 4008 2386 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_03330 4188 4778 gene locus_tag LOCUS_03340 gene algU 4188 4778 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_03340 4881 5549 gene locus_tag LOCUS_03350 4881 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5559 6572 gene locus_tag LOCUS_03360 5559 6572 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_03360 6585 7043 gene locus_tag LOCUS_03370 6585 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7291 8673 gene locus_tag LOCUS_03380 gene mucD 7291 8673 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_03380 8750 9592 gene locus_tag LOCUS_03390 8750 9592 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_03390 9751 11544 gene locus_tag LOCUS_03400 gene lepA 9751 11544 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_03400 11585 12316 gene locus_tag LOCUS_03410 gene lepB 11585 12316 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_03410 12415 12780 gene locus_tag LOCUS_03420 12415 12780 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246809.1 protein_id gnl|my_center|LOCUS_03420 12804 13481 gene locus_tag LOCUS_03430 gene rnc 12804 13481 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7Y0 protein_id gnl|my_center|LOCUS_03430 13481 14380 gene locus_tag LOCUS_03440 gene era 13481 14380 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_03440 14386 15114 gene locus_tag LOCUS_03450 gene recO 14386 15114 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_03450 15166 15543 gene locus_tag LOCUS_03460 gene acpS 15166 15543 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E318 protein_id gnl|my_center|LOCUS_03460 15725 16612 gene locus_tag LOCUS_03470 15725 16612 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_03470 16698 19019 gene locus_tag LOCUS_03480 gene relA 16698 19019 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_03480 19192 20016 gene locus_tag LOCUS_03490 19192 20016 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_03490 20208 20858 gene locus_tag LOCUS_03500 gene adk 20208 20858 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_03500 21068 22081 gene locus_tag LOCUS_03510 21068 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 22375 22962 gene locus_tag LOCUS_03520 22375 22962 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_03520 22965 23771 gene locus_tag LOCUS_03530 gene uppP 22965 23771 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_03530 23805 24689 gene locus_tag LOCUS_03540 23805 24689 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_03540 24729 26063 gene locus_tag LOCUS_03550 gene apeB 24729 26063 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW15 protein_id gnl|my_center|LOCUS_03550 26188 27195 gene locus_tag LOCUS_03560 gene trpS 26188 27195 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7X0 protein_id gnl|my_center|LOCUS_03560 27412 27858 gene locus_tag LOCUS_03570 27412 27858 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_03570 29565 28018 gene locus_tag LOCUS_03580 gene pckA 29565 28018 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500D1 protein_id gnl|my_center|LOCUS_03580 30577 29693 gene locus_tag LOCUS_03590 gene hslO 30577 29693 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_03590 31002 30628 gene locus_tag LOCUS_03600 31002 30628 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_03600 31674 31006 gene locus_tag LOCUS_03610 31674 31006 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_03610 34260 31711 gene locus_tag LOCUS_03620 gene mrcA 34260 31711 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_03620 34501 35568 gene locus_tag LOCUS_03630 34501 35568 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_03630 35569 36141 gene locus_tag LOCUS_03640 gene pilN 35569 36141 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_03640 36207 36818 gene locus_tag LOCUS_03650 gene pilO 36207 36818 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765501.1 protein_id gnl|my_center|LOCUS_03650 36815 37348 gene locus_tag LOCUS_03660 gene pilP 36815 37348 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378849.1 protein_id gnl|my_center|LOCUS_03660 37372 38766 gene locus_tag LOCUS_03670 37372 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03670 38767 39651 gene locus_tag LOCUS_03680 38767 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03680 39648 40166 gene locus_tag LOCUS_03690 gene aroK 39648 40166 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFS0 protein_id gnl|my_center|LOCUS_03690 40238 41332 gene locus_tag LOCUS_03700 gene aroB 40238 41332 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_03700 41581 46038 gene locus_tag LOCUS_03710 gene gltB 41581 46038 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_03710 46067 47491 gene locus_tag LOCUS_03720 gene gltD 46067 47491 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_03720 47641 48699 gene locus_tag LOCUS_03730 gene hemE 47641 48699 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_03730 49114 50277 gene locus_tag LOCUS_03740 49114 50277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 51133 50282 gene locus_tag LOCUS_03750 gene psd 51133 50282 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_03750 52026 51190 gene locus_tag LOCUS_03760 52026 51190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence008 1346 255 gene locus_tag LOCUS_03770 1346 255 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W88 protein_id gnl|my_center|LOCUS_03770 2156 1383 gene locus_tag LOCUS_03780 gene fnr-1 2156 1383 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616041.1 protein_id gnl|my_center|LOCUS_03780 3242 2172 gene locus_tag LOCUS_03790 3242 2172 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE45 protein_id gnl|my_center|LOCUS_03790 3549 3235 gene locus_tag LOCUS_03800 3549 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_03800 3990 3661 gene locus_tag LOCUS_03810 gene fdxA 3990 3661 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_03810 4209 3994 gene locus_tag LOCUS_03820 4209 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03820 4962 4237 gene locus_tag LOCUS_03830 4962 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03830 5204 4971 gene locus_tag LOCUS_03840 5204 4971 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_03840 6963 5230 gene locus_tag LOCUS_03850 6963 5230 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 protein_id gnl|my_center|LOCUS_03850 7783 7049 gene locus_tag LOCUS_03860 7783 7049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_03860 8665 7985 gene locus_tag LOCUS_03870 gene cc4 8665 7985 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_03870 9235 8726 gene locus_tag LOCUS_03880 9235 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_03880 9812 9228 gene locus_tag LOCUS_03890 9812 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10713 9862 gene locus_tag LOCUS_03900 10713 9862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088548.1 protein_id gnl|my_center|LOCUS_03900 11407 10766 gene locus_tag LOCUS_03910 11407 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 12202 11417 gene locus_tag LOCUS_03920 12202 11417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085975.1 protein_id gnl|my_center|LOCUS_03920 13798 12434 gene locus_tag LOCUS_03930 13798 12434 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085976.1 protein_id gnl|my_center|LOCUS_03930 15634 14426 gene locus_tag LOCUS_03940 15634 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 16994 16920 gene locus_tag LOCUS_t00080 16994 16920 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17714 17034 gene locus_tag LOCUS_03950 gene queC 17714 17034 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 protein_id gnl|my_center|LOCUS_03950 18406 17756 gene locus_tag LOCUS_03960 gene queE 18406 17756 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F56 protein_id gnl|my_center|LOCUS_03960 19315 18461 gene locus_tag LOCUS_03970 19315 18461 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_03970 19927 19427 gene locus_tag LOCUS_03980 gene pal 19927 19427 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z4 protein_id gnl|my_center|LOCUS_03980 21355 20045 gene locus_tag LOCUS_03990 gene tolB 21355 20045 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK6 protein_id gnl|my_center|LOCUS_03990 22135 21368 gene locus_tag LOCUS_04000 22135 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 22478 22137 gene locus_tag LOCUS_04010 gene tolR 22478 22137 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_04010 23297 22608 gene locus_tag LOCUS_04020 23297 22608 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_04020 23779 23357 gene locus_tag LOCUS_04030 23779 23357 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_04030 24863 23772 gene locus_tag LOCUS_04040 gene ruvB 24863 23772 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_04040 25554 24955 gene locus_tag LOCUS_04050 gene ruvA 25554 24955 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA3 protein_id gnl|my_center|LOCUS_04050 26094 25579 gene locus_tag LOCUS_04060 gene ruvC 26094 25579 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 protein_id gnl|my_center|LOCUS_04060 27406 26210 gene locus_tag LOCUS_04070 27406 26210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_04070 28614 27406 gene locus_tag LOCUS_04080 28614 27406 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_04080 29422 28601 gene locus_tag LOCUS_04090 gene macB 29422 28601 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNB9 protein_id gnl|my_center|LOCUS_04090 30555 29419 gene locus_tag LOCUS_04100 30555 29419 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391278.1 protein_id gnl|my_center|LOCUS_04100 31240 30773 gene locus_tag LOCUS_04110 31240 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 33314 31539 gene locus_tag LOCUS_04120 gene aspS 33314 31539 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 protein_id gnl|my_center|LOCUS_04120 33672 33421 gene locus_tag LOCUS_04130 33672 33421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 33988 34581 gene locus_tag LOCUS_04140 33988 34581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 35056 34634 gene locus_tag LOCUS_04150 35056 34634 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_04150 35159 36883 gene locus_tag LOCUS_04160 gene proS 35159 36883 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP53 protein_id gnl|my_center|LOCUS_04160 36912 37457 gene locus_tag LOCUS_04170 36912 37457 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_04170 37560 38387 gene locus_tag LOCUS_04180 37560 38387 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89R51 protein_id gnl|my_center|LOCUS_04180 38916 39650 gene locus_tag LOCUS_04190 38916 39650 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I203 protein_id gnl|my_center|LOCUS_04190 39650 40354 gene locus_tag LOCUS_04200 39650 40354 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_04200 40351 41316 gene locus_tag LOCUS_04210 gene ybgK 40351 41316 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_04210 41309 42172 gene locus_tag LOCUS_04220 41309 42172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_04220 42379 43236 gene locus_tag LOCUS_04230 42379 43236 CDS product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_04230 43245 44321 gene locus_tag LOCUS_04240 gene dadX 43245 44321 CDS product alanine racemase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ2 protein_id gnl|my_center|LOCUS_04240 44849 44352 gene locus_tag LOCUS_04250 gene lrp 44849 44352 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 protein_id gnl|my_center|LOCUS_04250 45015 48782 gene locus_tag LOCUS_04260 gene putA 45015 48782 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_04260 49331 48855 gene locus_tag LOCUS_04270 49331 48855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 49897 49331 gene locus_tag LOCUS_04280 gene ubiX 49897 49331 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 protein_id gnl|my_center|LOCUS_04280 >Feature sequence009 60 245 gene locus_tag LOCUS_04290 60 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 1812 541 gene locus_tag LOCUS_04300 gene mshG 1812 541 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_04300 3524 1809 gene locus_tag LOCUS_04310 3524 1809 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_04310 4284 4748 gene locus_tag LOCUS_04320 4284 4748 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_04320 4823 5734 gene locus_tag LOCUS_04330 gene rimK 4823 5734 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_04330 5746 6807 gene locus_tag LOCUS_04340 5746 6807 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_04340 7730 6819 gene locus_tag LOCUS_04350 7730 6819 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_04350 7914 8477 gene locus_tag LOCUS_04360 7914 8477 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_04360 8645 10279 gene locus_tag LOCUS_04370 8645 10279 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599501.1 protein_id gnl|my_center|LOCUS_04370 11281 10394 gene locus_tag LOCUS_04380 11281 10394 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_04380 11398 12603 gene locus_tag LOCUS_04390 gene nhaA 11398 12603 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG33 protein_id gnl|my_center|LOCUS_04390 12600 13091 gene locus_tag LOCUS_04400 12600 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13124 13429 gene locus_tag LOCUS_04410 13124 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 13473 14417 gene locus_tag LOCUS_04420 13473 14417 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_04420 14420 14755 gene locus_tag LOCUS_04430 14420 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_04430 14847 16415 gene locus_tag LOCUS_04440 14847 16415 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_04440 17620 16454 gene locus_tag LOCUS_04450 17620 16454 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_04450 19341 17812 gene locus_tag LOCUS_04460 19341 17812 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225314.1 protein_id gnl|my_center|LOCUS_04460 20861 19407 gene locus_tag LOCUS_04470 20861 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 21366 20872 gene locus_tag LOCUS_04480 21366 20872 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_04480 21725 24013 gene locus_tag LOCUS_04490 21725 24013 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_04490 24129 24899 gene locus_tag LOCUS_04500 24129 24899 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_04500 24954 25766 gene locus_tag LOCUS_04510 24954 25766 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_04510 25840 27021 gene locus_tag LOCUS_04520 25840 27021 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_04520 27237 27680 gene locus_tag LOCUS_04530 27237 27680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 27680 28183 gene locus_tag LOCUS_04540 27680 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 29760 28195 gene locus_tag LOCUS_04550 29760 28195 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_04550 30356 29760 gene locus_tag LOCUS_04560 30356 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 32892 30490 gene locus_tag LOCUS_04570 32892 30490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 34049 32961 gene locus_tag LOCUS_04580 34049 32961 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527983.1 protein_id gnl|my_center|LOCUS_04580 34333 34776 gene locus_tag LOCUS_04590 34333 34776 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_04590 35216 34824 gene locus_tag LOCUS_04600 35216 34824 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_04600 35343 36134 gene locus_tag LOCUS_04610 35343 36134 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086215.1 protein_id gnl|my_center|LOCUS_04610 36142 38325 gene locus_tag LOCUS_04620 gene iorA 36142 38325 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_04620 38322 39923 gene locus_tag LOCUS_04630 38322 39923 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_04630 41192 40008 gene locus_tag LOCUS_04640 gene gcdH 41192 40008 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_04640 42125 41415 gene locus_tag LOCUS_04650 42125 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 42406 42173 gene locus_tag LOCUS_04660 42406 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 43432 42518 gene locus_tag LOCUS_04670 gene secF 43432 42518 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_04670 45287 43443 gene locus_tag LOCUS_04680 gene secD 45287 43443 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_04680 46576 45386 gene locus_tag LOCUS_04690 gene tgt 46576 45386 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_04690 47619 46573 gene locus_tag LOCUS_04700 gene queA 47619 46573 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L6W9 protein_id gnl|my_center|LOCUS_04700 47985 48071 gene locus_tag LOCUS_t00090 47985 48071 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 357 668 gene locus_tag LOCUS_04710 gene rpsJ 357 668 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X2 protein_id gnl|my_center|LOCUS_04710 778 1413 gene locus_tag LOCUS_04720 gene rplC 778 1413 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY4 protein_id gnl|my_center|LOCUS_04720 1426 2040 gene locus_tag LOCUS_04730 gene rplD 1426 2040 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF22 protein_id gnl|my_center|LOCUS_04730 2037 2333 gene locus_tag LOCUS_04740 gene rplW 2037 2333 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_04740 2344 3165 gene locus_tag LOCUS_04750 gene rplB 2344 3165 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_04750 3202 3477 gene locus_tag LOCUS_04760 gene rpsS 3202 3477 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP8 protein_id gnl|my_center|LOCUS_04760 3489 3827 gene locus_tag LOCUS_04770 gene rplV 3489 3827 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_04770 3851 4534 gene locus_tag LOCUS_04780 gene rpsC 3851 4534 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_04780 4547 4960 gene locus_tag LOCUS_04790 gene rplP 4547 4960 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_04790 4963 5154 gene locus_tag LOCUS_04800 gene rpmC 4963 5154 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_04800 5157 5423 gene locus_tag LOCUS_04810 gene rpsQ 5157 5423 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_04810 5457 5825 gene locus_tag LOCUS_04820 gene rplN 5457 5825 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE5 protein_id gnl|my_center|LOCUS_04820 5840 6163 gene locus_tag LOCUS_04830 gene rplX 5840 6163 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_04830 6180 6719 gene locus_tag LOCUS_04840 gene rplE 6180 6719 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_04840 6732 7037 gene locus_tag LOCUS_04850 gene rpsN 6732 7037 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_04850 7057 7449 gene locus_tag LOCUS_04860 gene rpsH 7057 7449 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V7 protein_id gnl|my_center|LOCUS_04860 7462 7995 gene locus_tag LOCUS_04870 gene rplF 7462 7995 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_04870 8008 8358 gene locus_tag LOCUS_04880 gene rplR 8008 8358 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_04880 8371 8877 gene locus_tag LOCUS_04890 gene rpsE 8371 8877 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_04890 8916 9110 gene locus_tag LOCUS_04900 gene rpmD 8916 9110 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ14 protein_id gnl|my_center|LOCUS_04900 9112 9546 gene locus_tag LOCUS_04910 gene rplO 9112 9546 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02413 protein_id gnl|my_center|LOCUS_04910 9549 10868 gene locus_tag LOCUS_04920 gene secY 9549 10868 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V1 protein_id gnl|my_center|LOCUS_04920 11106 11462 gene locus_tag LOCUS_04930 gene rpsM 11106 11462 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ10 protein_id gnl|my_center|LOCUS_04930 11478 11870 gene locus_tag LOCUS_04940 gene rpsK 11478 11870 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR6 protein_id gnl|my_center|LOCUS_04940 11883 12503 gene locus_tag LOCUS_04950 gene rpsD 11883 12503 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_04950 12529 13524 gene locus_tag LOCUS_04960 gene rpoA 12529 13524 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_04960 13601 13999 gene locus_tag LOCUS_04970 gene rplQ 13601 13999 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_04970 16173 14128 gene locus_tag LOCUS_04980 gene pepO 16173 14128 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 protein_id gnl|my_center|LOCUS_04980 17033 16215 gene locus_tag LOCUS_04990 gene apaH 17033 16215 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_04990 17408 17034 gene locus_tag LOCUS_05000 gene apaG 17408 17034 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_05000 18205 17405 gene locus_tag LOCUS_05010 gene rsmA 18205 17405 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A46 protein_id gnl|my_center|LOCUS_05010 19195 18209 gene locus_tag LOCUS_05020 gene pdxA1 19195 18209 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_05020 20496 19192 gene locus_tag LOCUS_05030 gene surA 20496 19192 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_05030 23062 20474 gene locus_tag LOCUS_05040 gene lptD 23062 20474 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A43 protein_id gnl|my_center|LOCUS_05040 23432 24391 gene locus_tag LOCUS_05050 23432 24391 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946057.1 protein_id gnl|my_center|LOCUS_05050 24388 25062 gene locus_tag LOCUS_05060 24388 25062 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_05060 25130 25480 gene locus_tag LOCUS_05070 25130 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 25473 25703 gene locus_tag LOCUS_05080 25473 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 25703 27091 gene locus_tag LOCUS_05090 25703 27091 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_05090 28635 27589 gene locus_tag LOCUS_05100 gene holA 28635 27589 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_05100 29243 28638 gene locus_tag LOCUS_05110 29243 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 31887 29278 gene locus_tag LOCUS_05120 gene leuS 31887 29278 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN87 protein_id gnl|my_center|LOCUS_05120 32075 32611 gene locus_tag LOCUS_05130 32075 32611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_05130 33148 32621 gene locus_tag LOCUS_05140 33148 32621 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_05140 34692 33184 gene locus_tag LOCUS_05150 gene lnt 34692 33184 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZI86 protein_id gnl|my_center|LOCUS_05150 35528 34689 gene locus_tag LOCUS_05160 35528 34689 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 protein_id gnl|my_center|LOCUS_05160 36025 35531 gene locus_tag LOCUS_05170 gene ybeY 36025 35531 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_05170 37209 36037 gene locus_tag LOCUS_05180 37209 36037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 38690 37344 gene locus_tag LOCUS_05190 gene miaB 38690 37344 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_05190 38857 39204 gene locus_tag LOCUS_05200 38857 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_05200 39328 40812 gene locus_tag LOCUS_05210 gene gspE 39328 40812 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_05210 40828 42036 gene locus_tag LOCUS_05220 gene gspF 40828 42036 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947093.1 protein_id gnl|my_center|LOCUS_05220 42373 42798 gene locus_tag LOCUS_05230 42373 42798 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_05230 42800 43345 gene locus_tag LOCUS_05240 42800 43345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 43342 43743 gene locus_tag LOCUS_05250 43342 43743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 43743 44459 gene locus_tag LOCUS_05260 gene epsJ 43743 44459 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45776 protein_id gnl|my_center|LOCUS_05260 44449 45651 gene locus_tag LOCUS_05270 gene xcpX 44449 45651 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_05270 45821 46855 gene locus_tag LOCUS_05280 45821 46855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence011 2054 33 gene locus_tag LOCUS_05290 gene metG 2054 33 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_05290 2228 3031 gene locus_tag LOCUS_05300 2228 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3173 4402 gene locus_tag LOCUS_05310 3173 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4636 5202 gene locus_tag LOCUS_05320 gene dcd 4636 5202 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_05320 5542 6183 gene locus_tag LOCUS_05330 5542 6183 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_05330 6973 6128 gene locus_tag LOCUS_05340 6973 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_05340 7695 6970 gene locus_tag LOCUS_05350 7695 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_05350 8582 7902 gene locus_tag LOCUS_05360 gene purN 8582 7902 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM25 protein_id gnl|my_center|LOCUS_05360 9634 8582 gene locus_tag LOCUS_05370 gene purM 9634 8582 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_05370 9752 10798 gene locus_tag LOCUS_05380 9752 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_05380 10795 11499 gene locus_tag LOCUS_05390 10795 11499 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_05390 13402 11552 gene locus_tag LOCUS_05400 gene sppA 13402 11552 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_05400 13923 13513 gene locus_tag LOCUS_05410 13923 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14515 13925 gene locus_tag LOCUS_05420 14515 13925 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_05420 14859 14515 gene locus_tag LOCUS_05430 14859 14515 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_05430 14939 16228 gene locus_tag LOCUS_05440 14939 16228 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_05440 16253 16717 gene locus_tag LOCUS_05450 16253 16717 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268596.1 protein_id gnl|my_center|LOCUS_05450 16845 18263 gene locus_tag LOCUS_05460 16845 18263 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066637.1 protein_id gnl|my_center|LOCUS_05460 19168 18329 gene locus_tag LOCUS_05470 19168 18329 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_05470 20495 19212 gene locus_tag LOCUS_05480 20495 19212 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_05480 20692 21087 gene locus_tag LOCUS_05490 20692 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21084 22997 gene locus_tag LOCUS_05500 21084 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_05500 23138 24013 gene locus_tag LOCUS_05510 23138 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 24061 25104 gene locus_tag LOCUS_05520 24061 25104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_05520 26012 25209 gene locus_tag LOCUS_05530 gene suhB 26012 25209 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 protein_id gnl|my_center|LOCUS_05530 26173 26916 gene locus_tag LOCUS_05540 gene trmJ 26173 26916 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A4 protein_id gnl|my_center|LOCUS_05540 27111 27548 gene locus_tag LOCUS_05550 27111 27548 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_05550 27563 28777 gene locus_tag LOCUS_05560 gene iscS 27563 28777 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ32 protein_id gnl|my_center|LOCUS_05560 28843 29226 gene locus_tag LOCUS_05570 gene iscU 28843 29226 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_05570 29236 29559 gene locus_tag LOCUS_05580 gene iscA 29236 29559 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ0 protein_id gnl|my_center|LOCUS_05580 29693 30199 gene locus_tag LOCUS_05590 gene hscB 29693 30199 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCS4 protein_id gnl|my_center|LOCUS_05590 30203 32074 gene locus_tag LOCUS_05600 gene hscA 30203 32074 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP83 protein_id gnl|my_center|LOCUS_05600 32074 32412 gene locus_tag LOCUS_05610 gene fdx 32074 32412 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_05610 32499 32696 gene locus_tag LOCUS_05620 32499 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_05620 32753 34684 gene locus_tag LOCUS_05630 32753 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 34822 35247 gene locus_tag LOCUS_05640 gene ndk 34822 35247 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_05640 35339 36517 gene locus_tag LOCUS_05650 gene rlmN 35339 36517 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_05650 36764 37402 gene locus_tag LOCUS_05660 gene pilF 36764 37402 CDS product type 4 fimbrial biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 37424 38548 gene locus_tag LOCUS_05670 gene ispG 37424 38548 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_05670 38604 39878 gene locus_tag LOCUS_05680 gene hisS 38604 39878 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_05680 39888 40601 gene locus_tag LOCUS_05690 39888 40601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_05690 40598 41740 gene locus_tag LOCUS_05700 gene bamB 40598 41740 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_05700 41886 42527 gene locus_tag LOCUS_05710 41886 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_05710 42551 43147 gene locus_tag LOCUS_05720 42551 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 43251 44654 gene locus_tag LOCUS_05730 gene der 43251 44654 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_05730 >Feature sequence012 2896 104 gene locus_tag LOCUS_05740 2896 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2991 4820 gene locus_tag LOCUS_05750 2991 4820 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 protein_id gnl|my_center|LOCUS_05750 4842 6788 gene locus_tag LOCUS_05760 4842 6788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_05760 6903 7406 gene locus_tag LOCUS_05770 6903 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7424 8092 gene locus_tag LOCUS_05780 7424 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8192 8908 gene locus_tag LOCUS_05790 8192 8908 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890736.1 protein_id gnl|my_center|LOCUS_05790 8983 9699 gene locus_tag LOCUS_05800 8983 9699 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 protein_id gnl|my_center|LOCUS_05800 9696 10007 gene locus_tag LOCUS_05810 9696 10007 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 protein_id gnl|my_center|LOCUS_05810 10209 11351 gene locus_tag LOCUS_05820 10209 11351 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_05820 12310 11558 gene locus_tag LOCUS_05830 12310 11558 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_05830 12882 12310 gene locus_tag LOCUS_05840 12882 12310 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_05840 13971 12940 gene locus_tag LOCUS_05850 13971 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 13876 14193 gene locus_tag LOCUS_05860 13876 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15037 14207 gene locus_tag LOCUS_05870 gene tauD 15037 14207 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_05870 15663 15274 gene locus_tag LOCUS_05880 15663 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311710.1 protein_id gnl|my_center|LOCUS_05880 16756 15866 gene locus_tag LOCUS_05890 16756 15866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_05890 16928 18346 gene locus_tag LOCUS_05900 16928 18346 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919351.1 protein_id gnl|my_center|LOCUS_05900 18485 21778 gene locus_tag LOCUS_05910 gene mcm 18485 21778 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_05910 21965 22582 gene locus_tag LOCUS_05920 gene acrR 21965 22582 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225938.1 protein_id gnl|my_center|LOCUS_05920 22697 23242 gene locus_tag LOCUS_05930 22697 23242 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_05930 23239 25443 gene locus_tag LOCUS_05940 23239 25443 CDS product exported oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_05940 25590 26510 gene locus_tag LOCUS_05950 25590 26510 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_05950 26510 27088 gene locus_tag LOCUS_05960 26510 27088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 27275 28501 gene locus_tag LOCUS_05970 gene gluP 27275 28501 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 protein_id gnl|my_center|LOCUS_05970 30323 28908 gene locus_tag LOCUS_05980 gene ilvC 30323 28908 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_05980 30539 31420 gene locus_tag LOCUS_05990 gene ilvY 30539 31420 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 protein_id gnl|my_center|LOCUS_05990 31577 32005 gene locus_tag LOCUS_06000 31577 32005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 32081 32377 gene locus_tag LOCUS_06010 32081 32377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 32505 33035 gene locus_tag LOCUS_06020 32505 33035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 34142 33063 gene locus_tag LOCUS_06030 34142 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 34404 36023 gene locus_tag LOCUS_06040 34404 36023 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_06040 36332 37561 gene locus_tag LOCUS_06050 36332 37561 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_06050 37954 39525 gene locus_tag LOCUS_06060 37954 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 40224 40581 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattgagttaggctcgccgttagcgtcagtgtca >Feature sequence013 434 159 gene locus_tag LOCUS_06070 434 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2589 517 gene locus_tag LOCUS_06080 2589 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4261 2831 gene locus_tag LOCUS_06090 4261 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5467 4265 gene locus_tag LOCUS_06100 5467 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6070 5483 gene locus_tag LOCUS_06110 6070 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 7650 6316 gene locus_tag LOCUS_06120 7650 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7946 9139 gene locus_tag LOCUS_06130 7946 9139 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809576.1 protein_id gnl|my_center|LOCUS_06130 9211 10326 gene locus_tag LOCUS_06140 gene agxT 9211 10326 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_06140 11792 10419 gene locus_tag LOCUS_06150 11792 10419 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_06150 12739 11789 gene locus_tag LOCUS_06160 12739 11789 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_06160 14283 12814 gene locus_tag LOCUS_06170 gene nhaC 14283 12814 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 protein_id gnl|my_center|LOCUS_06170 14784 14362 gene locus_tag LOCUS_06180 14784 14362 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_06180 14922 16097 gene locus_tag LOCUS_06190 14922 16097 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545474.1 protein_id gnl|my_center|LOCUS_06190 17495 16131 gene locus_tag LOCUS_06200 17495 16131 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 protein_id gnl|my_center|LOCUS_06200 17888 20188 gene locus_tag LOCUS_06210 17888 20188 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_06210 20375 22393 gene locus_tag LOCUS_06220 20375 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_06220 22510 23874 gene locus_tag LOCUS_06230 gene spuI 22510 23874 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_06230 24467 23931 gene locus_tag LOCUS_06240 24467 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_06240 26821 24587 gene locus_tag LOCUS_06250 gene priA 26821 24587 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V04 protein_id gnl|my_center|LOCUS_06250 26966 27175 gene locus_tag LOCUS_06260 gene rpmE 26966 27175 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Z0 protein_id gnl|my_center|LOCUS_06260 27379 27627 gene locus_tag LOCUS_06270 27379 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 27635 28327 gene locus_tag LOCUS_06280 gene pyrF 27635 28327 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z6 protein_id gnl|my_center|LOCUS_06280 29540 28380 gene locus_tag LOCUS_06290 29540 28380 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_06290 29773 30759 gene locus_tag LOCUS_06300 29773 30759 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_06300 31617 30775 gene locus_tag LOCUS_06310 gene rlmJ 31617 30775 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XW91 protein_id gnl|my_center|LOCUS_06310 32944 31778 gene locus_tag LOCUS_06320 32944 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 33274 32975 gene locus_tag LOCUS_06330 33274 32975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 33465 34631 gene locus_tag LOCUS_06340 33465 34631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 35230 34847 gene locus_tag LOCUS_06350 35230 34847 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106301.1 protein_id gnl|my_center|LOCUS_06350 35564 37009 gene locus_tag LOCUS_06360 35564 37009 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339202.1 protein_id gnl|my_center|LOCUS_06360 37461 38558 gene locus_tag LOCUS_06370 37461 38558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 38987 40405 gene locus_tag LOCUS_06380 38987 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence014 668 1054 gene locus_tag LOCUS_06390 gene gcvH 668 1054 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_06390 1855 1199 gene locus_tag LOCUS_06400 1855 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_06400 1991 2491 gene locus_tag LOCUS_06410 gene rppH 1991 2491 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU53 protein_id gnl|my_center|LOCUS_06410 2494 4806 gene locus_tag LOCUS_06420 gene ptsP 2494 4806 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_06420 5581 4796 gene locus_tag LOCUS_06430 5581 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_06430 5686 6528 gene locus_tag LOCUS_06440 gene lgt 5686 6528 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL3 protein_id gnl|my_center|LOCUS_06440 6539 7444 gene locus_tag LOCUS_06450 gene thyA 6539 7444 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC7 protein_id gnl|my_center|LOCUS_06450 7464 7967 gene locus_tag LOCUS_06460 7464 7967 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG76 protein_id gnl|my_center|LOCUS_06460 8158 8940 gene locus_tag LOCUS_06470 8158 8940 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_06470 8937 10307 gene locus_tag LOCUS_06480 gene ttpC 8937 10307 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_06480 10309 10833 gene locus_tag LOCUS_06490 gene exbB 10309 10833 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_06490 10874 11278 gene locus_tag LOCUS_06500 10874 11278 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_06500 11289 11897 gene locus_tag LOCUS_06510 11289 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11908 13275 gene locus_tag LOCUS_06520 11908 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_06520 15209 13416 gene locus_tag LOCUS_06530 gene ilvD 15209 13416 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_06530 16657 15335 gene locus_tag LOCUS_06540 gene argA 16657 15335 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_06540 17786 16665 gene locus_tag LOCUS_06550 gene argE 17786 16665 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_06550 17909 19696 gene locus_tag LOCUS_06560 17909 19696 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_06560 19714 22725 gene locus_tag LOCUS_06570 gene glnE 19714 22725 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_06570 22796 23725 gene locus_tag LOCUS_06580 gene ilvE 22796 23725 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_06580 23753 24481 gene locus_tag LOCUS_06590 23753 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_06590 25356 24550 gene locus_tag LOCUS_06600 25356 24550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 27470 25413 gene locus_tag LOCUS_06610 27470 25413 CDS product phosphoglycerol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 protein_id gnl|my_center|LOCUS_06610 27736 28956 gene locus_tag LOCUS_06620 gene waaA 27736 28956 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_06620 30481 29087 gene locus_tag LOCUS_06630 gene tolC 30481 29087 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_06630 30732 31346 gene locus_tag LOCUS_06640 gene nudF 30732 31346 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262653.1 protein_id gnl|my_center|LOCUS_06640 31413 31859 gene locus_tag LOCUS_06650 31413 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_06650 31909 32694 gene locus_tag LOCUS_06660 gene cpdA 31909 32694 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQJ3 protein_id gnl|my_center|LOCUS_06660 32938 33420 gene locus_tag LOCUS_06670 32938 33420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 33426 35318 gene locus_tag LOCUS_06680 gene parE 33426 35318 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_06680 35392 37653 gene locus_tag LOCUS_06690 gene parC 35392 37653 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH6 protein_id gnl|my_center|LOCUS_06690 37709 38518 gene locus_tag LOCUS_06700 37709 38518 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_06700 38730 39221 gene locus_tag LOCUS_06710 38730 39221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 39270 40448 gene locus_tag LOCUS_06720 39270 40448 CDS product heme transporter CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence015 86 832 gene locus_tag LOCUS_06730 gene pdxJ 86 832 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_06730 836 1753 gene locus_tag LOCUS_06740 836 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958357.1 protein_id gnl|my_center|LOCUS_06740 1786 2562 gene locus_tag LOCUS_06750 gene yjfH 1786 2562 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_06750 3757 2549 gene locus_tag LOCUS_06760 3757 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4072 3836 gene locus_tag LOCUS_06770 4072 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4524 4099 gene locus_tag LOCUS_06780 4524 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_06780 6618 4585 gene locus_tag LOCUS_06790 gene ligA 6618 4585 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL9 protein_id gnl|my_center|LOCUS_06790 7471 6635 gene locus_tag LOCUS_06800 gene zipA 7471 6635 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_06800 11071 7574 gene locus_tag LOCUS_06810 gene smc 11071 7574 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_06810 12549 11266 gene locus_tag LOCUS_06820 gene cycH 12549 11266 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_06820 13058 12549 gene locus_tag LOCUS_06830 13058 12549 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_06830 13590 13048 gene locus_tag LOCUS_06840 gene dsbE 13590 13048 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_06840 15617 13587 gene locus_tag LOCUS_06850 gene ccmF 15617 13587 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_06850 16075 15614 gene locus_tag LOCUS_06860 gene ccmE 16075 15614 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_06860 16293 16075 gene locus_tag LOCUS_06870 16293 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 17093 16296 gene locus_tag LOCUS_06880 gene ccmC 17093 16296 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_06880 17811 17116 gene locus_tag LOCUS_06890 gene ccmB 17811 17116 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI32 protein_id gnl|my_center|LOCUS_06890 18452 17811 gene locus_tag LOCUS_06900 gene ccmA 18452 17811 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI31 protein_id gnl|my_center|LOCUS_06900 18804 18628 gene locus_tag LOCUS_06910 18804 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 19161 19769 gene locus_tag LOCUS_06920 gene msrA 19161 19769 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_06920 20788 19880 gene locus_tag LOCUS_06930 20788 19880 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 protein_id gnl|my_center|LOCUS_06930 21145 21825 gene locus_tag LOCUS_06940 gene fnr 21145 21825 CDS product fumarate and nitrate reduction regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE82 protein_id gnl|my_center|LOCUS_06940 21919 22200 gene locus_tag LOCUS_06950 gene ppiC 21919 22200 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329269.1 protein_id gnl|my_center|LOCUS_06950 22425 23669 gene locus_tag LOCUS_06960 gene cca 22425 23669 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZI64 protein_id gnl|my_center|LOCUS_06960 23676 24422 gene locus_tag LOCUS_06970 gene ptr1 23676 24422 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_06970 24397 24615 gene locus_tag LOCUS_06980 24397 24615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 25279 24605 gene locus_tag LOCUS_06990 25279 24605 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710077.1 protein_id gnl|my_center|LOCUS_06990 25897 25382 gene locus_tag LOCUS_07000 gene folK-2 25897 25382 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_07000 26253 25897 gene locus_tag LOCUS_07010 gene folB 26253 25897 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_07010 27293 26253 gene locus_tag LOCUS_07020 gene ygjD 27293 26253 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_07020 27550 27765 gene locus_tag LOCUS_07030 gene rpsU 27550 27765 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF3 protein_id gnl|my_center|LOCUS_07030 27876 28322 gene locus_tag LOCUS_07040 27876 28322 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_07040 28397 30394 gene locus_tag LOCUS_07050 gene dnaG 28397 30394 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_07050 30506 32344 gene locus_tag LOCUS_07060 gene rpoD 30506 32344 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_07060 32626 32702 gene locus_tag LOCUS_t00100 32626 32702 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33027 33644 gene locus_tag LOCUS_07070 33027 33644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 35754 33688 gene locus_tag LOCUS_07080 35754 33688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35925 38219 gene locus_tag LOCUS_07090 35925 38219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_07090 39955 38279 gene locus_tag LOCUS_07100 gene phoA 39955 38279 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_07100 40232 40095 gene locus_tag LOCUS_07110 40232 40095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence016 2043 604 gene locus_tag LOCUS_07120 gene lpdG 2043 604 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_07120 3272 2076 gene locus_tag LOCUS_07130 gene sucB 3272 2076 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_07130 6180 3343 gene locus_tag LOCUS_07140 gene sucA 6180 3343 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_07140 7029 6325 gene locus_tag LOCUS_07150 gene sdhB 7029 6325 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_07150 8819 7047 gene locus_tag LOCUS_07160 gene sdhA 8819 7047 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_07160 9192 8824 gene locus_tag LOCUS_07170 9192 8824 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 protein_id gnl|my_center|LOCUS_07170 9569 9186 gene locus_tag LOCUS_07180 gene sdhC 9569 9186 CDS product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_07180 10052 11338 gene locus_tag LOCUS_07190 gene gltA 10052 11338 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A2 protein_id gnl|my_center|LOCUS_07190 12023 11418 gene locus_tag LOCUS_07200 12023 11418 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_07200 12779 12198 gene locus_tag LOCUS_07210 gene nfuA 12779 12198 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_07210 13003 16671 gene locus_tag LOCUS_07220 gene metH 13003 16671 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_07220 18138 16993 gene locus_tag LOCUS_07230 18138 16993 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_07230 20329 18188 gene locus_tag LOCUS_07240 20329 18188 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_07240 21570 20362 gene locus_tag LOCUS_07250 gene fadA 21570 20362 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_07250 21753 22784 gene locus_tag LOCUS_07260 21753 22784 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 protein_id gnl|my_center|LOCUS_07260 22937 23929 gene locus_tag LOCUS_07270 22937 23929 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969985.1 protein_id gnl|my_center|LOCUS_07270 25639 23939 gene locus_tag LOCUS_07280 25639 23939 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_07280 27292 25733 gene locus_tag LOCUS_07290 27292 25733 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919833.1 protein_id gnl|my_center|LOCUS_07290 28517 27345 gene locus_tag LOCUS_07300 28517 27345 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_07300 29007 30179 gene locus_tag LOCUS_07310 29007 30179 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_07310 30317 32668 gene locus_tag LOCUS_07320 gene fyuA 30317 32668 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_07320 32762 33952 gene locus_tag LOCUS_07330 32762 33952 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266325.1 protein_id gnl|my_center|LOCUS_07330 34127 35266 gene locus_tag LOCUS_07340 34127 35266 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_07340 35315 35521 gene locus_tag LOCUS_07350 35315 35521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 36059 36406 gene locus_tag LOCUS_07360 36059 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 36403 37068 gene locus_tag LOCUS_07370 36403 37068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 37098 37466 gene locus_tag LOCUS_07380 37098 37466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 37566 37802 gene locus_tag LOCUS_07390 37566 37802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence017 1918 3498 gene locus_tag LOCUS_07400 1918 3498 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_07400 3638 4825 gene locus_tag LOCUS_07410 3638 4825 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_07410 4882 6069 gene locus_tag LOCUS_07420 4882 6069 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919188.1 protein_id gnl|my_center|LOCUS_07420 6120 6881 gene locus_tag LOCUS_07430 6120 6881 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085812.1 protein_id gnl|my_center|LOCUS_07430 6948 7718 gene locus_tag LOCUS_07440 6948 7718 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_07440 7722 8921 gene locus_tag LOCUS_07450 7722 8921 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_07450 9799 8993 gene locus_tag LOCUS_07460 9799 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10998 9796 gene locus_tag LOCUS_07470 10998 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 11342 11028 gene locus_tag LOCUS_07480 11342 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 11821 11384 gene locus_tag LOCUS_07490 11821 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 12420 11980 gene locus_tag LOCUS_07500 12420 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL25 protein_id gnl|my_center|LOCUS_07500 12661 13677 gene locus_tag LOCUS_07510 12661 13677 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_07510 13948 13709 gene locus_tag LOCUS_07520 13948 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 13942 14871 gene locus_tag LOCUS_07530 13942 14871 CDS product putative lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700832.1 protein_id gnl|my_center|LOCUS_07530 15316 14885 gene locus_tag LOCUS_07540 15316 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 15717 15364 gene locus_tag LOCUS_07550 15717 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16219 15806 gene locus_tag LOCUS_07560 16219 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 16408 17418 gene locus_tag LOCUS_07570 16408 17418 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_07570 17451 18230 gene locus_tag LOCUS_07580 17451 18230 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_07580 18270 18683 gene locus_tag LOCUS_07590 18270 18683 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 protein_id gnl|my_center|LOCUS_07590 18875 19135 gene locus_tag LOCUS_07600 18875 19135 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 protein_id gnl|my_center|LOCUS_07600 19418 19161 gene locus_tag LOCUS_07610 19418 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 20541 19525 gene locus_tag LOCUS_07620 20541 19525 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_07620 20939 20550 gene locus_tag LOCUS_07630 20939 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 22339 20957 gene locus_tag LOCUS_07640 22339 20957 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_07640 23508 22366 gene locus_tag LOCUS_07650 23508 22366 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728242.1 protein_id gnl|my_center|LOCUS_07650 23943 23512 gene locus_tag LOCUS_07660 23943 23512 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_07660 25383 23986 gene locus_tag LOCUS_07670 gene acoD 25383 23986 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK1 protein_id gnl|my_center|LOCUS_07670 26880 25399 gene locus_tag LOCUS_07680 gene acoC 26880 25399 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK0 protein_id gnl|my_center|LOCUS_07680 27944 26883 gene locus_tag LOCUS_07690 gene acoB 27944 26883 CDS product acetoin catabolism protein AcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_07690 28926 27955 gene locus_tag LOCUS_07700 gene acoA 28926 27955 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_07700 29722 29402 gene locus_tag LOCUS_07710 gene fdxB 29722 29402 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_07710 31005 29776 gene locus_tag LOCUS_07720 31005 29776 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_07720 31536 31231 gene locus_tag LOCUS_07730 31536 31231 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 protein_id gnl|my_center|LOCUS_07730 32632 31553 gene locus_tag LOCUS_07740 gene ctaA 32632 31553 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA28 protein_id gnl|my_center|LOCUS_07740 33948 32680 gene locus_tag LOCUS_07750 33948 32680 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_07750 34117 34767 gene locus_tag LOCUS_07760 gene ung 34117 34767 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_07760 34898 34662 gene locus_tag LOCUS_07770 34898 34662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence018 687 109 gene locus_tag LOCUS_07780 687 109 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_07780 808 2055 gene locus_tag LOCUS_07790 808 2055 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_07790 2271 2086 gene locus_tag LOCUS_07800 2271 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2971 2483 gene locus_tag LOCUS_07810 gene aspG 2971 2483 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_07810 4305 2971 gene locus_tag LOCUS_07820 gene pepQ 4305 2971 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S9 protein_id gnl|my_center|LOCUS_07820 5795 4416 gene locus_tag LOCUS_07830 5795 4416 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_07830 9378 6163 gene locus_tag LOCUS_07840 9378 6163 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_07840 10523 9378 gene locus_tag LOCUS_07850 10523 9378 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_07850 10735 11388 gene locus_tag LOCUS_07860 10735 11388 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_07860 11385 12044 gene locus_tag LOCUS_07870 gene chrR 11385 12044 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_07870 12256 13920 gene locus_tag LOCUS_07880 12256 13920 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_07880 13930 14361 gene locus_tag LOCUS_07890 13930 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635573.2 protein_id gnl|my_center|LOCUS_07890 15256 14417 gene locus_tag LOCUS_07900 15256 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 16297 15578 gene locus_tag LOCUS_07910 16297 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 16683 16360 gene locus_tag LOCUS_07920 16683 16360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 16944 18254 gene locus_tag LOCUS_07930 16944 18254 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_07930 18494 19345 gene locus_tag LOCUS_07940 18494 19345 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_07940 20236 19346 gene locus_tag LOCUS_07950 gene btuF 20236 19346 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_07950 21009 20236 gene locus_tag LOCUS_07960 gene hmuV 21009 20236 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_07960 22047 21013 gene locus_tag LOCUS_07970 22047 21013 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882731.1 protein_id gnl|my_center|LOCUS_07970 22662 22048 gene locus_tag LOCUS_07980 22662 22048 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388207.1 protein_id gnl|my_center|LOCUS_07980 23599 22682 gene locus_tag LOCUS_07990 23599 22682 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_07990 24294 23596 gene locus_tag LOCUS_08000 24294 23596 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_08000 26250 24295 gene locus_tag LOCUS_08010 26250 24295 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 protein_id gnl|my_center|LOCUS_08010 26740 27024 gene locus_tag LOCUS_08020 26740 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 28554 27181 gene locus_tag LOCUS_08030 gene radA 28554 27181 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_08030 28683 29189 gene locus_tag LOCUS_08040 28683 29189 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_08040 29211 29891 gene locus_tag LOCUS_08050 29211 29891 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_08050 30013 31221 gene locus_tag LOCUS_08060 30013 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 31133 31798 gene locus_tag LOCUS_08070 31133 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 31948 33717 gene locus_tag LOCUS_08080 gene aceK 31948 33717 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_08080 34248 33730 gene locus_tag LOCUS_08090 34248 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence019 1393 629 gene locus_tag LOCUS_08100 1393 629 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920654.1 protein_id gnl|my_center|LOCUS_08100 2840 1533 gene locus_tag LOCUS_08110 2840 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932690.1 protein_id gnl|my_center|LOCUS_08110 4051 2840 gene locus_tag LOCUS_08120 gene uxuA 4051 2840 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2M8 protein_id gnl|my_center|LOCUS_08120 7148 4149 gene locus_tag LOCUS_08130 7148 4149 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 protein_id gnl|my_center|LOCUS_08130 8146 7670 gene locus_tag LOCUS_08140 gene greA 8146 7670 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS95 protein_id gnl|my_center|LOCUS_08140 11328 8146 gene locus_tag LOCUS_08150 gene carB 11328 8146 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_08150 12524 11382 gene locus_tag LOCUS_08160 gene carA 12524 11382 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS6 protein_id gnl|my_center|LOCUS_08160 13583 12780 gene locus_tag LOCUS_08170 gene dapB 13583 12780 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_08170 14792 13668 gene locus_tag LOCUS_08180 gene dnaJ 14792 13668 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_08180 16826 14883 gene locus_tag LOCUS_08190 gene dnaK 16826 14883 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP7 protein_id gnl|my_center|LOCUS_08190 17534 16965 gene locus_tag LOCUS_08200 gene grpE 17534 16965 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP6 protein_id gnl|my_center|LOCUS_08200 17735 19411 gene locus_tag LOCUS_08210 gene recN 17735 19411 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_08210 20569 19562 gene locus_tag LOCUS_08220 20569 19562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_08220 20801 21721 gene locus_tag LOCUS_08230 20801 21721 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_08230 21751 22929 gene locus_tag LOCUS_08240 gene ltp1 21751 22929 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_08240 22951 23394 gene locus_tag LOCUS_08250 22951 23394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702790.1 protein_id gnl|my_center|LOCUS_08250 23444 23845 gene locus_tag LOCUS_08260 gene maoC 23444 23845 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_08260 23901 25049 gene locus_tag LOCUS_08270 gene acadL 23901 25049 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_08270 25140 26816 gene locus_tag LOCUS_08280 25140 26816 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_08280 27298 27768 gene locus_tag LOCUS_08290 27298 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 28527 28024 gene locus_tag LOCUS_08300 28527 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 protein_id gnl|my_center|LOCUS_08300 31167 29020 gene locus_tag LOCUS_08310 gene pnp 31167 29020 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_08310 31679 31410 gene locus_tag LOCUS_08320 gene rpsO 31679 31410 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU77 protein_id gnl|my_center|LOCUS_08320 32756 31815 gene locus_tag LOCUS_08330 gene truB 32756 31815 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBC4 protein_id gnl|my_center|LOCUS_08330 33232 32759 gene locus_tag LOCUS_08340 gene rbfA 33232 32759 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_08340 <34032 33245 gene locus_tag LOCUS_08350 <34032 33245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZBC2:translation initiation factor IF-2 >Feature sequence020 258 593 gene locus_tag LOCUS_08360 258 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 809 675 gene locus_tag LOCUS_08370 809 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 808 999 gene locus_tag LOCUS_08380 808 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1090 1287 gene locus_tag LOCUS_08390 1090 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1624 1534 gene locus_tag LOCUS_t00110 1624 1534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4669 1673 gene locus_tag LOCUS_08400 gene rne 4669 1673 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_08400 5285 6229 gene locus_tag LOCUS_08410 5285 6229 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_08410 6226 6888 gene locus_tag LOCUS_08420 6226 6888 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_08420 7487 6894 gene locus_tag LOCUS_08430 7487 6894 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 protein_id gnl|my_center|LOCUS_08430 7624 8142 gene locus_tag LOCUS_08440 7624 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_08440 8179 8358 gene locus_tag LOCUS_08450 gene rpmF 8179 8358 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN60 protein_id gnl|my_center|LOCUS_08450 8408 9409 gene locus_tag LOCUS_08460 gene plsX 8408 9409 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 protein_id gnl|my_center|LOCUS_08460 9423 10358 gene locus_tag LOCUS_08470 9423 10358 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH6 protein_id gnl|my_center|LOCUS_08470 10386 11129 gene locus_tag LOCUS_08480 gene fabG 10386 11129 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 protein_id gnl|my_center|LOCUS_08480 11293 11526 gene locus_tag LOCUS_08490 gene acpP 11293 11526 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH5 protein_id gnl|my_center|LOCUS_08490 11696 12550 gene locus_tag LOCUS_08500 gene pabC 11696 12550 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_08500 12544 13587 gene locus_tag LOCUS_08510 12544 13587 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267152.1 protein_id gnl|my_center|LOCUS_08510 13662 14288 gene locus_tag LOCUS_08520 gene tmk 13662 14288 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_08520 14288 15223 gene locus_tag LOCUS_08530 gene holB 14288 15223 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_08530 17206 15539 gene locus_tag LOCUS_08540 gene fhs 17206 15539 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ8 protein_id gnl|my_center|LOCUS_08540 17488 20007 gene locus_tag LOCUS_08550 17488 20007 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_08550 20138 21691 gene locus_tag LOCUS_08560 20138 21691 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_08560 21742 22440 gene locus_tag LOCUS_08570 gene mtbC 21742 22440 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 protein_id gnl|my_center|LOCUS_08570 22440 23078 gene locus_tag LOCUS_08580 22440 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975915.1 protein_id gnl|my_center|LOCUS_08580 23100 23411 gene locus_tag LOCUS_08590 23100 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_08590 23408 23878 gene locus_tag LOCUS_08600 23408 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 23875 24861 gene locus_tag LOCUS_08610 23875 24861 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P13 protein_id gnl|my_center|LOCUS_08610 24877 25770 gene locus_tag LOCUS_08620 24877 25770 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_08620 25777 27813 gene locus_tag LOCUS_08630 25777 27813 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530667.1 protein_id gnl|my_center|LOCUS_08630 27941 28924 gene locus_tag LOCUS_08640 gene gbdR 27941 28924 CDS product protein GbdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_08640 30023 29034 gene locus_tag LOCUS_08650 30023 29034 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709142.1 protein_id gnl|my_center|LOCUS_08650 30267 31517 gene locus_tag LOCUS_08660 gene soxB 30267 31517 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_08660 31561 31851 gene locus_tag LOCUS_08670 31561 31851 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316160.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence021 1373 165 gene locus_tag LOCUS_08680 1373 165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_08680 1691 2017 gene locus_tag LOCUS_08690 1691 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2127 2960 gene locus_tag LOCUS_08700 2127 2960 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769324.1 protein_id gnl|my_center|LOCUS_08700 3313 6147 gene locus_tag LOCUS_08710 3313 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6245 8224 gene locus_tag LOCUS_08720 6245 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_08720 8227 8850 gene locus_tag LOCUS_08730 8227 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9856 8867 gene locus_tag LOCUS_08740 9856 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 10028 11047 gene locus_tag LOCUS_08750 gene allD 10028 11047 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103966.1 protein_id gnl|my_center|LOCUS_08750 11971 11114 gene locus_tag LOCUS_08760 11971 11114 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268260.1 protein_id gnl|my_center|LOCUS_08760 12354 13799 gene locus_tag LOCUS_08770 12354 13799 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_08770 13813 14808 gene locus_tag LOCUS_08780 13813 14808 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_08780 14805 16337 gene locus_tag LOCUS_08790 14805 16337 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106258.1 protein_id gnl|my_center|LOCUS_08790 16563 18233 gene locus_tag LOCUS_08800 16563 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 protein_id gnl|my_center|LOCUS_08800 18239 18970 gene locus_tag LOCUS_08810 18239 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 19933 19013 gene locus_tag LOCUS_08820 19933 19013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_08820 20731 19943 gene locus_tag LOCUS_08830 20731 19943 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_08830 22266 20770 gene locus_tag LOCUS_08840 gene mmsA1 22266 20770 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_08840 23488 22331 gene locus_tag LOCUS_08850 23488 22331 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_08850 24259 26889 gene locus_tag LOCUS_08860 24259 26889 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706546.1 protein_id gnl|my_center|LOCUS_08860 27863 26886 gene locus_tag LOCUS_08870 27863 26886 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_08870 29205 28069 gene locus_tag LOCUS_08880 29205 28069 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_08880 29388 29573 gene locus_tag LOCUS_08890 29388 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 30234 29533 gene locus_tag LOCUS_08900 30234 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 33164 30237 gene locus_tag LOCUS_08910 33164 30237 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence022 1122 733 gene locus_tag LOCUS_08920 1122 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1482 1916 gene locus_tag LOCUS_08930 1482 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3265 1943 gene locus_tag LOCUS_08940 3265 1943 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_08940 4567 3416 gene locus_tag LOCUS_08950 4567 3416 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_08950 6157 4610 gene locus_tag LOCUS_08960 gene gpmI 6157 4610 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_08960 8171 6285 gene locus_tag LOCUS_08970 gene uup 8171 6285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_08970 10796 8193 gene locus_tag LOCUS_08980 10796 8193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_08980 11069 11491 gene locus_tag LOCUS_08990 11069 11491 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_08990 11635 12606 gene locus_tag LOCUS_09000 gene hprA 11635 12606 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_09000 14145 12883 gene locus_tag LOCUS_09010 gene pfp 14145 12883 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C58 protein_id gnl|my_center|LOCUS_09010 16805 14220 gene locus_tag LOCUS_09020 16805 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 16909 18324 gene locus_tag LOCUS_09030 gene mpl 16909 18324 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_09030 18807 18370 gene locus_tag LOCUS_09040 gene dtd 18807 18370 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_09040 19776 18817 gene locus_tag LOCUS_09050 19776 18817 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_09050 19901 20467 gene locus_tag LOCUS_09060 gene tag 19901 20467 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_09060 21121 20483 gene locus_tag LOCUS_09070 21121 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 21400 21269 gene locus_tag LOCUS_09080 21400 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 23496 21685 gene locus_tag LOCUS_09090 gene typA 23496 21685 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737390.1 protein_id gnl|my_center|LOCUS_09090 25690 23567 gene locus_tag LOCUS_09100 25690 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 26375 26109 gene locus_tag LOCUS_09110 26375 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 26782 28188 gene locus_tag LOCUS_09120 gene glnA 26782 28188 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_09120 28362 28871 gene locus_tag LOCUS_09130 28362 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 29142 30218 gene locus_tag LOCUS_09140 gene ntrB 29142 30218 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_09140 30220 31638 gene locus_tag LOCUS_09150 gene ntrC 30220 31638 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence023 701 369 gene locus_tag LOCUS_09160 701 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_09160 1449 724 gene locus_tag LOCUS_09170 gene cysH 1449 724 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_09170 1622 2239 gene locus_tag LOCUS_09180 gene thrH 1622 2239 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_09180 2307 3014 gene locus_tag LOCUS_09190 2307 3014 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_09190 3023 3589 gene locus_tag LOCUS_09200 3023 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_09200 5368 3722 gene locus_tag LOCUS_09210 5368 3722 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_09210 5622 6374 gene locus_tag LOCUS_09220 gene etfB 5622 6374 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039481.1 protein_id gnl|my_center|LOCUS_09220 6371 7300 gene locus_tag LOCUS_09230 gene etfA-2 6371 7300 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_09230 7970 7383 gene locus_tag LOCUS_09240 7970 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941384.1 protein_id gnl|my_center|LOCUS_09240 8422 8093 gene locus_tag LOCUS_09250 8422 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9194 8415 gene locus_tag LOCUS_09260 9194 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9801 9178 gene locus_tag LOCUS_09270 9801 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10775 9960 gene locus_tag LOCUS_09280 gene xthA 10775 9960 CDS product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_09280 13027 10778 gene locus_tag LOCUS_09290 gene prc 13027 10778 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_09290 13267 14544 gene locus_tag LOCUS_09300 13267 14544 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_09300 14658 15398 gene locus_tag LOCUS_09310 14658 15398 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267292.1 protein_id gnl|my_center|LOCUS_09310 16784 15441 gene locus_tag LOCUS_09320 gene glnA 16784 15441 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 protein_id gnl|my_center|LOCUS_09320 16916 18187 gene locus_tag LOCUS_09330 16916 18187 CDS product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_09330 18190 18819 gene locus_tag LOCUS_09340 18190 18819 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529812.1 protein_id gnl|my_center|LOCUS_09340 20237 18879 gene locus_tag LOCUS_09350 gene gor 20237 18879 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_09350 21655 20234 gene locus_tag LOCUS_09360 gene cysG 21655 20234 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_09360 23306 22029 gene locus_tag LOCUS_09370 gene serS 23306 22029 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 protein_id gnl|my_center|LOCUS_09370 23722 23351 gene locus_tag LOCUS_09380 gene crcB 23722 23351 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_09380 25053 23722 gene locus_tag LOCUS_09390 25053 23722 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 protein_id gnl|my_center|LOCUS_09390 25735 25043 gene locus_tag LOCUS_09400 gene lolA 25735 25043 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_09400 26342 25770 gene locus_tag LOCUS_09410 26342 25770 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_09410 26646 26356 gene locus_tag LOCUS_09420 26646 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 26956 26654 gene locus_tag LOCUS_09430 26956 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 29440 27071 gene locus_tag LOCUS_09440 gene ftsK 29440 27071 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U1 protein_id gnl|my_center|LOCUS_09440 29726 30670 gene locus_tag LOCUS_09450 gene trxB1 29726 30670 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_09450 30723 31442 gene locus_tag LOCUS_09460 gene aat 30723 31442 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMD2 protein_id gnl|my_center|LOCUS_09460 >Feature sequence024 567 791 gene locus_tag LOCUS_09470 567 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1032 1367 gene locus_tag LOCUS_09480 1032 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1601 3394 gene locus_tag LOCUS_09490 1601 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3423 3647 gene locus_tag LOCUS_09500 3423 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4122 4032 gene locus_tag LOCUS_t00120 4122 4032 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7163 4290 gene locus_tag LOCUS_09510 gene gcvP1 7163 4290 CDS product glycine dehydrogenase (decarboxylating) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I137 protein_id gnl|my_center|LOCUS_09510 8340 7219 gene locus_tag LOCUS_09520 gene gcvT2 8340 7219 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 protein_id gnl|my_center|LOCUS_09520 8525 9379 gene locus_tag LOCUS_09530 gene cztR 8525 9379 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_09530 10624 9410 gene locus_tag LOCUS_09540 10624 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 11492 10782 gene locus_tag LOCUS_09550 11492 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11762 11505 gene locus_tag LOCUS_09560 11762 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 12161 13258 gene locus_tag LOCUS_09570 12161 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 14158 13280 gene locus_tag LOCUS_09580 gene queF 14158 13280 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE7 protein_id gnl|my_center|LOCUS_09580 14931 14158 gene locus_tag LOCUS_09590 gene yadH 14931 14158 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_09590 15859 14924 gene locus_tag LOCUS_09600 15859 14924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_09600 16093 16638 gene locus_tag LOCUS_09610 16093 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_09610 17865 16648 gene locus_tag LOCUS_09620 17865 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_09620 18706 17858 gene locus_tag LOCUS_09630 gene lolD 18706 17858 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J04 protein_id gnl|my_center|LOCUS_09630 19976 18696 gene locus_tag LOCUS_09640 19976 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_09640 20684 20082 gene locus_tag LOCUS_09650 20684 20082 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_09650 21058 21363 gene locus_tag LOCUS_09660 21058 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 22799 21372 gene locus_tag LOCUS_09670 gene sthA 22799 21372 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_09670 23047 22802 gene locus_tag LOCUS_09680 23047 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_09680 24120 23050 gene locus_tag LOCUS_09690 24120 23050 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MB1 protein_id gnl|my_center|LOCUS_09690 25353 24130 gene locus_tag LOCUS_09700 gene nqrF 25353 24130 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_09700 25982 25374 gene locus_tag LOCUS_09710 gene nqrE 25982 25374 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_09710 26644 25982 gene locus_tag LOCUS_09720 gene nqrD 26644 25982 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_09720 27414 26647 gene locus_tag LOCUS_09730 gene nqrC 27414 26647 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_09730 >Feature sequence025 1224 343 gene locus_tag LOCUS_09740 gene fliC 1224 343 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Y7 protein_id gnl|my_center|LOCUS_09740 2566 1421 gene locus_tag LOCUS_09750 gene fliC 2566 1421 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C4 protein_id gnl|my_center|LOCUS_09750 3306 2869 gene locus_tag LOCUS_09760 3306 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3553 4110 gene locus_tag LOCUS_09770 3553 4110 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_09770 4110 5474 gene locus_tag LOCUS_09780 4110 5474 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_09780 5501 5893 gene locus_tag LOCUS_09790 5501 5893 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_09790 6922 5963 gene locus_tag LOCUS_09800 6922 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7509 7102 gene locus_tag LOCUS_09810 7509 7102 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09810 7703 8509 gene locus_tag LOCUS_09820 gene mutM 7703 8509 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_09820 8953 8549 gene locus_tag LOCUS_09830 gene coaD 8953 8549 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH8 protein_id gnl|my_center|LOCUS_09830 9647 9087 gene locus_tag LOCUS_09840 9647 9087 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_09840 9739 10818 gene locus_tag LOCUS_09850 9739 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10826 11503 gene locus_tag LOCUS_09860 gene ftsE 10826 11503 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_09860 11490 12470 gene locus_tag LOCUS_09870 gene ftsX 11490 12470 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG1 protein_id gnl|my_center|LOCUS_09870 12581 13438 gene locus_tag LOCUS_09880 gene rpoH 12581 13438 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_09880 13489 13857 gene locus_tag LOCUS_09890 13489 13857 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_09890 13857 14654 gene locus_tag LOCUS_09900 gene trmB 13857 14654 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM56 protein_id gnl|my_center|LOCUS_09900 14811 15548 gene locus_tag LOCUS_09910 gene fkpA 14811 15548 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_09910 16153 15665 gene locus_tag LOCUS_09920 gene rsd 16153 15665 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_09920 16959 16222 gene locus_tag LOCUS_09930 16959 16222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770108.1 protein_id gnl|my_center|LOCUS_09930 17311 16952 gene locus_tag LOCUS_09940 17311 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 17827 17336 gene locus_tag LOCUS_09950 gene dsbB1 17827 17336 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 protein_id gnl|my_center|LOCUS_09950 19471 17906 gene locus_tag LOCUS_09960 gene gshA 19471 17906 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR1 protein_id gnl|my_center|LOCUS_09960 19770 19486 gene locus_tag LOCUS_09970 19770 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 19845 20429 gene locus_tag LOCUS_09980 19845 20429 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705053.1 protein_id gnl|my_center|LOCUS_09980 23601 20464 gene locus_tag LOCUS_09990 23601 20464 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_09990 24851 23598 gene locus_tag LOCUS_10000 24851 23598 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_10000 26274 24991 gene locus_tag LOCUS_10010 26274 24991 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895466.1 protein_id gnl|my_center|LOCUS_10010 <27506 26382 gene locus_tag LOCUS_10020 <27506 26382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262221.1:MFS transporter >Feature sequence026 118 1044 gene locus_tag LOCUS_10030 118 1044 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_10030 2595 1078 gene locus_tag LOCUS_10040 2595 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3278 2595 gene locus_tag LOCUS_10050 gene phcN 3278 2595 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_10050 4241 3288 gene locus_tag LOCUS_10060 gene phnD 4241 3288 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_10060 6637 4508 gene locus_tag LOCUS_10070 gene fadJ 6637 4508 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_10070 6828 8006 gene locus_tag LOCUS_10080 6828 8006 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_10080 8199 9458 gene locus_tag LOCUS_10090 8199 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_10090 10815 10057 gene locus_tag LOCUS_10100 10815 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 12858 10909 gene locus_tag LOCUS_10110 gene mccA 12858 10909 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_10110 14643 13036 gene locus_tag LOCUS_10120 gene accB 14643 13036 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_10120 15855 14689 gene locus_tag LOCUS_10130 gene liuA 15855 14689 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_10130 16263 15859 gene locus_tag LOCUS_10140 gene liuR 16263 15859 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 protein_id gnl|my_center|LOCUS_10140 17163 16381 gene locus_tag LOCUS_10150 17163 16381 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602084.1 protein_id gnl|my_center|LOCUS_10150 17456 18655 gene locus_tag LOCUS_10160 17456 18655 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810799.1 protein_id gnl|my_center|LOCUS_10160 18655 19569 gene locus_tag LOCUS_10170 gene hmgL 18655 19569 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_10170 19686 21782 gene locus_tag LOCUS_10180 19686 21782 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_10180 21785 23668 gene locus_tag LOCUS_10190 21785 23668 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_10190 23810 26275 gene locus_tag LOCUS_10200 23810 26275 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_10200 26359 26982 gene locus_tag LOCUS_10210 26359 26982 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence027 <1 685 gene locus_tag LOCUS_10220 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963893.1:TonB-dependent receptor 2757 781 gene locus_tag LOCUS_10230 2757 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_10230 2920 2741 gene locus_tag LOCUS_10240 2920 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3012 4649 gene locus_tag LOCUS_10250 3012 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_10250 4781 6190 gene locus_tag LOCUS_10260 gene yhxA 4781 6190 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 protein_id gnl|my_center|LOCUS_10260 6265 7509 gene locus_tag LOCUS_10270 gene erg3 6265 7509 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_10270 7773 10412 gene locus_tag LOCUS_10280 gene btuB 7773 10412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_10280 11646 10498 gene locus_tag LOCUS_10290 11646 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 11949 14582 gene locus_tag LOCUS_10300 11949 14582 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_10300 14699 16945 gene locus_tag LOCUS_10310 gene fyuA 14699 16945 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_10310 17110 18636 gene locus_tag LOCUS_10320 17110 18636 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_10320 18686 19225 gene locus_tag LOCUS_10330 18686 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 19222 20466 gene locus_tag LOCUS_10340 19222 20466 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947944.1 protein_id gnl|my_center|LOCUS_10340 22227 20554 gene locus_tag LOCUS_10350 gene betA 22227 20554 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H53 protein_id gnl|my_center|LOCUS_10350 23411 22263 gene locus_tag LOCUS_10360 23411 22263 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_10360 23676 24848 gene locus_tag LOCUS_10370 23676 24848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26269 24914 gene locus_tag LOCUS_10380 26269 24914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence028 <1 902 gene locus_tag LOCUS_10390 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZX12:exodeoxyribonuclease 7 large subunit 2368 1169 gene locus_tag LOCUS_10400 2368 1169 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_10400 2501 2980 gene locus_tag LOCUS_10410 2501 2980 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419292.1 protein_id gnl|my_center|LOCUS_10410 3797 3135 gene locus_tag LOCUS_10420 gene can 3797 3135 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_10420 5046 3940 gene locus_tag LOCUS_10430 5046 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5640 5176 gene locus_tag LOCUS_10440 5640 5176 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_10440 5980 5666 gene locus_tag LOCUS_10450 5980 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6311 6006 gene locus_tag LOCUS_10460 6311 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6701 6315 gene locus_tag LOCUS_10470 6701 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10470 6813 7358 gene locus_tag LOCUS_10480 6813 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_10480 8451 7369 gene locus_tag LOCUS_10490 gene tqsA 8451 7369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_10490 8803 8444 gene locus_tag LOCUS_10500 8803 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 9576 8824 gene locus_tag LOCUS_10510 9576 8824 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKW5 protein_id gnl|my_center|LOCUS_10510 10279 9674 gene locus_tag LOCUS_10520 10279 9674 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_10520 11893 10322 gene locus_tag LOCUS_10530 gene prfC 11893 10322 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_10530 12115 12639 gene locus_tag LOCUS_10540 12115 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 12670 13176 gene locus_tag LOCUS_10550 12670 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10550 13260 13925 gene locus_tag LOCUS_10560 13260 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 14025 14255 gene locus_tag LOCUS_10570 14025 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 14398 15411 gene locus_tag LOCUS_10580 gene hemH2 14398 15411 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_10580 16390 15578 gene locus_tag LOCUS_10590 gene cobB 16390 15578 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFN0 protein_id gnl|my_center|LOCUS_10590 16516 17772 gene locus_tag LOCUS_10600 gene proA 16516 17772 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_10600 17774 18406 gene locus_tag LOCUS_10610 gene nadD 17774 18406 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX21 protein_id gnl|my_center|LOCUS_10610 18417 18794 gene locus_tag LOCUS_10620 gene rsfS 18417 18794 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_10620 18810 19280 gene locus_tag LOCUS_10630 gene rlmH 18810 19280 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF1 protein_id gnl|my_center|LOCUS_10630 19310 21169 gene locus_tag LOCUS_10640 gene pbpA 19310 21169 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10640 21176 22303 gene locus_tag LOCUS_10650 21176 22303 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_10650 22313 23353 gene locus_tag LOCUS_10660 gene sltB1 22313 23353 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_10660 23334 24203 gene locus_tag LOCUS_10670 23334 24203 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_10670 24321 25496 gene locus_tag LOCUS_10680 gene dacC 24321 25496 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_10680 25506 25793 gene locus_tag LOCUS_10690 25506 25793 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_10690 >Feature sequence029 2807 1005 gene locus_tag LOCUS_10700 2807 1005 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 protein_id gnl|my_center|LOCUS_10700 4295 3084 gene locus_tag LOCUS_10710 4295 3084 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_10710 4594 5760 gene locus_tag LOCUS_10720 4594 5760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203404.1 protein_id gnl|my_center|LOCUS_10720 7336 5783 gene locus_tag LOCUS_10730 7336 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202473.1 protein_id gnl|my_center|LOCUS_10730 7669 9249 gene locus_tag LOCUS_10740 7669 9249 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_10740 9823 9353 gene locus_tag LOCUS_10750 9823 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 10125 10385 gene locus_tag LOCUS_10760 10125 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13125 10480 gene locus_tag LOCUS_10770 13125 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 14320 13472 gene locus_tag LOCUS_10780 14320 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 14588 14875 gene locus_tag LOCUS_10790 14588 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 15973 14891 gene locus_tag LOCUS_10800 15973 14891 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 protein_id gnl|my_center|LOCUS_10800 16715 16161 gene locus_tag LOCUS_10810 16715 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 17040 16774 gene locus_tag LOCUS_10820 17040 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 17836 17003 gene locus_tag LOCUS_10830 17836 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 18520 17960 gene locus_tag LOCUS_10840 18520 17960 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404018.1 protein_id gnl|my_center|LOCUS_10840 18845 18534 gene locus_tag LOCUS_10850 18845 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 18984 19538 gene locus_tag LOCUS_10860 18984 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 19598 20425 gene locus_tag LOCUS_10870 19598 20425 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_10870 23025 20458 gene locus_tag LOCUS_10880 gene clpB 23025 20458 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_10880 24311 23190 gene locus_tag LOCUS_10890 gene proB 24311 23190 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_10890 25620 24397 gene locus_tag LOCUS_10900 gene obg 25620 24397 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence030 <1 584 gene locus_tag LOCUS_10910 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q500U7:chromosomal replication initiator protein DnaA 723 1823 gene locus_tag LOCUS_10920 gene dnaN 723 1823 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_10920 1869 2981 gene locus_tag LOCUS_10930 gene recF 1869 2981 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C3 protein_id gnl|my_center|LOCUS_10930 2978 5392 gene locus_tag LOCUS_10940 gene gyrB 2978 5392 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_10940 6266 5565 gene locus_tag LOCUS_10950 gene lptA 6266 5565 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_10950 8426 6345 gene locus_tag LOCUS_10960 gene glyS 8426 6345 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_10960 9424 8423 gene locus_tag LOCUS_10970 gene glyQ 9424 8423 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_10970 9646 10542 gene locus_tag LOCUS_10980 gene galU-2 9646 10542 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9N8 protein_id gnl|my_center|LOCUS_10980 10621 11502 gene locus_tag LOCUS_10990 10621 11502 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_10990 11633 12088 gene locus_tag LOCUS_11000 gene ubiC 11633 12088 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_11000 12155 13021 gene locus_tag LOCUS_11010 gene ubiA 12155 13021 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_11010 13707 13099 gene locus_tag LOCUS_11020 13707 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_11020 14514 13759 gene locus_tag LOCUS_11030 14514 13759 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43908 protein_id gnl|my_center|LOCUS_11030 14672 16225 gene locus_tag LOCUS_11040 14672 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 16259 16504 gene locus_tag LOCUS_11050 16259 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 17294 16719 gene locus_tag LOCUS_11060 17294 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 17681 18433 gene locus_tag LOCUS_11070 gene motA1 17681 18433 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_11070 18442 19641 gene locus_tag LOCUS_11080 18442 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 19708 20934 gene locus_tag LOCUS_11090 19708 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 21880 20996 gene locus_tag LOCUS_11100 gene kcnb2 21880 20996 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_11100 22611 22195 gene locus_tag LOCUS_11110 gene fliS 22611 22195 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5S6 protein_id gnl|my_center|LOCUS_11110 23419 22721 gene locus_tag LOCUS_11120 23419 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 25185 23488 gene locus_tag LOCUS_11130 25185 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence031 611 48 gene locus_tag LOCUS_11140 611 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1855 626 gene locus_tag LOCUS_11150 1855 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_11150 2156 2482 gene locus_tag LOCUS_11160 2156 2482 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_11160 2715 3464 gene locus_tag LOCUS_11170 2715 3464 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_11170 4062 3511 gene locus_tag LOCUS_11180 4062 3511 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_11180 4104 4754 gene locus_tag LOCUS_11190 4104 4754 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 protein_id gnl|my_center|LOCUS_11190 4751 5275 gene locus_tag LOCUS_11200 4751 5275 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615845.1 protein_id gnl|my_center|LOCUS_11200 5275 5460 gene locus_tag LOCUS_11210 5275 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6841 5561 gene locus_tag LOCUS_11220 6841 5561 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_11220 7736 6945 gene locus_tag LOCUS_11230 7736 6945 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_11230 7855 9279 gene locus_tag LOCUS_11240 gene ffh 7855 9279 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS7 protein_id gnl|my_center|LOCUS_11240 9479 9739 gene locus_tag LOCUS_11250 gene rpsP 9479 9739 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_11250 9783 10304 gene locus_tag LOCUS_11260 gene rimM 9783 10304 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_11260 10381 11133 gene locus_tag LOCUS_11270 gene trmD 10381 11133 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A876 protein_id gnl|my_center|LOCUS_11270 11206 11565 gene locus_tag LOCUS_11280 gene rplS 11206 11565 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_11280 11826 12122 gene locus_tag LOCUS_11290 11826 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 12125 12550 gene locus_tag LOCUS_11300 12125 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 13024 15477 gene locus_tag LOCUS_11310 gene rnr 13024 15477 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_11310 16226 15540 gene locus_tag LOCUS_11320 16226 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103037.1 protein_id gnl|my_center|LOCUS_11320 17053 16223 gene locus_tag LOCUS_11330 gene dapF 17053 16223 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B09 protein_id gnl|my_center|LOCUS_11330 18318 17059 gene locus_tag LOCUS_11340 gene lysA 18318 17059 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_11340 18724 19044 gene locus_tag LOCUS_11350 gene cyaY 18724 19044 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ1 protein_id gnl|my_center|LOCUS_11350 20573 19146 gene locus_tag LOCUS_11360 gene argH 20573 19146 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_11360 20644 21708 gene locus_tag LOCUS_11370 gene algZ 20644 21708 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_11370 21711 22430 gene locus_tag LOCUS_11380 gene algR 21711 22430 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 protein_id gnl|my_center|LOCUS_11380 22569 23465 gene locus_tag LOCUS_11390 gene hemC 22569 23465 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_11390 23465 24196 gene locus_tag LOCUS_11400 gene hemD 23465 24196 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_11400 >Feature sequence032 290 1447 gene locus_tag LOCUS_11410 gene metX 290 1447 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_11410 1444 2052 gene locus_tag LOCUS_11420 1444 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_11420 2094 2528 gene locus_tag LOCUS_11430 2094 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_11430 2571 3197 gene locus_tag LOCUS_11440 gene rdgB 2571 3197 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XCU5 protein_id gnl|my_center|LOCUS_11440 3264 4373 gene locus_tag LOCUS_11450 3264 4373 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_11450 4470 5426 gene locus_tag LOCUS_11460 4470 5426 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_11460 7591 5459 gene locus_tag LOCUS_11470 7591 5459 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11470 7875 8201 gene locus_tag LOCUS_11480 gene trxA 7875 8201 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENG0 protein_id gnl|my_center|LOCUS_11480 8484 9743 gene locus_tag LOCUS_11490 gene rho 8484 9743 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_11490 9807 11297 gene locus_tag LOCUS_11500 gene ubiD 9807 11297 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_11500 11322 11639 gene locus_tag LOCUS_11510 gene yoaB 11322 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_11510 11847 12248 gene locus_tag LOCUS_11520 11847 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12683 12985 gene locus_tag LOCUS_11530 12683 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13006 13452 gene locus_tag LOCUS_11540 13006 13452 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_11540 14074 16221 gene locus_tag LOCUS_11550 gene katG 14074 16221 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G105 protein_id gnl|my_center|LOCUS_11550 16465 17499 gene locus_tag LOCUS_11560 16465 17499 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134026.1 protein_id gnl|my_center|LOCUS_11560 17568 17852 gene locus_tag LOCUS_11570 17568 17852 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704510.1 protein_id gnl|my_center|LOCUS_11570 17982 18677 gene locus_tag LOCUS_11580 17982 18677 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_11580 18678 19487 gene locus_tag LOCUS_11590 18678 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 19871 20374 gene locus_tag LOCUS_11600 19871 20374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082093.1 protein_id gnl|my_center|LOCUS_11600 22972 20483 gene locus_tag LOCUS_11610 gene bfeA 22972 20483 CDS product ferric enterobactin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638392.2 protein_id gnl|my_center|LOCUS_11610 23389 23787 gene locus_tag LOCUS_11620 23389 23787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence033 424 1017 gene locus_tag LOCUS_11630 424 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1076 1291 gene locus_tag LOCUS_11640 1076 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1288 1557 gene locus_tag LOCUS_11650 1288 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1571 1849 gene locus_tag LOCUS_11660 1571 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1774 1992 gene locus_tag LOCUS_11670 1774 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 1992 2171 gene locus_tag LOCUS_11680 1992 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3539 2259 gene locus_tag LOCUS_11690 3539 2259 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_11690 4273 3593 gene locus_tag LOCUS_11700 4273 3593 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_11700 6429 4324 gene locus_tag LOCUS_11710 gene recG 6429 4324 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_11710 6626 7468 gene locus_tag LOCUS_11720 6626 7468 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_11720 7518 8126 gene locus_tag LOCUS_11730 7518 8126 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_11730 8183 8635 gene locus_tag LOCUS_11740 8183 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9040 8657 gene locus_tag LOCUS_11750 9040 8657 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_11750 11197 9083 gene locus_tag LOCUS_11760 gene spoT 11197 9083 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_11760 11647 11228 gene locus_tag LOCUS_11770 11647 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12428 11820 gene locus_tag LOCUS_11780 gene gmk 12428 11820 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_11780 13315 12494 gene locus_tag LOCUS_11790 13315 12494 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_11790 14246 13383 gene locus_tag LOCUS_11800 14246 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_11800 14366 15085 gene locus_tag LOCUS_11810 gene rph 14366 15085 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_11810 15113 15793 gene locus_tag LOCUS_11820 gene pyrE 15113 15793 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGJ9 protein_id gnl|my_center|LOCUS_11820 16444 15857 gene locus_tag LOCUS_11830 gene slmA 16444 15857 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_11830 17364 16444 gene locus_tag LOCUS_11840 gene argB 17364 16444 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY1 protein_id gnl|my_center|LOCUS_11840 18826 17366 gene locus_tag LOCUS_11850 gene algC 18826 17366 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_11850 20054 18861 gene locus_tag LOCUS_11860 gene coaC 20054 18861 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_11860 20135 20512 gene locus_tag LOCUS_11870 20135 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 20476 20808 gene locus_tag LOCUS_11880 20476 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 21029 21229 gene locus_tag LOCUS_11890 gene rpmB 21029 21229 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M3 protein_id gnl|my_center|LOCUS_11890 21241 21408 gene locus_tag LOCUS_11900 gene rpmG 21241 21408 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_11900 21886 21677 gene locus_tag LOCUS_11910 21886 21677 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422769.1 protein_id gnl|my_center|LOCUS_11910 22424 23818 gene locus_tag LOCUS_11920 22424 23818 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence034 1056 688 gene locus_tag LOCUS_11930 1056 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1163 1522 gene locus_tag LOCUS_11940 1163 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2266 1622 gene locus_tag LOCUS_11950 gene pdxH 2266 1622 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FE9 protein_id gnl|my_center|LOCUS_11950 3067 2300 gene locus_tag LOCUS_11960 3067 2300 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_11960 3332 3727 gene locus_tag LOCUS_11970 3332 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3785 4171 gene locus_tag LOCUS_11980 3785 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4177 4491 gene locus_tag LOCUS_11990 4177 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5515 4823 gene locus_tag LOCUS_12000 5515 4823 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_12000 5675 6142 gene locus_tag LOCUS_12010 5675 6142 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890146.1 protein_id gnl|my_center|LOCUS_12010 6461 6156 gene locus_tag LOCUS_12020 6461 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6774 6502 gene locus_tag LOCUS_12030 6774 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7066 8976 gene locus_tag LOCUS_12040 gene deaD-1 7066 8976 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_12040 9370 8960 gene locus_tag LOCUS_12050 9370 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 11514 9415 gene locus_tag LOCUS_12060 gene dinG 11514 9415 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_12060 12682 11519 gene locus_tag LOCUS_12070 12682 11519 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 protein_id gnl|my_center|LOCUS_12070 13734 12805 gene locus_tag LOCUS_12080 gene pyrB 13734 12805 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_12080 15344 13908 gene locus_tag LOCUS_12090 15344 13908 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_12090 16401 15457 gene locus_tag LOCUS_12100 16401 15457 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406743.1 protein_id gnl|my_center|LOCUS_12100 18155 16638 gene locus_tag LOCUS_12110 18155 16638 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_12110 18983 18177 gene locus_tag LOCUS_12120 18983 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 19847 19209 gene locus_tag LOCUS_12130 19847 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_12130 21738 20086 gene locus_tag LOCUS_12140 gene groL 21738 20086 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_12140 >Feature sequence035 678 133 gene locus_tag LOCUS_12150 gene pcaC 678 133 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KII5 protein_id gnl|my_center|LOCUS_12150 1480 734 gene locus_tag LOCUS_12160 1480 734 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707541.1 protein_id gnl|my_center|LOCUS_12160 1881 1477 gene locus_tag LOCUS_12170 1881 1477 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_12170 2420 1884 gene locus_tag LOCUS_12180 2420 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477135.1 protein_id gnl|my_center|LOCUS_12180 2596 3936 gene locus_tag LOCUS_12190 gene cry 2596 3936 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JP5 protein_id gnl|my_center|LOCUS_12190 4006 5553 gene locus_tag LOCUS_12200 4006 5553 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479939.1 protein_id gnl|my_center|LOCUS_12200 6846 5569 gene locus_tag LOCUS_12210 6846 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7083 7772 gene locus_tag LOCUS_12220 7083 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7962 8981 gene locus_tag LOCUS_12230 7962 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 8978 10480 gene locus_tag LOCUS_12240 gene crtI 8978 10480 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_12240 10484 11395 gene locus_tag LOCUS_12250 10484 11395 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_12250 11385 12569 gene locus_tag LOCUS_12260 gene crtY 11385 12569 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_12260 12562 13419 gene locus_tag LOCUS_12270 12562 13419 CDS product beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_12270 13416 14423 gene locus_tag LOCUS_12280 gene fni 13416 14423 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGM3 protein_id gnl|my_center|LOCUS_12280 14586 15686 gene locus_tag LOCUS_12290 14586 15686 CDS product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199465.1 protein_id gnl|my_center|LOCUS_12290 15758 15952 gene locus_tag LOCUS_12300 15758 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 16032 16568 gene locus_tag LOCUS_12310 gene yaeQ 16032 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_12310 16944 17477 gene locus_tag LOCUS_12320 16944 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 17977 17549 gene locus_tag LOCUS_12330 17977 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 19471 18626 gene locus_tag LOCUS_12340 19471 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_12340 20491 19526 gene locus_tag LOCUS_12350 20491 19526 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_12350 21099 20491 gene locus_tag LOCUS_12360 gene azoR3 21099 20491 CDS product FMN-dependent NADH-azoreductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ17 protein_id gnl|my_center|LOCUS_12360 21580 21134 gene locus_tag LOCUS_12370 21580 21134 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence036 39 761 gene locus_tag LOCUS_12380 gene ate 39 761 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 protein_id gnl|my_center|LOCUS_12380 884 1102 gene locus_tag LOCUS_12390 gene infA 884 1102 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM3 protein_id gnl|my_center|LOCUS_12390 3474 1198 gene locus_tag LOCUS_12400 3474 1198 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_12400 3737 3480 gene locus_tag LOCUS_12410 3737 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3898 4062 gene locus_tag LOCUS_12420 3898 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4005 4274 gene locus_tag LOCUS_12430 4005 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5626 4373 gene locus_tag LOCUS_12440 gene icd 5626 4373 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_12440 5749 6375 gene locus_tag LOCUS_12450 gene rluE 5749 6375 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1GRK1 protein_id gnl|my_center|LOCUS_12450 6378 6824 gene locus_tag LOCUS_12460 6378 6824 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_12460 6882 7994 gene locus_tag LOCUS_12470 gene mnmA 6882 7994 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_12470 7984 8601 gene locus_tag LOCUS_12480 gene hflD 7984 8601 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 protein_id gnl|my_center|LOCUS_12480 8709 10085 gene locus_tag LOCUS_12490 8709 10085 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_12490 10099 11040 gene locus_tag LOCUS_12500 10099 11040 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_12500 12846 11071 gene locus_tag LOCUS_12510 gene ggtA 12846 11071 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_12510 13090 13527 gene locus_tag LOCUS_12520 13090 13527 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 protein_id gnl|my_center|LOCUS_12520 14122 13640 gene locus_tag LOCUS_12530 14122 13640 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_12530 16297 14129 gene locus_tag LOCUS_12540 gene glcB 16297 14129 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_12540 17373 16432 gene locus_tag LOCUS_12550 gene nahR 17373 16432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_12550 17478 19058 gene locus_tag LOCUS_12560 17478 19058 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_12560 19243 20439 gene locus_tag LOCUS_12570 19243 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence037 870 43 gene locus_tag LOCUS_12580 870 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2429 1080 gene locus_tag LOCUS_12590 2429 1080 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_12590 3901 2444 gene locus_tag LOCUS_12600 gene davD 3901 2444 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_12600 4123 4710 gene locus_tag LOCUS_12610 4123 4710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_12610 4823 5500 gene locus_tag LOCUS_12620 gene echA3 4823 5500 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_12620 5527 6546 gene locus_tag LOCUS_12630 5527 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6698 7243 gene locus_tag LOCUS_12640 gene hslV 6698 7243 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_12640 7387 8715 gene locus_tag LOCUS_12650 gene hslU 7387 8715 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_12650 8717 9112 gene locus_tag LOCUS_12660 8717 9112 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105334.1 protein_id gnl|my_center|LOCUS_12660 9226 9972 gene locus_tag LOCUS_12670 gene ubiE 9226 9972 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V5 protein_id gnl|my_center|LOCUS_12670 9972 10655 gene locus_tag LOCUS_12680 9972 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704117.1 protein_id gnl|my_center|LOCUS_12680 10652 12274 gene locus_tag LOCUS_12690 gene ubiB 10652 12274 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_12690 12345 12725 gene locus_tag LOCUS_12700 gene hisI 12345 12725 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_12700 12722 13066 gene locus_tag LOCUS_12710 gene hisE 12722 13066 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_12710 13110 13346 gene locus_tag LOCUS_12720 gene tatA 13110 13346 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V2 protein_id gnl|my_center|LOCUS_12720 13740 14117 gene locus_tag LOCUS_12730 13740 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 14110 14847 gene locus_tag LOCUS_12740 gene tatC 14110 14847 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_12740 15010 14828 gene locus_tag LOCUS_12750 15010 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 15030 18173 gene locus_tag LOCUS_12760 gene dnaE2 15030 18173 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_12760 18658 18170 gene locus_tag LOCUS_12770 18658 18170 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_12770 19651 18689 gene locus_tag LOCUS_12780 19651 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_12780 20644 19706 gene locus_tag LOCUS_12790 20644 19706 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_12790 <21492 20729 gene locus_tag LOCUS_12800 <21492 20729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919055.1:2-hydroxychromene-2-carboxylate dehydrogenase >Feature sequence038 72 620 gene locus_tag LOCUS_12810 72 620 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_12810 2089 821 gene locus_tag LOCUS_12820 gene metY 2089 821 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_12820 3960 2206 gene locus_tag LOCUS_12830 3960 2206 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_12830 5201 3975 gene locus_tag LOCUS_12840 5201 3975 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_12840 6075 5227 gene locus_tag LOCUS_12850 6075 5227 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZ56 protein_id gnl|my_center|LOCUS_12850 6481 8007 gene locus_tag LOCUS_12860 6481 8007 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013532.1 protein_id gnl|my_center|LOCUS_12860 9583 8231 gene locus_tag LOCUS_12870 9583 8231 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_12870 10587 9790 gene locus_tag LOCUS_12880 10587 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10771 11805 gene locus_tag LOCUS_12890 gene oruR 10771 11805 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_12890 12044 13216 gene locus_tag LOCUS_12900 12044 13216 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_12900 13725 13426 gene locus_tag LOCUS_12910 13725 13426 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_12910 14019 15368 gene locus_tag LOCUS_12920 14019 15368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920344.1 protein_id gnl|my_center|LOCUS_12920 15530 17386 gene locus_tag LOCUS_12930 15530 17386 CDS product terpene utilization protein AtuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_12930 17420 19042 gene locus_tag LOCUS_12940 17420 19042 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544675.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence039 331 1302 gene locus_tag LOCUS_12950 gene ncd-2 331 1302 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_12950 1422 2186 gene locus_tag LOCUS_12960 gene dhrS4 1422 2186 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_12960 2303 3055 gene locus_tag LOCUS_12970 2303 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4390 3191 gene locus_tag LOCUS_12980 gene sat 4390 3191 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_12980 5086 4472 gene locus_tag LOCUS_12990 gene cysC 5086 4472 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_12990 5219 6100 gene locus_tag LOCUS_13000 5219 6100 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_13000 6212 7390 gene locus_tag LOCUS_13010 6212 7390 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_13010 8125 7439 gene locus_tag LOCUS_13020 8125 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8414 8965 gene locus_tag LOCUS_13030 8414 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9084 10565 gene locus_tag LOCUS_13040 gene gltX 9084 10565 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_13040 10635 10710 gene locus_tag LOCUS_t00130 10635 10710 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11034 12023 gene locus_tag LOCUS_13050 11034 12023 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389652.1 protein_id gnl|my_center|LOCUS_13050 12288 12974 gene locus_tag LOCUS_13060 12288 12974 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_13060 14813 13026 gene locus_tag LOCUS_13070 14813 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 15207 16055 gene locus_tag LOCUS_13080 15207 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 16455 16189 gene locus_tag LOCUS_13090 16455 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17086 16448 gene locus_tag LOCUS_13100 17086 16448 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804191.1 protein_id gnl|my_center|LOCUS_13100 17388 18644 gene locus_tag LOCUS_13110 17388 18644 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_13110 19481 18705 gene locus_tag LOCUS_13120 19481 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence040 394 68 gene locus_tag LOCUS_13130 gene soxD-2 394 68 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_13130 1654 413 gene locus_tag LOCUS_13140 gene soxB-2 1654 413 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_13140 2563 1685 gene locus_tag LOCUS_13150 gene purU-2 2563 1685 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B4 protein_id gnl|my_center|LOCUS_13150 2781 3422 gene locus_tag LOCUS_13160 2781 3422 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261307.1 protein_id gnl|my_center|LOCUS_13160 3514 4980 gene locus_tag LOCUS_13170 3514 4980 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_13170 5066 6223 gene locus_tag LOCUS_13180 5066 6223 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_13180 6227 6649 gene locus_tag LOCUS_13190 6227 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_13190 7595 6714 gene locus_tag LOCUS_13200 gene tesB 7595 6714 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_13200 8684 7635 gene locus_tag LOCUS_13210 8684 7635 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_13210 8996 10174 gene locus_tag LOCUS_13220 8996 10174 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_13220 10254 11393 gene locus_tag LOCUS_13230 10254 11393 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_13230 11532 12746 gene locus_tag LOCUS_13240 11532 12746 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_13240 12756 13670 gene locus_tag LOCUS_13250 gene fox2 12756 13670 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_13250 13695 14672 gene locus_tag LOCUS_13260 13695 14672 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_13260 15822 14803 gene locus_tag LOCUS_13270 gene yjgB 15822 14803 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_13270 16181 18004 gene locus_tag LOCUS_13280 gene recQ 16181 18004 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_13280 18187 18017 gene locus_tag LOCUS_13290 18187 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 19199 18354 gene locus_tag LOCUS_13300 19199 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence041 1257 688 gene locus_tag LOCUS_13310 gene tsaC 1257 688 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_13310 1770 1264 gene locus_tag LOCUS_13320 gene purE-2 1770 1264 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_13320 2992 1871 gene locus_tag LOCUS_13330 2992 1871 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_13330 3935 3162 gene locus_tag LOCUS_13340 3935 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4095 4601 gene locus_tag LOCUS_13350 gene def 4095 4601 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_13350 4614 5552 gene locus_tag LOCUS_13360 gene fmt 4614 5552 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q7 protein_id gnl|my_center|LOCUS_13360 5570 6856 gene locus_tag LOCUS_13370 gene rsmB 5570 6856 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_13370 6884 8266 gene locus_tag LOCUS_13380 gene trkA 6884 8266 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_13380 8334 9782 gene locus_tag LOCUS_13390 gene trkH 8334 9782 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_13390 10918 9827 gene locus_tag LOCUS_13400 10918 9827 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_13400 13154 10992 gene locus_tag LOCUS_13410 gene uvrD 13154 10992 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_13410 13334 14182 gene locus_tag LOCUS_13420 13334 14182 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_13420 15039 14197 gene locus_tag LOCUS_13430 15039 14197 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_13430 15485 15078 gene locus_tag LOCUS_13440 15485 15078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 protein_id gnl|my_center|LOCUS_13440 15795 15514 gene locus_tag LOCUS_13450 15795 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13450 17847 16018 gene locus_tag LOCUS_13460 gene glmS 17847 16018 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17169 protein_id gnl|my_center|LOCUS_13460 19226 17859 gene locus_tag LOCUS_13470 gene glmU 19226 17859 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_13470 >Feature sequence042 <1 716 gene locus_tag LOCUS_13480 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727945.1:alkane 1-monooxygenase 773 1063 gene locus_tag LOCUS_13490 773 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105135.1 protein_id gnl|my_center|LOCUS_13490 3429 1147 gene locus_tag LOCUS_13500 3429 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4531 3548 gene locus_tag LOCUS_13510 gene oruR 4531 3548 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_13510 4756 5658 gene locus_tag LOCUS_13520 4756 5658 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_13520 5802 7313 gene locus_tag LOCUS_13530 5802 7313 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_13530 7499 8866 gene locus_tag LOCUS_13540 7499 8866 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_13540 9392 10021 gene locus_tag LOCUS_13550 9392 10021 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_13550 11277 10102 gene locus_tag LOCUS_13560 11277 10102 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225762.1 protein_id gnl|my_center|LOCUS_13560 12375 11344 gene locus_tag LOCUS_13570 12375 11344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086693.1 protein_id gnl|my_center|LOCUS_13570 13801 12464 gene locus_tag LOCUS_13580 13801 12464 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_13580 16109 13848 gene locus_tag LOCUS_13590 16109 13848 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109396.1 protein_id gnl|my_center|LOCUS_13590 16321 16863 gene locus_tag LOCUS_13600 16321 16863 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_13600 17070 16855 gene locus_tag LOCUS_13610 17070 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 17033 17374 gene locus_tag LOCUS_13620 17033 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence043 507 1853 gene locus_tag LOCUS_13630 507 1853 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_13630 2014 2253 gene locus_tag LOCUS_13640 2014 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2262 3164 gene locus_tag LOCUS_13650 gene ispA 2262 3164 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_13650 3324 5261 gene locus_tag LOCUS_13660 gene dxs 3324 5261 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q1 protein_id gnl|my_center|LOCUS_13660 5283 5912 gene locus_tag LOCUS_13670 5283 5912 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_13670 8691 6004 gene locus_tag LOCUS_13680 gene fecA 8691 6004 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_13680 10492 8849 gene locus_tag LOCUS_13690 10492 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 protein_id gnl|my_center|LOCUS_13690 11431 10745 gene locus_tag LOCUS_13700 gene phoU 11431 10745 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_13700 12416 11571 gene locus_tag LOCUS_13710 gene pstB 12416 11571 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_13710 13721 12429 gene locus_tag LOCUS_13720 13721 12429 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_13720 15102 13714 gene locus_tag LOCUS_13730 15102 13714 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_13730 16238 15180 gene locus_tag LOCUS_13740 16238 15180 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence044 <1 856 gene locus_tag LOCUS_13750 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZXW8:glutamyl-tRNA reductase 973 2055 gene locus_tag LOCUS_13760 gene prfA 973 2055 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW7 protein_id gnl|my_center|LOCUS_13760 2055 2888 gene locus_tag LOCUS_13770 gene prmC 2055 2888 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_13770 4273 2879 gene locus_tag LOCUS_13780 gene pmpM 4273 2879 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_13780 4448 5104 gene locus_tag LOCUS_13790 4448 5104 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_13790 5338 6894 gene locus_tag LOCUS_13800 gene rhlB 5338 6894 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_13800 7730 6966 gene locus_tag LOCUS_13810 gene cysZ 7730 6966 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_13810 7857 8579 gene locus_tag LOCUS_13820 7857 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9126 8650 gene locus_tag LOCUS_13830 gene smpB 9126 8650 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_13830 9250 10623 gene locus_tag LOCUS_13840 9250 10623 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_13840 10636 11085 gene locus_tag LOCUS_13850 gene yfjG 10636 11085 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_13850 11072 11437 gene locus_tag LOCUS_13860 11072 11437 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_13860 11863 11507 gene locus_tag LOCUS_13870 11863 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11934 12344 gene locus_tag LOCUS_13880 gene fur 11934 12344 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_13880 12412 13800 gene locus_tag LOCUS_13890 gene dagA 12412 13800 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836461.1 protein_id gnl|my_center|LOCUS_13890 14338 13856 gene locus_tag LOCUS_13900 gene gpo 14338 13856 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SZ6 protein_id gnl|my_center|LOCUS_13900 15164 14406 gene locus_tag LOCUS_13910 gene panB 15164 14406 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRD0 protein_id gnl|my_center|LOCUS_13910 15969 15283 gene locus_tag LOCUS_13920 15969 15283 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_13920 16508 16020 gene locus_tag LOCUS_13930 gene folK 16508 16020 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_13930 <17104 16508 gene locus_tag LOCUS_13940 <17104 16508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV72:poly(A) polymerase I >Feature sequence045 1683 994 gene locus_tag LOCUS_13950 gene pgl 1683 994 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_13950 3168 1711 gene locus_tag LOCUS_13960 gene zwf-1 3168 1711 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887J2 protein_id gnl|my_center|LOCUS_13960 3848 3231 gene locus_tag LOCUS_13970 3848 3231 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_13970 4935 3961 gene locus_tag LOCUS_13980 gene glk 4935 3961 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR64 protein_id gnl|my_center|LOCUS_13980 6761 4938 gene locus_tag LOCUS_13990 gene edd 6761 4938 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_13990 7037 8665 gene locus_tag LOCUS_14000 gene pgi 7037 8665 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_14000 9621 8686 gene locus_tag LOCUS_14010 gene ispH 9621 8686 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_14010 10061 9621 gene locus_tag LOCUS_14020 10061 9621 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_14020 10660 10100 gene locus_tag LOCUS_14030 gene lspA 10660 10100 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI5 protein_id gnl|my_center|LOCUS_14030 13475 10653 gene locus_tag LOCUS_14040 gene ileS 13475 10653 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_14040 14529 13564 gene locus_tag LOCUS_14050 gene ribF 14529 13564 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_14050 16305 14653 gene locus_tag LOCUS_14060 gene murJ 16305 14653 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_14060 16522 16785 gene locus_tag LOCUS_14070 gene rpsT 16522 16785 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_14070 >Feature sequence046 <1 554 gene locus_tag LOCUS_14080 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096089.1:zinc ABC transporter substrate-binding protein 647 3430 gene locus_tag LOCUS_14090 gene polA 647 3430 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_14090 4432 3722 gene locus_tag LOCUS_14100 gene engB 4432 3722 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEY0 protein_id gnl|my_center|LOCUS_14100 4642 5145 gene locus_tag LOCUS_14110 gene cc4 4642 5145 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_14110 5229 5870 gene locus_tag LOCUS_14120 gene dsbA 5229 5870 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_14120 6074 7189 gene locus_tag LOCUS_14130 6074 7189 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_14130 7318 8487 gene locus_tag LOCUS_14140 7318 8487 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 protein_id gnl|my_center|LOCUS_14140 9519 8527 gene locus_tag LOCUS_14150 9519 8527 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_14150 9643 11592 gene locus_tag LOCUS_14160 gene fabY 9643 11592 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_14160 12214 11501 gene locus_tag LOCUS_14170 12214 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 12158 12328 gene locus_tag LOCUS_14180 12158 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13107 12370 gene locus_tag LOCUS_14190 13107 12370 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_14190 13965 13117 gene locus_tag LOCUS_14200 gene metF 13965 13117 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGJ7 protein_id gnl|my_center|LOCUS_14200 15382 14012 gene locus_tag LOCUS_14210 gene ahcY 15382 14012 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_14210 16612 15458 gene locus_tag LOCUS_14220 gene metK 16612 15458 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM01 protein_id gnl|my_center|LOCUS_14220 >Feature sequence047 185 2269 gene locus_tag LOCUS_14230 gene atuF 185 2269 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_14230 2269 2928 gene locus_tag LOCUS_14240 2269 2928 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_14240 2931 4964 gene locus_tag LOCUS_14250 gene fadH1 2931 4964 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_14250 5155 6348 gene locus_tag LOCUS_14260 5155 6348 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_14260 6377 7540 gene locus_tag LOCUS_14270 6377 7540 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_14270 7537 8616 gene locus_tag LOCUS_14280 7537 8616 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040591.1 protein_id gnl|my_center|LOCUS_14280 9924 9055 gene locus_tag LOCUS_14290 9924 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_14290 11401 10208 gene locus_tag LOCUS_14300 11401 10208 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_14300 12637 11423 gene locus_tag LOCUS_14310 12637 11423 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978025.1 protein_id gnl|my_center|LOCUS_14310 12874 14580 gene locus_tag LOCUS_14320 12874 14580 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_14320 14624 15088 gene locus_tag LOCUS_14330 14624 15088 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403014.1 protein_id gnl|my_center|LOCUS_14330 15932 15096 gene locus_tag LOCUS_14340 15932 15096 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729131.1 protein_id gnl|my_center|LOCUS_14340 16154 16615 gene locus_tag LOCUS_14350 16154 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence048 472 1005 gene locus_tag LOCUS_14360 gene nuoE 472 1005 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_14360 1005 2333 gene locus_tag LOCUS_14370 1005 2333 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_14370 2337 5279 gene locus_tag LOCUS_14380 2337 5279 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI8 protein_id gnl|my_center|LOCUS_14380 5272 6243 gene locus_tag LOCUS_14390 gene nuoH 5272 6243 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ61 protein_id gnl|my_center|LOCUS_14390 6247 6762 gene locus_tag LOCUS_14400 gene nuoI 6247 6762 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32DQ8 protein_id gnl|my_center|LOCUS_14400 6794 7378 gene locus_tag LOCUS_14410 gene nuoJ 6794 7378 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159228.1 protein_id gnl|my_center|LOCUS_14410 7378 7692 gene locus_tag LOCUS_14420 gene nuoK 7378 7692 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J2 protein_id gnl|my_center|LOCUS_14420 7695 9530 gene locus_tag LOCUS_14430 gene nuoL 7695 9530 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 protein_id gnl|my_center|LOCUS_14430 9569 11083 gene locus_tag LOCUS_14440 9569 11083 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554022.1 protein_id gnl|my_center|LOCUS_14440 11080 12495 gene locus_tag LOCUS_14450 gene nuoN 11080 12495 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_14450 12552 12962 gene locus_tag LOCUS_14460 12552 12962 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259266.1 protein_id gnl|my_center|LOCUS_14460 13883 12927 gene locus_tag LOCUS_14470 13883 12927 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_14470 14877 13885 gene locus_tag LOCUS_14480 gene rrmA 14877 13885 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010147.1 protein_id gnl|my_center|LOCUS_14480 15028 15663 gene locus_tag LOCUS_14490 15028 15663 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_14490 16152 15700 gene locus_tag LOCUS_14500 16152 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 16337 16486 gene locus_tag LOCUS_14510 16337 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence049 2186 2425 gene locus_tag LOCUS_14520 2186 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3838 2438 gene locus_tag LOCUS_14530 3838 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7028 3999 gene locus_tag LOCUS_14540 gene malA 7028 3999 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_14540 9892 7667 gene locus_tag LOCUS_14550 9892 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 10920 9991 gene locus_tag LOCUS_14560 10920 9991 CDS product ketodeoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099211.1 protein_id gnl|my_center|LOCUS_14560 11709 10957 gene locus_tag LOCUS_14570 11709 10957 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_14570 12652 11774 gene locus_tag LOCUS_14580 12652 11774 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 protein_id gnl|my_center|LOCUS_14580 14009 12714 gene locus_tag LOCUS_14590 gene exuT 14009 12714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817242.1 protein_id gnl|my_center|LOCUS_14590 14353 14006 gene locus_tag LOCUS_14600 14353 14006 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_14600 <16447 14455 gene locus_tag LOCUS_14610 <16447 14455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223691.1:lyase >Feature sequence050 3288 1924 gene locus_tag LOCUS_14620 gene mnmE 3288 1924 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XB41 protein_id gnl|my_center|LOCUS_14620 5135 3435 gene locus_tag LOCUS_14630 gene yidC 5135 3435 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_14630 5792 5418 gene locus_tag LOCUS_14640 gene rnpA 5792 5418 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_14640 6717 8585 gene locus_tag LOCUS_14650 gene mnmG 6717 8585 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS3 protein_id gnl|my_center|LOCUS_14650 8575 9291 gene locus_tag LOCUS_14660 gene rsmG 8575 9291 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_14660 9296 10096 gene locus_tag LOCUS_14670 gene soj 9296 10096 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_14670 10104 10988 gene locus_tag LOCUS_14680 gene spoOJ 10104 10988 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_14680 11146 11517 gene locus_tag LOCUS_14690 11146 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 11595 12617 gene locus_tag LOCUS_14700 gene atpB 11595 12617 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS8 protein_id gnl|my_center|LOCUS_14700 12660 12899 gene locus_tag LOCUS_14710 12660 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12946 13416 gene locus_tag LOCUS_14720 gene atpF 12946 13416 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_14720 13429 13965 gene locus_tag LOCUS_14730 gene atpH 13429 13965 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_14730 13983 15527 gene locus_tag LOCUS_14740 gene atpA 13983 15527 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_14740 >Feature sequence051 <1 2458 gene locus_tag LOCUS_14750 <1 2458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640064.1:1,4-beta-D-glucan glucohydrolase 2734 3306 gene locus_tag LOCUS_14760 2734 3306 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_14760 3316 3795 gene locus_tag LOCUS_14770 3316 3795 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103347.1 protein_id gnl|my_center|LOCUS_14770 4570 3773 gene locus_tag LOCUS_14780 4570 3773 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267411.1 protein_id gnl|my_center|LOCUS_14780 6564 4573 gene locus_tag LOCUS_14790 6564 4573 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_14790 7308 6868 gene locus_tag LOCUS_14800 7308 6868 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR97 protein_id gnl|my_center|LOCUS_14800 7470 7955 gene locus_tag LOCUS_14810 7470 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8085 10745 gene locus_tag LOCUS_14820 gene topA 8085 10745 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_14820 10754 11260 gene locus_tag LOCUS_14830 10754 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 11351 11596 gene locus_tag LOCUS_14840 11351 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 11755 12168 gene locus_tag LOCUS_14850 11755 12168 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_14850 12818 12213 gene locus_tag LOCUS_14860 gene lexA 12818 12213 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7C4 protein_id gnl|my_center|LOCUS_14860 12927 13580 gene locus_tag LOCUS_14870 12927 13580 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHG2 protein_id gnl|my_center|LOCUS_14870 13936 13643 gene locus_tag LOCUS_14880 13936 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14237 15289 gene locus_tag LOCUS_14890 gene nagZ 14237 15289 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC2 protein_id gnl|my_center|LOCUS_14890 >Feature sequence052 522 1751 gene locus_tag LOCUS_14900 522 1751 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_14900 2617 1769 gene locus_tag LOCUS_14910 gene nfo 2617 1769 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV76 protein_id gnl|my_center|LOCUS_14910 2830 3357 gene locus_tag LOCUS_14920 2830 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4628 3354 gene locus_tag LOCUS_14930 4628 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5158 4625 gene locus_tag LOCUS_14940 5158 4625 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB5 protein_id gnl|my_center|LOCUS_14940 5779 5315 gene locus_tag LOCUS_14950 gene yibK 5779 5315 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XDF6 protein_id gnl|my_center|LOCUS_14950 6309 5797 gene locus_tag LOCUS_14960 6309 5797 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763732.1 protein_id gnl|my_center|LOCUS_14960 6464 6721 gene locus_tag LOCUS_14970 6464 6721 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRL0 protein_id gnl|my_center|LOCUS_14970 6718 8079 gene locus_tag LOCUS_14980 gene tilS 6718 8079 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_14980 8242 9885 gene locus_tag LOCUS_14990 gene pyrG 8242 9885 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_14990 9885 10736 gene locus_tag LOCUS_15000 gene kdsA 9885 10736 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN0 protein_id gnl|my_center|LOCUS_15000 10850 12145 gene locus_tag LOCUS_15010 gene eno 10850 12145 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR0 protein_id gnl|my_center|LOCUS_15010 12256 12564 gene locus_tag LOCUS_15020 gene ftsB 12256 12564 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ6 protein_id gnl|my_center|LOCUS_15020 12561 13274 gene locus_tag LOCUS_15030 gene ispD 12561 13274 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ6 protein_id gnl|my_center|LOCUS_15030 13265 13738 gene locus_tag LOCUS_15040 gene ispF 13265 13738 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_15040 14041 13847 gene locus_tag LOCUS_15050 14041 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 14018 14851 gene locus_tag LOCUS_15060 gene truD 14018 14851 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_15060 >Feature sequence053 668 105 gene locus_tag LOCUS_15070 gene pgsA 668 105 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_15070 2565 742 gene locus_tag LOCUS_15080 gene uvrC 2565 742 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 protein_id gnl|my_center|LOCUS_15080 4509 2611 gene locus_tag LOCUS_15090 gene phoD 4509 2611 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_15090 5684 4590 gene locus_tag LOCUS_15100 gene kynU 5684 4590 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_15100 6856 5681 gene locus_tag LOCUS_15110 gene kynA 6856 5681 CDS product tryptophan 2,3-dioxygenase KynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074060.1 protein_id gnl|my_center|LOCUS_15110 7010 7507 gene locus_tag LOCUS_15120 7010 7507 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 protein_id gnl|my_center|LOCUS_15120 8497 7550 gene locus_tag LOCUS_15130 8497 7550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879212.1 protein_id gnl|my_center|LOCUS_15130 9962 8652 gene locus_tag LOCUS_15140 9962 8652 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_15140 10306 9959 gene locus_tag LOCUS_15150 10306 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10898 11866 gene locus_tag LOCUS_15160 gene dusA 10898 11866 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX9 protein_id gnl|my_center|LOCUS_15160 11872 12837 gene locus_tag LOCUS_15170 gene tal 11872 12837 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRF9 protein_id gnl|my_center|LOCUS_15170 12837 13280 gene locus_tag LOCUS_15180 12837 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262783.1 protein_id gnl|my_center|LOCUS_15180 13794 13309 gene locus_tag LOCUS_15190 13794 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_15190 14980 13796 gene locus_tag LOCUS_15200 14980 13796 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence054 2815 116 gene locus_tag LOCUS_15210 gene gyrA 2815 116 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T6 protein_id gnl|my_center|LOCUS_15210 3047 4369 gene locus_tag LOCUS_15220 3047 4369 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_15220 4448 5146 gene locus_tag LOCUS_15230 gene ubiG 4448 5146 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_15230 5157 5819 gene locus_tag LOCUS_15240 5157 5819 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_15240 5868 6635 gene locus_tag LOCUS_15250 gene yciK 5868 6635 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_15250 7549 6713 gene locus_tag LOCUS_15260 gene rluB 7549 6713 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PST1 protein_id gnl|my_center|LOCUS_15260 8348 7542 gene locus_tag LOCUS_15270 8348 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9259 8345 gene locus_tag LOCUS_15280 9259 8345 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_15280 9944 9330 gene locus_tag LOCUS_15290 9944 9330 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396553.1 protein_id gnl|my_center|LOCUS_15290 11490 10006 gene locus_tag LOCUS_15300 11490 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12074 11487 gene locus_tag LOCUS_15310 12074 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 12326 13057 gene locus_tag LOCUS_15320 12326 13057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_15320 13091 13390 gene locus_tag LOCUS_15330 gene yciL 13091 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_15330 13447 14253 gene locus_tag LOCUS_15340 13447 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14302 14958 gene locus_tag LOCUS_15350 gene ppiA 14302 14958 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E8 protein_id gnl|my_center|LOCUS_15350 >Feature sequence055 2513 489 gene locus_tag LOCUS_15360 gene fadH1 2513 489 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_15360 2703 3323 gene locus_tag LOCUS_15370 2703 3323 CDS product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701252.1 protein_id gnl|my_center|LOCUS_15370 3632 4303 gene locus_tag LOCUS_15380 3632 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4739 4458 gene locus_tag LOCUS_15390 4739 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5025 5109 gene locus_tag LOCUS_t00140 5025 5109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5141 6454 gene locus_tag LOCUS_15400 gene tig 5141 6454 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 protein_id gnl|my_center|LOCUS_15400 6548 7222 gene locus_tag LOCUS_15410 gene clpP 6548 7222 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_15410 7291 8577 gene locus_tag LOCUS_15420 gene clpX 7291 8577 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM6 protein_id gnl|my_center|LOCUS_15420 8816 8631 gene locus_tag LOCUS_15430 8816 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 8815 11229 gene locus_tag LOCUS_15440 gene lon 8815 11229 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_15440 11395 11667 gene locus_tag LOCUS_15450 gene hupB 11395 11667 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACF4 protein_id gnl|my_center|LOCUS_15450 11802 13658 gene locus_tag LOCUS_15460 11802 13658 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_15460 <14534 13865 gene locus_tag LOCUS_15470 <14534 13865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072517.1:lytic transglycosylase >Feature sequence056 <1 532 gene locus_tag LOCUS_15480 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888715.1:glycerophosphoryl diester phosphodiesterase 672 968 gene locus_tag LOCUS_15490 672 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1260 1126 gene locus_tag LOCUS_15500 1260 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1439 2095 gene locus_tag LOCUS_15510 1439 2095 CDS product amino acid efflux permease RhtB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 protein_id gnl|my_center|LOCUS_15510 2248 2919 gene locus_tag LOCUS_15520 2248 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_15520 3204 5318 gene locus_tag LOCUS_15530 3204 5318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_15530 5359 5607 gene locus_tag LOCUS_15540 5359 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 5611 6252 gene locus_tag LOCUS_15550 gene pnuT 5611 6252 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_15550 6224 7024 gene locus_tag LOCUS_15560 6224 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7008 7409 gene locus_tag LOCUS_15570 7008 7409 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 protein_id gnl|my_center|LOCUS_15570 7639 9291 gene locus_tag LOCUS_15580 gene rhlE 7639 9291 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J63 protein_id gnl|my_center|LOCUS_15580 9388 10953 gene locus_tag LOCUS_15590 9388 10953 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_15590 11100 11468 gene locus_tag LOCUS_15600 11100 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 12085 11507 gene locus_tag LOCUS_15610 12085 11507 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_15610 12231 13256 gene locus_tag LOCUS_15620 gene tdh 12231 13256 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence057 646 1647 gene locus_tag LOCUS_15630 gene oruR 646 1647 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_15630 2225 3565 gene locus_tag LOCUS_15640 2225 3565 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_15640 3655 4737 gene locus_tag LOCUS_15650 3655 4737 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_15650 5901 4993 gene locus_tag LOCUS_15660 5901 4993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931482.1 protein_id gnl|my_center|LOCUS_15660 7131 6004 gene locus_tag LOCUS_15670 7131 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 7529 7242 gene locus_tag LOCUS_15680 7529 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 7770 7576 gene locus_tag LOCUS_15690 7770 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7880 8353 gene locus_tag LOCUS_15700 7880 8353 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_15700 8775 8389 gene locus_tag LOCUS_15710 8775 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9001 11832 gene locus_tag LOCUS_15720 9001 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence058 2665 170 gene locus_tag LOCUS_15730 2665 170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_15730 3375 2665 gene locus_tag LOCUS_15740 3375 2665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_15740 3562 4083 gene locus_tag LOCUS_15750 3562 4083 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 protein_id gnl|my_center|LOCUS_15750 4598 4131 gene locus_tag LOCUS_15760 4598 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5596 4682 gene locus_tag LOCUS_15770 5596 4682 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_15770 7494 5725 gene locus_tag LOCUS_15780 7494 5725 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 protein_id gnl|my_center|LOCUS_15780 7760 7575 gene locus_tag LOCUS_15790 7760 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8490 7810 gene locus_tag LOCUS_15800 gene bioD 8490 7810 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 protein_id gnl|my_center|LOCUS_15800 10131 8542 gene locus_tag LOCUS_15810 10131 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 11297 10131 gene locus_tag LOCUS_15820 gene bioF 11297 10131 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I617 protein_id gnl|my_center|LOCUS_15820 12382 11327 gene locus_tag LOCUS_15830 gene bioB 12382 11327 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_15830 13369 12521 gene locus_tag LOCUS_15840 13369 12521 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_15840 <14206 13369 gene locus_tag LOCUS_15850 <14206 13369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268725.1:dehydrogenase >Feature sequence059 1240 746 gene locus_tag LOCUS_15860 gene ilvH 1240 746 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_15860 2976 1240 gene locus_tag LOCUS_15870 gene ilvI 2976 1240 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_15870 3406 3888 gene locus_tag LOCUS_15880 3406 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_15880 4077 5663 gene locus_tag LOCUS_15890 4077 5663 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_15890 6144 5761 gene locus_tag LOCUS_15900 gene panD 6144 5761 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_15900 7035 6184 gene locus_tag LOCUS_15910 gene panC 7035 6184 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_15910 8519 7071 gene locus_tag LOCUS_15920 gene dnaB 8519 7071 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_15920 9135 8686 gene locus_tag LOCUS_15930 gene rplI 9135 8686 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_15930 10031 9162 gene locus_tag LOCUS_15940 10031 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_15940 10274 10047 gene locus_tag LOCUS_15950 gene rpsR 10274 10047 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_15950 10765 10274 gene locus_tag LOCUS_15960 10765 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 11505 10927 gene locus_tag LOCUS_15970 11505 10927 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_15970 12459 11764 gene locus_tag LOCUS_15980 gene rlmB 12459 11764 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX2 protein_id gnl|my_center|LOCUS_15980 12586 13056 gene locus_tag LOCUS_15990 12586 13056 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence060 2375 672 gene locus_tag LOCUS_16000 2375 672 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_16000 2759 2526 gene locus_tag LOCUS_16010 2759 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3182 3526 gene locus_tag LOCUS_16020 gene pilZ 3182 3526 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_16020 3558 4334 gene locus_tag LOCUS_16030 3558 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_16030 4344 5021 gene locus_tag LOCUS_16040 4344 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_16040 5061 5684 gene locus_tag LOCUS_16050 gene dut 5061 5684 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_16050 5864 6844 gene locus_tag LOCUS_16060 gene mdh 5864 6844 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_16060 7055 7528 gene locus_tag LOCUS_16070 gene bcp 7055 7528 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365462.1 protein_id gnl|my_center|LOCUS_16070 7647 7976 gene locus_tag LOCUS_16080 7647 7976 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_16080 8047 9039 gene locus_tag LOCUS_16090 8047 9039 CDS product putative 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY68 protein_id gnl|my_center|LOCUS_16090 9081 10448 gene locus_tag LOCUS_16100 9081 10448 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_16100 10485 11393 gene locus_tag LOCUS_16110 10485 11393 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_16110 11437 11688 gene locus_tag LOCUS_16120 11437 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 12496 11708 gene locus_tag LOCUS_16130 12496 11708 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 protein_id gnl|my_center|LOCUS_16130 12686 13660 gene locus_tag LOCUS_16140 gene cysB 12686 13660 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence061 1957 1319 gene locus_tag LOCUS_16150 gene nuoB 1957 1319 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ2 protein_id gnl|my_center|LOCUS_16150 2376 1954 gene locus_tag LOCUS_16160 gene nuoA2 2376 1954 CDS product NADH-quinone oxidoreductase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K1 protein_id gnl|my_center|LOCUS_16160 4364 3072 gene locus_tag LOCUS_16170 gene purA 4364 3072 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_16170 5599 4421 gene locus_tag LOCUS_16180 gene hisZ 5599 4421 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_16180 5874 5671 gene locus_tag LOCUS_16190 5874 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_16190 6927 6058 gene locus_tag LOCUS_16200 6927 6058 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_16200 8054 6924 gene locus_tag LOCUS_16210 8054 6924 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_16210 9437 8142 gene locus_tag LOCUS_16220 gene hflX 9437 8142 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MN66 protein_id gnl|my_center|LOCUS_16220 9730 9443 gene locus_tag LOCUS_16230 9730 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 10825 9836 gene locus_tag LOCUS_16240 gene miaA 10825 9836 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2C7 protein_id gnl|my_center|LOCUS_16240 12683 10830 gene locus_tag LOCUS_16250 gene mutL 12683 10830 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_16250 <13740 12775 gene locus_tag LOCUS_16260 <13740 12775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123571.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence062 709 191 gene locus_tag LOCUS_16270 gene secB 709 191 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS8 protein_id gnl|my_center|LOCUS_16270 1035 751 gene locus_tag LOCUS_16280 gene grx 1035 751 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU55 protein_id gnl|my_center|LOCUS_16280 1503 1090 gene locus_tag LOCUS_16290 1503 1090 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 protein_id gnl|my_center|LOCUS_16290 2544 1723 gene locus_tag LOCUS_16300 2544 1723 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947171.1 protein_id gnl|my_center|LOCUS_16300 2607 3134 gene locus_tag LOCUS_16310 gene sprT 2607 3134 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP4 protein_id gnl|my_center|LOCUS_16310 3131 3379 gene locus_tag LOCUS_16320 gene yhbQ 3131 3379 CDS product UPF0213 protein YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45472 protein_id gnl|my_center|LOCUS_16320 3560 4276 gene locus_tag LOCUS_16330 gene hutC 3560 4276 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 protein_id gnl|my_center|LOCUS_16330 4340 4825 gene locus_tag LOCUS_16340 4340 4825 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 protein_id gnl|my_center|LOCUS_16340 5192 4818 gene locus_tag LOCUS_16350 5192 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6526 5297 gene locus_tag LOCUS_16360 6526 5297 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_16360 7589 6576 gene locus_tag LOCUS_16370 gene gapA 7589 6576 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_16370 7856 8023 gene locus_tag LOCUS_16380 7856 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8652 8167 gene locus_tag LOCUS_16390 gene slyD 8652 8167 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_16390 8816 9538 gene locus_tag LOCUS_16400 gene phoB 8816 9538 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_16400 9595 10875 gene locus_tag LOCUS_16410 gene phoR 9595 10875 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_16410 11825 10890 gene locus_tag LOCUS_16420 11825 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 12342 11944 gene locus_tag LOCUS_16430 gene cueR 12342 11944 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261479.1 protein_id gnl|my_center|LOCUS_16430 12928 12431 gene locus_tag LOCUS_16440 12928 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence063 1067 2134 gene locus_tag LOCUS_16450 1067 2134 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_16450 2482 4710 gene locus_tag LOCUS_16460 2482 4710 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_16460 5639 4812 gene locus_tag LOCUS_16470 gene paaG 5639 4812 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_16470 7523 5721 gene locus_tag LOCUS_16480 gene atuH 7523 5721 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_16480 8363 7587 gene locus_tag LOCUS_16490 8363 7587 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_16490 9062 8472 gene locus_tag LOCUS_16500 9062 8472 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_16500 10319 9276 gene locus_tag LOCUS_16510 10319 9276 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_16510 11424 10393 gene locus_tag LOCUS_16520 11424 10393 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_16520 11846 12748 gene locus_tag LOCUS_16530 11846 12748 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703499.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence064 430 1410 gene locus_tag LOCUS_16540 gene lipA 430 1410 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN84 protein_id gnl|my_center|LOCUS_16540 1931 1596 gene locus_tag LOCUS_16550 1931 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3097 2003 gene locus_tag LOCUS_16560 gene dinB 3097 2003 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 protein_id gnl|my_center|LOCUS_16560 6448 3287 gene locus_tag LOCUS_16570 6448 3287 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_16570 7593 6466 gene locus_tag LOCUS_16580 7593 6466 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_16580 7960 9279 gene locus_tag LOCUS_16590 7960 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9426 9956 gene locus_tag LOCUS_16600 gene ppa1 9426 9956 CDS product inorganic pyrophosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M7 protein_id gnl|my_center|LOCUS_16600 10978 10058 gene locus_tag LOCUS_16610 gene rpoS 10978 10058 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKC7 protein_id gnl|my_center|LOCUS_16610 11841 11188 gene locus_tag LOCUS_16620 11841 11188 CDS product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 protein_id gnl|my_center|LOCUS_16620 12956 12015 gene locus_tag LOCUS_16630 12956 12015 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence065 <1 652 gene locus_tag LOCUS_16640 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454994.1:aminopeptidase 957 1916 gene locus_tag LOCUS_16650 957 1916 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_16650 1978 2649 gene locus_tag LOCUS_16660 1978 2649 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_16660 2747 3220 gene locus_tag LOCUS_16670 gene moaC 2747 3220 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMD3 protein_id gnl|my_center|LOCUS_16670 3213 3452 gene locus_tag LOCUS_16680 gene moaD 3213 3452 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 protein_id gnl|my_center|LOCUS_16680 3455 3973 gene locus_tag LOCUS_16690 gene moaE 3455 3973 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418591.1 protein_id gnl|my_center|LOCUS_16690 3954 4559 gene locus_tag LOCUS_16700 gene mobA 3954 4559 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9U5 protein_id gnl|my_center|LOCUS_16700 4556 5305 gene locus_tag LOCUS_16710 gene thiF 4556 5305 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312942.2 protein_id gnl|my_center|LOCUS_16710 5434 5958 gene locus_tag LOCUS_16720 5434 5958 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_16720 5958 7136 gene locus_tag LOCUS_16730 5958 7136 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_16730 7158 8168 gene locus_tag LOCUS_16740 gene moaA 7158 8168 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_16740 8174 8932 gene locus_tag LOCUS_16750 8174 8932 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6S5 protein_id gnl|my_center|LOCUS_16750 9133 10410 gene locus_tag LOCUS_16760 9133 10410 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_16760 11298 11651 gene locus_tag LOCUS_16770 11298 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 12077 12448 gene locus_tag LOCUS_16780 12077 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence066 405 1289 gene locus_tag LOCUS_16790 405 1289 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482423.1 protein_id gnl|my_center|LOCUS_16790 1295 2932 gene locus_tag LOCUS_16800 1295 2932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975887.1 protein_id gnl|my_center|LOCUS_16800 2972 3718 gene locus_tag LOCUS_16810 2972 3718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707378.1 protein_id gnl|my_center|LOCUS_16810 4438 3815 gene locus_tag LOCUS_16820 gene msrA 4438 3815 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 protein_id gnl|my_center|LOCUS_16820 5729 4503 gene locus_tag LOCUS_16830 gene metZ 5729 4503 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_16830 7297 5756 gene locus_tag LOCUS_16840 gene purF 7297 5756 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_16840 7801 7301 gene locus_tag LOCUS_16850 7801 7301 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 protein_id gnl|my_center|LOCUS_16850 8298 7816 gene locus_tag LOCUS_16860 8298 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 9689 8334 gene locus_tag LOCUS_16870 gene folC 9689 8334 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z501 protein_id gnl|my_center|LOCUS_16870 10554 9682 gene locus_tag LOCUS_16880 gene accD 10554 9682 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_16880 11336 10716 gene locus_tag LOCUS_16890 gene trpF 11336 10716 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9X5 protein_id gnl|my_center|LOCUS_16890 12278 11421 gene locus_tag LOCUS_16900 gene truA 12278 11421 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E455 protein_id gnl|my_center|LOCUS_16900 >Feature sequence067 <1 1085 gene locus_tag LOCUS_16910 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263282.1:mechanosensitive ion channel protein MscS 1520 2461 gene locus_tag LOCUS_16920 1520 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2510 3130 gene locus_tag LOCUS_16930 gene blc 2510 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_16930 4470 3220 gene locus_tag LOCUS_16940 4470 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 8068 4535 gene locus_tag LOCUS_16950 gene mfd 8068 4535 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_16950 8267 9736 gene locus_tag LOCUS_16960 8267 9736 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_16960 10117 11457 gene locus_tag LOCUS_16970 gene nqrA 10117 11457 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_16970 >Feature sequence068 950 288 gene locus_tag LOCUS_16980 950 288 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EK85 protein_id gnl|my_center|LOCUS_16980 906 1097 gene locus_tag LOCUS_16990 906 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2166 1099 gene locus_tag LOCUS_17000 2166 1099 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH8 protein_id gnl|my_center|LOCUS_17000 2252 3244 gene locus_tag LOCUS_17010 gene bamD 2252 3244 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_17010 3279 4112 gene locus_tag LOCUS_17020 gene nadE 3279 4112 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMW1 protein_id gnl|my_center|LOCUS_17020 4157 5491 gene locus_tag LOCUS_17030 4157 5491 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_17030 7384 5978 gene locus_tag LOCUS_17040 7384 5978 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_17040 8763 7450 gene locus_tag LOCUS_17050 8763 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931585.1 protein_id gnl|my_center|LOCUS_17050 10103 8817 gene locus_tag LOCUS_17060 10103 8817 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529090.1 protein_id gnl|my_center|LOCUS_17060 10478 10402 gene locus_tag LOCUS_t00150 10478 10402 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10625 12034 gene locus_tag LOCUS_17070 gene cpsB 10625 12034 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence069 493 1152 gene locus_tag LOCUS_17080 493 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1149 2681 gene locus_tag LOCUS_17090 1149 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_17090 2731 3435 gene locus_tag LOCUS_17100 2731 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4215 3448 gene locus_tag LOCUS_17110 4215 3448 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_17110 5471 4215 gene locus_tag LOCUS_17120 gene trpB 5471 4215 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9W3 protein_id gnl|my_center|LOCUS_17120 6119 8281 gene locus_tag LOCUS_17130 gene nrdJa 6119 8281 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_17130 8322 9014 gene locus_tag LOCUS_17140 gene nrdJb 8322 9014 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_17140 9861 9598 gene locus_tag LOCUS_17150 9861 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10201 11673 gene locus_tag LOCUS_17160 10201 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence070 142 609 gene locus_tag LOCUS_17170 gene infC 142 609 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_17170 700 894 gene locus_tag LOCUS_17180 gene rpmI 700 894 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A1 protein_id gnl|my_center|LOCUS_17180 921 1277 gene locus_tag LOCUS_17190 gene rplT 921 1277 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A481 protein_id gnl|my_center|LOCUS_17190 1404 2417 gene locus_tag LOCUS_17200 gene pheS 1404 2417 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_17200 2431 4809 gene locus_tag LOCUS_17210 gene pheT 2431 4809 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 protein_id gnl|my_center|LOCUS_17210 4882 5181 gene locus_tag LOCUS_17220 gene ihfA 4882 5181 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_17220 5165 5524 gene locus_tag LOCUS_17230 5165 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_17230 5585 5661 gene locus_tag LOCUS_t00160 5585 5661 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6811 6353 gene locus_tag LOCUS_17240 6811 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 7550 6966 gene locus_tag LOCUS_17250 7550 6966 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_17250 7719 9197 gene locus_tag LOCUS_17260 7719 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLN7 protein_id gnl|my_center|LOCUS_17260 9194 10303 gene locus_tag LOCUS_17270 9194 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_17270 11208 10423 gene locus_tag LOCUS_17280 11208 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 11134 11691 gene locus_tag LOCUS_17290 gene narI 11134 11691 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence071 121 1134 gene locus_tag LOCUS_17300 gene rr07 121 1134 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_17300 1356 4268 gene locus_tag LOCUS_17310 gene preP2 1356 4268 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_17310 4274 5011 gene locus_tag LOCUS_17320 gene cmoA 4274 5011 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QV4 protein_id gnl|my_center|LOCUS_17320 6478 5045 gene locus_tag LOCUS_17330 gene putA 6478 5045 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_17330 6885 6664 gene locus_tag LOCUS_17340 gene slyX 6885 6664 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 protein_id gnl|my_center|LOCUS_17340 6978 7967 gene locus_tag LOCUS_17350 gene cmoB 6978 7967 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE6 protein_id gnl|my_center|LOCUS_17350 8035 8598 gene locus_tag LOCUS_17360 8035 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 8635 9348 gene locus_tag LOCUS_17370 8635 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_17370 10491 9376 gene locus_tag LOCUS_17380 gene ald 10491 9376 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_17380 10644 11138 gene locus_tag LOCUS_17390 10644 11138 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 protein_id gnl|my_center|LOCUS_17390 11236 11312 gene locus_tag LOCUS_t00170 11236 11312 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 557 2746 gene locus_tag LOCUS_17400 557 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2751 3341 gene locus_tag LOCUS_17410 2751 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3419 3494 gene locus_tag LOCUS_t00180 3419 3494 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3508 4218 gene locus_tag LOCUS_17420 3508 4218 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_17420 6416 4215 gene locus_tag LOCUS_17430 6416 4215 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_17430 6617 6432 gene locus_tag LOCUS_17440 6617 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6677 6901 gene locus_tag LOCUS_17450 6677 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 6917 8770 gene locus_tag LOCUS_17460 6917 8770 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5G5 protein_id gnl|my_center|LOCUS_17460 8825 10198 gene locus_tag LOCUS_17470 gene pabB 8825 10198 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_17470 <11481 10264 gene locus_tag LOCUS_17480 <11481 10264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458682.1:valine--pyruvate transaminase >Feature sequence073 <1 1292 gene locus_tag LOCUS_17490 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707862.1:ATP-dependent protease note possible pseudo, internal stop codon 1293 1502 gene locus_tag LOCUS_17500 1293 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17500 2348 1533 gene locus_tag LOCUS_17510 2348 1533 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_17510 2503 3300 gene locus_tag LOCUS_17520 2503 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3666 4583 gene locus_tag LOCUS_17530 3666 4583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_17530 4583 5197 gene locus_tag LOCUS_17540 4583 5197 CDS product homoserine lactone transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263918.1 protein_id gnl|my_center|LOCUS_17540 5647 6651 gene locus_tag LOCUS_17550 5647 6651 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_17550 6727 7050 gene locus_tag LOCUS_17560 gene yciH 6727 7050 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 protein_id gnl|my_center|LOCUS_17560 7054 8973 gene locus_tag LOCUS_17570 7054 8973 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_17570 8977 9474 gene locus_tag LOCUS_17580 gene greB 8977 9474 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_17580 10085 9471 gene locus_tag LOCUS_17590 10085 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17590 10796 10113 gene locus_tag LOCUS_17600 10796 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17600 >Feature sequence074 345 2432 gene locus_tag LOCUS_17610 gene oprC 345 2432 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208134.1 protein_id gnl|my_center|LOCUS_17610 2446 3714 gene locus_tag LOCUS_17620 gene roxS 2446 3714 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_17620 3711 4238 gene locus_tag LOCUS_17630 gene roxR 3711 4238 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_17630 4730 4290 gene locus_tag LOCUS_17640 4730 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5616 4762 gene locus_tag LOCUS_17650 gene qmcA 5616 4762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_17650 6129 5677 gene locus_tag LOCUS_17660 6129 5677 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_17660 6714 6208 gene locus_tag LOCUS_17670 gene rimI 6714 6208 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVB7 protein_id gnl|my_center|LOCUS_17670 7501 6749 gene locus_tag LOCUS_17680 7501 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9060 7501 gene locus_tag LOCUS_17690 gene leuA 9060 7501 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_17690 10208 9414 gene locus_tag LOCUS_17700 gene pssA 10208 9414 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence075 838 2568 gene locus_tag LOCUS_17710 838 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_17710 2741 4141 gene locus_tag LOCUS_17720 2741 4141 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768718.1 protein_id gnl|my_center|LOCUS_17720 4215 4580 gene locus_tag LOCUS_17730 4215 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4673 6625 gene locus_tag LOCUS_17740 4673 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_17740 7113 9272 gene locus_tag LOCUS_17750 7113 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008992010.1 protein_id gnl|my_center|LOCUS_17750 <10600 9543 gene locus_tag LOCUS_17760 <10600 9543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000160066.1:GGDEF-domain containing protein >Feature sequence076 1651 707 gene locus_tag LOCUS_17770 gene prmB 1651 707 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_17770 1770 2312 gene locus_tag LOCUS_17780 gene folE2 1770 2312 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_17780 2773 2435 gene locus_tag LOCUS_17790 2773 2435 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQG4 protein_id gnl|my_center|LOCUS_17790 2894 3286 gene locus_tag LOCUS_17800 gene dgkA 2894 3286 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF02 protein_id gnl|my_center|LOCUS_17800 3537 3283 gene locus_tag LOCUS_17810 3537 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265623.1 protein_id gnl|my_center|LOCUS_17810 4444 3581 gene locus_tag LOCUS_17820 4444 3581 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_17820 5144 4707 gene locus_tag LOCUS_17830 5144 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 6231 5134 gene locus_tag LOCUS_17840 gene gpsA 6231 5134 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_17840 8290 6350 gene locus_tag LOCUS_17850 gene htpG 8290 6350 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_17850 8851 8393 gene locus_tag LOCUS_17860 8851 8393 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_17860 9378 8851 gene locus_tag LOCUS_17870 9378 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 10480 9608 gene locus_tag LOCUS_17880 gene sucD 10480 9608 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_17880 >Feature sequence077 1134 1967 gene locus_tag LOCUS_17890 1134 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1993 2424 gene locus_tag LOCUS_17900 gene rnhA 1993 2424 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_17900 2462 3181 gene locus_tag LOCUS_17910 gene dnaQ 2462 3181 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104689.1 protein_id gnl|my_center|LOCUS_17910 3191 7147 gene locus_tag LOCUS_17920 gene hrpA 3191 7147 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_17920 7276 7656 gene locus_tag LOCUS_17930 7276 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 7737 8633 gene locus_tag LOCUS_17940 7737 8633 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_17940 8630 9400 gene locus_tag LOCUS_17950 8630 9400 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_17950 9492 10232 gene locus_tag LOCUS_17960 9492 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence078 2 1135 gene locus_tag LOCUS_17970 2 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3446 1260 gene locus_tag LOCUS_17980 3446 1260 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099343.1 protein_id gnl|my_center|LOCUS_17980 3641 4789 gene locus_tag LOCUS_17990 gene dgoD 3641 4789 CDS product D-galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENQ7 protein_id gnl|my_center|LOCUS_17990 5244 4846 gene locus_tag LOCUS_18000 5244 4846 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_18000 6510 5344 gene locus_tag LOCUS_18010 6510 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 7616 6741 gene locus_tag LOCUS_18020 7616 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8434 7730 gene locus_tag LOCUS_18030 8434 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 8622 9818 gene locus_tag LOCUS_18040 8622 9818 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence079 696 2567 gene locus_tag LOCUS_18050 696 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_18050 2564 3169 gene locus_tag LOCUS_18060 gene lolB 2564 3169 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C4 protein_id gnl|my_center|LOCUS_18060 3183 4052 gene locus_tag LOCUS_18070 gene ispE 3183 4052 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_18070 4031 4106 gene locus_tag LOCUS_t00190 4031 4106 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4149 5078 gene locus_tag LOCUS_18080 gene prs 4149 5078 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX2 protein_id gnl|my_center|LOCUS_18080 5172 5825 gene locus_tag LOCUS_18090 gene rplY 5172 5825 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_18090 5859 6446 gene locus_tag LOCUS_18100 gene pth 5859 6446 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_18100 6475 7566 gene locus_tag LOCUS_18110 gene ychF 6475 7566 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_18110 7579 8505 gene locus_tag LOCUS_18120 7579 8505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268573.1 protein_id gnl|my_center|LOCUS_18120 9138 9214 gene locus_tag LOCUS_t00200 9138 9214 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 782 462 gene locus_tag LOCUS_18130 782 462 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_18130 1959 787 gene locus_tag LOCUS_18140 gene oadB 1959 787 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_18140 3765 1975 gene locus_tag LOCUS_18150 3765 1975 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_18150 4113 3868 gene locus_tag LOCUS_18160 4113 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4302 6041 gene locus_tag LOCUS_18170 gene argS 4302 6041 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6L2 protein_id gnl|my_center|LOCUS_18170 6684 6199 gene locus_tag LOCUS_18180 6684 6199 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088456.1 protein_id gnl|my_center|LOCUS_18180 8295 6805 gene locus_tag LOCUS_18190 8295 6805 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_18190 9213 8377 gene locus_tag LOCUS_18200 gene ttcA 9213 8377 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG9 protein_id gnl|my_center|LOCUS_18200 >Feature sequence081 169 390 gene locus_tag LOCUS_18210 169 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 556 1095 gene locus_tag LOCUS_18220 556 1095 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_18220 1088 1852 gene locus_tag LOCUS_18230 gene znuC 1088 1852 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZS2 protein_id gnl|my_center|LOCUS_18230 1845 2630 gene locus_tag LOCUS_18240 gene znuB 1845 2630 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_18240 3271 2627 gene locus_tag LOCUS_18250 gene senC 3271 2627 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_18250 4241 3336 gene locus_tag LOCUS_18260 gene cyoE1 4241 3336 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_18260 4933 4316 gene locus_tag LOCUS_18270 4933 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5718 4930 gene locus_tag LOCUS_18280 5718 4930 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_18280 5764 6039 gene locus_tag LOCUS_18290 5764 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7160 6219 gene locus_tag LOCUS_18300 gene coxC 7160 6219 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_18300 7753 7202 gene locus_tag LOCUS_18310 7753 7202 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_18310 9341 7767 gene locus_tag LOCUS_18320 gene coxA 9341 7767 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_18320 >Feature sequence082 355 107 gene locus_tag LOCUS_18330 355 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 991 901 gene locus_tag LOCUS_t00210 991 901 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1454 1239 gene locus_tag LOCUS_18340 gene csrA 1454 1239 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 protein_id gnl|my_center|LOCUS_18340 2868 1651 gene locus_tag LOCUS_18350 gene lysC 2868 1651 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_18350 5561 2967 gene locus_tag LOCUS_18360 gene alaS 5561 2967 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_18360 6138 5776 gene locus_tag LOCUS_18370 6138 5776 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 protein_id gnl|my_center|LOCUS_18370 6378 6169 gene locus_tag LOCUS_18380 6378 6169 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_18380 7298 6492 gene locus_tag LOCUS_18390 7298 6492 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_18390 7868 7392 gene locus_tag LOCUS_18400 7868 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 8013 8954 gene locus_tag LOCUS_18410 8013 8954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence083 510 1952 gene locus_tag LOCUS_18420 gene flrC 510 1952 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 protein_id gnl|my_center|LOCUS_18420 1964 2311 gene locus_tag LOCUS_18430 gene fliE 1964 2311 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YV9 protein_id gnl|my_center|LOCUS_18430 2336 4135 gene locus_tag LOCUS_18440 gene fliF1 2336 4135 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V7 protein_id gnl|my_center|LOCUS_18440 4155 5222 gene locus_tag LOCUS_18450 gene fliG 4155 5222 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V6 protein_id gnl|my_center|LOCUS_18450 5194 6270 gene locus_tag LOCUS_18460 5194 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 6263 7597 gene locus_tag LOCUS_18470 gene fliI 6263 7597 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073109.1 protein_id gnl|my_center|LOCUS_18470 7594 8037 gene locus_tag LOCUS_18480 7594 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence084 1386 445 gene locus_tag LOCUS_18490 1386 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_18490 2339 1386 gene locus_tag LOCUS_18500 2339 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_18500 2556 7421 gene locus_tag LOCUS_18510 gene gdhB 2556 7421 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_18510 8095 8625 gene locus_tag LOCUS_18520 8095 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence085 664 38 gene locus_tag LOCUS_18530 664 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1494 661 gene locus_tag LOCUS_18540 1494 661 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_18540 2236 1595 gene locus_tag LOCUS_18550 gene ydaL 2236 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418232.1 protein_id gnl|my_center|LOCUS_18550 2392 2877 gene locus_tag LOCUS_18560 2392 2877 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_18560 2891 3673 gene locus_tag LOCUS_18570 2891 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3740 4987 gene locus_tag LOCUS_18580 3740 4987 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263259.1 protein_id gnl|my_center|LOCUS_18580 5691 5023 gene locus_tag LOCUS_18590 gene nfnB 5691 5023 CDS product nitroreductase NfnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D0 protein_id gnl|my_center|LOCUS_18590 7676 5865 gene locus_tag LOCUS_18600 gene mmgC 7676 5865 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_18600 8596 7688 gene locus_tag LOCUS_18610 8596 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence086 62 874 gene locus_tag LOCUS_18620 62 874 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_18620 973 2166 gene locus_tag LOCUS_18630 gene aspC 973 2166 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_18630 2683 2174 gene locus_tag LOCUS_18640 2683 2174 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_18640 3632 2856 gene locus_tag LOCUS_18650 3632 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_18650 5464 3725 gene locus_tag LOCUS_18660 5464 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_18660 7347 5476 gene locus_tag LOCUS_18670 7347 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8344 7340 gene locus_tag LOCUS_18680 gene batA 8344 7340 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence087 <1 912 gene locus_tag LOCUS_18690 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763685.1:sarcosine oxidase subunit alpha 905 1540 gene locus_tag LOCUS_18700 gene soxG 905 1540 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096784.1 protein_id gnl|my_center|LOCUS_18700 1653 3596 gene locus_tag LOCUS_18710 gene dnaX 1653 3596 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_18710 3669 3986 gene locus_tag LOCUS_18720 3669 3986 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_18720 4056 4649 gene locus_tag LOCUS_18730 gene recR 4056 4649 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65993 protein_id gnl|my_center|LOCUS_18730 4657 5802 gene locus_tag LOCUS_18740 gene rnd 4657 5802 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y81 protein_id gnl|my_center|LOCUS_18740 5799 6071 gene locus_tag LOCUS_18750 5799 6071 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CID0 protein_id gnl|my_center|LOCUS_18750 6071 6514 gene locus_tag LOCUS_18760 6071 6514 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJL2 protein_id gnl|my_center|LOCUS_18760 6517 6927 gene locus_tag LOCUS_18770 6517 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7733 7392 gene locus_tag LOCUS_18780 7733 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 8305 7730 gene locus_tag LOCUS_18790 8305 7730 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A642 protein_id gnl|my_center|LOCUS_18790 >Feature sequence088 2182 677 gene locus_tag LOCUS_18800 gene nhaB 2182 677 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_18800 2339 3172 gene locus_tag LOCUS_18810 2339 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3217 4296 gene locus_tag LOCUS_18820 3217 4296 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_18820 5435 4401 gene locus_tag LOCUS_18830 5435 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 6974 5670 gene locus_tag LOCUS_18840 6974 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 <8031 6974 gene locus_tag LOCUS_18850 <8031 6974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113015.1:cyclic di-GMP phosphodiesterase >Feature sequence089 <1 696 gene locus_tag LOCUS_18860 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CHY1:flagellar basal-body rod protein FlgG 706 1404 gene locus_tag LOCUS_18870 gene flgH 706 1404 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA1 protein_id gnl|my_center|LOCUS_18870 1441 2592 gene locus_tag LOCUS_18880 gene flgI1 1441 2592 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1T3 protein_id gnl|my_center|LOCUS_18880 2593 3072 gene locus_tag LOCUS_18890 2593 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3130 6135 gene locus_tag LOCUS_18900 3130 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6147 7067 gene locus_tag LOCUS_18910 6147 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence090 1219 2631 gene locus_tag LOCUS_18920 gene sdaA 1219 2631 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_18920 3814 2711 gene locus_tag LOCUS_18930 gene purC 3814 2711 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA43 protein_id gnl|my_center|LOCUS_18930 4046 4963 gene locus_tag LOCUS_18940 gene yfcH 4046 4963 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 protein_id gnl|my_center|LOCUS_18940 6534 4960 gene locus_tag LOCUS_18950 6534 4960 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_18950 <7853 6562 gene locus_tag LOCUS_18960 <7853 6562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113972.1:FAD-dependent glycerol-3-phosphate dehydrogenase >Feature sequence091 476 1516 gene locus_tag LOCUS_18970 476 1516 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_18970 2497 1517 gene locus_tag LOCUS_18980 2497 1517 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705110.1 protein_id gnl|my_center|LOCUS_18980 3351 2554 gene locus_tag LOCUS_18990 3351 2554 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_18990 6102 3577 gene locus_tag LOCUS_19000 6102 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence092 <1 988 gene locus_tag LOCUS_19010 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881828.1:flagellar hook-length control protein FliK 1027 1611 gene locus_tag LOCUS_19020 1027 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1660 2652 gene locus_tag LOCUS_19030 gene fliM 1660 2652 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI10 protein_id gnl|my_center|LOCUS_19030 2726 3052 gene locus_tag LOCUS_19040 2726 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3065 3460 gene locus_tag LOCUS_19050 3065 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3462 4232 gene locus_tag LOCUS_19060 gene fliP 3462 4232 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V7T3 protein_id gnl|my_center|LOCUS_19060 4242 4511 gene locus_tag LOCUS_19070 gene fliQ 4242 4511 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554277.1 protein_id gnl|my_center|LOCUS_19070 4511 5281 gene locus_tag LOCUS_19080 gene fliR 4511 5281 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MG24 protein_id gnl|my_center|LOCUS_19080 5281 6426 gene locus_tag LOCUS_19090 gene flhB 5281 6426 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence093 547 472 gene locus_tag LOCUS_t00220 547 472 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 890 618 gene locus_tag LOCUS_19100 890 618 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_19100 1995 943 gene locus_tag LOCUS_19110 1995 943 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297399.1 protein_id gnl|my_center|LOCUS_19110 3906 2038 gene locus_tag LOCUS_19120 gene asmA 3906 2038 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 protein_id gnl|my_center|LOCUS_19120 6105 3934 gene locus_tag LOCUS_19130 gene phuR 6105 3934 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_19130 6548 7141 gene locus_tag LOCUS_19140 gene hisB 6548 7141 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_19140 >Feature sequence094 2569 632 gene locus_tag LOCUS_19150 gene acsA2 2569 632 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_19150 3631 2774 gene locus_tag LOCUS_19160 gene hexR 3631 2774 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375897.1 protein_id gnl|my_center|LOCUS_19160 3873 4901 gene locus_tag LOCUS_19170 gene gapA 3873 4901 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_19170 4891 6336 gene locus_tag LOCUS_19180 gene pykA 4891 6336 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 protein_id gnl|my_center|LOCUS_19180 >Feature sequence095 265 2106 gene locus_tag LOCUS_19190 265 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2137 2607 gene locus_tag LOCUS_19200 2137 2607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_19200 2701 3180 gene locus_tag LOCUS_19210 2701 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19210 3187 3633 gene locus_tag LOCUS_19220 3187 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4346 3666 gene locus_tag LOCUS_19230 4346 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4987 4346 gene locus_tag LOCUS_19240 gene wcaA 4987 4346 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_19240 5832 4984 gene locus_tag LOCUS_19250 gene mtnP 5832 4984 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_19250 >Feature sequence096 50 1072 gene locus_tag LOCUS_19260 gene epd 50 1072 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB2 protein_id gnl|my_center|LOCUS_19260 1106 2269 gene locus_tag LOCUS_19270 gene pgk 1106 2269 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK3 protein_id gnl|my_center|LOCUS_19270 2360 3424 gene locus_tag LOCUS_19280 2360 3424 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_19280 3543 3764 gene locus_tag LOCUS_19290 3543 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3757 4389 gene locus_tag LOCUS_19300 3757 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4670 4984 gene locus_tag LOCUS_19310 4670 4984 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_19310 5018 5494 gene locus_tag LOCUS_19320 5018 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5793 6266 gene locus_tag LOCUS_19330 5793 6266 CDS product avidin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088404.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence097 1528 323 gene locus_tag LOCUS_19340 1528 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3563 1557 gene locus_tag LOCUS_19350 gene sepA 3563 1557 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989908.1 protein_id gnl|my_center|LOCUS_19350 5276 4095 gene locus_tag LOCUS_19360 5276 4095 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_19360 6283 5372 gene locus_tag LOCUS_19370 6283 5372 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence098 721 224 gene locus_tag LOCUS_19380 gene recX 721 224 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56647 protein_id gnl|my_center|LOCUS_19380 1869 832 gene locus_tag LOCUS_19390 gene recA 1869 832 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_19390 2436 1939 gene locus_tag LOCUS_19400 2436 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_19400 2666 5248 gene locus_tag LOCUS_19410 gene mutS 2666 5248 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_19410 5318 5686 gene locus_tag LOCUS_19420 gene fdxA 5318 5686 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_19420 5764 5840 gene locus_tag LOCUS_t00230 5764 5840 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 1286 261 gene locus_tag LOCUS_19430 gene rsgA 1286 261 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_19430 1396 1962 gene locus_tag LOCUS_19440 gene orn 1396 1962 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU2 protein_id gnl|my_center|LOCUS_19440 3073 1952 gene locus_tag LOCUS_19450 gene queG 3073 1952 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_19450 3130 4680 gene locus_tag LOCUS_19460 gene nnr 3130 4680 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_19460 4734 5288 gene locus_tag LOCUS_19470 4734 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence100 414 160 gene locus_tag LOCUS_19480 414 160 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_19480 2585 414 gene locus_tag LOCUS_19490 gene rlmL 2585 414 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_19490 2812 3018 gene locus_tag LOCUS_19500 2812 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4713 3337 gene locus_tag LOCUS_19510 4713 3337 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_19510 <5676 4771 gene locus_tag LOCUS_19520 <5676 4771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113096.1:protein AmbD >Feature sequence101 395 961 gene locus_tag LOCUS_19530 395 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1240 1154 gene locus_tag LOCUS_t00240 1240 1154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1586 1906 gene locus_tag LOCUS_19540 1586 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2002 3771 gene locus_tag LOCUS_19550 2002 3771 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_19550 3896 5263 gene locus_tag LOCUS_19560 gene manB 3896 5263 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85343 protein_id gnl|my_center|LOCUS_19560 >Feature sequence102 3738 1843 gene locus_tag LOCUS_19570 gene xcpQ 3738 1843 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_19570 4636 3788 gene locus_tag LOCUS_19580 4636 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 5126 4626 gene locus_tag LOCUS_19590 5126 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence103 1 309 gene locus_tag LOCUS_19600 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1923 433 gene locus_tag LOCUS_19610 gene prnA 1923 433 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 protein_id gnl|my_center|LOCUS_19610 2966 1947 gene locus_tag LOCUS_19620 2966 1947 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_19620 3757 3014 gene locus_tag LOCUS_19630 3757 3014 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039036.1 protein_id gnl|my_center|LOCUS_19630 5391 3814 gene locus_tag LOCUS_19640 5391 3814 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence104 1039 155 gene locus_tag LOCUS_19650 1039 155 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_19650 2984 1491 gene locus_tag LOCUS_19660 gene lysS 2984 1491 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_19660 4141 3209 gene locus_tag LOCUS_19670 gene prfB 4141 3209 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA8 protein_id gnl|my_center|LOCUS_19670 >Feature sequence105 895 2166 gene locus_tag LOCUS_19680 895 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3126 2212 gene locus_tag LOCUS_19690 gene argF 3126 2212 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_19690 4311 3133 gene locus_tag LOCUS_19700 gene argD 4311 3133 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_19700 5235 4516 gene locus_tag LOCUS_19710 5235 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence106 532 1278 gene locus_tag LOCUS_19720 532 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1374 2171 gene locus_tag LOCUS_19730 1374 2171 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK15 protein_id gnl|my_center|LOCUS_19730 2189 3199 gene locus_tag LOCUS_19740 gene birA 2189 3199 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y7 protein_id gnl|my_center|LOCUS_19740 3196 3936 gene locus_tag LOCUS_19750 gene coaX 3196 3936 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_19750 3933 4412 gene locus_tag LOCUS_19760 3933 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4435 4510 gene locus_tag LOCUS_t00250 4435 4510 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4730 4813 gene locus_tag LOCUS_t00260 4730 4813 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4910 4983 gene locus_tag LOCUS_t00270 4910 4983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5003 5077 gene locus_tag LOCUS_t00280 5003 5077 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 2910 1225 gene locus_tag LOCUS_19770 gene yidK 2910 1225 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_19770 3921 3262 gene locus_tag LOCUS_19780 3921 3262 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_19780 4130 4573 gene locus_tag LOCUS_19790 4130 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4702 5079 gene locus_tag LOCUS_19800 4702 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence108 2946 2500 gene locus_tag LOCUS_19810 2946 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3377 2946 gene locus_tag LOCUS_19820 3377 2946 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_19820 4854 3385 gene locus_tag LOCUS_19830 gene pepA 4854 3385 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_19830 >Feature sequence109 1 1245 gene locus_tag LOCUS_19840 1 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1263 2564 gene locus_tag LOCUS_19850 gene flhF 1263 2564 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 protein_id gnl|my_center|LOCUS_19850 2708 3538 gene locus_tag LOCUS_19860 2708 3538 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL0 protein_id gnl|my_center|LOCUS_19860 3541 4263 gene locus_tag LOCUS_19870 gene fliA 3541 4263 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQD4 protein_id gnl|my_center|LOCUS_19870 4271 4816 gene locus_tag LOCUS_19880 4271 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence110 713 3583 gene locus_tag LOCUS_19890 gene uvrA 713 3583 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_19890 4322 3612 gene locus_tag LOCUS_19900 4322 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_19900 4704 4339 gene locus_tag LOCUS_19910 4704 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence111 2103 265 gene locus_tag LOCUS_19920 gene atsA 2103 265 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_19920 2280 2936 gene locus_tag LOCUS_19930 gene paaG 2280 2936 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_19930 3228 3518 gene locus_tag LOCUS_19940 3228 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3577 4200 gene locus_tag LOCUS_19950 3577 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence112 2579 1506 gene locus_tag LOCUS_19960 gene wecA 2579 1506 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM92 protein_id gnl|my_center|LOCUS_19960 3043 2968 gene locus_tag LOCUS_t00290 3043 2968 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3314 3577 gene locus_tag LOCUS_19970 3314 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3609 3785 gene locus_tag LOCUS_19980 3609 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3819 4007 gene locus_tag LOCUS_19990 3819 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence113 2228 195 gene locus_tag LOCUS_20000 2228 195 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070205.1 protein_id gnl|my_center|LOCUS_20000 2971 2513 gene locus_tag LOCUS_20010 2971 2513 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 protein_id gnl|my_center|LOCUS_20010 3320 3072 gene locus_tag LOCUS_20020 3320 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4134 3331 gene locus_tag LOCUS_20030 gene fdhD 4134 3331 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_20030 >Feature sequence114 1149 160 gene locus_tag LOCUS_20040 1149 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2204 1146 gene locus_tag LOCUS_20050 2204 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3537 2197 gene locus_tag LOCUS_20060 3537 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4335 3541 gene locus_tag LOCUS_20070 4335 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence115 1599 49 gene locus_tag LOCUS_20080 gene fdsB 1599 49 CDS product NAD-dependent formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040336.1 protein_id gnl|my_center|LOCUS_20080 2084 1596 gene locus_tag LOCUS_20090 2084 1596 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 protein_id gnl|my_center|LOCUS_20090 3203 2352 gene locus_tag LOCUS_20100 gene frmB 3203 2352 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC6 protein_id gnl|my_center|LOCUS_20100 <4282 3203 gene locus_tag LOCUS_20110 <4282 3203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064805.1:S-(hydroxymethyl)glutathione dehydrogenase >Feature sequence116 1857 265 gene locus_tag LOCUS_20120 1857 265 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence117 861 1706 gene locus_tag LOCUS_20130 861 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_20130 1719 2894 gene locus_tag LOCUS_20140 1719 2894 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence118 150 1682 gene locus_tag LOCUS_20150 150 1682 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_20150 1711 3693 gene locus_tag LOCUS_20160 1711 3693 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence119 448 1116 gene locus_tag LOCUS_20170 448 1116 CDS product isomerase/hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 protein_id gnl|my_center|LOCUS_20170 1118 1336 gene locus_tag LOCUS_20180 1118 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_20180 1339 1755 gene locus_tag LOCUS_20190 gene yaeJ 1339 1755 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_20190 1801 2793 gene locus_tag LOCUS_20200 gene srkA 1801 2793 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_20200 >Feature sequence120 27 335 gene locus_tag LOCUS_20210 27 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 542 973 gene locus_tag LOCUS_20220 542 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1383 1087 gene locus_tag LOCUS_20230 1383 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941037.1 protein_id gnl|my_center|LOCUS_20230 2435 1380 gene locus_tag LOCUS_20240 2435 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2952 2482 gene locus_tag LOCUS_20250 2952 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence121 32 1477 gene locus_tag LOCUS_20260 32 1477 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_20260 1490 2479 gene locus_tag LOCUS_20270 1490 2479 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_20270