>Feature sequence01 1697 177 gene locus_tag LOCUS_00010 1697 177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_00010 4802 1725 gene locus_tag LOCUS_00020 4802 1725 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_00020 5854 5309 gene locus_tag LOCUS_00030 5854 5309 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_00030 6047 6961 gene locus_tag LOCUS_00040 6047 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7815 6958 gene locus_tag LOCUS_00050 7815 6958 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705418.1 protein_id gnl|my_center|LOCUS_00050 9250 7880 gene locus_tag LOCUS_00060 gene wcaJ 9250 7880 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_00060 9411 10082 gene locus_tag LOCUS_00070 9411 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_00070 11866 10079 gene locus_tag LOCUS_00080 11866 10079 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_00080 12652 12053 gene locus_tag LOCUS_00090 12652 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14087 12942 gene locus_tag LOCUS_00100 gene lolE 14087 12942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_00100 14569 14183 gene locus_tag LOCUS_00110 14569 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14740 16041 gene locus_tag LOCUS_00120 14740 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16277 17548 gene locus_tag LOCUS_00130 16277 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17793 18401 gene locus_tag LOCUS_00140 17793 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18398 19525 gene locus_tag LOCUS_00150 18398 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19540 21282 gene locus_tag LOCUS_00160 19540 21282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21310 22767 gene locus_tag LOCUS_00170 21310 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22808 23242 gene locus_tag LOCUS_00180 22808 23242 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_00180 23246 23713 gene locus_tag LOCUS_00190 23246 23713 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_00190 23721 23876 gene locus_tag LOCUS_00200 23721 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23888 24688 gene locus_tag LOCUS_00210 23888 24688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24681 26435 gene locus_tag LOCUS_00220 24681 26435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26438 26716 gene locus_tag LOCUS_00230 26438 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_00230 26718 27131 gene locus_tag LOCUS_00240 26718 27131 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_00240 27128 30520 gene locus_tag LOCUS_00250 27128 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30531 34772 gene locus_tag LOCUS_00260 30531 34772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34784 38425 gene locus_tag LOCUS_00270 34784 38425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 38425 39987 gene locus_tag LOCUS_00280 38425 39987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39981 41330 gene locus_tag LOCUS_00290 39981 41330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 41327 41515 gene locus_tag LOCUS_00300 41327 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 41517 45317 gene locus_tag LOCUS_00310 41517 45317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 45727 46299 gene locus_tag LOCUS_00320 45727 46299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 46373 46954 gene locus_tag LOCUS_00330 46373 46954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 47299 47168 gene locus_tag LOCUS_00340 47299 47168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 47453 47277 gene locus_tag LOCUS_00350 47453 47277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47518 47856 gene locus_tag LOCUS_00360 47518 47856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 48049 48951 gene locus_tag LOCUS_00370 48049 48951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 49475 49038 gene locus_tag LOCUS_00380 49475 49038 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_00380 50457 49600 gene locus_tag LOCUS_00390 gene tatC 50457 49600 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_00390 51742 50474 gene locus_tag LOCUS_00400 gene glyA 51742 50474 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_00400 51889 52263 gene locus_tag LOCUS_00410 51889 52263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 52811 53500 gene locus_tag LOCUS_00420 52811 53500 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906865.1 protein_id gnl|my_center|LOCUS_00420 54304 53501 gene locus_tag LOCUS_00430 54304 53501 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_00430 55014 54322 gene locus_tag LOCUS_00440 gene rsmI 55014 54322 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_00440 55244 55011 gene locus_tag LOCUS_00450 55244 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55525 55256 gene locus_tag LOCUS_00460 55525 55256 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_00460 57726 55615 gene locus_tag LOCUS_00470 57726 55615 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_00470 59099 57810 gene locus_tag LOCUS_00480 59099 57810 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00480 59311 59102 gene locus_tag LOCUS_00490 59311 59102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59931 59389 gene locus_tag LOCUS_00500 59931 59389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61322 60015 gene locus_tag LOCUS_00510 61322 60015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62701 61418 gene locus_tag LOCUS_00520 62701 61418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_00520 63407 62691 gene locus_tag LOCUS_00530 gene coaX 63407 62691 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_00530 63512 64585 gene locus_tag LOCUS_00540 63512 64585 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_00540 64657 65883 gene locus_tag LOCUS_00550 64657 65883 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_00550 66065 67591 gene locus_tag LOCUS_00560 66065 67591 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_00560 67817 68401 gene locus_tag LOCUS_00570 67817 68401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 69088 68495 gene locus_tag LOCUS_00580 gene tag 69088 68495 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_00580 69177 70331 gene locus_tag LOCUS_00590 gene alr 69177 70331 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_00590 71182 70328 gene locus_tag LOCUS_00600 gene purU 71182 70328 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_00600 71903 71295 gene locus_tag LOCUS_00610 71903 71295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72695 71958 gene locus_tag LOCUS_00620 72695 71958 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_00620 73627 72692 gene locus_tag LOCUS_00630 73627 72692 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_00630 74456 73686 gene locus_tag LOCUS_00640 74456 73686 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_00640 75888 74473 gene locus_tag LOCUS_00650 75888 74473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_00650 76987 76034 gene locus_tag LOCUS_00660 gene dfrA 76987 76034 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_00660 77749 77003 gene locus_tag LOCUS_00670 77749 77003 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_00670 78300 77749 gene locus_tag LOCUS_00680 78300 77749 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_00680 78501 79751 gene locus_tag LOCUS_00690 gene hflX 78501 79751 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_00690 79880 80959 gene locus_tag LOCUS_00700 79880 80959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 81070 82740 gene locus_tag LOCUS_00710 81070 82740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 84491 82896 gene locus_tag LOCUS_00720 84491 82896 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_00720 84694 85038 gene locus_tag LOCUS_00730 84694 85038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 85044 85193 gene locus_tag LOCUS_00740 85044 85193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 85183 85434 gene locus_tag LOCUS_00750 85183 85434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 85487 86002 gene locus_tag LOCUS_00760 85487 86002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88383 86056 gene locus_tag LOCUS_00770 gene metE 88383 86056 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 protein_id gnl|my_center|LOCUS_00770 90441 89065 gene locus_tag LOCUS_00780 90441 89065 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_00780 90596 90958 gene locus_tag LOCUS_00790 90596 90958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_00790 91598 91176 gene locus_tag LOCUS_00800 91598 91176 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_00800 95697 91591 gene locus_tag LOCUS_00810 95697 91591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 98882 96675 gene locus_tag LOCUS_00820 98882 96675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 99409 98984 gene locus_tag LOCUS_00830 99409 98984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_00830 99866 99456 gene locus_tag LOCUS_00840 99866 99456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 100305 99949 gene locus_tag LOCUS_00850 100305 99949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 100816 100460 gene locus_tag LOCUS_00860 100816 100460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 101792 100947 gene locus_tag LOCUS_00870 gene hpaG 101792 100947 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_00870 102185 104572 gene locus_tag LOCUS_00880 102185 104572 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_00880 105188 104679 gene locus_tag LOCUS_00890 105188 104679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105848 105231 gene locus_tag LOCUS_00900 105848 105231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 106407 105841 gene locus_tag LOCUS_00910 106407 105841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 107077 106553 gene locus_tag LOCUS_00920 107077 106553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 107411 107247 gene locus_tag LOCUS_00930 107411 107247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 108731 107613 gene locus_tag LOCUS_00940 108731 107613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 111387 108832 gene locus_tag LOCUS_00950 111387 108832 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_00950 111760 111993 gene locus_tag LOCUS_00960 111760 111993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 111995 112168 gene locus_tag LOCUS_00970 111995 112168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 112537 113205 gene locus_tag LOCUS_00980 112537 113205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_00980 114115 113228 gene locus_tag LOCUS_00990 114115 113228 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_00990 114342 115607 gene locus_tag LOCUS_01000 114342 115607 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_01000 115635 117449 gene locus_tag LOCUS_01010 115635 117449 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_01010 117581 118312 gene locus_tag LOCUS_01020 117581 118312 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_01020 119121 118309 gene locus_tag LOCUS_01030 119121 118309 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_01030 121621 119159 gene locus_tag LOCUS_01040 gene mur/alr 121621 119159 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_01040 122687 121605 gene locus_tag LOCUS_01050 122687 121605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_01050 123440 122691 gene locus_tag LOCUS_01060 gene scpA 123440 122691 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_01060 123620 125536 gene locus_tag LOCUS_01070 gene dxs 123620 125536 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 protein_id gnl|my_center|LOCUS_01070 125540 126313 gene locus_tag LOCUS_01080 125540 126313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_01080 126588 126310 gene locus_tag LOCUS_01090 126588 126310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 126890 126585 gene locus_tag LOCUS_01100 126890 126585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 127418 126936 gene locus_tag LOCUS_01110 127418 126936 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_01110 128436 127411 gene locus_tag LOCUS_01120 gene ribD 128436 127411 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_01120 129194 128436 gene locus_tag LOCUS_01130 129194 128436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 130118 129321 gene locus_tag LOCUS_01140 130118 129321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130247 131596 gene locus_tag LOCUS_01150 gene dgt 130247 131596 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_01150 131976 131593 gene locus_tag LOCUS_01160 131976 131593 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_01160 132183 135191 gene locus_tag LOCUS_01170 132183 135191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 135509 135240 gene locus_tag LOCUS_01180 135509 135240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 136247 135597 gene locus_tag LOCUS_01190 136247 135597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 137290 136238 gene locus_tag LOCUS_01200 137290 136238 CDS product AIR synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_01200 138012 137290 gene locus_tag LOCUS_01210 138012 137290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 138984 138529 gene locus_tag LOCUS_01220 138984 138529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 140979 139186 gene locus_tag LOCUS_01230 140979 139186 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_01230 142318 141143 gene locus_tag LOCUS_01240 142318 141143 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_01240 144785 142380 gene locus_tag LOCUS_01250 144785 142380 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_01250 145300 144830 gene locus_tag LOCUS_01260 145300 144830 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_01260 147295 145547 gene locus_tag LOCUS_01270 gene fadD 147295 145547 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_01270 149357 147759 gene locus_tag LOCUS_01280 149357 147759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_01280 150325 149429 gene locus_tag LOCUS_01290 150325 149429 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_01290 152192 150327 gene locus_tag LOCUS_01300 gene mnmG 152192 150327 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01300 152698 152273 gene locus_tag LOCUS_01310 gene ybeY 152698 152273 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01310 153103 152702 gene locus_tag LOCUS_01320 153103 152702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 153899 153138 gene locus_tag LOCUS_01330 gene xth 153899 153138 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_01330 154265 153903 gene locus_tag LOCUS_01340 154265 153903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01340 154613 154272 gene locus_tag LOCUS_01350 154613 154272 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_01350 154788 155387 gene locus_tag LOCUS_01360 154788 155387 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_01360 155393 155926 gene locus_tag LOCUS_01370 155393 155926 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_01370 155979 156737 gene locus_tag LOCUS_01380 155979 156737 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_01380 156767 157360 gene locus_tag LOCUS_01390 156767 157360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 157347 157820 gene locus_tag LOCUS_01400 157347 157820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 157860 158273 gene locus_tag LOCUS_01410 157860 158273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 158803 158270 gene locus_tag LOCUS_01420 158803 158270 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_01420 158896 161502 gene locus_tag LOCUS_01430 gene mutS 158896 161502 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_01430 161553 162350 gene locus_tag LOCUS_01440 161553 162350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 162492 162565 gene locus_tag LOCUS_t00010 162492 162565 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 162707 162791 gene locus_tag LOCUS_t00020 162707 162791 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 163391 164842 gene locus_tag LOCUS_01450 gene betB 163391 164842 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H52 protein_id gnl|my_center|LOCUS_01450 164895 166388 gene locus_tag LOCUS_01460 164895 166388 CDS product choline oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_01460 167998 166439 gene locus_tag LOCUS_01470 167998 166439 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_01470 168399 171626 gene locus_tag LOCUS_01480 168399 171626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 171799 172371 gene locus_tag LOCUS_01490 171799 172371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 172368 173105 gene locus_tag LOCUS_01500 172368 173105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 173201 175720 gene locus_tag LOCUS_01510 173201 175720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 175795 176661 gene locus_tag LOCUS_01520 175795 176661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 177123 176656 gene locus_tag LOCUS_01530 177123 176656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 177971 177204 gene locus_tag LOCUS_01540 177971 177204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 178579 179352 gene locus_tag LOCUS_01550 gene dapF 178579 179352 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_01550 179453 182833 gene locus_tag LOCUS_01560 gene secA 179453 182833 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_01560 182841 183362 gene locus_tag LOCUS_01570 182841 183362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 183367 184557 gene locus_tag LOCUS_01580 183367 184557 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_01580 184621 185388 gene locus_tag LOCUS_01590 184621 185388 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_01590 185478 187334 gene locus_tag LOCUS_01600 185478 187334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 187358 188008 gene locus_tag LOCUS_01610 187358 188008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944228.1 protein_id gnl|my_center|LOCUS_01610 190628 188070 gene locus_tag LOCUS_01620 gene dsbD 190628 188070 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_01620 192059 190671 gene locus_tag LOCUS_01630 192059 190671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_01630 192871 193848 gene locus_tag LOCUS_01640 192871 193848 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_01640 193891 194562 gene locus_tag LOCUS_01650 193891 194562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 195037 194615 gene locus_tag LOCUS_01660 195037 194615 CDS product OsmC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342698.1 protein_id gnl|my_center|LOCUS_01660 195473 195018 gene locus_tag LOCUS_01670 195473 195018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 196713 195571 gene locus_tag LOCUS_01680 196713 195571 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_01680 196733 196945 gene locus_tag LOCUS_01690 196733 196945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197050 197982 gene locus_tag LOCUS_01700 197050 197982 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_01700 198446 197985 gene locus_tag LOCUS_01710 gene nlpE 198446 197985 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073050.1 protein_id gnl|my_center|LOCUS_01710 199230 198616 gene locus_tag LOCUS_01720 199230 198616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 199709 199341 gene locus_tag LOCUS_01730 199709 199341 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035971.1 protein_id gnl|my_center|LOCUS_01730 200158 199706 gene locus_tag LOCUS_01740 200158 199706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 201031 200429 gene locus_tag LOCUS_01750 201031 200429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 201238 202134 gene locus_tag LOCUS_01760 201238 202134 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_01760 202622 205786 gene locus_tag LOCUS_01770 202622 205786 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_01770 205794 207599 gene locus_tag LOCUS_01780 205794 207599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_01780 207705 208913 gene locus_tag LOCUS_01790 207705 208913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 210885 209002 gene locus_tag LOCUS_01800 210885 209002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_01800 211064 211846 gene locus_tag LOCUS_01810 gene uppP 211064 211846 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_01810 212490 211930 gene locus_tag LOCUS_01820 212490 211930 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_01820 213696 212701 gene locus_tag LOCUS_01830 213696 212701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941376.1 protein_id gnl|my_center|LOCUS_01830 215247 214021 gene locus_tag LOCUS_01840 215247 214021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 218656 215426 gene locus_tag LOCUS_01850 gene mfd 218656 215426 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_01850 218906 219349 gene locus_tag LOCUS_01860 218906 219349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 219816 219346 gene locus_tag LOCUS_01870 219816 219346 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_01870 220110 221282 gene locus_tag LOCUS_01880 220110 221282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 221401 221991 gene locus_tag LOCUS_01890 221401 221991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_01890 222004 222441 gene locus_tag LOCUS_01900 222004 222441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_01900 222530 223231 gene locus_tag LOCUS_01910 222530 223231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 223809 224834 gene locus_tag LOCUS_01920 gene moeA 223809 224834 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932999.1 protein_id gnl|my_center|LOCUS_01920 224836 225588 gene locus_tag LOCUS_01930 224836 225588 CDS product UPF0721 transmembrane protein y4hK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55478 protein_id gnl|my_center|LOCUS_01930 225592 226176 gene locus_tag LOCUS_01940 gene mobA 225592 226176 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q835J2 protein_id gnl|my_center|LOCUS_01940 226173 226985 gene locus_tag LOCUS_01950 226173 226985 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_01950 227014 227250 gene locus_tag LOCUS_01960 227014 227250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 227253 228299 gene locus_tag LOCUS_01970 227253 228299 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_01970 228471 228899 gene locus_tag LOCUS_01980 228471 228899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 229052 229969 gene locus_tag LOCUS_01990 gene moaCB 229052 229969 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_01990 230061 230966 gene locus_tag LOCUS_02000 gene moaA 230061 230966 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y870 protein_id gnl|my_center|LOCUS_02000 231776 231009 gene locus_tag LOCUS_02010 231776 231009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 232148 231888 gene locus_tag LOCUS_02020 232148 231888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 232439 232149 gene locus_tag LOCUS_02030 232439 232149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 232861 232493 gene locus_tag LOCUS_02040 232861 232493 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_02040 233227 232922 gene locus_tag LOCUS_02050 233227 232922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 233552 233214 gene locus_tag LOCUS_02060 233552 233214 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_02060 235183 233660 gene locus_tag LOCUS_02070 235183 233660 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_02070 236289 235189 gene locus_tag LOCUS_02080 236289 235189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_02080 236900 236487 gene locus_tag LOCUS_02090 236900 236487 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_02090 237150 236893 gene locus_tag LOCUS_02100 237150 236893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 238042 237233 gene locus_tag LOCUS_02110 238042 237233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 238246 239181 gene locus_tag LOCUS_02120 gene queG 238246 239181 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_02120 239199 240311 gene locus_tag LOCUS_02130 gene corA 239199 240311 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_02130 240727 240314 gene locus_tag LOCUS_02140 240727 240314 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257335.1 protein_id gnl|my_center|LOCUS_02140 241647 240790 gene locus_tag LOCUS_02150 241647 240790 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_02150 242387 241989 gene locus_tag LOCUS_02160 242387 241989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 242525 244048 gene locus_tag LOCUS_02170 gene gpmI 242525 244048 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_02170 244048 244617 gene locus_tag LOCUS_02180 244048 244617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 246403 244724 gene locus_tag LOCUS_02190 246403 244724 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_02190 246539 246916 gene locus_tag LOCUS_02200 246539 246916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 247472 247011 gene locus_tag LOCUS_02210 247472 247011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 247528 250314 gene locus_tag LOCUS_02220 gene polA 247528 250314 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_02220 250504 251877 gene locus_tag LOCUS_02230 gene radA 250504 251877 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_02230 252055 252285 gene locus_tag LOCUS_02240 252055 252285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 253749 252367 gene locus_tag LOCUS_02250 253749 252367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 254705 253773 gene locus_tag LOCUS_02260 254705 253773 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_02260 255283 255047 gene locus_tag LOCUS_02270 255283 255047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 256549 255317 gene locus_tag LOCUS_02280 256549 255317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 257607 256546 gene locus_tag LOCUS_02290 257607 256546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 258039 257617 gene locus_tag LOCUS_02300 258039 257617 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_02300 258100 259002 gene locus_tag LOCUS_02310 gene rssA 258100 259002 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_02310 258989 259609 gene locus_tag LOCUS_02320 258989 259609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 262090 259634 gene locus_tag LOCUS_02330 262090 259634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 262847 262080 gene locus_tag LOCUS_02340 262847 262080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 263068 263670 gene locus_tag LOCUS_02350 263068 263670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_02350 264464 265672 gene locus_tag LOCUS_02360 264464 265672 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_02360 265665 266339 gene locus_tag LOCUS_02370 gene deoC 265665 266339 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88Z64 protein_id gnl|my_center|LOCUS_02370 267430 266321 gene locus_tag LOCUS_02380 gene nptA 267430 266321 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_02380 267674 268804 gene locus_tag LOCUS_02390 267674 268804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_02390 268810 269259 gene locus_tag LOCUS_02400 gene tadA 268810 269259 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_02400 269364 269975 gene locus_tag LOCUS_02410 gene sodA 269364 269975 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_02410 270182 272614 gene locus_tag LOCUS_02420 270182 272614 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_02420 273823 272663 gene locus_tag LOCUS_02430 273823 272663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 274414 273950 gene locus_tag LOCUS_02440 274414 273950 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_02440 274603 276465 gene locus_tag LOCUS_02450 274603 276465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 276458 278383 gene locus_tag LOCUS_02460 276458 278383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 278591 280453 gene locus_tag LOCUS_02470 278591 280453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 280518 281312 gene locus_tag LOCUS_02480 280518 281312 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223919.1 protein_id gnl|my_center|LOCUS_02480 281439 282017 gene locus_tag LOCUS_02490 gene mtgA 281439 282017 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_02490 284186 282459 gene locus_tag LOCUS_02500 284186 282459 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_02500 285236 284307 gene locus_tag LOCUS_02510 285236 284307 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_02510 285306 286292 gene locus_tag LOCUS_02520 285306 286292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 287059 286493 gene locus_tag LOCUS_02530 287059 286493 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_02530 287791 287084 gene locus_tag LOCUS_02540 287791 287084 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_02540 287937 289268 gene locus_tag LOCUS_02550 287937 289268 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_02550 289318 289785 gene locus_tag LOCUS_02560 289318 289785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 291334 289862 gene locus_tag LOCUS_02570 gene gltD 291334 289862 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_02570 295826 291336 gene locus_tag LOCUS_02580 gene gltB 295826 291336 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_02580 297569 296220 gene locus_tag LOCUS_02590 297569 296220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 298104 297643 gene locus_tag LOCUS_02600 gene ssb 298104 297643 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M7 protein_id gnl|my_center|LOCUS_02600 299223 298150 gene locus_tag LOCUS_02610 299223 298150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 299369 299677 gene locus_tag LOCUS_02620 gene hupA 299369 299677 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_02620 299696 300523 gene locus_tag LOCUS_02630 299696 300523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 300705 302276 gene locus_tag LOCUS_02640 300705 302276 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_02640 303521 302394 gene locus_tag LOCUS_02650 303521 302394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 304481 303708 gene locus_tag LOCUS_02660 304481 303708 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_02660 305617 304544 gene locus_tag LOCUS_02670 305617 304544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 306338 305694 gene locus_tag LOCUS_02680 306338 305694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 308500 306341 gene locus_tag LOCUS_02690 308500 306341 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_02690 308776 309354 gene locus_tag LOCUS_02700 308776 309354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 309407 310633 gene locus_tag LOCUS_02710 309407 310633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 310701 311294 gene locus_tag LOCUS_02720 310701 311294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 311778 313892 gene locus_tag LOCUS_02730 311778 313892 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_02730 314406 314020 gene locus_tag LOCUS_02740 314406 314020 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_02740 316145 314421 gene locus_tag LOCUS_02750 316145 314421 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_02750 318017 316359 gene locus_tag LOCUS_02760 318017 316359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_02760 319873 318212 gene locus_tag LOCUS_02770 319873 318212 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AA12 protein_id gnl|my_center|LOCUS_02770 321501 320044 gene locus_tag LOCUS_02780 321501 320044 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_02780 324093 321688 gene locus_tag LOCUS_02790 324093 321688 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_02790 324412 325806 gene locus_tag LOCUS_02800 324412 325806 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_02800 325818 326129 gene locus_tag LOCUS_02810 325818 326129 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_02810 329195 326379 gene locus_tag LOCUS_02820 gene uvrA1 329195 326379 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_02820 329505 334616 gene locus_tag LOCUS_02830 329505 334616 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_02830 334685 336484 gene locus_tag LOCUS_02840 334685 336484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 336481 338043 gene locus_tag LOCUS_02850 336481 338043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 338129 338740 gene locus_tag LOCUS_02860 gene pnuC 338129 338740 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_02860 338733 339245 gene locus_tag LOCUS_02870 338733 339245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 339271 340797 gene locus_tag LOCUS_02880 339271 340797 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_02880 341907 340822 gene locus_tag LOCUS_02890 341907 340822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 343893 342352 gene locus_tag LOCUS_02900 343893 342352 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_02900 344572 343991 gene locus_tag LOCUS_02910 344572 343991 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861294.1 protein_id gnl|my_center|LOCUS_02910 345432 344608 gene locus_tag LOCUS_02920 345432 344608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_02920 346373 345474 gene locus_tag LOCUS_02930 346373 345474 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_02930 346639 347685 gene locus_tag LOCUS_02940 346639 347685 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767184.1 protein_id gnl|my_center|LOCUS_02940 347944 350085 gene locus_tag LOCUS_02950 347944 350085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_02950 350099 351943 gene locus_tag LOCUS_02960 350099 351943 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_02960 351948 353090 gene locus_tag LOCUS_02970 gene galM 351948 353090 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_02970 353297 356383 gene locus_tag LOCUS_02980 353297 356383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 356431 358740 gene locus_tag LOCUS_02990 356431 358740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 358730 359182 gene locus_tag LOCUS_03000 358730 359182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_03000 359169 360185 gene locus_tag LOCUS_03010 359169 360185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 361799 360390 gene locus_tag LOCUS_03020 361799 360390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 362446 362102 gene locus_tag LOCUS_03030 362446 362102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 363118 362474 gene locus_tag LOCUS_03040 363118 362474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 364230 363154 gene locus_tag LOCUS_03050 364230 363154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 364995 364435 gene locus_tag LOCUS_03060 gene mip 364995 364435 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CQ49 protein_id gnl|my_center|LOCUS_03060 365603 365076 gene locus_tag LOCUS_03070 365603 365076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 366292 365558 gene locus_tag LOCUS_03080 366292 365558 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 protein_id gnl|my_center|LOCUS_03080 366660 366289 gene locus_tag LOCUS_03090 366660 366289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 367485 366676 gene locus_tag LOCUS_03100 gene chd1 367485 366676 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_03100 368138 367536 gene locus_tag LOCUS_03110 368138 367536 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_03110 369523 368204 gene locus_tag LOCUS_03120 369523 368204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 370226 369576 gene locus_tag LOCUS_03130 370226 369576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 370788 370213 gene locus_tag LOCUS_03140 370788 370213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 371543 370788 gene locus_tag LOCUS_03150 371543 370788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 372214 371714 gene locus_tag LOCUS_03160 372214 371714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 372667 376551 gene locus_tag LOCUS_03170 372667 376551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 376548 380735 gene locus_tag LOCUS_03180 376548 380735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 380770 381072 gene locus_tag LOCUS_03190 380770 381072 CDS product putative ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701647.1 protein_id gnl|my_center|LOCUS_03190 381210 382280 gene locus_tag LOCUS_03200 381210 382280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_03200 382403 383788 gene locus_tag LOCUS_03210 382403 383788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 384129 387899 gene locus_tag LOCUS_03220 384129 387899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 387902 391600 gene locus_tag LOCUS_03230 387902 391600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 391602 392519 gene locus_tag LOCUS_03240 391602 392519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 392516 392896 gene locus_tag LOCUS_03250 392516 392896 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_03250 392911 393951 gene locus_tag LOCUS_03260 392911 393951 CDS product adenylate/guanylate cyclase domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_03260 394222 395001 gene locus_tag LOCUS_03270 394222 395001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 395121 397700 gene locus_tag LOCUS_03280 395121 397700 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_03280 397700 398767 gene locus_tag LOCUS_03290 397700 398767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 398898 400076 gene locus_tag LOCUS_03300 398898 400076 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_03300 400178 401110 gene locus_tag LOCUS_03310 400178 401110 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_03310 401103 401882 gene locus_tag LOCUS_03320 401103 401882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 402008 403408 gene locus_tag LOCUS_03330 402008 403408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 403405 404547 gene locus_tag LOCUS_03340 403405 404547 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_03340 404626 405711 gene locus_tag LOCUS_03350 gene csp2G 404626 405711 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_03350 405687 406814 gene locus_tag LOCUS_03360 405687 406814 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_03360 406960 407373 gene locus_tag LOCUS_03370 gene osmC 406960 407373 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_03370 407422 408102 gene locus_tag LOCUS_03380 407422 408102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_03380 408099 408395 gene locus_tag LOCUS_03390 408099 408395 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_03390 408455 409804 gene locus_tag LOCUS_03400 408455 409804 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_03400 410836 409886 gene locus_tag LOCUS_03410 gene rlmF 410836 409886 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 protein_id gnl|my_center|LOCUS_03410 411020 413002 gene locus_tag LOCUS_03420 411020 413002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_03420 413009 414160 gene locus_tag LOCUS_03430 413009 414160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 protein_id gnl|my_center|LOCUS_03430 414210 414629 gene locus_tag LOCUS_03440 414210 414629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_03440 414944 414651 gene locus_tag LOCUS_03450 414944 414651 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_03450 415118 415420 gene locus_tag LOCUS_03460 415118 415420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 415563 415838 gene locus_tag LOCUS_03470 415563 415838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 416755 415823 gene locus_tag LOCUS_03480 416755 415823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267262.1 protein_id gnl|my_center|LOCUS_03480 417323 417778 gene locus_tag LOCUS_03490 417323 417778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 417813 418265 gene locus_tag LOCUS_03500 417813 418265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_03500 420670 418268 gene locus_tag LOCUS_03510 420670 418268 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_03510 421387 420686 gene locus_tag LOCUS_03520 gene crtO 421387 420686 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_03520 422256 421411 gene locus_tag LOCUS_03530 gene ispH 422256 421411 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_03530 422625 422260 gene locus_tag LOCUS_03540 422625 422260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 423815 422973 gene locus_tag LOCUS_03550 gene crtB 423815 422973 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_03550 425315 423834 gene locus_tag LOCUS_03560 gene crtI 425315 423834 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_03560 425832 425320 gene locus_tag LOCUS_03570 425832 425320 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_03570 426922 426032 gene locus_tag LOCUS_03580 426922 426032 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_03580 427365 426919 gene locus_tag LOCUS_03590 gene crtZ 427365 426919 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_03590 428283 427615 gene locus_tag LOCUS_03600 428283 427615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 428395 428700 gene locus_tag LOCUS_03610 428395 428700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence02 10205 7875 gene locus_tag LOCUS_03620 10205 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 12825 10453 gene locus_tag LOCUS_03630 12825 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12917 13657 gene locus_tag LOCUS_03640 12917 13657 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_03640 14514 13951 gene locus_tag LOCUS_03650 14514 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_03650 15000 14554 gene locus_tag LOCUS_03660 15000 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053574.1 protein_id gnl|my_center|LOCUS_03660 15609 16766 gene locus_tag LOCUS_03670 15609 16766 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_03670 17949 16954 gene locus_tag LOCUS_03680 17949 16954 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_03680 18018 18695 gene locus_tag LOCUS_03690 18018 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 18956 18714 gene locus_tag LOCUS_03700 18956 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 20209 18956 gene locus_tag LOCUS_03710 20209 18956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_03710 20904 20266 gene locus_tag LOCUS_03720 20904 20266 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_03720 21589 20906 gene locus_tag LOCUS_03730 21589 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 21906 23633 gene locus_tag LOCUS_03740 gene aceK 21906 23633 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_03740 23712 24842 gene locus_tag LOCUS_03750 23712 24842 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_03750 24862 26289 gene locus_tag LOCUS_03760 gene pepA 24862 26289 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_03760 26292 27509 gene locus_tag LOCUS_03770 26292 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 28329 27562 gene locus_tag LOCUS_03780 28329 27562 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_03780 28883 28329 gene locus_tag LOCUS_03790 28883 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 30161 29076 gene locus_tag LOCUS_03800 30161 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 30599 31954 gene locus_tag LOCUS_03810 gene yqeZ 30599 31954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_03810 31977 32351 gene locus_tag LOCUS_03820 31977 32351 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_03820 32344 33075 gene locus_tag LOCUS_03830 32344 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 33072 33359 gene locus_tag LOCUS_03840 gene gatC 33072 33359 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S325 protein_id gnl|my_center|LOCUS_03840 33365 36148 gene locus_tag LOCUS_03850 33365 36148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 36225 36941 gene locus_tag LOCUS_03860 36225 36941 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_03860 37002 37550 gene locus_tag LOCUS_03870 37002 37550 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_03870 37592 38659 gene locus_tag LOCUS_03880 gene ilvE 37592 38659 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_03880 39103 38717 gene locus_tag LOCUS_03890 gene rnk-2 39103 38717 CDS product RNA polymerase-binding protein Rnk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941503.1 protein_id gnl|my_center|LOCUS_03890 39839 39483 gene locus_tag LOCUS_03900 39839 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 40683 39955 gene locus_tag LOCUS_03910 40683 39955 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_03910 41048 40686 gene locus_tag LOCUS_03920 41048 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728528.1 protein_id gnl|my_center|LOCUS_03920 41619 41185 gene locus_tag LOCUS_03930 41619 41185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 41821 42327 gene locus_tag LOCUS_03940 41821 42327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 42548 43495 gene locus_tag LOCUS_03950 gene prfB 42548 43495 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_03950 43629 44726 gene locus_tag LOCUS_03960 43629 44726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251197.1 protein_id gnl|my_center|LOCUS_03960 46075 44723 gene locus_tag LOCUS_03970 46075 44723 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_03970 47501 46146 gene locus_tag LOCUS_03980 gene norM 47501 46146 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_03980 48045 47503 gene locus_tag LOCUS_03990 48045 47503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 48594 48100 gene locus_tag LOCUS_04000 48594 48100 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204854.1 protein_id gnl|my_center|LOCUS_04000 49986 48793 gene locus_tag LOCUS_04010 49986 48793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 50066 50716 gene locus_tag LOCUS_04020 50066 50716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 51596 50790 gene locus_tag LOCUS_04030 51596 50790 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_04030 51812 52615 gene locus_tag LOCUS_04040 51812 52615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 53272 52616 gene locus_tag LOCUS_04050 53272 52616 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_04050 53760 53987 gene locus_tag LOCUS_04060 53760 53987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 53993 56122 gene locus_tag LOCUS_04070 gene feoB 53993 56122 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_04070 56292 57767 gene locus_tag LOCUS_04080 56292 57767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_04080 58204 59124 gene locus_tag LOCUS_04090 gene usp 58204 59124 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021757.1 protein_id gnl|my_center|LOCUS_04090 59350 59778 gene locus_tag LOCUS_04100 59350 59778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 59813 60172 gene locus_tag LOCUS_04110 59813 60172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 60178 60618 gene locus_tag LOCUS_04120 60178 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_04120 61067 60651 gene locus_tag LOCUS_04130 gene mscL 61067 60651 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG6 protein_id gnl|my_center|LOCUS_04130 61255 63297 gene locus_tag LOCUS_04140 gene ptrB 61255 63297 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_04140 63395 63766 gene locus_tag LOCUS_04150 gene mgsA 63395 63766 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42980 protein_id gnl|my_center|LOCUS_04150 63770 64756 gene locus_tag LOCUS_04160 gene pfkA2 63770 64756 CDS product ATP-dependent 6-phosphofructokinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A624 protein_id gnl|my_center|LOCUS_04160 66271 65210 gene locus_tag LOCUS_04170 gene fbaA 66271 65210 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209962.1 protein_id gnl|my_center|LOCUS_04170 66626 67657 gene locus_tag LOCUS_04180 66626 67657 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_04180 67775 70279 gene locus_tag LOCUS_04190 67775 70279 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_04190 70315 71640 gene locus_tag LOCUS_04200 70315 71640 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 protein_id gnl|my_center|LOCUS_04200 71719 72591 gene locus_tag LOCUS_04210 71719 72591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_04210 74526 72577 gene locus_tag LOCUS_04220 74526 72577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 75392 74607 gene locus_tag LOCUS_04230 gene surE 75392 74607 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_04230 76094 75393 gene locus_tag LOCUS_04240 76094 75393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 77344 76133 gene locus_tag LOCUS_04250 gene ribBA 77344 76133 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_04250 79367 77430 gene locus_tag LOCUS_04260 gene dnaG 79367 77430 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_04260 79518 80612 gene locus_tag LOCUS_04270 79518 80612 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P46 protein_id gnl|my_center|LOCUS_04270 80617 80865 gene locus_tag LOCUS_04280 80617 80865 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_04280 80876 83944 gene locus_tag LOCUS_04290 80876 83944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 84163 84831 gene locus_tag LOCUS_04300 84163 84831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 84864 86672 gene locus_tag LOCUS_04310 84864 86672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 86677 86973 gene locus_tag LOCUS_04320 86677 86973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 88283 87159 gene locus_tag LOCUS_04330 88283 87159 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_04330 88905 88276 gene locus_tag LOCUS_04340 88905 88276 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_04340 89010 89085 gene locus_tag LOCUS_t00030 89010 89085 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 90368 89523 gene locus_tag LOCUS_04350 90368 89523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 94124 90606 gene locus_tag LOCUS_04360 94124 90606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 95905 94703 gene locus_tag LOCUS_04370 95905 94703 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_04370 96299 96099 gene locus_tag LOCUS_04380 96299 96099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 97749 96463 gene locus_tag LOCUS_04390 97749 96463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 98246 97746 gene locus_tag LOCUS_04400 98246 97746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 100442 98301 gene locus_tag LOCUS_04410 100442 98301 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR9 protein_id gnl|my_center|LOCUS_04410 103313 100887 gene locus_tag LOCUS_04420 103313 100887 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_04420 104083 103313 gene locus_tag LOCUS_04430 104083 103313 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879222.1 protein_id gnl|my_center|LOCUS_04430 105039 104530 gene locus_tag LOCUS_04440 105039 104530 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_04440 106528 105155 gene locus_tag LOCUS_04450 106528 105155 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_04450 108409 106592 gene locus_tag LOCUS_04460 108409 106592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 109318 108449 gene locus_tag LOCUS_04470 gene cysM 109318 108449 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207017.1 protein_id gnl|my_center|LOCUS_04470 110301 109861 gene locus_tag LOCUS_04480 110301 109861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_04480 113752 110519 gene locus_tag LOCUS_04490 113752 110519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 114679 113942 gene locus_tag LOCUS_04500 114679 113942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 115314 115090 gene locus_tag LOCUS_04510 115314 115090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 115749 115435 gene locus_tag LOCUS_04520 115749 115435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_04520 115842 116291 gene locus_tag LOCUS_04530 115842 116291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 116298 117188 gene locus_tag LOCUS_04540 116298 117188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 117185 117820 gene locus_tag LOCUS_04550 117185 117820 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013857.1 protein_id gnl|my_center|LOCUS_04550 117825 118304 gene locus_tag LOCUS_04560 117825 118304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 120076 118622 gene locus_tag LOCUS_04570 120076 118622 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_04570 120784 120086 gene locus_tag LOCUS_04580 gene drrA 120784 120086 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_04580 121604 121035 gene locus_tag LOCUS_04590 121604 121035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 122043 124283 gene locus_tag LOCUS_04600 122043 124283 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_04600 124759 127950 gene locus_tag LOCUS_04610 124759 127950 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 protein_id gnl|my_center|LOCUS_04610 127962 129359 gene locus_tag LOCUS_04620 127962 129359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_04620 129477 130736 gene locus_tag LOCUS_04630 gene dacB 129477 130736 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_04630 130755 131144 gene locus_tag LOCUS_04640 130755 131144 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_04640 132698 131208 gene locus_tag LOCUS_04650 132698 131208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_04650 135845 132711 gene locus_tag LOCUS_04660 135845 132711 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_04660 138742 136307 gene locus_tag LOCUS_04670 138742 136307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_04670 138948 139364 gene locus_tag LOCUS_04680 138948 139364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 139366 140115 gene locus_tag LOCUS_04690 139366 140115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 140751 140158 gene locus_tag LOCUS_04700 140751 140158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 141247 140738 gene locus_tag LOCUS_04710 141247 140738 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_04710 141507 142481 gene locus_tag LOCUS_04720 141507 142481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_04720 142737 144695 gene locus_tag LOCUS_04730 gene yyaL 142737 144695 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_04730 144789 147218 gene locus_tag LOCUS_04740 gene priA 144789 147218 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_04740 147345 147611 gene locus_tag LOCUS_04750 147345 147611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 147595 148014 gene locus_tag LOCUS_04760 147595 148014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 148871 148026 gene locus_tag LOCUS_04770 148871 148026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 150090 149011 gene locus_tag LOCUS_04780 150090 149011 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_04780 150965 150090 gene locus_tag LOCUS_04790 150965 150090 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_04790 151655 153049 gene locus_tag LOCUS_04800 151655 153049 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_04800 153410 154480 gene locus_tag LOCUS_04810 153410 154480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 154661 155464 gene locus_tag LOCUS_04820 154661 155464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 155611 156537 gene locus_tag LOCUS_04830 155611 156537 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_04830 156742 158241 gene locus_tag LOCUS_04840 156742 158241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 160773 158452 gene locus_tag LOCUS_04850 160773 158452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_04850 161850 161155 gene locus_tag LOCUS_04860 161850 161155 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_04860 162328 161960 gene locus_tag LOCUS_04870 162328 161960 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_04870 163682 162435 gene locus_tag LOCUS_04880 163682 162435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_04880 164012 165400 gene locus_tag LOCUS_04890 164012 165400 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_04890 165390 166742 gene locus_tag LOCUS_04900 165390 166742 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_04900 166994 167515 gene locus_tag LOCUS_04910 166994 167515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 169810 167654 gene locus_tag LOCUS_04920 169810 167654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202643.1 protein_id gnl|my_center|LOCUS_04920 170557 170060 gene locus_tag LOCUS_04930 170557 170060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_04930 170909 170547 gene locus_tag LOCUS_04940 170909 170547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 172122 171052 gene locus_tag LOCUS_04950 172122 171052 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_04950 172578 172126 gene locus_tag LOCUS_04960 172578 172126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_04960 174360 172738 gene locus_tag LOCUS_04970 174360 172738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 176525 174357 gene locus_tag LOCUS_04980 176525 174357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 177586 176522 gene locus_tag LOCUS_04990 177586 176522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 178563 177694 gene locus_tag LOCUS_05000 178563 177694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 179554 178550 gene locus_tag LOCUS_05010 179554 178550 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640601.1 protein_id gnl|my_center|LOCUS_05010 180168 179551 gene locus_tag LOCUS_05020 180168 179551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_05020 181615 180284 gene locus_tag LOCUS_05030 181615 180284 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920664.1 protein_id gnl|my_center|LOCUS_05030 183275 181632 gene locus_tag LOCUS_05040 183275 181632 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_05040 183759 184439 gene locus_tag LOCUS_05050 183759 184439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 185161 184553 gene locus_tag LOCUS_05060 185161 184553 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_05060 186019 185174 gene locus_tag LOCUS_05070 gene ada 186019 185174 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_05070 187288 186098 gene locus_tag LOCUS_05080 187288 186098 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_05080 187685 187338 gene locus_tag LOCUS_05090 187685 187338 CDS product transcription initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_05090 188136 187759 gene locus_tag LOCUS_05100 188136 187759 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_05100 188263 188772 gene locus_tag LOCUS_05110 188263 188772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 189106 189480 gene locus_tag LOCUS_05120 189106 189480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 189477 190091 gene locus_tag LOCUS_05130 189477 190091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 190928 190542 gene locus_tag LOCUS_05140 190928 190542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_05140 191283 192458 gene locus_tag LOCUS_05150 191283 192458 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_05150 192458 192979 gene locus_tag LOCUS_05160 192458 192979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 193530 192976 gene locus_tag LOCUS_05170 193530 192976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 194011 193541 gene locus_tag LOCUS_05180 194011 193541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 195024 194137 gene locus_tag LOCUS_05190 195024 194137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 195667 195158 gene locus_tag LOCUS_05200 195667 195158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 196748 195972 gene locus_tag LOCUS_05210 196748 195972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 197275 199719 gene locus_tag LOCUS_05220 197275 199719 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_05220 200046 201038 gene locus_tag LOCUS_05230 200046 201038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 201161 201520 gene locus_tag LOCUS_05240 201161 201520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 201680 203893 gene locus_tag LOCUS_05250 201680 203893 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_05250 204057 204416 gene locus_tag LOCUS_05260 204057 204416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 205586 204837 gene locus_tag LOCUS_05270 205586 204837 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096693.1 protein_id gnl|my_center|LOCUS_05270 205775 206458 gene locus_tag LOCUS_05280 205775 206458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946025.1 protein_id gnl|my_center|LOCUS_05280 206634 208100 gene locus_tag LOCUS_05290 gene yngK 206634 208100 CDS product UPF0748 protein YngK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35015 protein_id gnl|my_center|LOCUS_05290 208111 208590 gene locus_tag LOCUS_05300 208111 208590 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086344.1 protein_id gnl|my_center|LOCUS_05300 208638 209852 gene locus_tag LOCUS_05310 208638 209852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_05310 210028 211542 gene locus_tag LOCUS_05320 210028 211542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 212320 211730 gene locus_tag LOCUS_05330 212320 211730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 213698 212562 gene locus_tag LOCUS_05340 gene mro 213698 212562 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB5 protein_id gnl|my_center|LOCUS_05340 215191 213824 gene locus_tag LOCUS_05350 215191 213824 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_05350 215818 215321 gene locus_tag LOCUS_05360 215818 215321 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFA3 protein_id gnl|my_center|LOCUS_05360 216244 218571 gene locus_tag LOCUS_05370 216244 218571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 218662 219522 gene locus_tag LOCUS_05380 218662 219522 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_05380 220325 219675 gene locus_tag LOCUS_05390 220325 219675 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_05390 223029 220552 gene locus_tag LOCUS_05400 223029 220552 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405469.1 protein_id gnl|my_center|LOCUS_05400 223294 224169 gene locus_tag LOCUS_05410 223294 224169 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_05410 224166 225281 gene locus_tag LOCUS_05420 224166 225281 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_05420 227800 225449 gene locus_tag LOCUS_05430 227800 225449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 228249 227878 gene locus_tag LOCUS_05440 228249 227878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 228522 231230 gene locus_tag LOCUS_05450 228522 231230 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_05450 231202 231804 gene locus_tag LOCUS_05460 gene rnhB 231202 231804 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 protein_id gnl|my_center|LOCUS_05460 231959 232696 gene locus_tag LOCUS_05470 231959 232696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 protein_id gnl|my_center|LOCUS_05470 232928 233257 gene locus_tag LOCUS_05480 232928 233257 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_05480 234032 233313 gene locus_tag LOCUS_05490 234032 233313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_05490 234302 234138 gene locus_tag LOCUS_05500 234302 234138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 235163 234729 gene locus_tag LOCUS_05510 235163 234729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 235748 235239 gene locus_tag LOCUS_05520 235748 235239 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_05520 236402 235752 gene locus_tag LOCUS_05530 236402 235752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 236979 236512 gene locus_tag LOCUS_05540 gene smpB 236979 236512 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_05540 237995 236982 gene locus_tag LOCUS_05550 gene tsaD 237995 236982 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_05550 238073 242602 gene locus_tag LOCUS_05560 238073 242602 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_05560 242791 244089 gene locus_tag LOCUS_05570 gene phrB1 242791 244089 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_05570 244086 245036 gene locus_tag LOCUS_05580 244086 245036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 245040 245873 gene locus_tag LOCUS_05590 245040 245873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 246502 248802 gene locus_tag LOCUS_05600 246502 248802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 248936 249412 gene locus_tag LOCUS_05610 248936 249412 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_05610 251725 249740 gene locus_tag LOCUS_05620 251725 249740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 251670 251882 gene locus_tag LOCUS_05630 251670 251882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 252021 253352 gene locus_tag LOCUS_05640 252021 253352 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_05640 253423 253824 gene locus_tag LOCUS_05650 253423 253824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_05650 253948 254718 gene locus_tag LOCUS_05660 253948 254718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_05660 254915 255154 gene locus_tag LOCUS_05670 254915 255154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 255183 255971 gene locus_tag LOCUS_05680 255183 255971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 256161 256784 gene locus_tag LOCUS_05690 256161 256784 CDS product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962260.1 protein_id gnl|my_center|LOCUS_05690 259116 256867 gene locus_tag LOCUS_05700 gene katG 259116 256867 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_05700 259432 259992 gene locus_tag LOCUS_05710 259432 259992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_05710 260036 261727 gene locus_tag LOCUS_05720 260036 261727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 261911 262441 gene locus_tag LOCUS_05730 261911 262441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 262545 263078 gene locus_tag LOCUS_05740 262545 263078 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_05740 264092 263310 gene locus_tag LOCUS_05750 264092 263310 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_05750 265414 264314 gene locus_tag LOCUS_05760 265414 264314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 267970 265418 gene locus_tag LOCUS_05770 267970 265418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 268183 268611 gene locus_tag LOCUS_05780 268183 268611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124807.1 protein_id gnl|my_center|LOCUS_05780 268650 269783 gene locus_tag LOCUS_05790 gene rhlE 268650 269783 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LU9 protein_id gnl|my_center|LOCUS_05790 270151 269981 gene locus_tag LOCUS_05800 270151 269981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 270248 271759 gene locus_tag LOCUS_05810 270248 271759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 271966 272550 gene locus_tag LOCUS_05820 271966 272550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_05820 272765 274000 gene locus_tag LOCUS_05830 272765 274000 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_05830 275530 274106 gene locus_tag LOCUS_05840 275530 274106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 275714 276580 gene locus_tag LOCUS_05850 275714 276580 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_05850 276723 277997 gene locus_tag LOCUS_05860 gene eriC 276723 277997 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080004.1 protein_id gnl|my_center|LOCUS_05860 278109 278405 gene locus_tag LOCUS_05870 278109 278405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 279728 278589 gene locus_tag LOCUS_05880 279728 278589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_05880 280792 279737 gene locus_tag LOCUS_05890 280792 279737 CDS product erythromycin biosynthesis sensory transduction protein EryC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461012.1 protein_id gnl|my_center|LOCUS_05890 282092 280803 gene locus_tag LOCUS_05900 282092 280803 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_05900 283969 282518 gene locus_tag LOCUS_05910 gene leuB 283969 282518 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_05910 284181 284966 gene locus_tag LOCUS_05920 gene crt 284181 284966 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_05920 284982 286487 gene locus_tag LOCUS_05930 284982 286487 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05930 286649 288376 gene locus_tag LOCUS_05940 286649 288376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_05940 288369 289109 gene locus_tag LOCUS_05950 288369 289109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 289115 290362 gene locus_tag LOCUS_05960 289115 290362 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_05960 290476 290676 gene locus_tag LOCUS_05970 290476 290676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 290695 292122 gene locus_tag LOCUS_05980 gene gatA 290695 292122 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_05980 292137 293525 gene locus_tag LOCUS_05990 292137 293525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 293647 294744 gene locus_tag LOCUS_06000 293647 294744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 294768 297038 gene locus_tag LOCUS_06010 gene maeB 294768 297038 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_06010 297035 297631 gene locus_tag LOCUS_06020 gene ruvA 297035 297631 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_06020 297962 304774 gene locus_tag LOCUS_06030 gene sprA 297962 304774 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_06030 304831 305208 gene locus_tag LOCUS_06040 gene gcvH 304831 305208 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_06040 305218 305586 gene locus_tag LOCUS_06050 305218 305586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 305656 306333 gene locus_tag LOCUS_06060 305656 306333 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_06060 306492 307163 gene locus_tag LOCUS_06070 306492 307163 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_06070 308085 307204 gene locus_tag LOCUS_06080 308085 307204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_06080 311390 308100 gene locus_tag LOCUS_06090 311390 308100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 312458 311412 gene locus_tag LOCUS_06100 312458 311412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 312515 313168 gene locus_tag LOCUS_06110 312515 313168 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_06110 313165 313857 gene locus_tag LOCUS_06120 gene pssA 313165 313857 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_06120 313854 317108 gene locus_tag LOCUS_06130 gene porU 313854 317108 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_06130 317105 318316 gene locus_tag LOCUS_06140 gene porV 317105 318316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_06140 318319 319590 gene locus_tag LOCUS_06150 318319 319590 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_06150 320541 319591 gene locus_tag LOCUS_06160 320541 319591 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597670.1 protein_id gnl|my_center|LOCUS_06160 321472 320543 gene locus_tag LOCUS_06170 321472 320543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 321869 321444 gene locus_tag LOCUS_06180 321869 321444 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_06180 321973 322599 gene locus_tag LOCUS_06190 321973 322599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_06190 323191 322592 gene locus_tag LOCUS_06200 323191 322592 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_06200 324651 323188 gene locus_tag LOCUS_06210 324651 323188 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_06210 325828 324701 gene locus_tag LOCUS_06220 325828 324701 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_06220 325904 326383 gene locus_tag LOCUS_06230 325904 326383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_06230 328683 326377 gene locus_tag LOCUS_06240 328683 326377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 328901 329398 gene locus_tag LOCUS_06250 328901 329398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_06250 329787 330830 gene locus_tag LOCUS_06260 329787 330830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 331803 330934 gene locus_tag LOCUS_06270 gene ykuF 331803 330934 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_06270 331947 332717 gene locus_tag LOCUS_06280 331947 332717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 334088 332769 gene locus_tag LOCUS_06290 gene ahcY 334088 332769 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_06290 334928 334170 gene locus_tag LOCUS_06300 334928 334170 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108184.1 protein_id gnl|my_center|LOCUS_06300 334984 335340 gene locus_tag LOCUS_06310 gene rsfS 334984 335340 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_06310 335406 337478 gene locus_tag LOCUS_06320 gene ftsH 335406 337478 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_06320 337539 338315 gene locus_tag LOCUS_06330 gene lpxH 337539 338315 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_06330 338312 339142 gene locus_tag LOCUS_06340 338312 339142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 339152 339979 gene locus_tag LOCUS_06350 339152 339979 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_06350 340122 340667 gene locus_tag LOCUS_06360 340122 340667 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB9 protein_id gnl|my_center|LOCUS_06360 341880 341455 gene locus_tag LOCUS_06370 341880 341455 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_06370 342062 343444 gene locus_tag LOCUS_06380 342062 343444 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_06380 343434 344777 gene locus_tag LOCUS_06390 343434 344777 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_06390 345698 346396 gene locus_tag LOCUS_06400 345698 346396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 346441 346965 gene locus_tag LOCUS_06410 346441 346965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 347116 348120 gene locus_tag LOCUS_06420 gene fjo19 347116 348120 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_06420 349161 348313 gene locus_tag LOCUS_06430 349161 348313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 349602 350285 gene locus_tag LOCUS_06440 349602 350285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 351368 350415 gene locus_tag LOCUS_06450 351368 350415 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_06450 351507 352001 gene locus_tag LOCUS_06460 351507 352001 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_06460 352189 352911 gene locus_tag LOCUS_06470 352189 352911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 354734 353142 gene locus_tag LOCUS_06480 354734 353142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 356425 355049 gene locus_tag LOCUS_06490 356425 355049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 356960 356412 gene locus_tag LOCUS_06500 356960 356412 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_06500 357292 357026 gene locus_tag LOCUS_06510 357292 357026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 357879 359642 gene locus_tag LOCUS_06520 357879 359642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 360047 359694 gene locus_tag LOCUS_06530 360047 359694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 362721 360115 gene locus_tag LOCUS_06540 362721 360115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_06540 363052 362711 gene locus_tag LOCUS_06550 363052 362711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 363673 363524 gene locus_tag LOCUS_06560 363673 363524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 365170 363674 gene locus_tag LOCUS_06570 365170 363674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 367575 365284 gene locus_tag LOCUS_06580 367575 365284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036930.1 protein_id gnl|my_center|LOCUS_06580 368180 369103 gene locus_tag LOCUS_06590 368180 369103 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_06590 369878 369294 gene locus_tag LOCUS_06600 369878 369294 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_06600 370100 370684 gene locus_tag LOCUS_06610 370100 370684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 370903 371751 gene locus_tag LOCUS_06620 370903 371751 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_06620 371958 372374 gene locus_tag LOCUS_06630 371958 372374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_06630 374056 372707 gene locus_tag LOCUS_06640 374056 372707 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_06640 374732 374049 gene locus_tag LOCUS_06650 374732 374049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_06650 377219 374820 gene locus_tag LOCUS_06660 377219 374820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_06660 378999 377650 gene locus_tag LOCUS_06670 378999 377650 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_06670 379644 379015 gene locus_tag LOCUS_06680 379644 379015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence03 585 1448 gene locus_tag LOCUS_06690 gene dapA 585 1448 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_06690 1451 2761 gene locus_tag LOCUS_06700 gene xseA 1451 2761 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_06700 2758 2946 gene locus_tag LOCUS_06710 2758 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3135 3785 gene locus_tag LOCUS_06720 3135 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4348 3848 gene locus_tag LOCUS_06730 4348 3848 CDS product transcription antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_06730 7892 4488 gene locus_tag LOCUS_06740 7892 4488 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_06740 9030 7897 gene locus_tag LOCUS_06750 9030 7897 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403687.1 protein_id gnl|my_center|LOCUS_06750 10468 9086 gene locus_tag LOCUS_06760 10468 9086 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_06760 11131 10532 gene locus_tag LOCUS_06770 11131 10532 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 protein_id gnl|my_center|LOCUS_06770 11757 15440 gene locus_tag LOCUS_06780 gene purL 11757 15440 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R22 protein_id gnl|my_center|LOCUS_06780 16072 16800 gene locus_tag LOCUS_06790 16072 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 protein_id gnl|my_center|LOCUS_06790 17276 17932 gene locus_tag LOCUS_06800 17276 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 18019 18882 gene locus_tag LOCUS_06810 18019 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19664 20206 gene locus_tag LOCUS_06820 19664 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 21247 22017 gene locus_tag LOCUS_06830 21247 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 22170 22727 gene locus_tag LOCUS_06840 22170 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 24716 23490 gene locus_tag LOCUS_06850 24716 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 25976 24951 gene locus_tag LOCUS_06860 gene cysP 25976 24951 CDS product sulfate permease CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34734 protein_id gnl|my_center|LOCUS_06860 27067 28014 gene locus_tag LOCUS_06870 27067 28014 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_06870 29081 28620 gene locus_tag LOCUS_06880 29081 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 29543 30616 gene locus_tag LOCUS_06890 29543 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 31736 30717 gene locus_tag LOCUS_06900 gene yjjN 31736 30717 CDS product zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_06900 32520 31783 gene locus_tag LOCUS_06910 32520 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 32593 32922 gene locus_tag LOCUS_06920 32593 32922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 33459 33001 gene locus_tag LOCUS_06930 33459 33001 CDS product ligand-binding protein SH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582755.1 protein_id gnl|my_center|LOCUS_06930 34400 33597 gene locus_tag LOCUS_06940 34400 33597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 38007 35179 gene locus_tag LOCUS_06950 gene rapA 38007 35179 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD0 protein_id gnl|my_center|LOCUS_06950 39103 38654 gene locus_tag LOCUS_06960 39103 38654 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_06960 39475 40119 gene locus_tag LOCUS_06970 39475 40119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 protein_id gnl|my_center|LOCUS_06970 40304 40918 gene locus_tag LOCUS_06980 40304 40918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 40972 41760 gene locus_tag LOCUS_06990 40972 41760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 41926 42417 gene locus_tag LOCUS_07000 41926 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 42472 43956 gene locus_tag LOCUS_07010 42472 43956 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_07010 44363 44169 gene locus_tag LOCUS_07020 44363 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 44538 45590 gene locus_tag LOCUS_07030 44538 45590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07030 45654 45974 gene locus_tag LOCUS_07040 45654 45974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 46238 47434 gene locus_tag LOCUS_07050 46238 47434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 47615 47815 gene locus_tag LOCUS_07060 47615 47815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 48103 47870 gene locus_tag LOCUS_07070 48103 47870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 48297 49478 gene locus_tag LOCUS_07080 48297 49478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 49807 49487 gene locus_tag LOCUS_07090 49807 49487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 50228 50917 gene locus_tag LOCUS_07100 50228 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259509.1 protein_id gnl|my_center|LOCUS_07100 51977 51048 gene locus_tag LOCUS_07110 51977 51048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 52789 51989 gene locus_tag LOCUS_07120 52789 51989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 53912 52911 gene locus_tag LOCUS_07130 53912 52911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 54764 53964 gene locus_tag LOCUS_07140 54764 53964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 55326 54757 gene locus_tag LOCUS_07150 55326 54757 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_07150 56680 56213 gene locus_tag LOCUS_07160 56680 56213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 58127 56727 gene locus_tag LOCUS_07170 58127 56727 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039770.1 protein_id gnl|my_center|LOCUS_07170 60184 58190 gene locus_tag LOCUS_07180 60184 58190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 60631 60302 gene locus_tag LOCUS_07190 60631 60302 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_07190 61155 62288 gene locus_tag LOCUS_07200 61155 62288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_07200 62324 67306 gene locus_tag LOCUS_07210 62324 67306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 67393 67626 gene locus_tag LOCUS_07220 67393 67626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 67909 68091 gene locus_tag LOCUS_07230 67909 68091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 68326 71997 gene locus_tag LOCUS_07240 68326 71997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 73140 72358 gene locus_tag LOCUS_07250 73140 72358 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_07250 73680 74009 gene locus_tag LOCUS_07260 73680 74009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 74116 74949 gene locus_tag LOCUS_07270 74116 74949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 75304 76806 gene locus_tag LOCUS_07280 gene phoD 75304 76806 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_07280 77245 78480 gene locus_tag LOCUS_07290 77245 78480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 78718 79455 gene locus_tag LOCUS_07300 78718 79455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 79763 80026 gene locus_tag LOCUS_07310 79763 80026 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_07310 80207 80836 gene locus_tag LOCUS_07320 80207 80836 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_07320 81589 80984 gene locus_tag LOCUS_07330 81589 80984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 81808 82953 gene locus_tag LOCUS_07340 81808 82953 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_07340 83463 83155 gene locus_tag LOCUS_07350 83463 83155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 84321 83527 gene locus_tag LOCUS_07360 gene rsbQ 84321 83527 CDS product sigma factor SigB regulation protein RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07015 protein_id gnl|my_center|LOCUS_07360 84697 85329 gene locus_tag LOCUS_07370 84697 85329 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_07370 85849 85658 gene locus_tag LOCUS_07380 85849 85658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 87789 86386 gene locus_tag LOCUS_07390 87789 86386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_07390 88108 90033 gene locus_tag LOCUS_07400 88108 90033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 90971 90165 gene locus_tag LOCUS_07410 90971 90165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 91401 91721 gene locus_tag LOCUS_07420 91401 91721 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQU1 protein_id gnl|my_center|LOCUS_07420 94284 92593 gene locus_tag LOCUS_07430 94284 92593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 95035 94535 gene locus_tag LOCUS_07440 gene msrA 95035 94535 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6A2 protein_id gnl|my_center|LOCUS_07440 96948 95320 gene locus_tag LOCUS_07450 96948 95320 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_07450 97365 98903 gene locus_tag LOCUS_07460 97365 98903 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_07460 98924 100483 gene locus_tag LOCUS_07470 98924 100483 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_07470 100491 101564 gene locus_tag LOCUS_07480 100491 101564 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061882.1 protein_id gnl|my_center|LOCUS_07480 101567 103018 gene locus_tag LOCUS_07490 101567 103018 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_07490 103015 104235 gene locus_tag LOCUS_07500 103015 104235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 104303 105553 gene locus_tag LOCUS_07510 104303 105553 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_07510 105742 106824 gene locus_tag LOCUS_07520 105742 106824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 106960 108009 gene locus_tag LOCUS_07530 106960 108009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 108160 109206 gene locus_tag LOCUS_07540 108160 109206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 109575 112820 gene locus_tag LOCUS_07550 109575 112820 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_07550 112848 114476 gene locus_tag LOCUS_07560 112848 114476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_07560 114611 115276 gene locus_tag LOCUS_07570 114611 115276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 115266 116750 gene locus_tag LOCUS_07580 115266 116750 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_07580 118428 116971 gene locus_tag LOCUS_07590 118428 116971 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_07590 120982 118430 gene locus_tag LOCUS_07600 120982 118430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_07600 122841 121186 gene locus_tag LOCUS_07610 122841 121186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 126034 122852 gene locus_tag LOCUS_07620 126034 122852 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_07620 127939 126383 gene locus_tag LOCUS_07630 127939 126383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_07630 131078 127968 gene locus_tag LOCUS_07640 131078 127968 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_07640 134150 132306 gene locus_tag LOCUS_07650 134150 132306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 134376 135452 gene locus_tag LOCUS_07660 134376 135452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_07660 135617 137353 gene locus_tag LOCUS_07670 135617 137353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 137580 138779 gene locus_tag LOCUS_07680 137580 138779 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_07680 138841 139842 gene locus_tag LOCUS_07690 138841 139842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118289.1 protein_id gnl|my_center|LOCUS_07690 139865 140791 gene locus_tag LOCUS_07700 139865 140791 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_07700 141184 140792 gene locus_tag LOCUS_07710 141184 140792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 142113 141250 gene locus_tag LOCUS_07720 gene phuW 142113 141250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_07720 142471 142106 gene locus_tag LOCUS_07730 gene folA 142471 142106 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUG0 protein_id gnl|my_center|LOCUS_07730 143424 142471 gene locus_tag LOCUS_07740 143424 142471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 144342 143428 gene locus_tag LOCUS_07750 144342 143428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 144378 145007 gene locus_tag LOCUS_07760 144378 145007 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107823.1 protein_id gnl|my_center|LOCUS_07760 145008 145586 gene locus_tag LOCUS_07770 145008 145586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 146425 145580 gene locus_tag LOCUS_07780 146425 145580 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_07780 148110 146482 gene locus_tag LOCUS_07790 148110 146482 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_07790 149130 148435 gene locus_tag LOCUS_07800 149130 148435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 149420 152035 gene locus_tag LOCUS_07810 149420 152035 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_07810 153260 152046 gene locus_tag LOCUS_07820 gene arcA1 153260 152046 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXW2 protein_id gnl|my_center|LOCUS_07820 155000 153489 gene locus_tag LOCUS_07830 gene aslA 155000 153489 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120093.1 protein_id gnl|my_center|LOCUS_07830 155441 156181 gene locus_tag LOCUS_07840 155441 156181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_07840 156869 156588 gene locus_tag LOCUS_07850 156869 156588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 157271 161392 gene locus_tag LOCUS_07860 157271 161392 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_07860 161701 162381 gene locus_tag LOCUS_07870 161701 162381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 163092 163274 gene locus_tag LOCUS_07880 163092 163274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 163290 163559 gene locus_tag LOCUS_07890 163290 163559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 163752 164252 gene locus_tag LOCUS_07900 gene greA 163752 164252 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_07900 166885 164459 gene locus_tag LOCUS_07910 166885 164459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07910 169551 167122 gene locus_tag LOCUS_07920 169551 167122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07920 170066 171052 gene locus_tag LOCUS_07930 170066 171052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_07930 171858 171163 gene locus_tag LOCUS_07940 171858 171163 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_07940 174496 172070 gene locus_tag LOCUS_07950 174496 172070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_07950 175275 174628 gene locus_tag LOCUS_07960 175275 174628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 175654 177591 gene locus_tag LOCUS_07970 175654 177591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 177703 178113 gene locus_tag LOCUS_07980 177703 178113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 178247 179128 gene locus_tag LOCUS_07990 178247 179128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798133.1 protein_id gnl|my_center|LOCUS_07990 179149 179766 gene locus_tag LOCUS_08000 gene satA 179149 179766 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_08000 179919 181097 gene locus_tag LOCUS_08010 179919 181097 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582901.1 protein_id gnl|my_center|LOCUS_08010 181292 182818 gene locus_tag LOCUS_08020 gene purH 181292 182818 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_08020 182954 183217 gene locus_tag LOCUS_08030 182954 183217 CDS product toxin HicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_08030 183207 183425 gene locus_tag LOCUS_08040 183207 183425 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_08040 183470 183712 gene locus_tag LOCUS_08050 183470 183712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 184170 185660 gene locus_tag LOCUS_08060 gene cysS 184170 185660 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F4 protein_id gnl|my_center|LOCUS_08060 185650 186627 gene locus_tag LOCUS_08070 185650 186627 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_08070 186810 187835 gene locus_tag LOCUS_08080 186810 187835 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_08080 187836 188978 gene locus_tag LOCUS_08090 gene galK 187836 188978 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHD0 protein_id gnl|my_center|LOCUS_08090 189110 192553 gene locus_tag LOCUS_08100 189110 192553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 193010 192654 gene locus_tag LOCUS_08110 193010 192654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 193832 193083 gene locus_tag LOCUS_08120 193832 193083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 194275 193913 gene locus_tag LOCUS_08130 194275 193913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 196162 195149 gene locus_tag LOCUS_08140 gene gnl 196162 195149 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_08140 197840 196368 gene locus_tag LOCUS_08150 197840 196368 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_08150 199143 197869 gene locus_tag LOCUS_08160 199143 197869 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_08160 199947 202067 gene locus_tag LOCUS_08170 199947 202067 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_08170 202123 203157 gene locus_tag LOCUS_08180 202123 203157 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_08180 203168 204493 gene locus_tag LOCUS_08190 203168 204493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 204603 205397 gene locus_tag LOCUS_08200 204603 205397 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_08200 205394 206755 gene locus_tag LOCUS_08210 205394 206755 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_08210 206752 207312 gene locus_tag LOCUS_08220 gene lldG 206752 207312 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071697.1 protein_id gnl|my_center|LOCUS_08220 208616 207309 gene locus_tag LOCUS_08230 208616 207309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 209109 208729 gene locus_tag LOCUS_08240 209109 208729 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_08240 210163 209162 gene locus_tag LOCUS_08250 gene pam 210163 209162 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_08250 210402 211133 gene locus_tag LOCUS_08260 210402 211133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 211214 211819 gene locus_tag LOCUS_08270 211214 211819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence04 889 623 gene locus_tag LOCUS_08280 889 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1276 1851 gene locus_tag LOCUS_08290 1276 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1921 2370 gene locus_tag LOCUS_08300 gene ydfG 1921 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96684 protein_id gnl|my_center|LOCUS_08300 3270 2905 gene locus_tag LOCUS_08310 3270 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3637 3455 gene locus_tag LOCUS_08320 3637 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4177 3929 gene locus_tag LOCUS_08330 4177 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5243 4410 gene locus_tag LOCUS_08340 5243 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6286 5576 gene locus_tag LOCUS_08350 6286 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6474 7139 gene locus_tag LOCUS_08360 6474 7139 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203021.1 protein_id gnl|my_center|LOCUS_08360 8321 7299 gene locus_tag LOCUS_08370 8321 7299 CDS product alkanal monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530498.1 protein_id gnl|my_center|LOCUS_08370 9499 8579 gene locus_tag LOCUS_08380 9499 8579 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_08380 10415 9576 gene locus_tag LOCUS_08390 10415 9576 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224863.1 protein_id gnl|my_center|LOCUS_08390 10720 11064 gene locus_tag LOCUS_08400 10720 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 11428 11189 gene locus_tag LOCUS_08410 11428 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14121 12055 gene locus_tag LOCUS_08420 14121 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14508 15065 gene locus_tag LOCUS_08430 14508 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15070 16125 gene locus_tag LOCUS_08440 15070 16125 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087109.1 protein_id gnl|my_center|LOCUS_08440 17561 16599 gene locus_tag LOCUS_08450 gene ephA 17561 16599 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_08450 18326 17637 gene locus_tag LOCUS_08460 18326 17637 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_08460 18673 18903 gene locus_tag LOCUS_08470 18673 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 19330 19052 gene locus_tag LOCUS_08480 19330 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19704 20423 gene locus_tag LOCUS_08490 19704 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 20815 21339 gene locus_tag LOCUS_08500 20815 21339 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435461.1 protein_id gnl|my_center|LOCUS_08500 22591 22157 gene locus_tag LOCUS_08510 22591 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 22893 23141 gene locus_tag LOCUS_08520 22893 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 23262 23558 gene locus_tag LOCUS_08530 23262 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 24283 23555 gene locus_tag LOCUS_08540 24283 23555 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_08540 24829 25083 gene locus_tag LOCUS_08550 24829 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 25983 25588 gene locus_tag LOCUS_08560 25983 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 27370 26090 gene locus_tag LOCUS_08570 27370 26090 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_08570 28515 27592 gene locus_tag LOCUS_08580 28515 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 28543 29280 gene locus_tag LOCUS_08590 gene surE 28543 29280 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W92 protein_id gnl|my_center|LOCUS_08590 31045 29582 gene locus_tag LOCUS_08600 31045 29582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_08600 34126 31064 gene locus_tag LOCUS_08610 34126 31064 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_08610 35212 34364 gene locus_tag LOCUS_08620 gene yhxC 35212 34364 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 protein_id gnl|my_center|LOCUS_08620 35483 35235 gene locus_tag LOCUS_08630 35483 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 35898 35710 gene locus_tag LOCUS_08640 35898 35710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 36445 35942 gene locus_tag LOCUS_08650 36445 35942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 36792 37082 gene locus_tag LOCUS_08660 36792 37082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 37615 37265 gene locus_tag LOCUS_08670 37615 37265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 38543 39781 gene locus_tag LOCUS_08680 38543 39781 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_08680 42156 40177 gene locus_tag LOCUS_08690 42156 40177 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291482.1 protein_id gnl|my_center|LOCUS_08690 43371 42166 gene locus_tag LOCUS_08700 43371 42166 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202381.1 protein_id gnl|my_center|LOCUS_08700 43758 43372 gene locus_tag LOCUS_08710 43758 43372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 44161 43946 gene locus_tag LOCUS_08720 44161 43946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 45675 44839 gene locus_tag LOCUS_08730 45675 44839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 46176 45976 gene locus_tag LOCUS_08740 46176 45976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 46427 48889 gene locus_tag LOCUS_08750 46427 48889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108170.1 protein_id gnl|my_center|LOCUS_08750 51119 48915 gene locus_tag LOCUS_08760 51119 48915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_08760 52046 51291 gene locus_tag LOCUS_08770 52046 51291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 54191 52134 gene locus_tag LOCUS_08780 54191 52134 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_08780 57558 54328 gene locus_tag LOCUS_08790 57558 54328 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108996.1 protein_id gnl|my_center|LOCUS_08790 59103 57658 gene locus_tag LOCUS_08800 59103 57658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 60930 59119 gene locus_tag LOCUS_08810 60930 59119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 62168 61464 gene locus_tag LOCUS_08820 62168 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 63917 62172 gene locus_tag LOCUS_08830 63917 62172 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_08830 65050 64190 gene locus_tag LOCUS_08840 65050 64190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_08840 66370 65159 gene locus_tag LOCUS_08850 66370 65159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_08850 67525 66566 gene locus_tag LOCUS_08860 67525 66566 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_08860 68485 67634 gene locus_tag LOCUS_08870 68485 67634 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_08870 69607 68492 gene locus_tag LOCUS_08880 69607 68492 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_08880 70466 69738 gene locus_tag LOCUS_08890 70466 69738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 71109 70561 gene locus_tag LOCUS_08900 71109 70561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 74221 71117 gene locus_tag LOCUS_08910 74221 71117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 78607 74534 gene locus_tag LOCUS_08920 78607 74534 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_08920 79308 82379 gene locus_tag LOCUS_08930 79308 82379 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_08930 82396 84264 gene locus_tag LOCUS_08940 82396 84264 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_08940 84288 84992 gene locus_tag LOCUS_08950 84288 84992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 85064 86131 gene locus_tag LOCUS_08960 85064 86131 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767184.1 protein_id gnl|my_center|LOCUS_08960 86131 88236 gene locus_tag LOCUS_08970 86131 88236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 89427 88591 gene locus_tag LOCUS_08980 89427 88591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121844.1 protein_id gnl|my_center|LOCUS_08980 90229 89450 gene locus_tag LOCUS_08990 90229 89450 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123085.1 protein_id gnl|my_center|LOCUS_08990 91442 90246 gene locus_tag LOCUS_09000 91442 90246 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_09000 93181 91433 gene locus_tag LOCUS_09010 93181 91433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_09010 96671 93201 gene locus_tag LOCUS_09020 96671 93201 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_09020 97821 96838 gene locus_tag LOCUS_09030 97821 96838 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_09030 98503 97916 gene locus_tag LOCUS_09040 98503 97916 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_09040 99449 99261 gene locus_tag LOCUS_09050 99449 99261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 100814 99852 gene locus_tag LOCUS_09060 100814 99852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 111758 100929 gene locus_tag LOCUS_09070 111758 100929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 113700 112000 gene locus_tag LOCUS_09080 113700 112000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 114163 114594 gene locus_tag LOCUS_09090 114163 114594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 116561 116133 gene locus_tag LOCUS_09100 116561 116133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 119021 117138 gene locus_tag LOCUS_09110 119021 117138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 120814 119471 gene locus_tag LOCUS_09120 120814 119471 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_09120 122752 121082 gene locus_tag LOCUS_09130 gene araB 122752 121082 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FK5 protein_id gnl|my_center|LOCUS_09130 124248 122749 gene locus_tag LOCUS_09140 124248 122749 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_09140 125250 124309 gene locus_tag LOCUS_09150 125250 124309 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_09150 126720 125254 gene locus_tag LOCUS_09160 126720 125254 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_09160 128697 126733 gene locus_tag LOCUS_09170 128697 126733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_09170 130192 128708 gene locus_tag LOCUS_09180 130192 128708 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118991.1 protein_id gnl|my_center|LOCUS_09180 131382 130204 gene locus_tag LOCUS_09190 131382 130204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_09190 132907 131387 gene locus_tag LOCUS_09200 132907 131387 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_09200 134372 132894 gene locus_tag LOCUS_09210 134372 132894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 137407 134384 gene locus_tag LOCUS_09220 137407 134384 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_09220 139285 137804 gene locus_tag LOCUS_09230 139285 137804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 142324 139298 gene locus_tag LOCUS_09240 142324 139298 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_09240 144022 142415 gene locus_tag LOCUS_09250 gene fucI 144022 142415 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 protein_id gnl|my_center|LOCUS_09250 144246 145115 gene locus_tag LOCUS_09260 144246 145115 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267683.1 protein_id gnl|my_center|LOCUS_09260 145288 145548 gene locus_tag LOCUS_09270 145288 145548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 145687 146853 gene locus_tag LOCUS_09280 145687 146853 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_09280 147086 146868 gene locus_tag LOCUS_09290 147086 146868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 147784 147140 gene locus_tag LOCUS_09300 147784 147140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 148278 148649 gene locus_tag LOCUS_09310 148278 148649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 149004 150434 gene locus_tag LOCUS_09320 gene yrbD 149004 150434 CDS product putative sodium/proton-dependent alanine carrier protein YrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32060 protein_id gnl|my_center|LOCUS_09320 150547 150906 gene locus_tag LOCUS_09330 150547 150906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 151024 151488 gene locus_tag LOCUS_09340 151024 151488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 152400 151567 gene locus_tag LOCUS_09350 gene melR 152400 151567 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119382.1 protein_id gnl|my_center|LOCUS_09350 152627 153817 gene locus_tag LOCUS_09360 152627 153817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_09360 153863 155251 gene locus_tag LOCUS_09370 gene pel 153863 155251 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_09370 155423 156718 gene locus_tag LOCUS_09380 155423 156718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119390.1 protein_id gnl|my_center|LOCUS_09380 156960 156766 gene locus_tag LOCUS_09390 156960 156766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 156908 157714 gene locus_tag LOCUS_09400 156908 157714 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_09400 157997 159040 gene locus_tag LOCUS_09410 157997 159040 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_09410 159193 159957 gene locus_tag LOCUS_09420 gene mapB 159193 159957 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_09420 160934 160248 gene locus_tag LOCUS_09430 160934 160248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 161193 161981 gene locus_tag LOCUS_09440 161193 161981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 162011 162613 gene locus_tag LOCUS_09450 162011 162613 CDS product nodulation protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_09450 162842 163087 gene locus_tag LOCUS_09460 162842 163087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 163148 164047 gene locus_tag LOCUS_09470 163148 164047 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123493.1 protein_id gnl|my_center|LOCUS_09470 164175 164630 gene locus_tag LOCUS_09480 164175 164630 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_09480 164636 165034 gene locus_tag LOCUS_09490 164636 165034 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973783.1 protein_id gnl|my_center|LOCUS_09490 165164 165622 gene locus_tag LOCUS_09500 165164 165622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 165970 166449 gene locus_tag LOCUS_09510 165970 166449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 166698 167057 gene locus_tag LOCUS_09520 166698 167057 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_09520 167054 167668 gene locus_tag LOCUS_09530 167054 167668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 167935 168372 gene locus_tag LOCUS_09540 gene phnB 167935 168372 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_09540 170351 168669 gene locus_tag LOCUS_09550 170351 168669 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_09550 171696 170656 gene locus_tag LOCUS_09560 171696 170656 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_09560 172331 171702 gene locus_tag LOCUS_09570 gene arsC 172331 171702 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_09570 172823 172353 gene locus_tag LOCUS_09580 172823 172353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_09580 173011 172820 gene locus_tag LOCUS_09590 173011 172820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 173297 172965 gene locus_tag LOCUS_09600 173297 172965 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_09600 173558 175060 gene locus_tag LOCUS_09610 173558 175060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 175352 176791 gene locus_tag LOCUS_09620 175352 176791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 177106 178359 gene locus_tag LOCUS_09630 177106 178359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 178720 180048 gene locus_tag LOCUS_09640 178720 180048 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_09640 180060 181259 gene locus_tag LOCUS_09650 180060 181259 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_09650 181267 182010 gene locus_tag LOCUS_09660 181267 182010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_09660 182013 183233 gene locus_tag LOCUS_09670 182013 183233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_09670 183385 184275 gene locus_tag LOCUS_09680 183385 184275 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_09680 184279 185016 gene locus_tag LOCUS_09690 184279 185016 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_09690 185172 186185 gene locus_tag LOCUS_09700 185172 186185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 186391 187737 gene locus_tag LOCUS_09710 186391 187737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 190039 187814 gene locus_tag LOCUS_09720 190039 187814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 190907 191734 gene locus_tag LOCUS_09730 190907 191734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 192067 192927 gene locus_tag LOCUS_09740 192067 192927 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_09740 192939 193667 gene locus_tag LOCUS_09750 192939 193667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence05 631 176 gene locus_tag LOCUS_09760 gene rnhA 631 176 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_09760 1258 668 gene locus_tag LOCUS_09770 1258 668 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_09770 2507 1452 gene locus_tag LOCUS_09780 2507 1452 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_09780 2932 2519 gene locus_tag LOCUS_09790 gene aroQ 2932 2519 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_09790 3063 3968 gene locus_tag LOCUS_09800 gene xerD 3063 3968 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_09800 4046 4603 gene locus_tag LOCUS_09810 4046 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4628 4876 gene locus_tag LOCUS_09820 4628 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5710 4889 gene locus_tag LOCUS_09830 5710 4889 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_09830 5805 6329 gene locus_tag LOCUS_09840 5805 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8015 6333 gene locus_tag LOCUS_09850 8015 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 9440 8112 gene locus_tag LOCUS_09860 gene ftsA 9440 8112 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_09860 10191 9433 gene locus_tag LOCUS_09870 10191 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11600 10188 gene locus_tag LOCUS_09880 gene murC 11600 10188 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_09880 12679 11597 gene locus_tag LOCUS_09890 gene murG 12679 11597 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_09890 13887 12709 gene locus_tag LOCUS_09900 13887 12709 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_09900 15236 13884 gene locus_tag LOCUS_09910 gene murD 15236 13884 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_09910 16453 15242 gene locus_tag LOCUS_09920 gene mraY 16453 15242 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_09920 17918 16455 gene locus_tag LOCUS_09930 gene murE 17918 16455 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_09930 19928 17919 gene locus_tag LOCUS_09940 gene ftsI 19928 17919 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_09940 20407 20024 gene locus_tag LOCUS_09950 20407 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 21315 20404 gene locus_tag LOCUS_09960 gene rsmH 21315 20404 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_09960 21754 21320 gene locus_tag LOCUS_09970 gene mraZ 21754 21320 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK88 protein_id gnl|my_center|LOCUS_09970 24427 22433 gene locus_tag LOCUS_09980 24427 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 24798 24427 gene locus_tag LOCUS_09990 24798 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 25149 26261 gene locus_tag LOCUS_10000 25149 26261 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_10000 26308 27072 gene locus_tag LOCUS_10010 26308 27072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_10010 27079 28059 gene locus_tag LOCUS_10020 27079 28059 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_10020 30188 28392 gene locus_tag LOCUS_10030 30188 28392 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_10030 30852 30364 gene locus_tag LOCUS_10040 30852 30364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_10040 31723 30932 gene locus_tag LOCUS_10050 31723 30932 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_10050 33018 31828 gene locus_tag LOCUS_10060 33018 31828 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_10060 33270 33343 gene locus_tag LOCUS_t00040 33270 33343 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 33713 34108 gene locus_tag LOCUS_10070 33713 34108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 34105 34533 gene locus_tag LOCUS_10080 34105 34533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 34537 35082 gene locus_tag LOCUS_10090 34537 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801902.1 protein_id gnl|my_center|LOCUS_10090 35189 35674 gene locus_tag LOCUS_10100 35189 35674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 36260 36826 gene locus_tag LOCUS_10110 36260 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 38981 36972 gene locus_tag LOCUS_10120 38981 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 40458 39079 gene locus_tag LOCUS_10130 40458 39079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 40651 40929 gene locus_tag LOCUS_10140 40651 40929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 40931 41758 gene locus_tag LOCUS_10150 40931 41758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 43608 41857 gene locus_tag LOCUS_10160 43608 41857 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_10160 45216 43612 gene locus_tag LOCUS_10170 45216 43612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 45530 46318 gene locus_tag LOCUS_10180 45530 46318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 46325 47560 gene locus_tag LOCUS_10190 46325 47560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 47662 48705 gene locus_tag LOCUS_10200 gene hemH 47662 48705 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_10200 49651 48707 gene locus_tag LOCUS_10210 49651 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 50103 51266 gene locus_tag LOCUS_10220 50103 51266 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_10220 51425 52774 gene locus_tag LOCUS_10230 51425 52774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 53303 54196 gene locus_tag LOCUS_10240 53303 54196 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268470.1 protein_id gnl|my_center|LOCUS_10240 54847 54188 gene locus_tag LOCUS_10250 54847 54188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 54976 56334 gene locus_tag LOCUS_10260 gene gcdH 54976 56334 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_10260 57104 56331 gene locus_tag LOCUS_10270 57104 56331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 57438 58076 gene locus_tag LOCUS_10280 57438 58076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 59807 58248 gene locus_tag LOCUS_10290 59807 58248 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_10290 60826 59954 gene locus_tag LOCUS_10300 gene atpG 60826 59954 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_10300 62468 60891 gene locus_tag LOCUS_10310 gene atpA 62468 60891 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_10310 63054 62494 gene locus_tag LOCUS_10320 gene atpH 63054 62494 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241344.1 protein_id gnl|my_center|LOCUS_10320 63462 63064 gene locus_tag LOCUS_10330 gene atpF 63462 63064 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9U9 protein_id gnl|my_center|LOCUS_10330 63891 63631 gene locus_tag LOCUS_10340 63891 63631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 64972 63929 gene locus_tag LOCUS_10350 gene atpB 64972 63929 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_10350 65794 68415 gene locus_tag LOCUS_10360 65794 68415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 68419 70725 gene locus_tag LOCUS_10370 gene mrcA 68419 70725 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_10370 70791 72596 gene locus_tag LOCUS_10380 gene uvrC 70791 72596 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_10380 73437 72613 gene locus_tag LOCUS_10390 73437 72613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 74950 73463 gene locus_tag LOCUS_10400 74950 73463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 75871 75116 gene locus_tag LOCUS_10410 75871 75116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 77094 75979 gene locus_tag LOCUS_10420 77094 75979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 78146 77244 gene locus_tag LOCUS_10430 gene porP 78146 77244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_10430 79075 78302 gene locus_tag LOCUS_10440 79075 78302 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_10440 80229 79108 gene locus_tag LOCUS_10450 80229 79108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 81878 80232 gene locus_tag LOCUS_10460 81878 80232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 82075 83103 gene locus_tag LOCUS_10470 82075 83103 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_10470 83118 83429 gene locus_tag LOCUS_10480 83118 83429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 83549 85624 gene locus_tag LOCUS_10490 83549 85624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 85628 85960 gene locus_tag LOCUS_10500 85628 85960 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AJ7 protein_id gnl|my_center|LOCUS_10500 85974 86375 gene locus_tag LOCUS_10510 85974 86375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 86463 88463 gene locus_tag LOCUS_10520 86463 88463 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_10520 88516 89883 gene locus_tag LOCUS_10530 gene surA 88516 89883 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAA2 protein_id gnl|my_center|LOCUS_10530 90267 89950 gene locus_tag LOCUS_10540 90267 89950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 92149 90356 gene locus_tag LOCUS_10550 92149 90356 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_10550 92292 93392 gene locus_tag LOCUS_10560 gene vdh 92292 93392 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_10560 93509 94693 gene locus_tag LOCUS_10570 gene nusB 93509 94693 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_10570 94701 95003 gene locus_tag LOCUS_10580 94701 95003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 95100 95642 gene locus_tag LOCUS_10590 95100 95642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_10590 95645 95962 gene locus_tag LOCUS_10600 gene yajC 95645 95962 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_10600 96031 96933 gene locus_tag LOCUS_10610 96031 96933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 96926 97531 gene locus_tag LOCUS_10620 gene coaE 96926 97531 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_10620 97607 98488 gene locus_tag LOCUS_10630 97607 98488 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_10630 98608 99402 gene locus_tag LOCUS_10640 98608 99402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_10640 99380 99763 gene locus_tag LOCUS_10650 99380 99763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_10650 101198 99924 gene locus_tag LOCUS_10660 101198 99924 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_10660 102005 101238 gene locus_tag LOCUS_10670 102005 101238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 102080 103057 gene locus_tag LOCUS_10680 102080 103057 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_10680 103061 104260 gene locus_tag LOCUS_10690 103061 104260 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_10690 104354 105019 gene locus_tag LOCUS_10700 104354 105019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 105023 105898 gene locus_tag LOCUS_10710 gene nadK 105023 105898 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_10710 106007 106756 gene locus_tag LOCUS_10720 106007 106756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 106841 107578 gene locus_tag LOCUS_10730 106841 107578 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z22 protein_id gnl|my_center|LOCUS_10730 107637 110282 gene locus_tag LOCUS_10740 107637 110282 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_10740 110375 110905 gene locus_tag LOCUS_10750 110375 110905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766991.1 protein_id gnl|my_center|LOCUS_10750 110919 111467 gene locus_tag LOCUS_10760 110919 111467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 111692 111997 gene locus_tag LOCUS_10770 111692 111997 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_10770 112974 112081 gene locus_tag LOCUS_10780 112974 112081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_10780 113983 113018 gene locus_tag LOCUS_10790 113983 113018 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_10790 114103 115764 gene locus_tag LOCUS_10800 114103 115764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 116654 115767 gene locus_tag LOCUS_10810 116654 115767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 117012 116674 gene locus_tag LOCUS_10820 117012 116674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 117663 117346 gene locus_tag LOCUS_10830 117663 117346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_10830 118571 117687 gene locus_tag LOCUS_10840 gene xerC 118571 117687 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_10840 118896 118702 gene locus_tag LOCUS_10850 gene rpsU 118896 118702 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_10850 119156 119833 gene locus_tag LOCUS_10860 119156 119833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 120194 121435 gene locus_tag LOCUS_10870 120194 121435 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_10870 121828 124395 gene locus_tag LOCUS_10880 121828 124395 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_10880 124916 124563 gene locus_tag LOCUS_10890 124916 124563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 126438 124936 gene locus_tag LOCUS_10900 gene atpD 126438 124936 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_10900 126733 127584 gene locus_tag LOCUS_10910 126733 127584 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_10910 127690 128748 gene locus_tag LOCUS_10920 127690 128748 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_10920 128748 129551 gene locus_tag LOCUS_10930 gene hmuV 128748 129551 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_10930 129554 130600 gene locus_tag LOCUS_10940 gene hmuS 129554 130600 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_10940 130884 133091 gene locus_tag LOCUS_10950 130884 133091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_10950 133114 134175 gene locus_tag LOCUS_10960 133114 134175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 134873 134445 gene locus_tag LOCUS_10970 134873 134445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 135031 135270 gene locus_tag LOCUS_10980 135031 135270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 135475 135852 gene locus_tag LOCUS_10990 135475 135852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_10990 136220 137203 gene locus_tag LOCUS_11000 gene ddl 136220 137203 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_11000 137507 138928 gene locus_tag LOCUS_11010 137507 138928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 139171 140784 gene locus_tag LOCUS_11020 139171 140784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 141123 142784 gene locus_tag LOCUS_11030 141123 142784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 143088 148019 gene locus_tag LOCUS_11040 143088 148019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 152381 148104 gene locus_tag LOCUS_11050 152381 148104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 154573 153539 gene locus_tag LOCUS_11060 154573 153539 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_11060 154632 155549 gene locus_tag LOCUS_11070 gene acdS 154632 155549 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_11070 156174 155530 gene locus_tag LOCUS_11080 156174 155530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 158243 156201 gene locus_tag LOCUS_11090 gene uvrB 158243 156201 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_11090 159497 158307 gene locus_tag LOCUS_11100 159497 158307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_11100 159724 161850 gene locus_tag LOCUS_11110 159724 161850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 162095 161916 gene locus_tag LOCUS_11120 162095 161916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 162094 163248 gene locus_tag LOCUS_11130 gene gntT 162094 163248 CDS product high-affinity gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_709192.1 protein_id gnl|my_center|LOCUS_11130 163273 163746 gene locus_tag LOCUS_11140 163273 163746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_11140 165224 163830 gene locus_tag LOCUS_11150 165224 163830 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_11150 166705 165359 gene locus_tag LOCUS_11160 166705 165359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 169767 166705 gene locus_tag LOCUS_11170 169767 166705 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_11170 170851 169769 gene locus_tag LOCUS_11180 170851 169769 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_11180 171654 170869 gene locus_tag LOCUS_11190 171654 170869 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_11190 175233 171889 gene locus_tag LOCUS_11200 175233 171889 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_11200 175632 176279 gene locus_tag LOCUS_11210 175632 176279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_11210 176823 176353 gene locus_tag LOCUS_11220 176823 176353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 178058 177018 gene locus_tag LOCUS_11230 178058 177018 CDS product methyltransferase/methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_11230 180182 178428 gene locus_tag LOCUS_11240 gene aspS 180182 178428 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_11240 180504 181811 gene locus_tag LOCUS_11250 180504 181811 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_11250 182154 182885 gene locus_tag LOCUS_11260 182154 182885 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_11260 183842 182994 gene locus_tag LOCUS_11270 183842 182994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 186540 184123 gene locus_tag LOCUS_11280 186540 184123 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_11280 187505 186531 gene locus_tag LOCUS_11290 187505 186531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence06 1480 239 gene locus_tag LOCUS_11300 1480 239 CDS product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_11300 2136 1540 gene locus_tag LOCUS_11310 2136 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2211 3863 gene locus_tag LOCUS_11320 2211 3863 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_11320 3860 4225 gene locus_tag LOCUS_11330 gene acpS 3860 4225 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI1 protein_id gnl|my_center|LOCUS_11330 4222 5511 gene locus_tag LOCUS_11340 4222 5511 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_11340 5504 7027 gene locus_tag LOCUS_11350 5504 7027 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_11350 8724 7150 gene locus_tag LOCUS_11360 8724 7150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_11360 11974 8711 gene locus_tag LOCUS_11370 11974 8711 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_11370 12871 11993 gene locus_tag LOCUS_11380 12871 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 14054 12852 gene locus_tag LOCUS_11390 14054 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 15668 14748 gene locus_tag LOCUS_11400 15668 14748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090081.1 protein_id gnl|my_center|LOCUS_11400 18178 15953 gene locus_tag LOCUS_11410 18178 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_11410 20120 18537 gene locus_tag LOCUS_11420 20120 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 22702 20285 gene locus_tag LOCUS_11430 22702 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 23520 23104 gene locus_tag LOCUS_11440 23520 23104 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_11440 25483 23510 gene locus_tag LOCUS_11450 25483 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 26284 25823 gene locus_tag LOCUS_11460 26284 25823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 26731 27261 gene locus_tag LOCUS_11470 26731 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 27764 28201 gene locus_tag LOCUS_11480 gene ppi 27764 28201 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_11480 28335 28940 gene locus_tag LOCUS_11490 28335 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 29641 28937 gene locus_tag LOCUS_11500 gene trmH 29641 28937 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51081 protein_id gnl|my_center|LOCUS_11500 32283 29659 gene locus_tag LOCUS_11510 gene parC 32283 29659 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_11510 34287 32386 gene locus_tag LOCUS_11520 gene parE 34287 32386 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_11520 34805 34311 gene locus_tag LOCUS_11530 34805 34311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 34921 36153 gene locus_tag LOCUS_11540 gene erg3 34921 36153 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_11540 36237 36542 gene locus_tag LOCUS_11550 36237 36542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 37455 36523 gene locus_tag LOCUS_11560 37455 36523 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_11560 38101 38475 gene locus_tag LOCUS_11570 38101 38475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 39289 38453 gene locus_tag LOCUS_11580 39289 38453 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769324.1 protein_id gnl|my_center|LOCUS_11580 39580 40470 gene locus_tag LOCUS_11590 39580 40470 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_11590 40477 41094 gene locus_tag LOCUS_11600 40477 41094 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_11600 42171 41524 gene locus_tag LOCUS_11610 42171 41524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 42582 42917 gene locus_tag LOCUS_11620 42582 42917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 43032 45311 gene locus_tag LOCUS_11630 43032 45311 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_11630 46207 45524 gene locus_tag LOCUS_11640 46207 45524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 46784 46200 gene locus_tag LOCUS_11650 46784 46200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 47597 46806 gene locus_tag LOCUS_11660 47597 46806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 48234 47590 gene locus_tag LOCUS_11670 48234 47590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 49157 48243 gene locus_tag LOCUS_11680 49157 48243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 50276 49593 gene locus_tag LOCUS_11690 50276 49593 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_11690 50817 50269 gene locus_tag LOCUS_11700 50817 50269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 51670 50858 gene locus_tag LOCUS_11710 51670 50858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 52186 51710 gene locus_tag LOCUS_11720 52186 51710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 52451 52173 gene locus_tag LOCUS_11730 52451 52173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 53059 52454 gene locus_tag LOCUS_11740 53059 52454 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_11740 55815 53266 gene locus_tag LOCUS_11750 55815 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 56198 56824 gene locus_tag LOCUS_11760 gene pnuC 56198 56824 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_11760 56802 57875 gene locus_tag LOCUS_11770 56802 57875 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088361.1 protein_id gnl|my_center|LOCUS_11770 58381 58674 gene locus_tag LOCUS_11780 gene rhaM 58381 58674 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_11780 58978 60402 gene locus_tag LOCUS_11790 58978 60402 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_11790 60592 60383 gene locus_tag LOCUS_11800 60592 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 60841 62118 gene locus_tag LOCUS_11810 60841 62118 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_11810 64246 62186 gene locus_tag LOCUS_11820 64246 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 64864 64349 gene locus_tag LOCUS_11830 64864 64349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 65170 66327 gene locus_tag LOCUS_11840 65170 66327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 66346 67623 gene locus_tag LOCUS_11850 66346 67623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 67729 67959 gene locus_tag LOCUS_11860 67729 67959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 68059 69270 gene locus_tag LOCUS_11870 68059 69270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 69302 70009 gene locus_tag LOCUS_11880 69302 70009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 70013 70996 gene locus_tag LOCUS_11890 70013 70996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 71235 72866 gene locus_tag LOCUS_11900 71235 72866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 74204 73260 gene locus_tag LOCUS_11910 74204 73260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 74516 74833 gene locus_tag LOCUS_11920 74516 74833 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_11920 74989 75552 gene locus_tag LOCUS_11930 74989 75552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 75715 76308 gene locus_tag LOCUS_11940 75715 76308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 76460 77542 gene locus_tag LOCUS_11950 76460 77542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 77823 81077 gene locus_tag LOCUS_11960 77823 81077 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_11960 81096 82682 gene locus_tag LOCUS_11970 81096 82682 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_11970 82902 84689 gene locus_tag LOCUS_11980 82902 84689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 84708 86633 gene locus_tag LOCUS_11990 84708 86633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_11990 86946 88115 gene locus_tag LOCUS_12000 86946 88115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_12000 88263 89411 gene locus_tag LOCUS_12010 88263 89411 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_12010 89693 90199 gene locus_tag LOCUS_12020 89693 90199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 92905 90398 gene locus_tag LOCUS_12030 92905 90398 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_12030 94680 93139 gene locus_tag LOCUS_12040 94680 93139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_12040 95253 96044 gene locus_tag LOCUS_12050 gene kce 95253 96044 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 protein_id gnl|my_center|LOCUS_12050 96041 96688 gene locus_tag LOCUS_12060 96041 96688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 96685 97530 gene locus_tag LOCUS_12070 96685 97530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 98438 97542 gene locus_tag LOCUS_12080 98438 97542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 99740 98511 gene locus_tag LOCUS_12090 99740 98511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 100672 100046 gene locus_tag LOCUS_12100 100672 100046 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_12100 100996 103482 gene locus_tag LOCUS_12110 100996 103482 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_12110 104111 103479 gene locus_tag LOCUS_12120 104111 103479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 104691 104164 gene locus_tag LOCUS_12130 104691 104164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 104740 105450 gene locus_tag LOCUS_12140 104740 105450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 105970 107409 gene locus_tag LOCUS_12150 105970 107409 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_12150 107442 107906 gene locus_tag LOCUS_12160 107442 107906 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_12160 108033 108884 gene locus_tag LOCUS_12170 108033 108884 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_12170 109090 110382 gene locus_tag LOCUS_12180 gene tyrS 109090 110382 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_12180 110530 111231 gene locus_tag LOCUS_12190 110530 111231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 112911 111349 gene locus_tag LOCUS_12200 112911 111349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_12200 113195 114793 gene locus_tag LOCUS_12210 gene pckA1 113195 114793 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_12210 115167 114937 gene locus_tag LOCUS_12220 115167 114937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 118393 115235 gene locus_tag LOCUS_12230 gene nolG 118393 115235 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537777.1 protein_id gnl|my_center|LOCUS_12230 119449 118397 gene locus_tag LOCUS_12240 119449 118397 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704066.1 protein_id gnl|my_center|LOCUS_12240 120898 119579 gene locus_tag LOCUS_12250 120898 119579 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_12250 121478 121017 gene locus_tag LOCUS_12260 121478 121017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 122197 122868 gene locus_tag LOCUS_12270 122197 122868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 122996 123502 gene locus_tag LOCUS_12280 122996 123502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 123545 123949 gene locus_tag LOCUS_12290 123545 123949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 125326 124019 gene locus_tag LOCUS_12300 125326 124019 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_12300 126263 125496 gene locus_tag LOCUS_12310 126263 125496 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_12310 127037 126645 gene locus_tag LOCUS_12320 127037 126645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 128466 127195 gene locus_tag LOCUS_12330 128466 127195 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_12330 128837 128463 gene locus_tag LOCUS_12340 128837 128463 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_12340 129913 129077 gene locus_tag LOCUS_12350 129913 129077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 132317 129915 gene locus_tag LOCUS_12360 132317 129915 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_12360 132460 133425 gene locus_tag LOCUS_12370 132460 133425 CDS product aerotolerance regulator BatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405281.1 protein_id gnl|my_center|LOCUS_12370 133426 134070 gene locus_tag LOCUS_12380 133426 134070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 134060 134680 gene locus_tag LOCUS_12390 134060 134680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 134772 135953 gene locus_tag LOCUS_12400 134772 135953 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_12400 136010 137095 gene locus_tag LOCUS_12410 136010 137095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 137155 138093 gene locus_tag LOCUS_12420 gene purC 137155 138093 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_12420 138114 138497 gene locus_tag LOCUS_12430 138114 138497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 138494 139411 gene locus_tag LOCUS_12440 gene rnz 138494 139411 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_12440 139408 140199 gene locus_tag LOCUS_12450 139408 140199 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_12450 141939 140218 gene locus_tag LOCUS_12460 141939 140218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 144499 142043 gene locus_tag LOCUS_12470 144499 142043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 145712 144582 gene locus_tag LOCUS_12480 145712 144582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 147076 145886 gene locus_tag LOCUS_12490 147076 145886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 149698 147125 gene locus_tag LOCUS_12500 gene gyrA 149698 147125 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_12500 >Feature sequence07 3696 4646 gene locus_tag LOCUS_12510 3696 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4637 5524 gene locus_tag LOCUS_12520 4637 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6914 5568 gene locus_tag LOCUS_12530 6914 5568 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_12530 10034 7095 gene locus_tag LOCUS_12540 10034 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10047 10268 gene locus_tag LOCUS_12550 10047 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10885 10253 gene locus_tag LOCUS_12560 gene lspA 10885 10253 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_12560 14297 10902 gene locus_tag LOCUS_12570 gene ileS 14297 10902 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_12570 15628 14522 gene locus_tag LOCUS_12580 15628 14522 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_12580 15794 16885 gene locus_tag LOCUS_12590 15794 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 19134 17878 gene locus_tag LOCUS_12600 19134 17878 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_12600 19195 20304 gene locus_tag LOCUS_12610 19195 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 20390 20854 gene locus_tag LOCUS_12620 20390 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 20984 21910 gene locus_tag LOCUS_12630 20984 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 23162 22137 gene locus_tag LOCUS_12640 23162 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 25179 23164 gene locus_tag LOCUS_12650 25179 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 26661 25618 gene locus_tag LOCUS_12660 26661 25618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12660 28133 26901 gene locus_tag LOCUS_12670 28133 26901 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12670 28406 30067 gene locus_tag LOCUS_12680 28406 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 30064 30759 gene locus_tag LOCUS_12690 gene rprY 30064 30759 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_12690 31939 30926 gene locus_tag LOCUS_12700 gene ykfB 31939 30926 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_12700 32034 33515 gene locus_tag LOCUS_12710 32034 33515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 33615 34346 gene locus_tag LOCUS_12720 33615 34346 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_12720 34499 34912 gene locus_tag LOCUS_12730 34499 34912 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_12730 35656 35090 gene locus_tag LOCUS_12740 35656 35090 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_12740 35934 36962 gene locus_tag LOCUS_12750 gene pheS 35934 36962 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_12750 38599 37247 gene locus_tag LOCUS_12760 gene kmo 38599 37247 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_12760 39902 38625 gene locus_tag LOCUS_12770 gene kynU 39902 38625 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_12770 40856 40344 gene locus_tag LOCUS_12780 gene haaO 40856 40344 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_12780 40999 41967 gene locus_tag LOCUS_12790 40999 41967 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882917.1 protein_id gnl|my_center|LOCUS_12790 41967 42581 gene locus_tag LOCUS_12800 41967 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 42918 42535 gene locus_tag LOCUS_12810 42918 42535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 43202 42918 gene locus_tag LOCUS_12820 43202 42918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 43575 43207 gene locus_tag LOCUS_12830 43575 43207 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_12830 44090 43572 gene locus_tag LOCUS_12840 44090 43572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 45095 44256 gene locus_tag LOCUS_12850 gene prmC 45095 44256 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_12850 45373 46566 gene locus_tag LOCUS_12860 gene rsmB 45373 46566 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_12860 46710 48188 gene locus_tag LOCUS_12870 gene guaB 46710 48188 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_12870 48853 48392 gene locus_tag LOCUS_12880 48853 48392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 49321 48854 gene locus_tag LOCUS_12890 49321 48854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 49885 49409 gene locus_tag LOCUS_12900 49885 49409 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_12900 49948 50718 gene locus_tag LOCUS_12910 gene coaX 49948 50718 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_12910 51383 50715 gene locus_tag LOCUS_12920 51383 50715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 51471 52421 gene locus_tag LOCUS_12930 51471 52421 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_12930 55387 52427 gene locus_tag LOCUS_12940 55387 52427 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_12940 55760 56173 gene locus_tag LOCUS_12950 55760 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 56166 58013 gene locus_tag LOCUS_12960 gene mutL 56166 58013 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_12960 58015 58806 gene locus_tag LOCUS_12970 58015 58806 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_12970 58809 59747 gene locus_tag LOCUS_12980 58809 59747 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_12980 60354 59878 gene locus_tag LOCUS_12990 60354 59878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 61481 60414 gene locus_tag LOCUS_13000 gene rlmN 61481 60414 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_13000 61798 63702 gene locus_tag LOCUS_13010 61798 63702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_13010 63816 64286 gene locus_tag LOCUS_13020 63816 64286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 64734 64501 gene locus_tag LOCUS_13030 64734 64501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 65311 64709 gene locus_tag LOCUS_13040 65311 64709 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_13040 65661 66008 gene locus_tag LOCUS_13050 65661 66008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_13050 66021 66482 gene locus_tag LOCUS_13060 66021 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 66658 66479 gene locus_tag LOCUS_13070 66658 66479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 67177 66662 gene locus_tag LOCUS_13080 gene purE 67177 66662 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_13080 68319 67177 gene locus_tag LOCUS_13090 gene purK 68319 67177 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_13090 70128 68359 gene locus_tag LOCUS_13100 70128 68359 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_13100 70237 70416 gene locus_tag LOCUS_13110 70237 70416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 70499 71281 gene locus_tag LOCUS_13120 70499 71281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 71338 72015 gene locus_tag LOCUS_13130 71338 72015 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_13130 72920 72057 gene locus_tag LOCUS_13140 gene mscS 72920 72057 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_13140 73653 72949 gene locus_tag LOCUS_13150 73653 72949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_13150 74729 73650 gene locus_tag LOCUS_13160 74729 73650 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_13160 74985 75827 gene locus_tag LOCUS_13170 74985 75827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 76930 75824 gene locus_tag LOCUS_13180 76930 75824 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_13180 77101 79572 gene locus_tag LOCUS_13190 77101 79572 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_13190 79799 80212 gene locus_tag LOCUS_13200 gene fur 79799 80212 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0P4 protein_id gnl|my_center|LOCUS_13200 80436 80209 gene locus_tag LOCUS_13210 80436 80209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 80586 81059 gene locus_tag LOCUS_13220 80586 81059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 82511 81255 gene locus_tag LOCUS_13230 gene arsA 82511 81255 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_13230 83180 82629 gene locus_tag LOCUS_13240 83180 82629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 protein_id gnl|my_center|LOCUS_13240 83527 84408 gene locus_tag LOCUS_13250 83527 84408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 84447 85352 gene locus_tag LOCUS_13260 84447 85352 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_13260 85355 86269 gene locus_tag LOCUS_13270 85355 86269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 86340 87494 gene locus_tag LOCUS_13280 gene aroB 86340 87494 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_13280 87519 88730 gene locus_tag LOCUS_13290 87519 88730 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_13290 88732 90105 gene locus_tag LOCUS_13300 88732 90105 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_13300 90544 90236 gene locus_tag LOCUS_13310 90544 90236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 90924 90541 gene locus_tag LOCUS_13320 90924 90541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 90923 91936 gene locus_tag LOCUS_13330 gene gldB 90923 91936 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_13330 92987 92031 gene locus_tag LOCUS_13340 92987 92031 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_13340 94551 93328 gene locus_tag LOCUS_13350 94551 93328 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_13350 96323 94548 gene locus_tag LOCUS_13360 gene asnB 96323 94548 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13360 96994 96323 gene locus_tag LOCUS_13370 gene nth 96994 96323 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_13370 97281 98294 gene locus_tag LOCUS_13380 97281 98294 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_13380 98305 100296 gene locus_tag LOCUS_13390 98305 100296 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_13390 100403 100771 gene locus_tag LOCUS_13400 100403 100771 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_13400 101089 101847 gene locus_tag LOCUS_13410 101089 101847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 101977 103674 gene locus_tag LOCUS_13420 101977 103674 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_13420 103843 105141 gene locus_tag LOCUS_13430 103843 105141 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_13430 105300 105491 gene locus_tag LOCUS_13440 105300 105491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 106819 105542 gene locus_tag LOCUS_13450 106819 105542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_13450 108369 106927 gene locus_tag LOCUS_13460 108369 106927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 111905 108381 gene locus_tag LOCUS_13470 111905 108381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 113657 112233 gene locus_tag LOCUS_13480 gene crnA 113657 112233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_13480 114465 113803 gene locus_tag LOCUS_13490 114465 113803 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_13490 116336 114525 gene locus_tag LOCUS_13500 116336 114525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 116919 116341 gene locus_tag LOCUS_13510 116919 116341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 117309 116932 gene locus_tag LOCUS_13520 gene nirD 117309 116932 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_13520 119838 117328 gene locus_tag LOCUS_13530 119838 117328 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369394.1 protein_id gnl|my_center|LOCUS_13530 120758 120336 gene locus_tag LOCUS_13540 gene ndk 120758 120336 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_13540 120934 121977 gene locus_tag LOCUS_13550 gene fjo19 120934 121977 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_13550 122025 122948 gene locus_tag LOCUS_13560 122025 122948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 122996 123547 gene locus_tag LOCUS_13570 122996 123547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 123550 124107 gene locus_tag LOCUS_13580 123550 124107 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS7 protein_id gnl|my_center|LOCUS_13580 125366 124197 gene locus_tag LOCUS_13590 125366 124197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 126484 125363 gene locus_tag LOCUS_13600 126484 125363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 127634 126477 gene locus_tag LOCUS_13610 127634 126477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 128772 127627 gene locus_tag LOCUS_13620 128772 127627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 129931 128765 gene locus_tag LOCUS_13630 129931 128765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 131039 129924 gene locus_tag LOCUS_13640 131039 129924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 132216 131068 gene locus_tag LOCUS_13650 132216 131068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 133230 132223 gene locus_tag LOCUS_13660 133230 132223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 134520 133351 gene locus_tag LOCUS_13670 134520 133351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 135651 134527 gene locus_tag LOCUS_13680 135651 134527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 136801 135656 gene locus_tag LOCUS_13690 136801 135656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 137938 136802 gene locus_tag LOCUS_13700 137938 136802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 139081 137945 gene locus_tag LOCUS_13710 139081 137945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 140237 139086 gene locus_tag LOCUS_13720 140237 139086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence08 846 355 gene locus_tag LOCUS_13730 846 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 930 1511 gene locus_tag LOCUS_13740 930 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_13740 1569 3932 gene locus_tag LOCUS_13750 gene pepN 1569 3932 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_13750 4095 4823 gene locus_tag LOCUS_13760 4095 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6209 5085 gene locus_tag LOCUS_13770 gene celE 6209 5085 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_13770 6352 6528 gene locus_tag LOCUS_13780 6352 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6539 7150 gene locus_tag LOCUS_13790 6539 7150 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_13790 7551 8522 gene locus_tag LOCUS_13800 7551 8522 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_13800 8709 9947 gene locus_tag LOCUS_13810 8709 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10028 12931 gene locus_tag LOCUS_13820 10028 12931 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_13820 14055 13027 gene locus_tag LOCUS_13830 gene ruvB 14055 13027 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_13830 14235 15245 gene locus_tag LOCUS_13840 14235 15245 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_13840 15337 16092 gene locus_tag LOCUS_13850 15337 16092 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485757.1 protein_id gnl|my_center|LOCUS_13850 16220 16540 gene locus_tag LOCUS_13860 16220 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_13860 16560 18245 gene locus_tag LOCUS_13870 16560 18245 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_13870 18294 20186 gene locus_tag LOCUS_13880 gene acsA 18294 20186 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_13880 20707 21951 gene locus_tag LOCUS_13890 20707 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 21964 22452 gene locus_tag LOCUS_13900 21964 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 23054 22530 gene locus_tag LOCUS_13910 23054 22530 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203650.1 protein_id gnl|my_center|LOCUS_13910 24218 23139 gene locus_tag LOCUS_13920 gene prfA 24218 23139 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_13920 24333 24557 gene locus_tag LOCUS_13930 24333 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 26626 24785 gene locus_tag LOCUS_13940 gene glmS 26626 24785 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_13940 28002 26749 gene locus_tag LOCUS_13950 28002 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 28882 28064 gene locus_tag LOCUS_13960 28882 28064 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_13960 29099 29860 gene locus_tag LOCUS_13970 gene panC 29099 29860 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_13970 29882 30229 gene locus_tag LOCUS_13980 gene panD 29882 30229 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_13980 30229 31233 gene locus_tag LOCUS_13990 30229 31233 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_13990 31265 31957 gene locus_tag LOCUS_14000 31265 31957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_14000 32055 33194 gene locus_tag LOCUS_14010 32055 33194 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_14010 33333 34259 gene locus_tag LOCUS_14020 33333 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 35024 34245 gene locus_tag LOCUS_14030 gene pcrB 35024 34245 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_14030 35382 34996 gene locus_tag LOCUS_14040 35382 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 35792 35463 gene locus_tag LOCUS_14050 35792 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 36410 35811 gene locus_tag LOCUS_14060 36410 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 36583 37305 gene locus_tag LOCUS_14070 36583 37305 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_14070 37421 38305 gene locus_tag LOCUS_14080 37421 38305 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_14080 38714 41545 gene locus_tag LOCUS_14090 38714 41545 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_14090 41626 42678 gene locus_tag LOCUS_14100 41626 42678 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_14100 42693 43427 gene locus_tag LOCUS_14110 gene algR 42693 43427 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_14110 43551 44306 gene locus_tag LOCUS_14120 43551 44306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 44577 44410 gene locus_tag LOCUS_14130 44577 44410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 47152 44909 gene locus_tag LOCUS_14140 47152 44909 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_14140 47286 49334 gene locus_tag LOCUS_14150 47286 49334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 49375 50781 gene locus_tag LOCUS_14160 49375 50781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 50836 51408 gene locus_tag LOCUS_14170 50836 51408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 51401 53119 gene locus_tag LOCUS_14180 51401 53119 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_14180 53390 54556 gene locus_tag LOCUS_14190 53390 54556 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_14190 54673 55299 gene locus_tag LOCUS_14200 54673 55299 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_14200 55349 56176 gene locus_tag LOCUS_14210 gene yeeZ 55349 56176 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_14210 56511 56173 gene locus_tag LOCUS_14220 gene csaA 56511 56173 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708805.1 protein_id gnl|my_center|LOCUS_14220 56649 56939 gene locus_tag LOCUS_14230 56649 56939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 59538 57016 gene locus_tag LOCUS_14240 59538 57016 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_14240 59981 59565 gene locus_tag LOCUS_14250 59981 59565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256827.1 protein_id gnl|my_center|LOCUS_14250 60324 60082 gene locus_tag LOCUS_14260 60324 60082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 61001 60327 gene locus_tag LOCUS_14270 61001 60327 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_14270 61856 61191 gene locus_tag LOCUS_14280 61856 61191 CDS product cytochrome c-type biogenesis heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_14280 62128 64014 gene locus_tag LOCUS_14290 gene htpG 62128 64014 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_14290 64387 64656 gene locus_tag LOCUS_14300 64387 64656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 64679 65845 gene locus_tag LOCUS_14310 64679 65845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 65842 66180 gene locus_tag LOCUS_14320 65842 66180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 66402 66818 gene locus_tag LOCUS_14330 66402 66818 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_14330 66894 67166 gene locus_tag LOCUS_14340 66894 67166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 67159 67845 gene locus_tag LOCUS_14350 gene cysH 67159 67845 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_14350 68107 69006 gene locus_tag LOCUS_14360 gene cysD 68107 69006 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_14360 69170 70426 gene locus_tag LOCUS_14370 gene cysN 69170 70426 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_14370 70499 72598 gene locus_tag LOCUS_14380 70499 72598 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_14380 72595 73371 gene locus_tag LOCUS_14390 72595 73371 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_14390 73557 74162 gene locus_tag LOCUS_14400 gene cysG 73557 74162 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_14400 74572 74255 gene locus_tag LOCUS_14410 74572 74255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 74762 76015 gene locus_tag LOCUS_14420 gene metK 74762 76015 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_14420 77918 76110 gene locus_tag LOCUS_14430 gene rho 77918 76110 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_14430 78814 78125 gene locus_tag LOCUS_14440 gene recO 78814 78125 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_14440 79545 78961 gene locus_tag LOCUS_14450 gene tdk 79545 78961 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_14450 79880 79554 gene locus_tag LOCUS_14460 79880 79554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 79914 81032 gene locus_tag LOCUS_14470 79914 81032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 81181 81741 gene locus_tag LOCUS_14480 81181 81741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 81763 82338 gene locus_tag LOCUS_14490 81763 82338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 83609 82335 gene locus_tag LOCUS_14500 gene rodA 83609 82335 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_14500 85411 83609 gene locus_tag LOCUS_14510 85411 83609 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_14510 85788 85411 gene locus_tag LOCUS_14520 85788 85411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 86704 85922 gene locus_tag LOCUS_14530 86704 85922 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_14530 87794 86766 gene locus_tag LOCUS_14540 gene mreB 87794 86766 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_14540 88104 88589 gene locus_tag LOCUS_14550 gene rimP 88104 88589 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_14550 88595 89839 gene locus_tag LOCUS_14560 gene nusA 88595 89839 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_14560 89902 92811 gene locus_tag LOCUS_14570 gene infB 89902 92811 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_14570 93253 93089 gene locus_tag LOCUS_14580 93253 93089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 93334 93732 gene locus_tag LOCUS_14590 93334 93732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 93877 94986 gene locus_tag LOCUS_14600 93877 94986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 96632 94998 gene locus_tag LOCUS_14610 gene cstA 96632 94998 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_14610 96859 97701 gene locus_tag LOCUS_14620 gene accD 96859 97701 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_14620 97834 99138 gene locus_tag LOCUS_14630 gene nqrF 97834 99138 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_14630 99222 100373 gene locus_tag LOCUS_14640 gene fjo29 99222 100373 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_14640 100465 100692 gene locus_tag LOCUS_14650 100465 100692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 100693 101535 gene locus_tag LOCUS_14660 100693 101535 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_14660 101639 102451 gene locus_tag LOCUS_14670 gene murQ 101639 102451 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_14670 102583 103926 gene locus_tag LOCUS_14680 102583 103926 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z9 protein_id gnl|my_center|LOCUS_14680 104079 104894 gene locus_tag LOCUS_14690 gene pyrF 104079 104894 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_14690 104995 106290 gene locus_tag LOCUS_14700 104995 106290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_14700 106346 106981 gene locus_tag LOCUS_14710 106346 106981 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270072.1 protein_id gnl|my_center|LOCUS_14710 107054 108022 gene locus_tag LOCUS_14720 107054 108022 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTV8 protein_id gnl|my_center|LOCUS_14720 108031 108888 gene locus_tag LOCUS_14730 gene udp 108031 108888 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_14730 109177 108902 gene locus_tag LOCUS_14740 109177 108902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 109927 109292 gene locus_tag LOCUS_14750 109927 109292 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_14750 111911 109920 gene locus_tag LOCUS_14760 111911 109920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 112228 114624 gene locus_tag LOCUS_14770 112228 114624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_14770 114653 115372 gene locus_tag LOCUS_14780 114653 115372 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_14780 115448 115693 gene locus_tag LOCUS_14790 115448 115693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 115822 116007 gene locus_tag LOCUS_14800 115822 116007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 116055 116657 gene locus_tag LOCUS_14810 116055 116657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 117764 116715 gene locus_tag LOCUS_14820 gene adhC1 117764 116715 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706187.1 protein_id gnl|my_center|LOCUS_14820 118625 117912 gene locus_tag LOCUS_14830 118625 117912 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_14830 120376 118850 gene locus_tag LOCUS_14840 gene zwf 120376 118850 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_14840 120572 121984 gene locus_tag LOCUS_14850 gene gndA 120572 121984 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_14850 122850 122260 gene locus_tag LOCUS_14860 gene ahpD 122850 122260 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 protein_id gnl|my_center|LOCUS_14860 123495 122938 gene locus_tag LOCUS_14870 123495 122938 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_14870 123597 124526 gene locus_tag LOCUS_14880 gene oxyR 123597 124526 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_14880 125064 124561 gene locus_tag LOCUS_14890 125064 124561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 125260 126819 gene locus_tag LOCUS_14900 125260 126819 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_14900 128355 126955 gene locus_tag LOCUS_14910 128355 126955 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_14910 128622 130166 gene locus_tag LOCUS_14920 gene yidK 128622 130166 CDS product putative symporter YidK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31448 protein_id gnl|my_center|LOCUS_14920 130171 130989 gene locus_tag LOCUS_14930 130171 130989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence09 1678 296 gene locus_tag LOCUS_14940 1678 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2797 2111 gene locus_tag LOCUS_14950 2797 2111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_14950 3014 3763 gene locus_tag LOCUS_14960 3014 3763 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_14960 5063 3828 gene locus_tag LOCUS_14970 5063 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6762 5437 gene locus_tag LOCUS_14980 6762 5437 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_14980 7985 7164 gene locus_tag LOCUS_14990 7985 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 8672 8181 gene locus_tag LOCUS_15000 8672 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 9801 8665 gene locus_tag LOCUS_15010 9801 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_15010 11462 10032 gene locus_tag LOCUS_15020 11462 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15020 14247 12019 gene locus_tag LOCUS_15030 14247 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 17371 15257 gene locus_tag LOCUS_15040 17371 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 18326 17532 gene locus_tag LOCUS_15050 18326 17532 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_15050 19486 18485 gene locus_tag LOCUS_15060 19486 18485 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_15060 19695 20447 gene locus_tag LOCUS_15070 19695 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402862.1 protein_id gnl|my_center|LOCUS_15070 21087 20578 gene locus_tag LOCUS_15080 21087 20578 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933367.1 protein_id gnl|my_center|LOCUS_15080 21635 21402 gene locus_tag LOCUS_15090 21635 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 23399 21939 gene locus_tag LOCUS_15100 23399 21939 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_15100 23810 24934 gene locus_tag LOCUS_15110 gene pntA 23810 24934 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_15110 24954 25241 gene locus_tag LOCUS_15120 24954 25241 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_15120 25238 26623 gene locus_tag LOCUS_15130 gene pntB 25238 26623 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_15130 27170 26850 gene locus_tag LOCUS_15140 27170 26850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 27810 27496 gene locus_tag LOCUS_15150 27810 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 27920 28441 gene locus_tag LOCUS_15160 27920 28441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_15160 28444 28857 gene locus_tag LOCUS_15170 28444 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 28889 29509 gene locus_tag LOCUS_15180 28889 29509 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_15180 29513 30232 gene locus_tag LOCUS_15190 29513 30232 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_15190 30229 30681 gene locus_tag LOCUS_15200 gene dtd 30229 30681 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_15200 30775 32253 gene locus_tag LOCUS_15210 30775 32253 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_15210 32518 34053 gene locus_tag LOCUS_15220 32518 34053 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_15220 35479 34298 gene locus_tag LOCUS_15230 35479 34298 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_15230 38208 35506 gene locus_tag LOCUS_15240 38208 35506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 38538 38254 gene locus_tag LOCUS_15250 38538 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718625.1 protein_id gnl|my_center|LOCUS_15250 38756 38962 gene locus_tag LOCUS_15260 38756 38962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 38959 39342 gene locus_tag LOCUS_15270 38959 39342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 39469 39858 gene locus_tag LOCUS_15280 39469 39858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_15280 40096 41364 gene locus_tag LOCUS_15290 gene sufS 40096 41364 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32164 protein_id gnl|my_center|LOCUS_15290 41947 41567 gene locus_tag LOCUS_15300 41947 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_15300 43562 42003 gene locus_tag LOCUS_15310 43562 42003 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_15310 44800 43703 gene locus_tag LOCUS_15320 44800 43703 CDS product teicoplanin resistance protein VanZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 protein_id gnl|my_center|LOCUS_15320 44958 45296 gene locus_tag LOCUS_15330 44958 45296 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_15330 46783 45305 gene locus_tag LOCUS_15340 46783 45305 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_15340 48409 46931 gene locus_tag LOCUS_15350 gene amyA 48409 46931 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973424.1 protein_id gnl|my_center|LOCUS_15350 48600 49784 gene locus_tag LOCUS_15360 48600 49784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_15360 50491 49781 gene locus_tag LOCUS_15370 gene comB 50491 49781 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_15370 51586 50492 gene locus_tag LOCUS_15380 gene gcvT 51586 50492 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_15380 52020 51694 gene locus_tag LOCUS_15390 gene sufA 52020 51694 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15390 52111 52509 gene locus_tag LOCUS_15400 52111 52509 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_15400 52747 53775 gene locus_tag LOCUS_15410 gene thiL 52747 53775 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_15410 55594 54017 gene locus_tag LOCUS_15420 55594 54017 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_15420 56749 55919 gene locus_tag LOCUS_15430 gene tsf 56749 55919 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_15430 57712 56951 gene locus_tag LOCUS_15440 gene rpsB 57712 56951 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z4 protein_id gnl|my_center|LOCUS_15440 58139 57753 gene locus_tag LOCUS_15450 gene rpsI 58139 57753 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_15450 58594 58151 gene locus_tag LOCUS_15460 gene rplM 58594 58151 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z6 protein_id gnl|my_center|LOCUS_15460 59486 58776 gene locus_tag LOCUS_15470 59486 58776 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_15470 60641 59562 gene locus_tag LOCUS_15480 gene phoR 60641 59562 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_15480 61334 60642 gene locus_tag LOCUS_15490 gene phoP 61334 60642 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_15490 62277 61486 gene locus_tag LOCUS_15500 62277 61486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 62458 63495 gene locus_tag LOCUS_15510 gene recA 62458 63495 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_15510 64828 63581 gene locus_tag LOCUS_15520 64828 63581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_15520 64946 65995 gene locus_tag LOCUS_15530 gene queA 64946 65995 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_15530 66097 66786 gene locus_tag LOCUS_15540 gene ispD 66097 66786 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P77 protein_id gnl|my_center|LOCUS_15540 66915 67742 gene locus_tag LOCUS_15550 66915 67742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_15550 67862 68809 gene locus_tag LOCUS_15560 67862 68809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 68806 69531 gene locus_tag LOCUS_15570 68806 69531 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_15570 69973 69752 gene locus_tag LOCUS_15580 69973 69752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_15580 71298 70051 gene locus_tag LOCUS_15590 71298 70051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 71430 73109 gene locus_tag LOCUS_15600 71430 73109 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_15600 73292 74464 gene locus_tag LOCUS_15610 73292 74464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 74566 76086 gene locus_tag LOCUS_15620 74566 76086 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_15620 77567 76146 gene locus_tag LOCUS_15630 77567 76146 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117863.1 protein_id gnl|my_center|LOCUS_15630 77767 79068 gene locus_tag LOCUS_15640 77767 79068 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_15640 79689 79129 gene locus_tag LOCUS_15650 79689 79129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 80580 79765 gene locus_tag LOCUS_15660 80580 79765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 80913 81167 gene locus_tag LOCUS_15670 gene rpsT 80913 81167 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_15670 81265 81960 gene locus_tag LOCUS_15680 gene radC 81265 81960 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_15680 82102 82719 gene locus_tag LOCUS_15690 82102 82719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_15690 82790 85249 gene locus_tag LOCUS_15700 gene pheT 82790 85249 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_15700 85252 85536 gene locus_tag LOCUS_15710 85252 85536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 85538 85822 gene locus_tag LOCUS_15720 85538 85822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 85891 87456 gene locus_tag LOCUS_15730 gene rny 85891 87456 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_15730 87519 88280 gene locus_tag LOCUS_15740 87519 88280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_15740 90432 88312 gene locus_tag LOCUS_15750 gene mcm3 90432 88312 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_15750 91835 90429 gene locus_tag LOCUS_15760 91835 90429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 92242 93663 gene locus_tag LOCUS_15770 gene dnaA 92242 93663 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_15770 94147 93731 gene locus_tag LOCUS_15780 94147 93731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 95741 94293 gene locus_tag LOCUS_15790 gene degP/Q 95741 94293 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_15790 95972 97138 gene locus_tag LOCUS_15800 gene dxr 95972 97138 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_15800 97138 98463 gene locus_tag LOCUS_15810 97138 98463 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_15810 98580 99818 gene locus_tag LOCUS_15820 98580 99818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 100042 101316 gene locus_tag LOCUS_15830 100042 101316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 101321 103372 gene locus_tag LOCUS_15840 101321 103372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 103499 105976 gene locus_tag LOCUS_15850 gene lon 103499 105976 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_15850 106088 107485 gene locus_tag LOCUS_15860 gene hslU 106088 107485 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD63 protein_id gnl|my_center|LOCUS_15860 107516 108250 gene locus_tag LOCUS_15870 107516 108250 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_15870 108929 108441 gene locus_tag LOCUS_15880 108929 108441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence10 <1 1039 gene locus_tag LOCUS_15890 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460205.1:CPBP family intramembrane metalloprotease 1014 1220 gene locus_tag LOCUS_15900 1014 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1204 2043 gene locus_tag LOCUS_15910 1204 2043 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_15910 2114 3391 gene locus_tag LOCUS_15920 gene gdhA 2114 3391 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_15920 3503 4123 gene locus_tag LOCUS_15930 gene psd 3503 4123 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_15930 4227 4724 gene locus_tag LOCUS_15940 4227 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5194 4721 gene locus_tag LOCUS_15950 5194 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5610 5191 gene locus_tag LOCUS_15960 5610 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6435 5752 gene locus_tag LOCUS_15970 6435 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_15970 6914 6432 gene locus_tag LOCUS_15980 gene ispF 6914 6432 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_15980 8152 6911 gene locus_tag LOCUS_15990 8152 6911 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_15990 8448 10013 gene locus_tag LOCUS_16000 gene bshC 8448 10013 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_16000 10003 10575 gene locus_tag LOCUS_16010 gene ygfA 10003 10575 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_16010 10598 11095 gene locus_tag LOCUS_16020 10598 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11449 14241 gene locus_tag LOCUS_16030 gene sucA 11449 14241 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_16030 14330 15853 gene locus_tag LOCUS_16040 gene sucB 14330 15853 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_16040 16003 17400 gene locus_tag LOCUS_16050 gene lpdA1 16003 17400 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_16050 17486 18259 gene locus_tag LOCUS_16060 17486 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_16060 19114 18260 gene locus_tag LOCUS_16070 19114 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191946.1 protein_id gnl|my_center|LOCUS_16070 20675 19137 gene locus_tag LOCUS_16080 20675 19137 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_16080 21836 20835 gene locus_tag LOCUS_16090 21836 20835 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_16090 23041 22157 gene locus_tag LOCUS_16100 23041 22157 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_16100 23420 24679 gene locus_tag LOCUS_16110 23420 24679 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_16110 25374 27995 gene locus_tag LOCUS_16120 gene clpB 25374 27995 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 protein_id gnl|my_center|LOCUS_16120 29200 28058 gene locus_tag LOCUS_16130 29200 28058 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_16130 31854 29620 gene locus_tag LOCUS_16140 gene dpp4 31854 29620 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_16140 34137 31960 gene locus_tag LOCUS_16150 34137 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 36630 34228 gene locus_tag LOCUS_16160 36630 34228 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_16160 38051 36801 gene locus_tag LOCUS_16170 38051 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 38946 38044 gene locus_tag LOCUS_16180 38946 38044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16180 39926 38970 gene locus_tag LOCUS_16190 39926 38970 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_16190 40137 40718 gene locus_tag LOCUS_16200 40137 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 42526 41240 gene locus_tag LOCUS_16210 42526 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 42698 43606 gene locus_tag LOCUS_16220 42698 43606 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583050.1 protein_id gnl|my_center|LOCUS_16220 43616 44152 gene locus_tag LOCUS_16230 gene hpt 43616 44152 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_16230 44168 44740 gene locus_tag LOCUS_16240 gene adk 44168 44740 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_16240 44815 45810 gene locus_tag LOCUS_16250 gene obg 44815 45810 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_16250 45894 46466 gene locus_tag LOCUS_16260 gene grpE 45894 46466 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_16260 46471 47589 gene locus_tag LOCUS_16270 gene dnaJ 46471 47589 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_16270 47700 48557 gene locus_tag LOCUS_16280 47700 48557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 48575 49468 gene locus_tag LOCUS_16290 gene natA 48575 49468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_16290 49461 50771 gene locus_tag LOCUS_16300 gene natB 49461 50771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_16300 50933 51526 gene locus_tag LOCUS_16310 gene upp 50933 51526 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_16310 51534 52472 gene locus_tag LOCUS_16320 gene yrbG 51534 52472 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_16320 52472 52930 gene locus_tag LOCUS_16330 52472 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 53827 52919 gene locus_tag LOCUS_16340 53827 52919 CDS product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_16340 54382 53978 gene locus_tag LOCUS_16350 gene osmC 54382 53978 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_16350 54453 55181 gene locus_tag LOCUS_16360 54453 55181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 55236 56114 gene locus_tag LOCUS_16370 gene lipA 55236 56114 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_16370 56363 56674 gene locus_tag LOCUS_16380 56363 56674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023556.1 protein_id gnl|my_center|LOCUS_16380 56963 57274 gene locus_tag LOCUS_16390 56963 57274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023556.1 protein_id gnl|my_center|LOCUS_16390 60216 57328 gene locus_tag LOCUS_16400 gene gcvP 60216 57328 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_16400 60490 61986 gene locus_tag LOCUS_16410 60490 61986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 62368 63342 gene locus_tag LOCUS_16420 gene pyrD 62368 63342 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_16420 63532 63347 gene locus_tag LOCUS_16430 63532 63347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 63561 65888 gene locus_tag LOCUS_16440 gene ftsK 63561 65888 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_16440 65922 66575 gene locus_tag LOCUS_16450 65922 66575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 66888 67946 gene locus_tag LOCUS_16460 66888 67946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_16460 68412 68182 gene locus_tag LOCUS_16470 68412 68182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 68698 68417 gene locus_tag LOCUS_16480 68698 68417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 68870 69529 gene locus_tag LOCUS_16490 gene truA 68870 69529 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE4 protein_id gnl|my_center|LOCUS_16490 70156 69662 gene locus_tag LOCUS_16500 70156 69662 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_16500 71624 70257 gene locus_tag LOCUS_16510 71624 70257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_16510 71945 72985 gene locus_tag LOCUS_16520 71945 72985 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_16520 73624 73139 gene locus_tag LOCUS_16530 73624 73139 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_16530 73816 75060 gene locus_tag LOCUS_16540 gene kdtA 73816 75060 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_16540 75163 76086 gene locus_tag LOCUS_16550 gene rsgA2 75163 76086 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_16550 76196 76639 gene locus_tag LOCUS_16560 gene pyrR2 76196 76639 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_16560 76644 77465 gene locus_tag LOCUS_16570 gene panB 76644 77465 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_16570 77577 79496 gene locus_tag LOCUS_16580 77577 79496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 80637 79570 gene locus_tag LOCUS_16590 80637 79570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 82070 80784 gene locus_tag LOCUS_16600 82070 80784 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_16600 83997 82081 gene locus_tag LOCUS_16610 83997 82081 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_16610 84415 84341 gene locus_tag LOCUS_t00050 84415 84341 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 85836 84493 gene locus_tag LOCUS_16620 gene pyrC1 85836 84493 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_16620 85884 87257 gene locus_tag LOCUS_16630 gene rhlE 85884 87257 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_16630 88652 87351 gene locus_tag LOCUS_16640 gene amaA 88652 87351 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_16640 88800 89498 gene locus_tag LOCUS_16650 88800 89498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_16650 89670 90194 gene locus_tag LOCUS_16660 89670 90194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 90332 91240 gene locus_tag LOCUS_16670 gene gldA 90332 91240 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_16670 91244 91963 gene locus_tag LOCUS_16680 gene gldF 91244 91963 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_16680 91960 93648 gene locus_tag LOCUS_16690 91960 93648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_16690 93769 94893 gene locus_tag LOCUS_16700 gene dnaN 93769 94893 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_16700 95430 95200 gene locus_tag LOCUS_16710 95430 95200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 95969 95583 gene locus_tag LOCUS_16720 95969 95583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263478.1 protein_id gnl|my_center|LOCUS_16720 96404 96018 gene locus_tag LOCUS_16730 96404 96018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 97225 96416 gene locus_tag LOCUS_16740 97225 96416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence11 1400 834 gene locus_tag LOCUS_16750 1400 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2070 1507 gene locus_tag LOCUS_16760 2070 1507 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_16760 2388 4613 gene locus_tag LOCUS_16770 2388 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5410 4679 gene locus_tag LOCUS_16780 gene yhdW 5410 4679 CDS product putative glycerophosphoryl diester phosphodiesterase YhdW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07592 protein_id gnl|my_center|LOCUS_16780 8137 6137 gene locus_tag LOCUS_16790 8137 6137 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403313.1 protein_id gnl|my_center|LOCUS_16790 10472 8286 gene locus_tag LOCUS_16800 10472 8286 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_16800 11440 10550 gene locus_tag LOCUS_16810 11440 10550 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_16810 11685 11443 gene locus_tag LOCUS_16820 11685 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 11576 12550 gene locus_tag LOCUS_16830 gene pfkA 11576 12550 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_16830 12552 12887 gene locus_tag LOCUS_16840 12552 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 13651 12875 gene locus_tag LOCUS_16850 gene miaA1 13651 12875 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_16850 13823 14563 gene locus_tag LOCUS_16860 13823 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 14560 14937 gene locus_tag LOCUS_16870 14560 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 14939 15217 gene locus_tag LOCUS_16880 14939 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 15214 15978 gene locus_tag LOCUS_16890 15214 15978 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_16890 15978 17558 gene locus_tag LOCUS_16900 15978 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_16900 19150 17726 gene locus_tag LOCUS_16910 gene pyk 19150 17726 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_16910 19586 19158 gene locus_tag LOCUS_16920 19586 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 19739 19975 gene locus_tag LOCUS_16930 gene acpP 19739 19975 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_16930 19995 21245 gene locus_tag LOCUS_16940 gene fabF 19995 21245 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_16940 21335 21994 gene locus_tag LOCUS_16950 21335 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 22026 23864 gene locus_tag LOCUS_16960 gene nadE 22026 23864 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_16960 23875 24978 gene locus_tag LOCUS_16970 23875 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 25264 26724 gene locus_tag LOCUS_16980 25264 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 26912 27631 gene locus_tag LOCUS_16990 26912 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 27628 29730 gene locus_tag LOCUS_17000 27628 29730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_17000 29798 32224 gene locus_tag LOCUS_17010 29798 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_17010 32456 34492 gene locus_tag LOCUS_17020 gene dcp1 32456 34492 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_17020 34555 35673 gene locus_tag LOCUS_17030 34555 35673 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894636.1 protein_id gnl|my_center|LOCUS_17030 35654 36592 gene locus_tag LOCUS_17040 35654 36592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 38820 36580 gene locus_tag LOCUS_17050 38820 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 40828 39383 gene locus_tag LOCUS_17060 40828 39383 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_17060 42918 41212 gene locus_tag LOCUS_17070 gene lysS 42918 41212 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_17070 44177 43080 gene locus_tag LOCUS_17080 gene putA 44177 43080 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_17080 44889 45986 gene locus_tag LOCUS_17090 44889 45986 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_17090 46083 47126 gene locus_tag LOCUS_17100 gene aroB 46083 47126 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_17100 47153 48379 gene locus_tag LOCUS_17110 gene aroA 47153 48379 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_17110 48382 49206 gene locus_tag LOCUS_17120 gene pheA 48382 49206 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_17120 49306 50454 gene locus_tag LOCUS_17130 gene aspC3 49306 50454 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_17130 50461 51309 gene locus_tag LOCUS_17140 gene tyrA 50461 51309 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_17140 51493 51744 gene locus_tag LOCUS_17150 51493 51744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 52373 53125 gene locus_tag LOCUS_17160 52373 53125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 53290 53991 gene locus_tag LOCUS_17170 53290 53991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 54068 54649 gene locus_tag LOCUS_17180 54068 54649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 55301 54735 gene locus_tag LOCUS_17190 55301 54735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 55474 57999 gene locus_tag LOCUS_17200 55474 57999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 60754 58580 gene locus_tag LOCUS_17210 60754 58580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_17210 61216 62103 gene locus_tag LOCUS_17220 61216 62103 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_17220 62467 64404 gene locus_tag LOCUS_17230 62467 64404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_17230 65069 66400 gene locus_tag LOCUS_17240 65069 66400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 66662 67453 gene locus_tag LOCUS_17250 66662 67453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_17250 67459 67650 gene locus_tag LOCUS_17260 67459 67650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 67635 68303 gene locus_tag LOCUS_17270 67635 68303 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_17270 69655 68492 gene locus_tag LOCUS_17280 69655 68492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 70814 69660 gene locus_tag LOCUS_17290 70814 69660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 71826 70807 gene locus_tag LOCUS_17300 71826 70807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 72872 71991 gene locus_tag LOCUS_17310 72872 71991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368121.1 protein_id gnl|my_center|LOCUS_17310 74016 72994 gene locus_tag LOCUS_17320 74016 72994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 74834 74166 gene locus_tag LOCUS_17330 74834 74166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 75918 75085 gene locus_tag LOCUS_17340 75918 75085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_17340 76490 75948 gene locus_tag LOCUS_17350 76490 75948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_17350 76984 76487 gene locus_tag LOCUS_17360 76984 76487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 77471 77076 gene locus_tag LOCUS_17370 77471 77076 CDS product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_17370 78715 77477 gene locus_tag LOCUS_17380 78715 77477 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_17380 79659 78814 gene locus_tag LOCUS_17390 79659 78814 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640183.1 protein_id gnl|my_center|LOCUS_17390 79869 80546 gene locus_tag LOCUS_17400 79869 80546 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_17400 81186 80671 gene locus_tag LOCUS_17410 gene paiA 81186 80671 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_17410 81941 81363 gene locus_tag LOCUS_17420 gene ydeI 81941 81363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_17420 82395 81979 gene locus_tag LOCUS_17430 82395 81979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_17430 83407 82529 gene locus_tag LOCUS_17440 gene pqqB 83407 82529 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHG4 protein_id gnl|my_center|LOCUS_17440 84044 83601 gene locus_tag LOCUS_17450 84044 83601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 84480 84028 gene locus_tag LOCUS_17460 84480 84028 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_17460 84993 84586 gene locus_tag LOCUS_17470 84993 84586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 85565 84990 gene locus_tag LOCUS_17480 85565 84990 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 protein_id gnl|my_center|LOCUS_17480 85672 86013 gene locus_tag LOCUS_17490 85672 86013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 86128 86598 gene locus_tag LOCUS_17500 86128 86598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 86595 88037 gene locus_tag LOCUS_17510 86595 88037 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_17510 88058 88762 gene locus_tag LOCUS_17520 88058 88762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 89398 88994 gene locus_tag LOCUS_17530 89398 88994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 90308 89523 gene locus_tag LOCUS_17540 90308 89523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 90566 92182 gene locus_tag LOCUS_17550 gene pyrG 90566 92182 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_17550 92225 94030 gene locus_tag LOCUS_17560 gene yidC 92225 94030 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_17560 >Feature sequence12 139 492 gene locus_tag LOCUS_17570 gene yffB 139 492 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_17570 2068 686 gene locus_tag LOCUS_17580 2068 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2933 2061 gene locus_tag LOCUS_17590 2933 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4446 2941 gene locus_tag LOCUS_17600 4446 2941 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_17600 7189 4448 gene locus_tag LOCUS_17610 7189 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 8636 7689 gene locus_tag LOCUS_17620 gene ltd 8636 7689 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_17620 8792 9988 gene locus_tag LOCUS_17630 gene kbl 8792 9988 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_17630 10938 10213 gene locus_tag LOCUS_17640 10938 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 11255 11872 gene locus_tag LOCUS_17650 11255 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 12359 12099 gene locus_tag LOCUS_17660 12359 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 13841 12867 gene locus_tag LOCUS_17670 13841 12867 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_17670 14327 13917 gene locus_tag LOCUS_17680 14327 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 14968 14327 gene locus_tag LOCUS_17690 14968 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 15784 15062 gene locus_tag LOCUS_17700 15784 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 16281 15916 gene locus_tag LOCUS_17710 16281 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_17710 17830 16451 gene locus_tag LOCUS_17720 17830 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 20815 17843 gene locus_tag LOCUS_17730 20815 17843 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_17730 22911 21028 gene locus_tag LOCUS_17740 22911 21028 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_17740 23286 24554 gene locus_tag LOCUS_17750 gene fahA 23286 24554 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_17750 24772 24596 gene locus_tag LOCUS_17760 24772 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 24922 26325 gene locus_tag LOCUS_17770 24922 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 28070 26634 gene locus_tag LOCUS_17780 28070 26634 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767371.1 protein_id gnl|my_center|LOCUS_17780 29222 28311 gene locus_tag LOCUS_17790 29222 28311 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_17790 29405 29986 gene locus_tag LOCUS_17800 29405 29986 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_17800 30182 30877 gene locus_tag LOCUS_17810 30182 30877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948253.1 protein_id gnl|my_center|LOCUS_17810 32118 30874 gene locus_tag LOCUS_17820 gene nhaP 32118 30874 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_17820 32451 33566 gene locus_tag LOCUS_17830 32451 33566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 33967 33590 gene locus_tag LOCUS_17840 33967 33590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 34981 34181 gene locus_tag LOCUS_17850 34981 34181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 35313 36218 gene locus_tag LOCUS_17860 35313 36218 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_17860 37115 36459 gene locus_tag LOCUS_17870 37115 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 38058 37399 gene locus_tag LOCUS_17880 38058 37399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 38333 38563 gene locus_tag LOCUS_17890 38333 38563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 38567 39604 gene locus_tag LOCUS_17900 38567 39604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 40085 39618 gene locus_tag LOCUS_17910 40085 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 40527 40171 gene locus_tag LOCUS_17920 40527 40171 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_17920 41511 40861 gene locus_tag LOCUS_17930 41511 40861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 42080 43267 gene locus_tag LOCUS_17940 42080 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 43272 43610 gene locus_tag LOCUS_17950 43272 43610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 43607 44626 gene locus_tag LOCUS_17960 43607 44626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 44638 44970 gene locus_tag LOCUS_17970 44638 44970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 44963 45259 gene locus_tag LOCUS_17980 44963 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 46420 45998 gene locus_tag LOCUS_17990 46420 45998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 47233 46622 gene locus_tag LOCUS_18000 47233 46622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 48027 47572 gene locus_tag LOCUS_18010 48027 47572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 51249 48028 gene locus_tag LOCUS_18020 51249 48028 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_18020 52554 51391 gene locus_tag LOCUS_18030 52554 51391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_18030 52820 53395 gene locus_tag LOCUS_18040 52820 53395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 53830 56190 gene locus_tag LOCUS_18050 53830 56190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_18050 56464 59127 gene locus_tag LOCUS_18060 56464 59127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 59210 59578 gene locus_tag LOCUS_18070 59210 59578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_18070 59701 60957 gene locus_tag LOCUS_18080 gene dbpA 59701 60957 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_18080 62242 61844 gene locus_tag LOCUS_18090 62242 61844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_18090 62723 63142 gene locus_tag LOCUS_18100 62723 63142 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_18100 63148 63438 gene locus_tag LOCUS_18110 63148 63438 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_18110 64126 65256 gene locus_tag LOCUS_18120 64126 65256 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_18120 65664 65275 gene locus_tag LOCUS_18130 65664 65275 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_18130 67464 65836 gene locus_tag LOCUS_18140 gene groL 67464 65836 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_18140 67782 67504 gene locus_tag LOCUS_18150 gene groS 67782 67504 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_18150 67997 68707 gene locus_tag LOCUS_18160 67997 68707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 69201 68836 gene locus_tag LOCUS_18170 69201 68836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 70533 69214 gene locus_tag LOCUS_18180 70533 69214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 71184 70645 gene locus_tag LOCUS_18190 71184 70645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_18190 72457 71168 gene locus_tag LOCUS_18200 72457 71168 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_18200 73932 72457 gene locus_tag LOCUS_18210 gene miaB 73932 72457 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_18210 75169 74066 gene locus_tag LOCUS_18220 gene dinB2 75169 74066 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_18220 76412 75159 gene locus_tag LOCUS_18230 gene pabB 76412 75159 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_18230 77196 76474 gene locus_tag LOCUS_18240 77196 76474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 77334 77846 gene locus_tag LOCUS_18250 77334 77846 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_18250 77943 78455 gene locus_tag LOCUS_18260 77943 78455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 78574 79287 gene locus_tag LOCUS_18270 78574 79287 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_18270 79311 80267 gene locus_tag LOCUS_18280 79311 80267 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_18280 80290 81408 gene locus_tag LOCUS_18290 80290 81408 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_18290 81489 82283 gene locus_tag LOCUS_18300 81489 82283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 82290 83480 gene locus_tag LOCUS_18310 82290 83480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 84193 83549 gene locus_tag LOCUS_18320 gene pyrE 84193 83549 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 protein_id gnl|my_center|LOCUS_18320 84293 84979 gene locus_tag LOCUS_18330 84293 84979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 85422 84967 gene locus_tag LOCUS_18340 gene coaD 85422 84967 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831P9 protein_id gnl|my_center|LOCUS_18340 86343 85525 gene locus_tag LOCUS_18350 86343 85525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 86936 86355 gene locus_tag LOCUS_18360 86936 86355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 87494 86985 gene locus_tag LOCUS_18370 87494 86985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 87608 88963 gene locus_tag LOCUS_18380 87608 88963 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_18380 89421 89816 gene locus_tag LOCUS_18390 89421 89816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 90789 89968 gene locus_tag LOCUS_18400 90789 89968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_18400 92725 91067 gene locus_tag LOCUS_18410 92725 91067 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_18410 93700 92957 gene locus_tag LOCUS_18420 93700 92957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 93669 93803 gene locus_tag LOCUS_18430 93669 93803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence13 834 187 gene locus_tag LOCUS_18440 834 187 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_18440 1321 839 gene locus_tag LOCUS_18450 gene cdd 1321 839 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_18450 1593 2924 gene locus_tag LOCUS_18460 1593 2924 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_18460 4128 3415 gene locus_tag LOCUS_18470 4128 3415 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 protein_id gnl|my_center|LOCUS_18470 4730 4128 gene locus_tag LOCUS_18480 4730 4128 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_18480 5967 4801 gene locus_tag LOCUS_18490 gene yycB 5967 4801 CDS product putative transporter YycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37482 protein_id gnl|my_center|LOCUS_18490 6474 7745 gene locus_tag LOCUS_18500 6474 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 8370 7867 gene locus_tag LOCUS_18510 8370 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 10931 8586 gene locus_tag LOCUS_18520 10931 8586 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_18520 11980 11417 gene locus_tag LOCUS_18530 11980 11417 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_18530 12140 12715 gene locus_tag LOCUS_18540 12140 12715 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_18540 12753 13370 gene locus_tag LOCUS_18550 gene udk 12753 13370 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE1 protein_id gnl|my_center|LOCUS_18550 13546 13851 gene locus_tag LOCUS_18560 13546 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 13944 16916 gene locus_tag LOCUS_18570 13944 16916 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_18570 17062 17463 gene locus_tag LOCUS_18580 17062 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 17466 18251 gene locus_tag LOCUS_18590 17466 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 18254 19021 gene locus_tag LOCUS_18600 18254 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 19008 19763 gene locus_tag LOCUS_18610 19008 19763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 19813 20445 gene locus_tag LOCUS_18620 gene uvrY 19813 20445 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 protein_id gnl|my_center|LOCUS_18620 20448 21494 gene locus_tag LOCUS_18630 gene iolW 20448 21494 CDS product scyllo-inositol 2-dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32223 protein_id gnl|my_center|LOCUS_18630 21550 21987 gene locus_tag LOCUS_18640 21550 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 22740 22060 gene locus_tag LOCUS_18650 22740 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 22870 24336 gene locus_tag LOCUS_18660 gene glyQS 22870 24336 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_18660 25204 24407 gene locus_tag LOCUS_18670 25204 24407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 26147 25806 gene locus_tag LOCUS_18680 26147 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 26252 27718 gene locus_tag LOCUS_18690 26252 27718 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_18690 28330 27857 gene locus_tag LOCUS_18700 gene rlmH 28330 27857 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_18700 28427 31546 gene locus_tag LOCUS_18710 28427 31546 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_18710 31558 31962 gene locus_tag LOCUS_18720 31558 31962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 32077 32688 gene locus_tag LOCUS_18730 32077 32688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 protein_id gnl|my_center|LOCUS_18730 35675 32820 gene locus_tag LOCUS_18740 35675 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_18740 36136 35801 gene locus_tag LOCUS_18750 gene ytxJ 36136 35801 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_18750 36350 37612 gene locus_tag LOCUS_18760 36350 37612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 40427 37617 gene locus_tag LOCUS_18770 40427 37617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 40579 41232 gene locus_tag LOCUS_18780 40579 41232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 41470 44628 gene locus_tag LOCUS_18790 41470 44628 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_18790 44641 46500 gene locus_tag LOCUS_18800 44641 46500 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_18800 46569 49919 gene locus_tag LOCUS_18810 46569 49919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 49947 50930 gene locus_tag LOCUS_18820 49947 50930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_18820 50949 52259 gene locus_tag LOCUS_18830 50949 52259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_18830 52262 53173 gene locus_tag LOCUS_18840 52262 53173 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM52 protein_id gnl|my_center|LOCUS_18840 53187 54221 gene locus_tag LOCUS_18850 53187 54221 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_18850 54362 55096 gene locus_tag LOCUS_18860 gene hisA 54362 55096 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_18860 56692 55166 gene locus_tag LOCUS_18870 56692 55166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_18870 57429 56692 gene locus_tag LOCUS_18880 gene lptB 57429 56692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_18880 59155 57431 gene locus_tag LOCUS_18890 59155 57431 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_18890 59447 59259 gene locus_tag LOCUS_18900 59447 59259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 60460 59630 gene locus_tag LOCUS_18910 gene prmA 60460 59630 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_18910 61228 60467 gene locus_tag LOCUS_18920 gene tpiA 61228 60467 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_18920 61301 61816 gene locus_tag LOCUS_18930 gene recX 61301 61816 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_18930 61988 61773 gene locus_tag LOCUS_18940 61988 61773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 62092 62913 gene locus_tag LOCUS_18950 62092 62913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 63701 63186 gene locus_tag LOCUS_18960 63701 63186 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRM4 protein_id gnl|my_center|LOCUS_18960 65434 63722 gene locus_tag LOCUS_18970 65434 63722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 66096 65431 gene locus_tag LOCUS_18980 66096 65431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 66235 67335 gene locus_tag LOCUS_18990 66235 67335 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_18990 67337 67825 gene locus_tag LOCUS_19000 67337 67825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_19000 68458 67928 gene locus_tag LOCUS_19010 68458 67928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 68535 69107 gene locus_tag LOCUS_19020 68535 69107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 70879 69104 gene locus_tag LOCUS_19030 gene sglT 70879 69104 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_19030 71333 72397 gene locus_tag LOCUS_19040 71333 72397 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_19040 72481 74574 gene locus_tag LOCUS_19050 gene recG 72481 74574 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_19050 75005 74679 gene locus_tag LOCUS_19060 75005 74679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 76386 75067 gene locus_tag LOCUS_19070 76386 75067 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_19070 76896 76420 gene locus_tag LOCUS_19080 gene ribH 76896 76420 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_19080 77697 76984 gene locus_tag LOCUS_19090 77697 76984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 78832 77813 gene locus_tag LOCUS_19100 gene pdhA 78832 77813 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_19100 78925 80034 gene locus_tag LOCUS_19110 gene recF 78925 80034 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_19110 80965 80060 gene locus_tag LOCUS_19120 80965 80060 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_19120 81241 81579 gene locus_tag LOCUS_19130 81241 81579 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704615.1 protein_id gnl|my_center|LOCUS_19130 81615 82844 gene locus_tag LOCUS_19140 81615 82844 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_19140 83215 84663 gene locus_tag LOCUS_19150 83215 84663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 84663 85748 gene locus_tag LOCUS_19160 gene aroC 84663 85748 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_19160 85756 87087 gene locus_tag LOCUS_19170 gene gltP 85756 87087 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_19170 88569 87169 gene locus_tag LOCUS_19180 gene fumC 88569 87169 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_19180 89130 88645 gene locus_tag LOCUS_19190 89130 88645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence14 443 69 gene locus_tag LOCUS_19200 443 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1158 631 gene locus_tag LOCUS_19210 1158 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2570 1284 gene locus_tag LOCUS_19220 2570 1284 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_19220 4175 3579 gene locus_tag LOCUS_19230 4175 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_19230 5150 4182 gene locus_tag LOCUS_19240 gene etfA 5150 4182 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_19240 5923 5186 gene locus_tag LOCUS_19250 gene etfB 5923 5186 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_19250 5998 6330 gene locus_tag LOCUS_19260 5998 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6411 7547 gene locus_tag LOCUS_19270 6411 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7684 8169 gene locus_tag LOCUS_19280 7684 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9174 8176 gene locus_tag LOCUS_19290 9174 8176 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_19290 10764 9184 gene locus_tag LOCUS_19300 gene dnaB 10764 9184 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_19300 11546 10863 gene locus_tag LOCUS_19310 11546 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 11682 13037 gene locus_tag LOCUS_19320 11682 13037 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_19320 13040 13843 gene locus_tag LOCUS_19330 13040 13843 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_19330 14073 15044 gene locus_tag LOCUS_19340 14073 15044 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_19340 15336 18899 gene locus_tag LOCUS_19350 15336 18899 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_19350 18941 20581 gene locus_tag LOCUS_19360 18941 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_19360 20789 21043 gene locus_tag LOCUS_19370 20789 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 22515 21166 gene locus_tag LOCUS_19380 22515 21166 CDS product PhoPQ-activated pathogenicity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120441.1 protein_id gnl|my_center|LOCUS_19380 22642 23964 gene locus_tag LOCUS_19390 22642 23964 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_19390 23961 24827 gene locus_tag LOCUS_19400 23961 24827 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 protein_id gnl|my_center|LOCUS_19400 24921 25454 gene locus_tag LOCUS_19410 24921 25454 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760954.1 protein_id gnl|my_center|LOCUS_19410 26372 25578 gene locus_tag LOCUS_19420 26372 25578 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19420 26455 26961 gene locus_tag LOCUS_19430 26455 26961 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_19430 27695 26958 gene locus_tag LOCUS_19440 27695 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 28452 27775 gene locus_tag LOCUS_19450 28452 27775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 28489 29367 gene locus_tag LOCUS_19460 gene glnS 28489 29367 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125551.1 protein_id gnl|my_center|LOCUS_19460 31007 29526 gene locus_tag LOCUS_19470 31007 29526 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_19470 31794 31093 gene locus_tag LOCUS_19480 31794 31093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 32589 31795 gene locus_tag LOCUS_19490 32589 31795 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_19490 33107 32592 gene locus_tag LOCUS_19500 33107 32592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_19500 33176 34522 gene locus_tag LOCUS_19510 33176 34522 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_19510 34622 35164 gene locus_tag LOCUS_19520 gene ftnA 34622 35164 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_19520 35421 35777 gene locus_tag LOCUS_19530 35421 35777 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_19530 36054 36245 gene locus_tag LOCUS_19540 36054 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 36761 36964 gene locus_tag LOCUS_19550 36761 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 38079 36970 gene locus_tag LOCUS_19560 gene garK 38079 36970 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_19560 39431 38082 gene locus_tag LOCUS_19570 39431 38082 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_19570 41184 39586 gene locus_tag LOCUS_19580 41184 39586 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229994.1 protein_id gnl|my_center|LOCUS_19580 41438 42895 gene locus_tag LOCUS_19590 41438 42895 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_19590 44684 43059 gene locus_tag LOCUS_19600 44684 43059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 45659 44688 gene locus_tag LOCUS_19610 45659 44688 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_19610 46357 45758 gene locus_tag LOCUS_19620 46357 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 47358 46456 gene locus_tag LOCUS_19630 47358 46456 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_19630 47975 47412 gene locus_tag LOCUS_19640 47975 47412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 48676 48323 gene locus_tag LOCUS_19650 48676 48323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_19650 48928 49590 gene locus_tag LOCUS_19660 48928 49590 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_19660 49756 50085 gene locus_tag LOCUS_19670 49756 50085 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_19670 50669 50289 gene locus_tag LOCUS_19680 50669 50289 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_19680 51183 52061 gene locus_tag LOCUS_19690 51183 52061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 52072 52986 gene locus_tag LOCUS_19700 52072 52986 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_19700 54492 53158 gene locus_tag LOCUS_19710 54492 53158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 56955 54532 gene locus_tag LOCUS_19720 56955 54532 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_19720 57890 57180 gene locus_tag LOCUS_19730 57890 57180 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_19730 58287 59546 gene locus_tag LOCUS_19740 58287 59546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 59953 60648 gene locus_tag LOCUS_19750 59953 60648 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_19750 60771 61964 gene locus_tag LOCUS_19760 60771 61964 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_19760 61957 62925 gene locus_tag LOCUS_19770 gene argC 61957 62925 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_19770 63083 64228 gene locus_tag LOCUS_19780 63083 64228 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_19780 64232 65203 gene locus_tag LOCUS_19790 64232 65203 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_19790 65217 66017 gene locus_tag LOCUS_19800 gene argB 65217 66017 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_19800 66039 67109 gene locus_tag LOCUS_19810 66039 67109 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_19810 67112 68458 gene locus_tag LOCUS_19820 gene argH 67112 68458 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_19820 68788 68534 gene locus_tag LOCUS_19830 68788 68534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 68670 70097 gene locus_tag LOCUS_19840 gene sulP 68670 70097 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_19840 70094 70741 gene locus_tag LOCUS_19850 gene cynT 70094 70741 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_19850 71113 72417 gene locus_tag LOCUS_19860 gene cysD 71113 72417 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_19860 72426 73481 gene locus_tag LOCUS_19870 gene metX 72426 73481 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_19870 73972 73529 gene locus_tag LOCUS_19880 73972 73529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 74715 75605 gene locus_tag LOCUS_19890 gene ftsX 74715 75605 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_19890 75610 75822 gene locus_tag LOCUS_19900 75610 75822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 75878 76567 gene locus_tag LOCUS_19910 gene truB 75878 76567 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_19910 76698 77621 gene locus_tag LOCUS_19920 gene ribF 76698 77621 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_19920 77633 78328 gene locus_tag LOCUS_19930 gene atoD 77633 78328 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_19930 78338 79045 gene locus_tag LOCUS_19940 gene liuG 78338 79045 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_19940 79142 79480 gene locus_tag LOCUS_19950 gene gldC 79142 79480 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_19950 79845 82769 gene locus_tag LOCUS_19960 79845 82769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_19960 86577 83158 gene locus_tag LOCUS_19970 gene gdhP 86577 83158 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence15 892 383 gene locus_tag LOCUS_19980 892 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_19980 1578 889 gene locus_tag LOCUS_19990 1578 889 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_19990 3245 1584 gene locus_tag LOCUS_20000 3245 1584 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_20000 3733 3332 gene locus_tag LOCUS_20010 3733 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4083 5729 gene locus_tag LOCUS_20020 4083 5729 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_20020 6512 5784 gene locus_tag LOCUS_20030 6512 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8567 6519 gene locus_tag LOCUS_20040 8567 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9953 8595 gene locus_tag LOCUS_20050 9953 8595 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_20050 11123 10128 gene locus_tag LOCUS_20060 11123 10128 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_20060 12499 11336 gene locus_tag LOCUS_20070 12499 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_20070 13484 12939 gene locus_tag LOCUS_20080 13484 12939 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_20080 14932 13619 gene locus_tag LOCUS_20090 gene rimO 14932 13619 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_20090 16564 15470 gene locus_tag LOCUS_20100 16564 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 16884 18884 gene locus_tag LOCUS_20110 gene bfmBA 16884 18884 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_20110 20170 19010 gene locus_tag LOCUS_20120 20170 19010 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_20120 21479 20346 gene locus_tag LOCUS_20130 21479 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 22633 21479 gene locus_tag LOCUS_20140 22633 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 23940 22915 gene locus_tag LOCUS_20150 23940 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 25352 24162 gene locus_tag LOCUS_20160 25352 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 25467 26618 gene locus_tag LOCUS_20170 25467 26618 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_20170 27960 26854 gene locus_tag LOCUS_20180 27960 26854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 31206 28021 gene locus_tag LOCUS_20190 31206 28021 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107392.1 protein_id gnl|my_center|LOCUS_20190 34252 31208 gene locus_tag LOCUS_20200 34252 31208 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_20200 35326 34256 gene locus_tag LOCUS_20210 35326 34256 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_20210 35956 35408 gene locus_tag LOCUS_20220 35956 35408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 36179 37417 gene locus_tag LOCUS_20230 gene sbcD 36179 37417 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23479 protein_id gnl|my_center|LOCUS_20230 37414 40443 gene locus_tag LOCUS_20240 gene sbcC 37414 40443 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS0 protein_id gnl|my_center|LOCUS_20240 41468 40848 gene locus_tag LOCUS_20250 41468 40848 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_20250 42399 41449 gene locus_tag LOCUS_20260 gene mhqO 42399 41449 CDS product putative ring-cleaving dioxygenase MhqO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96693 protein_id gnl|my_center|LOCUS_20260 43038 42511 gene locus_tag LOCUS_20270 43038 42511 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_20270 43618 43112 gene locus_tag LOCUS_20280 43618 43112 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_20280 44513 43713 gene locus_tag LOCUS_20290 44513 43713 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_20290 46182 44593 gene locus_tag LOCUS_20300 46182 44593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 47132 46317 gene locus_tag LOCUS_20310 47132 46317 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_20310 48870 47218 gene locus_tag LOCUS_20320 gene recN 48870 47218 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_20320 49812 48910 gene locus_tag LOCUS_20330 49812 48910 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_20330 51264 50056 gene locus_tag LOCUS_20340 51264 50056 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_20340 51583 51269 gene locus_tag LOCUS_20350 51583 51269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_20350 52506 51604 gene locus_tag LOCUS_20360 52506 51604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 53296 52580 gene locus_tag LOCUS_20370 53296 52580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 55106 53466 gene locus_tag LOCUS_20380 55106 53466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_20380 55248 56474 gene locus_tag LOCUS_20390 gene tilS 55248 56474 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_20390 56478 56993 gene locus_tag LOCUS_20400 56478 56993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 57141 58076 gene locus_tag LOCUS_20410 gene mdh 57141 58076 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_20410 58177 60882 gene locus_tag LOCUS_20420 58177 60882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 60951 62606 gene locus_tag LOCUS_20430 60951 62606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 64232 62619 gene locus_tag LOCUS_20440 64232 62619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 65388 64234 gene locus_tag LOCUS_20450 65388 64234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 68126 65388 gene locus_tag LOCUS_20460 68126 65388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_20460 68845 68123 gene locus_tag LOCUS_20470 68845 68123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 69049 69954 gene locus_tag LOCUS_20480 gene lolI 69049 69954 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_20480 71199 70036 gene locus_tag LOCUS_20490 71199 70036 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_20490 72362 71334 gene locus_tag LOCUS_20500 72362 71334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_20500 73765 72554 gene locus_tag LOCUS_20510 73765 72554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_20510 74912 73854 gene locus_tag LOCUS_20520 74912 73854 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_20520 75995 75318 gene locus_tag LOCUS_20530 75995 75318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 77389 76586 gene locus_tag LOCUS_20540 77389 76586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122498.1 protein_id gnl|my_center|LOCUS_20540 80082 77386 gene locus_tag LOCUS_20550 80082 77386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 81777 80269 gene locus_tag LOCUS_20560 81777 80269 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_20560 84920 81825 gene locus_tag LOCUS_20570 84920 81825 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence16 1587 1 gene locus_tag LOCUS_20580 1587 1 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_20580 2184 1594 gene locus_tag LOCUS_20590 2184 1594 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_20590 3699 2293 gene locus_tag LOCUS_20600 gene leuC 3699 2293 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_20600 5210 3702 gene locus_tag LOCUS_20610 gene leuA 5210 3702 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_20610 6274 5231 gene locus_tag LOCUS_20620 6274 5231 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_20620 6837 6337 gene locus_tag LOCUS_20630 gene ilvH 6837 6337 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_20630 8543 6849 gene locus_tag LOCUS_20640 gene ilvB 8543 6849 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_20640 10233 8548 gene locus_tag LOCUS_20650 gene ilvD 10233 8548 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_20650 10786 11595 gene locus_tag LOCUS_20660 gene ispE 10786 11595 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_20660 11678 11920 gene locus_tag LOCUS_20670 11678 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 13118 12210 gene locus_tag LOCUS_20680 13118 12210 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_20680 14192 13119 gene locus_tag LOCUS_20690 14192 13119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_20690 15351 14194 gene locus_tag LOCUS_20700 gene tgt 15351 14194 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_20700 15446 16582 gene locus_tag LOCUS_20710 15446 16582 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_20710 16573 17184 gene locus_tag LOCUS_20720 gene sigW 16573 17184 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_20720 17184 17828 gene locus_tag LOCUS_20730 gene rsmG 17184 17828 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_20730 19303 17999 gene locus_tag LOCUS_20740 19303 17999 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_20740 19501 19794 gene locus_tag LOCUS_20750 19501 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 19807 20427 gene locus_tag LOCUS_20760 gene recR 19807 20427 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_20760 20476 20550 gene locus_tag LOCUS_t00060 20476 20550 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20823 21242 gene locus_tag LOCUS_20770 20823 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 21383 21712 gene locus_tag LOCUS_20780 21383 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 21726 21998 gene locus_tag LOCUS_20790 21726 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 21998 22834 gene locus_tag LOCUS_20800 21998 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_20800 23536 22859 gene locus_tag LOCUS_20810 23536 22859 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_20810 23670 23975 gene locus_tag LOCUS_20820 23670 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 23965 24384 gene locus_tag LOCUS_20830 23965 24384 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_20830 25672 24377 gene locus_tag LOCUS_20840 gene murF 25672 24377 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_20840 25767 27848 gene locus_tag LOCUS_20850 25767 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 27909 29612 gene locus_tag LOCUS_20860 27909 29612 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_20860 29985 32837 gene locus_tag LOCUS_20870 29985 32837 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 protein_id gnl|my_center|LOCUS_20870 32884 33585 gene locus_tag LOCUS_20880 32884 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 33707 35098 gene locus_tag LOCUS_20890 33707 35098 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061566.1 protein_id gnl|my_center|LOCUS_20890 35101 35886 gene locus_tag LOCUS_20900 35101 35886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_20900 35897 36445 gene locus_tag LOCUS_20910 35897 36445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_20910 36684 37250 gene locus_tag LOCUS_20920 36684 37250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 37263 38777 gene locus_tag LOCUS_20930 37263 38777 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_20930 38892 40184 gene locus_tag LOCUS_20940 38892 40184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 40712 40242 gene locus_tag LOCUS_20950 40712 40242 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_20950 40951 42186 gene locus_tag LOCUS_20960 gene porY 40951 42186 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_20960 42409 43989 gene locus_tag LOCUS_20970 gene prfC 42409 43989 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WR5 protein_id gnl|my_center|LOCUS_20970 46471 44039 gene locus_tag LOCUS_20980 46471 44039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 46860 46567 gene locus_tag LOCUS_20990 46860 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 48958 47312 gene locus_tag LOCUS_21000 gene ade 48958 47312 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_21000 49089 49793 gene locus_tag LOCUS_21010 gene cmk 49089 49793 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_21010 49777 50673 gene locus_tag LOCUS_21020 gene ispH 49777 50673 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_21020 50808 52160 gene locus_tag LOCUS_21030 gene nqrA 50808 52160 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_21030 52166 53383 gene locus_tag LOCUS_21040 gene nqrB 52166 53383 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_21040 53370 54134 gene locus_tag LOCUS_21050 gene nqrC 53370 54134 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_21050 54165 54848 gene locus_tag LOCUS_21060 gene nqrD 54165 54848 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_21060 54863 55474 gene locus_tag LOCUS_21070 gene nqrE 54863 55474 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_21070 55611 56240 gene locus_tag LOCUS_21080 55611 56240 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_21080 56327 56881 gene locus_tag LOCUS_21090 56327 56881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 57794 56883 gene locus_tag LOCUS_21100 57794 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969512.1 protein_id gnl|my_center|LOCUS_21100 58882 57839 gene locus_tag LOCUS_21110 gene selD 58882 57839 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F7 protein_id gnl|my_center|LOCUS_21110 59909 58854 gene locus_tag LOCUS_21120 59909 58854 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_21120 60296 59976 gene locus_tag LOCUS_21130 gene trx2 60296 59976 CDS product thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE49 protein_id gnl|my_center|LOCUS_21130 64749 60463 gene locus_tag LOCUS_21140 gene dnaE 64749 60463 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_21140 65321 64983 gene locus_tag LOCUS_21150 gene ogt2 65321 64983 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_21150 66195 65302 gene locus_tag LOCUS_21160 66195 65302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 66255 66932 gene locus_tag LOCUS_21170 gene fabG 66255 66932 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056775.1 protein_id gnl|my_center|LOCUS_21170 66949 67407 gene locus_tag LOCUS_21180 66949 67407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_21180 67414 67869 gene locus_tag LOCUS_21190 67414 67869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 68176 67877 gene locus_tag LOCUS_21200 68176 67877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 68720 71170 gene locus_tag LOCUS_21210 68720 71170 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_21210 71170 72108 gene locus_tag LOCUS_21220 gene thrB 71170 72108 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_21220 72113 73408 gene locus_tag LOCUS_21230 72113 73408 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_21230 74686 73712 gene locus_tag LOCUS_21240 74686 73712 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_21240 74834 75313 gene locus_tag LOCUS_21250 74834 75313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 75400 77097 gene locus_tag LOCUS_21260 75400 77097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 77075 78133 gene locus_tag LOCUS_21270 gene gpsA 77075 78133 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_21270 79457 78291 gene locus_tag LOCUS_21280 79457 78291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_21280 80563 79526 gene locus_tag LOCUS_21290 gene fbp 80563 79526 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_21290 80621 81895 gene locus_tag LOCUS_21300 gene lysC 80621 81895 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_21300 82459 81998 gene locus_tag LOCUS_21310 82459 81998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence17 1245 454 gene locus_tag LOCUS_21320 1245 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1885 2376 gene locus_tag LOCUS_21330 1885 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2397 4085 gene locus_tag LOCUS_21340 gene snf 2397 4085 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_21340 4479 5447 gene locus_tag LOCUS_21350 4479 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_21350 6271 7674 gene locus_tag LOCUS_21360 6271 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7751 9232 gene locus_tag LOCUS_21370 7751 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 9459 11582 gene locus_tag LOCUS_21380 9459 11582 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584070.1 protein_id gnl|my_center|LOCUS_21380 11902 16104 gene locus_tag LOCUS_21390 11902 16104 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_21390 16866 19904 gene locus_tag LOCUS_21400 16866 19904 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_21400 20051 21541 gene locus_tag LOCUS_21410 20051 21541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795013.1 protein_id gnl|my_center|LOCUS_21410 21559 22248 gene locus_tag LOCUS_21420 21559 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 22480 26004 gene locus_tag LOCUS_21430 22480 26004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 26114 27889 gene locus_tag LOCUS_21440 26114 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 27913 29823 gene locus_tag LOCUS_21450 27913 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 29828 31261 gene locus_tag LOCUS_21460 gene betC 29828 31261 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118653.1 protein_id gnl|my_center|LOCUS_21460 31348 32868 gene locus_tag LOCUS_21470 31348 32868 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_21470 33123 34508 gene locus_tag LOCUS_21480 33123 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 35651 34653 gene locus_tag LOCUS_21490 35651 34653 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_21490 35762 36109 gene locus_tag LOCUS_21500 35762 36109 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293542.1 protein_id gnl|my_center|LOCUS_21500 36351 37004 gene locus_tag LOCUS_21510 36351 37004 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_21510 37196 38206 gene locus_tag LOCUS_21520 37196 38206 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_21520 38358 41759 gene locus_tag LOCUS_21530 38358 41759 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_21530 41805 43283 gene locus_tag LOCUS_21540 41805 43283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21540 43285 44775 gene locus_tag LOCUS_21550 43285 44775 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_21550 45724 45581 gene locus_tag LOCUS_21560 45724 45581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 46018 46203 gene locus_tag LOCUS_21570 46018 46203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 46185 46709 gene locus_tag LOCUS_21580 46185 46709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 47084 47257 gene locus_tag LOCUS_21590 47084 47257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 47250 48338 gene locus_tag LOCUS_21600 47250 48338 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX1 protein_id gnl|my_center|LOCUS_21600 49603 48425 gene locus_tag LOCUS_21610 49603 48425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 49937 49593 gene locus_tag LOCUS_21620 49937 49593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 51586 50369 gene locus_tag LOCUS_21630 51586 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 51942 51583 gene locus_tag LOCUS_21640 51942 51583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 53312 52506 gene locus_tag LOCUS_21650 53312 52506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 55643 54261 gene locus_tag LOCUS_21660 gene mnmE 55643 54261 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_21660 56092 55640 gene locus_tag LOCUS_21670 56092 55640 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_21670 57242 56346 gene locus_tag LOCUS_21680 gene mntD 57242 56346 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_21680 58524 57232 gene locus_tag LOCUS_21690 gene mntB 58524 57232 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_21690 59314 58526 gene locus_tag LOCUS_21700 gene troB 59314 58526 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_21700 60225 59311 gene locus_tag LOCUS_21710 60225 59311 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_21710 60884 60222 gene locus_tag LOCUS_21720 gene sirR 60884 60222 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21720 62320 61199 gene locus_tag LOCUS_21730 62320 61199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 62341 63156 gene locus_tag LOCUS_21740 gene dapD 62341 63156 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_21740 63167 63769 gene locus_tag LOCUS_21750 63167 63769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 64747 64154 gene locus_tag LOCUS_21760 64747 64154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 65085 65492 gene locus_tag LOCUS_21770 65085 65492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 65583 67121 gene locus_tag LOCUS_21780 65583 67121 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_21780 67159 68364 gene locus_tag LOCUS_21790 67159 68364 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_21790 68370 68720 gene locus_tag LOCUS_21800 68370 68720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 68867 69832 gene locus_tag LOCUS_21810 68867 69832 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_21810 69881 71398 gene locus_tag LOCUS_21820 69881 71398 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194399.1 protein_id gnl|my_center|LOCUS_21820 72798 71596 gene locus_tag LOCUS_21830 72798 71596 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_21830 72965 75442 gene locus_tag LOCUS_21840 72965 75442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_21840 75473 76042 gene locus_tag LOCUS_21850 75473 76042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107174.1 protein_id gnl|my_center|LOCUS_21850 76215 77348 gene locus_tag LOCUS_21860 76215 77348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 77641 79587 gene locus_tag LOCUS_21870 gene thrS 77641 79587 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_21870 79675 80229 gene locus_tag LOCUS_21880 gene infC 79675 80229 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence18 34 897 gene locus_tag LOCUS_21890 34 897 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_21890 1081 2025 gene locus_tag LOCUS_21900 gene trxB1 1081 2025 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_21900 2035 3078 gene locus_tag LOCUS_21910 2035 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3091 3810 gene locus_tag LOCUS_21920 3091 3810 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_21920 4443 3811 gene locus_tag LOCUS_21930 gene pdxH 4443 3811 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_21930 4546 5115 gene locus_tag LOCUS_21940 4546 5115 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_21940 5164 7314 gene locus_tag LOCUS_21950 5164 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 7415 7488 gene locus_tag LOCUS_t00070 7415 7488 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7572 7751 gene locus_tag LOCUS_21960 7572 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 8781 8065 gene locus_tag LOCUS_21970 8781 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 9024 9398 gene locus_tag LOCUS_21980 9024 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 10703 9591 gene locus_tag LOCUS_21990 10703 9591 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_21990 10863 10696 gene locus_tag LOCUS_22000 10863 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 11720 10860 gene locus_tag LOCUS_22010 11720 10860 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_22010 15247 11723 gene locus_tag LOCUS_22020 15247 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 15390 16262 gene locus_tag LOCUS_22030 15390 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 17096 16416 gene locus_tag LOCUS_22040 17096 16416 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_22040 18501 17098 gene locus_tag LOCUS_22050 18501 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 20583 19117 gene locus_tag LOCUS_22060 20583 19117 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_22060 20875 21630 gene locus_tag LOCUS_22070 20875 21630 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_22070 22576 21731 gene locus_tag LOCUS_22080 22576 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_22080 22914 23579 gene locus_tag LOCUS_22090 22914 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 25083 23563 gene locus_tag LOCUS_22100 25083 23563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_22100 26303 25302 gene locus_tag LOCUS_22110 26303 25302 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_22110 27497 26379 gene locus_tag LOCUS_22120 gene nagX 27497 26379 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_22120 28840 27503 gene locus_tag LOCUS_22130 28840 27503 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_22130 30022 28877 gene locus_tag LOCUS_22140 gene nagA 30022 28877 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFQ8 protein_id gnl|my_center|LOCUS_22140 31451 30123 gene locus_tag LOCUS_22150 31451 30123 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_22150 32328 31552 gene locus_tag LOCUS_22160 gene nagB 32328 31552 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_22160 32581 34626 gene locus_tag LOCUS_22170 gene glnS 32581 34626 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_22170 38027 35184 gene locus_tag LOCUS_22180 38027 35184 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_22180 38396 38136 gene locus_tag LOCUS_22190 38396 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 40540 38516 gene locus_tag LOCUS_22200 gene pepO 40540 38516 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_22200 40702 41613 gene locus_tag LOCUS_22210 40702 41613 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_22210 43242 41995 gene locus_tag LOCUS_22220 43242 41995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 44396 43242 gene locus_tag LOCUS_22230 44396 43242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_22230 45623 45147 gene locus_tag LOCUS_22240 45623 45147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 45731 46837 gene locus_tag LOCUS_22250 gene pucA 45731 46837 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_22250 46905 47513 gene locus_tag LOCUS_22260 46905 47513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 48954 47812 gene locus_tag LOCUS_22270 gene iscS 48954 47812 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_22270 48987 49181 gene locus_tag LOCUS_22280 48987 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 49144 49488 gene locus_tag LOCUS_22290 49144 49488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 51741 49576 gene locus_tag LOCUS_22300 51741 49576 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_22300 52202 51744 gene locus_tag LOCUS_22310 52202 51744 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_22310 52503 54731 gene locus_tag LOCUS_22320 52503 54731 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_22320 54967 55176 gene locus_tag LOCUS_22330 54967 55176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 55666 56364 gene locus_tag LOCUS_22340 55666 56364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596582.1 protein_id gnl|my_center|LOCUS_22340 57590 56373 gene locus_tag LOCUS_22350 57590 56373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 57755 58174 gene locus_tag LOCUS_22360 57755 58174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 58428 58763 gene locus_tag LOCUS_22370 58428 58763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 58861 62679 gene locus_tag LOCUS_22380 58861 62679 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_22380 62682 63911 gene locus_tag LOCUS_22390 62682 63911 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657265.1 protein_id gnl|my_center|LOCUS_22390 63914 64372 gene locus_tag LOCUS_22400 63914 64372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_22400 64379 66796 gene locus_tag LOCUS_22410 64379 66796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 66818 68857 gene locus_tag LOCUS_22420 66818 68857 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755978.1 protein_id gnl|my_center|LOCUS_22420 68858 70648 gene locus_tag LOCUS_22430 68858 70648 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_22430 70670 71269 gene locus_tag LOCUS_22440 70670 71269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_22440 71582 72052 gene locus_tag LOCUS_22450 71582 72052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 75037 72758 gene locus_tag LOCUS_22460 75037 72758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 75149 75805 gene locus_tag LOCUS_22470 gene sirR 75149 75805 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_22470 76090 75821 gene locus_tag LOCUS_22480 76090 75821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 76296 77108 gene locus_tag LOCUS_22490 76296 77108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 79637 77559 gene locus_tag LOCUS_22500 gene pepX1 79637 77559 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence19 473 2890 gene locus_tag LOCUS_22510 473 2890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_22510 4307 3429 gene locus_tag LOCUS_22520 4307 3429 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 protein_id gnl|my_center|LOCUS_22520 5173 4544 gene locus_tag LOCUS_22530 5173 4544 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_22530 6357 5365 gene locus_tag LOCUS_22540 gene yhbW 6357 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068512.1 protein_id gnl|my_center|LOCUS_22540 8174 7431 gene locus_tag LOCUS_22550 8174 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 11267 8451 gene locus_tag LOCUS_22560 11267 8451 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_22560 14838 12097 gene locus_tag LOCUS_22570 14838 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_22570 15291 15566 gene locus_tag LOCUS_22580 15291 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 15563 16336 gene locus_tag LOCUS_22590 15563 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 17397 16333 gene locus_tag LOCUS_22600 17397 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 18229 17468 gene locus_tag LOCUS_22610 18229 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 18692 18264 gene locus_tag LOCUS_22620 18692 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 19753 18689 gene locus_tag LOCUS_22630 gene menE 19753 18689 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_22630 19864 20697 gene locus_tag LOCUS_22640 gene menB 19864 20697 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_22640 22590 20947 gene locus_tag LOCUS_22650 22590 20947 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_22650 22681 23376 gene locus_tag LOCUS_22660 22681 23376 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_22660 24020 23454 gene locus_tag LOCUS_22670 24020 23454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_22670 24366 25277 gene locus_tag LOCUS_22680 24366 25277 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_22680 25414 26199 gene locus_tag LOCUS_22690 25414 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 26438 26983 gene locus_tag LOCUS_22700 26438 26983 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_22700 27010 27555 gene locus_tag LOCUS_22710 27010 27555 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_22710 27614 36625 gene locus_tag LOCUS_22720 27614 36625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 36729 37688 gene locus_tag LOCUS_22730 36729 37688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 38456 37863 gene locus_tag LOCUS_22740 38456 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 39690 38734 gene locus_tag LOCUS_22750 39690 38734 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_22750 42292 39956 gene locus_tag LOCUS_22760 42292 39956 CDS product large protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 protein_id gnl|my_center|LOCUS_22760 43733 42456 gene locus_tag LOCUS_22770 43733 42456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 44431 43733 gene locus_tag LOCUS_22780 44431 43733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 46827 44437 gene locus_tag LOCUS_22790 46827 44437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 47618 47025 gene locus_tag LOCUS_22800 47618 47025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_22800 48332 47709 gene locus_tag LOCUS_22810 48332 47709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_22810 48487 50733 gene locus_tag LOCUS_22820 48487 50733 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_22820 52095 50899 gene locus_tag LOCUS_22830 52095 50899 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_22830 52965 52297 gene locus_tag LOCUS_22840 52965 52297 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_22840 53014 54564 gene locus_tag LOCUS_22850 53014 54564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_22850 54525 55181 gene locus_tag LOCUS_22860 54525 55181 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_22860 55356 56291 gene locus_tag LOCUS_22870 55356 56291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 56376 56999 gene locus_tag LOCUS_22880 56376 56999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 58242 57124 gene locus_tag LOCUS_22890 58242 57124 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_22890 58677 61091 gene locus_tag LOCUS_22900 58677 61091 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_22900 61467 61147 gene locus_tag LOCUS_22910 61467 61147 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ7 protein_id gnl|my_center|LOCUS_22910 61714 65991 gene locus_tag LOCUS_22920 61714 65991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 66061 67377 gene locus_tag LOCUS_22930 66061 67377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 67633 68685 gene locus_tag LOCUS_22940 67633 68685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 68690 71383 gene locus_tag LOCUS_22950 68690 71383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 71380 72333 gene locus_tag LOCUS_22960 71380 72333 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_22960 72926 72405 gene locus_tag LOCUS_22970 72926 72405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 73299 74117 gene locus_tag LOCUS_22980 gene mvaB 73299 74117 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_22980 75250 74132 gene locus_tag LOCUS_22990 gene smf 75250 74132 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_22990 75584 75231 gene locus_tag LOCUS_23000 75584 75231 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_23000 76421 75795 gene locus_tag LOCUS_23010 76421 75795 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_23010 78380 76578 gene locus_tag LOCUS_23020 78380 76578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence20 1475 675 gene locus_tag LOCUS_23030 1475 675 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_23030 1599 1778 gene locus_tag LOCUS_23040 1599 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1836 3230 gene locus_tag LOCUS_23050 1836 3230 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_23050 3271 4413 gene locus_tag LOCUS_23060 3271 4413 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_23060 5221 4478 gene locus_tag LOCUS_23070 5221 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5331 5660 gene locus_tag LOCUS_23080 5331 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5765 7039 gene locus_tag LOCUS_23090 5765 7039 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860655.1 protein_id gnl|my_center|LOCUS_23090 7237 8775 gene locus_tag LOCUS_23100 gene gltX 7237 8775 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A455 protein_id gnl|my_center|LOCUS_23100 8787 8990 gene locus_tag LOCUS_23110 8787 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 9115 9855 gene locus_tag LOCUS_23120 9115 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10041 10445 gene locus_tag LOCUS_23130 10041 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 10435 10746 gene locus_tag LOCUS_23140 10435 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 10758 11513 gene locus_tag LOCUS_23150 10758 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 13304 11622 gene locus_tag LOCUS_23160 13304 11622 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_23160 13709 14596 gene locus_tag LOCUS_23170 13709 14596 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_23170 14607 18251 gene locus_tag LOCUS_23180 14607 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_23180 18500 18291 gene locus_tag LOCUS_23190 18500 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 19047 18514 gene locus_tag LOCUS_23200 19047 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 22320 19354 gene locus_tag LOCUS_23210 22320 19354 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_23210 23470 22322 gene locus_tag LOCUS_23220 gene dinP 23470 22322 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_23220 23612 24343 gene locus_tag LOCUS_23230 23612 24343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 24640 24458 gene locus_tag LOCUS_23240 24640 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 25520 24654 gene locus_tag LOCUS_23250 25520 24654 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_23250 25635 26543 gene locus_tag LOCUS_23260 25635 26543 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_23260 26620 28071 gene locus_tag LOCUS_23270 26620 28071 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_23270 28198 29202 gene locus_tag LOCUS_23280 28198 29202 CDS product putative 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WS1 protein_id gnl|my_center|LOCUS_23280 29325 30575 gene locus_tag LOCUS_23290 gene dadA 29325 30575 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_23290 30711 31268 gene locus_tag LOCUS_23300 30711 31268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_23300 32546 31335 gene locus_tag LOCUS_23310 gene argJ 32546 31335 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG63 protein_id gnl|my_center|LOCUS_23310 33707 32664 gene locus_tag LOCUS_23320 gene argC1 33707 32664 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH7 protein_id gnl|my_center|LOCUS_23320 34902 33709 gene locus_tag LOCUS_23330 34902 33709 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_23330 35721 34906 gene locus_tag LOCUS_23340 gene argB 35721 34906 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF41 protein_id gnl|my_center|LOCUS_23340 35772 36053 gene locus_tag LOCUS_23350 35772 36053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 37322 36129 gene locus_tag LOCUS_23360 37322 36129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 37540 39087 gene locus_tag LOCUS_23370 37540 39087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 39074 40018 gene locus_tag LOCUS_23380 39074 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 40024 41091 gene locus_tag LOCUS_23390 40024 41091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 41276 42487 gene locus_tag LOCUS_23400 41276 42487 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268292.1 protein_id gnl|my_center|LOCUS_23400 43698 44690 gene locus_tag LOCUS_23410 43698 44690 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_23410 44698 46389 gene locus_tag LOCUS_23420 44698 46389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 46400 47317 gene locus_tag LOCUS_23430 gene rfbN 46400 47317 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_23430 47488 48207 gene locus_tag LOCUS_23440 47488 48207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 48345 48770 gene locus_tag LOCUS_23450 48345 48770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090958.1 protein_id gnl|my_center|LOCUS_23450 50908 48791 gene locus_tag LOCUS_23460 50908 48791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 51402 51112 gene locus_tag LOCUS_23470 51402 51112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 51561 52748 gene locus_tag LOCUS_23480 51561 52748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 53295 52930 gene locus_tag LOCUS_23490 gene rplS 53295 52930 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S235 protein_id gnl|my_center|LOCUS_23490 54061 53345 gene locus_tag LOCUS_23500 gene trmD 54061 53345 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_23500 54595 54065 gene locus_tag LOCUS_23510 gene rimM 54595 54065 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_23510 55308 54607 gene locus_tag LOCUS_23520 55308 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 55728 55800 gene locus_tag LOCUS_t00080 55728 55800 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56633 55893 gene locus_tag LOCUS_23530 56633 55893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 57685 56807 gene locus_tag LOCUS_23540 57685 56807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_23540 58683 57796 gene locus_tag LOCUS_23550 58683 57796 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_23550 59505 58708 gene locus_tag LOCUS_23560 59505 58708 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_23560 60544 59507 gene locus_tag LOCUS_23570 60544 59507 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_23570 61255 60557 gene locus_tag LOCUS_23580 61255 60557 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_23580 62666 61596 gene locus_tag LOCUS_23590 62666 61596 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_23590 63380 62670 gene locus_tag LOCUS_23600 63380 62670 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_23600 64240 63482 gene locus_tag LOCUS_23610 64240 63482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_23610 65125 64361 gene locus_tag LOCUS_23620 gene pdxJ 65125 64361 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_23620 65137 65589 gene locus_tag LOCUS_23630 65137 65589 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_23630 65591 66136 gene locus_tag LOCUS_23640 65591 66136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 66120 66695 gene locus_tag LOCUS_23650 gene trpG 66120 66695 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_23650 67892 66702 gene locus_tag LOCUS_23660 67892 66702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 68124 68858 gene locus_tag LOCUS_23670 68124 68858 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_23670 69081 69581 gene locus_tag LOCUS_23680 69081 69581 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_23680 69669 71234 gene locus_tag LOCUS_23690 gene glpA 69669 71234 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_23690 71241 72740 gene locus_tag LOCUS_23700 gene glpK 71241 72740 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_23700 72740 73474 gene locus_tag LOCUS_23710 gene glpF 72740 73474 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_23710 74801 73659 gene locus_tag LOCUS_23720 74801 73659 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_23720 75094 76980 gene locus_tag LOCUS_23730 75094 76980 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_23730 77092 77379 gene locus_tag LOCUS_23740 77092 77379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 77493 77936 gene locus_tag LOCUS_23750 77493 77936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence21 1195 560 gene locus_tag LOCUS_23760 1195 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2039 1368 gene locus_tag LOCUS_23770 2039 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2313 3956 gene locus_tag LOCUS_23780 gene pgi 2313 3956 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_23780 4735 4223 gene locus_tag LOCUS_23790 4735 4223 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764601.1 protein_id gnl|my_center|LOCUS_23790 5818 4937 gene locus_tag LOCUS_23800 gene sucD 5818 4937 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_23800 6084 7259 gene locus_tag LOCUS_23810 6084 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 7262 7894 gene locus_tag LOCUS_23820 7262 7894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884017.1 protein_id gnl|my_center|LOCUS_23820 7891 9153 gene locus_tag LOCUS_23830 7891 9153 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_23830 9180 9620 gene locus_tag LOCUS_23840 9180 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 10769 9711 gene locus_tag LOCUS_23850 10769 9711 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405476.1 protein_id gnl|my_center|LOCUS_23850 12010 11189 gene locus_tag LOCUS_23860 12010 11189 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_23860 12139 12558 gene locus_tag LOCUS_23870 12139 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 12999 12559 gene locus_tag LOCUS_23880 12999 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 13646 12996 gene locus_tag LOCUS_23890 13646 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 14189 13659 gene locus_tag LOCUS_23900 14189 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_23900 14242 14649 gene locus_tag LOCUS_23910 14242 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14646 15641 gene locus_tag LOCUS_23920 gene argK 14646 15641 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_23920 15644 16381 gene locus_tag LOCUS_23930 15644 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932758.1 protein_id gnl|my_center|LOCUS_23930 17679 16630 gene locus_tag LOCUS_23940 17679 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_23940 19625 17766 gene locus_tag LOCUS_23950 19625 17766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_23950 20100 21215 gene locus_tag LOCUS_23960 20100 21215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_23960 21202 22233 gene locus_tag LOCUS_23970 21202 22233 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_23970 22237 23211 gene locus_tag LOCUS_23980 22237 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 23624 23286 gene locus_tag LOCUS_23990 23624 23286 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_23990 23850 23611 gene locus_tag LOCUS_24000 23850 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 24047 25531 gene locus_tag LOCUS_24010 24047 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405194.1 protein_id gnl|my_center|LOCUS_24010 25528 26223 gene locus_tag LOCUS_24020 25528 26223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_24020 27266 28378 gene locus_tag LOCUS_24030 27266 28378 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_24030 29906 28467 gene locus_tag LOCUS_24040 29906 28467 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_24040 33066 29899 gene locus_tag LOCUS_24050 33066 29899 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_24050 34062 33097 gene locus_tag LOCUS_24060 34062 33097 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_24060 34755 34345 gene locus_tag LOCUS_24070 34755 34345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 35139 35558 gene locus_tag LOCUS_24080 35139 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 35506 36645 gene locus_tag LOCUS_24090 35506 36645 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24090 37726 36797 gene locus_tag LOCUS_24100 37726 36797 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_24100 38858 37932 gene locus_tag LOCUS_24110 38858 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 40721 39279 gene locus_tag LOCUS_24120 gene uxuB 40721 39279 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762615.1 protein_id gnl|my_center|LOCUS_24120 40876 41886 gene locus_tag LOCUS_24130 gene regA 40876 41886 CDS product HTH-type transcriptional regulator RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58258 protein_id gnl|my_center|LOCUS_24130 43512 42535 gene locus_tag LOCUS_24140 43512 42535 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969632.1 protein_id gnl|my_center|LOCUS_24140 44711 43518 gene locus_tag LOCUS_24150 44711 43518 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258650.1 protein_id gnl|my_center|LOCUS_24150 45128 44718 gene locus_tag LOCUS_24160 45128 44718 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_24160 45243 45899 gene locus_tag LOCUS_24170 45243 45899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_24170 46031 47314 gene locus_tag LOCUS_24180 46031 47314 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_24180 47307 47741 gene locus_tag LOCUS_24190 47307 47741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 47912 48214 gene locus_tag LOCUS_24200 47912 48214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 48288 50612 gene locus_tag LOCUS_24210 48288 50612 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_24210 50622 51692 gene locus_tag LOCUS_24220 50622 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 51760 56478 gene locus_tag LOCUS_24230 51760 56478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 57323 57916 gene locus_tag LOCUS_24240 57323 57916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_24240 57903 58235 gene locus_tag LOCUS_24250 57903 58235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_24250 59191 58790 gene locus_tag LOCUS_tm00010 59191 58790 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 59595 60740 gene locus_tag LOCUS_24260 59595 60740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 60815 61315 gene locus_tag LOCUS_24270 60815 61315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 62304 61312 gene locus_tag LOCUS_24280 62304 61312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_24280 63924 62329 gene locus_tag LOCUS_24290 63924 62329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 64636 63992 gene locus_tag LOCUS_24300 64636 63992 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_24300 65868 64639 gene locus_tag LOCUS_24310 65868 64639 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_24310 66245 67537 gene locus_tag LOCUS_24320 gene pepP 66245 67537 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_24320 67671 68264 gene locus_tag LOCUS_24330 67671 68264 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_24330 68489 69523 gene locus_tag LOCUS_24340 68489 69523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 69605 73087 gene locus_tag LOCUS_24350 69605 73087 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107429.1 protein_id gnl|my_center|LOCUS_24350 73101 74879 gene locus_tag LOCUS_24360 73101 74879 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107430.1 protein_id gnl|my_center|LOCUS_24360 75066 77096 gene locus_tag LOCUS_24370 75066 77096 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence22 <1 804 gene locus_tag LOCUS_24380 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481810.1:RNA methyltransferase 801 1787 gene locus_tag LOCUS_24390 801 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 protein_id gnl|my_center|LOCUS_24390 2126 1866 gene locus_tag LOCUS_24400 2126 1866 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_24400 3548 2256 gene locus_tag LOCUS_24410 gene gltA 3548 2256 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_24410 4213 3791 gene locus_tag LOCUS_24420 gene yqiW 4213 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_24420 4583 4239 gene locus_tag LOCUS_24430 4583 4239 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_24430 5019 4588 gene locus_tag LOCUS_24440 5019 4588 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_24440 6239 5016 gene locus_tag LOCUS_24450 6239 5016 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A296 protein_id gnl|my_center|LOCUS_24450 7516 6248 gene locus_tag LOCUS_24460 gene sufD 7516 6248 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_24460 8303 7539 gene locus_tag LOCUS_24470 gene sufC 8303 7539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_24470 9798 8353 gene locus_tag LOCUS_24480 gene sufB 9798 8353 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_24480 10504 10031 gene locus_tag LOCUS_24490 10504 10031 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_24490 10524 10685 gene locus_tag LOCUS_24500 10524 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11003 11407 gene locus_tag LOCUS_24510 11003 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 11566 14403 gene locus_tag LOCUS_24520 11566 14403 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_24520 14556 15122 gene locus_tag LOCUS_24530 14556 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 15489 15253 gene locus_tag LOCUS_24540 15489 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 16473 15679 gene locus_tag LOCUS_24550 gene thyA 16473 15679 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_24550 16607 18859 gene locus_tag LOCUS_24560 16607 18859 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_24560 19626 18871 gene locus_tag LOCUS_24570 19626 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 20159 20734 gene locus_tag LOCUS_24580 20159 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_24580 20872 23286 gene locus_tag LOCUS_24590 20872 23286 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_24590 23292 23666 gene locus_tag LOCUS_24600 23292 23666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 23776 24294 gene locus_tag LOCUS_24610 23776 24294 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_24610 24412 27081 gene locus_tag LOCUS_24620 24412 27081 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_24620 27125 28444 gene locus_tag LOCUS_24630 27125 28444 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_24630 28504 29118 gene locus_tag LOCUS_24640 gene pglD 28504 29118 CDS product UDP-N-acetylbacillosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9D1 protein_id gnl|my_center|LOCUS_24640 29164 30261 gene locus_tag LOCUS_24650 29164 30261 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_24650 30269 31396 gene locus_tag LOCUS_24660 gene porR 30269 31396 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_24660 31515 32087 gene locus_tag LOCUS_24670 31515 32087 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_24670 32090 33058 gene locus_tag LOCUS_24680 32090 33058 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_24680 33156 34307 gene locus_tag LOCUS_24690 33156 34307 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_24690 34297 35439 gene locus_tag LOCUS_24700 34297 35439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 35439 36905 gene locus_tag LOCUS_24710 35439 36905 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_24710 36930 38027 gene locus_tag LOCUS_24720 36930 38027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 38024 39271 gene locus_tag LOCUS_24730 38024 39271 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_24730 39268 40551 gene locus_tag LOCUS_24740 39268 40551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 40541 41704 gene locus_tag LOCUS_24750 40541 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 41736 42731 gene locus_tag LOCUS_24760 41736 42731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 42728 44323 gene locus_tag LOCUS_24770 42728 44323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_24770 44316 45404 gene locus_tag LOCUS_24780 44316 45404 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028306.1 protein_id gnl|my_center|LOCUS_24780 45467 47092 gene locus_tag LOCUS_24790 45467 47092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 47345 48649 gene locus_tag LOCUS_24800 47345 48649 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_24800 48757 49524 gene locus_tag LOCUS_24810 48757 49524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 49537 51906 gene locus_tag LOCUS_24820 gene wzc 49537 51906 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_24820 52336 53766 gene locus_tag LOCUS_24830 52336 53766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_24830 53763 54860 gene locus_tag LOCUS_24840 53763 54860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 54868 55875 gene locus_tag LOCUS_24850 54868 55875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 55879 56544 gene locus_tag LOCUS_24860 55879 56544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 56558 57940 gene locus_tag LOCUS_24870 56558 57940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_24870 57946 59088 gene locus_tag LOCUS_24880 57946 59088 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_24880 59081 60202 gene locus_tag LOCUS_24890 59081 60202 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_24890 60199 61263 gene locus_tag LOCUS_24900 60199 61263 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_24900 61265 62746 gene locus_tag LOCUS_24910 61265 62746 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_24910 62875 64038 gene locus_tag LOCUS_24920 62875 64038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 64042 64845 gene locus_tag LOCUS_24930 64042 64845 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 protein_id gnl|my_center|LOCUS_24930 64849 65928 gene locus_tag LOCUS_24940 64849 65928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 65928 66854 gene locus_tag LOCUS_24950 65928 66854 CDS product glycosyl transferase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311097.1 protein_id gnl|my_center|LOCUS_24950 68081 66840 gene locus_tag LOCUS_24960 68081 66840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 68411 69175 gene locus_tag LOCUS_24970 68411 69175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 69238 69867 gene locus_tag LOCUS_24980 gene ptmB 69238 69867 CDS product posttranslational modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_24980 69992 70807 gene locus_tag LOCUS_24990 69992 70807 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_24990 70821 71864 gene locus_tag LOCUS_25000 gene neuB 70821 71864 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_25000 72233 73375 gene locus_tag LOCUS_25010 gene neuC 72233 73375 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289362.1 protein_id gnl|my_center|LOCUS_25010 73629 74207 gene locus_tag LOCUS_25020 73629 74207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 74209 75282 gene locus_tag LOCUS_25030 74209 75282 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_25030 75279 76271 gene locus_tag LOCUS_25040 75279 76271 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence23 914 318 gene locus_tag LOCUS_25050 914 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1801 1037 gene locus_tag LOCUS_25060 1801 1037 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_25060 2818 2018 gene locus_tag LOCUS_25070 2818 2018 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_25070 3884 2820 gene locus_tag LOCUS_25080 3884 2820 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_25080 5510 3927 gene locus_tag LOCUS_25090 gene pccB 5510 3927 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_25090 5940 6884 gene locus_tag LOCUS_25100 5940 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 6955 8025 gene locus_tag LOCUS_25110 6955 8025 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_25110 8672 8211 gene locus_tag LOCUS_25120 gene mscL 8672 8211 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_25120 8864 9079 gene locus_tag LOCUS_25130 8864 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 9205 10413 gene locus_tag LOCUS_25140 9205 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 10569 10928 gene locus_tag LOCUS_25150 10569 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 10931 12766 gene locus_tag LOCUS_25160 10931 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973596.1 protein_id gnl|my_center|LOCUS_25160 12783 13826 gene locus_tag LOCUS_25170 gene gshB 12783 13826 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_25170 14891 13902 gene locus_tag LOCUS_25180 14891 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 15447 15785 gene locus_tag LOCUS_25190 15447 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 15969 16679 gene locus_tag LOCUS_25200 15969 16679 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206937.1 protein_id gnl|my_center|LOCUS_25200 16874 17938 gene locus_tag LOCUS_25210 16874 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_25210 18288 19676 gene locus_tag LOCUS_25220 18288 19676 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_25220 19691 20551 gene locus_tag LOCUS_25230 19691 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 20603 20914 gene locus_tag LOCUS_25240 20603 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 21021 22223 gene locus_tag LOCUS_25250 21021 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_25250 22447 22181 gene locus_tag LOCUS_25260 22447 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 22557 23318 gene locus_tag LOCUS_25270 gene traP 22557 23318 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_25270 23414 23758 gene locus_tag LOCUS_25280 23414 23758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 23748 24932 gene locus_tag LOCUS_25290 23748 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 25426 28197 gene locus_tag LOCUS_25300 gene yeeA 25426 28197 CDS product putative DNA methyltransferase YeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31504 protein_id gnl|my_center|LOCUS_25300 28197 29642 gene locus_tag LOCUS_25310 gene mloB 28197 29642 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_25310 30205 32133 gene locus_tag LOCUS_25320 gene yeeB 30205 32133 CDS product putative ATP-dependent helicase YeeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34469 protein_id gnl|my_center|LOCUS_25320 32120 33367 gene locus_tag LOCUS_25330 gene yeeC 32120 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34352 protein_id gnl|my_center|LOCUS_25330 33996 33406 gene locus_tag LOCUS_25340 33996 33406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 34332 34003 gene locus_tag LOCUS_25350 34332 34003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 35232 34384 gene locus_tag LOCUS_25360 35232 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 35474 35635 gene locus_tag LOCUS_25370 35474 35635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 36016 36519 gene locus_tag LOCUS_25380 36016 36519 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_25380 36592 36921 gene locus_tag LOCUS_25390 36592 36921 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_25390 36947 37408 gene locus_tag LOCUS_25400 36947 37408 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_25400 37416 37940 gene locus_tag LOCUS_25410 37416 37940 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_25410 38753 38187 gene locus_tag LOCUS_25420 38753 38187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 39444 39151 gene locus_tag LOCUS_25430 39444 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 39835 39748 gene locus_tag LOCUS_t00090 39835 39748 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41002 39935 gene locus_tag LOCUS_25440 gene ansA 41002 39935 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_25440 41775 40999 gene locus_tag LOCUS_25450 gene tatD 41775 40999 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_25450 42878 41763 gene locus_tag LOCUS_25460 42878 41763 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_25460 43504 42878 gene locus_tag LOCUS_25470 43504 42878 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_25470 44717 43506 gene locus_tag LOCUS_25480 44717 43506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 44971 44720 gene locus_tag LOCUS_25490 44971 44720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 46030 44975 gene locus_tag LOCUS_25500 46030 44975 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_25500 46127 46702 gene locus_tag LOCUS_25510 gene ruvC 46127 46702 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_25510 47299 46754 gene locus_tag LOCUS_25520 47299 46754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 47478 48041 gene locus_tag LOCUS_25530 47478 48041 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_25530 48607 48068 gene locus_tag LOCUS_25540 48607 48068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 49205 48717 gene locus_tag LOCUS_25550 49205 48717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 49674 49297 gene locus_tag LOCUS_25560 49674 49297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 49871 50215 gene locus_tag LOCUS_25570 49871 50215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 50307 51674 gene locus_tag LOCUS_25580 50307 51674 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_25580 51849 56897 gene locus_tag LOCUS_25590 51849 56897 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_25590 56887 59181 gene locus_tag LOCUS_25600 56887 59181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_25600 59338 60243 gene locus_tag LOCUS_25610 59338 60243 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_25610 60245 60547 gene locus_tag LOCUS_25620 60245 60547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 60564 61022 gene locus_tag LOCUS_25630 60564 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_25630 61161 61012 gene locus_tag LOCUS_25640 61161 61012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 61160 61531 gene locus_tag LOCUS_25650 61160 61531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 61589 62788 gene locus_tag LOCUS_25660 61589 62788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 62917 64023 gene locus_tag LOCUS_25670 62917 64023 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_25670 64810 64274 gene locus_tag LOCUS_25680 64810 64274 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_25680 65969 65094 gene locus_tag LOCUS_25690 gene cysM 65969 65094 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_25690 66900 66052 gene locus_tag LOCUS_25700 66900 66052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 67467 66919 gene locus_tag LOCUS_25710 67467 66919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 67669 67448 gene locus_tag LOCUS_25720 67669 67448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 69120 67840 gene locus_tag LOCUS_25730 gene eno 69120 67840 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_25730 70240 69143 gene locus_tag LOCUS_25740 gene carA 70240 69143 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_25740 70917 70360 gene locus_tag LOCUS_25750 70917 70360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 71913 70924 gene locus_tag LOCUS_25760 gene rpoA 71913 70924 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_25760 72558 71953 gene locus_tag LOCUS_25770 gene rpsD 72558 71953 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_25770 72975 72577 gene locus_tag LOCUS_25780 gene rpsK 72975 72577 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_25780 73368 72991 gene locus_tag LOCUS_25790 gene rpsM 73368 72991 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_25790 73714 73496 gene locus_tag LOCUS_25800 gene infA 73714 73496 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_25800 74489 73716 gene locus_tag LOCUS_25810 gene map 74489 73716 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_25810 75810 74491 gene locus_tag LOCUS_25820 gene secY 75810 74491 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_25820 >Feature sequence24 274 185 gene locus_tag LOCUS_t00100 274 185 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 614 838 gene locus_tag LOCUS_25830 614 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2148 865 gene locus_tag LOCUS_25840 gene queA 2148 865 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_25840 2147 3229 gene locus_tag LOCUS_25850 gene menC 2147 3229 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_25850 4365 3226 gene locus_tag LOCUS_25860 4365 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204946.1 protein_id gnl|my_center|LOCUS_25860 4632 7169 gene locus_tag LOCUS_25870 gene ppc 4632 7169 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_25870 10014 7381 gene locus_tag LOCUS_25880 gene valS 10014 7381 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZM4 protein_id gnl|my_center|LOCUS_25880 11159 10278 gene locus_tag LOCUS_25890 11159 10278 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_25890 11932 11156 gene locus_tag LOCUS_25900 gene folP 11932 11156 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_25900 12055 12600 gene locus_tag LOCUS_25910 12055 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_25910 12593 13693 gene locus_tag LOCUS_25920 12593 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_25920 13697 14227 gene locus_tag LOCUS_25930 gene aroK 13697 14227 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57605 protein_id gnl|my_center|LOCUS_25930 15596 14217 gene locus_tag LOCUS_25940 15596 14217 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_25940 17124 15901 gene locus_tag LOCUS_25950 17124 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 17078 17248 gene locus_tag LOCUS_25960 17078 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 17358 18839 gene locus_tag LOCUS_25970 gene proS 17358 18839 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_25970 18940 19398 gene locus_tag LOCUS_25980 18940 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 19400 20419 gene locus_tag LOCUS_25990 19400 20419 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_25990 21995 20430 gene locus_tag LOCUS_26000 21995 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 23358 22090 gene locus_tag LOCUS_26010 gene hemA 23358 22090 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_26010 23551 24234 gene locus_tag LOCUS_26020 23551 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 24285 24758 gene locus_tag LOCUS_26030 24285 24758 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_26030 24870 25526 gene locus_tag LOCUS_26040 24870 25526 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_26040 25563 26072 gene locus_tag LOCUS_26050 25563 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 26239 26925 gene locus_tag LOCUS_26060 26239 26925 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_26060 26977 28332 gene locus_tag LOCUS_26070 26977 28332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 28421 29965 gene locus_tag LOCUS_26080 28421 29965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 29966 31432 gene locus_tag LOCUS_26090 29966 31432 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_26090 31439 32131 gene locus_tag LOCUS_26100 31439 32131 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_26100 32160 32723 gene locus_tag LOCUS_26110 32160 32723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 32888 33685 gene locus_tag LOCUS_26120 32888 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 34285 35016 gene locus_tag LOCUS_26130 34285 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 35013 35741 gene locus_tag LOCUS_26140 35013 35741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 35789 36538 gene locus_tag LOCUS_26150 35789 36538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_26150 36545 37762 gene locus_tag LOCUS_26160 36545 37762 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_26160 37759 38799 gene locus_tag LOCUS_26170 37759 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_26170 38939 40648 gene locus_tag LOCUS_26180 38939 40648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 40675 42663 gene locus_tag LOCUS_26190 40675 42663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 44216 42660 gene locus_tag LOCUS_26200 44216 42660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 44857 46269 gene locus_tag LOCUS_26210 44857 46269 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZX8 protein_id gnl|my_center|LOCUS_26210 47225 46362 gene locus_tag LOCUS_26220 47225 46362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 48083 47337 gene locus_tag LOCUS_26230 48083 47337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 48501 50075 gene locus_tag LOCUS_26240 48501 50075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 50611 50237 gene locus_tag LOCUS_26250 50611 50237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 51726 51103 gene locus_tag LOCUS_26260 gene paiB 51726 51103 CDS product protease synthase and sporulation protein PAI 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21341 protein_id gnl|my_center|LOCUS_26260 51836 54091 gene locus_tag LOCUS_26270 51836 54091 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_26270 55465 54242 gene locus_tag LOCUS_26280 55465 54242 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_26280 56174 55599 gene locus_tag LOCUS_26290 56174 55599 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_26290 56473 56814 gene locus_tag LOCUS_26300 56473 56814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26300 56799 57317 gene locus_tag LOCUS_26310 56799 57317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 57818 57327 gene locus_tag LOCUS_26320 57818 57327 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_26320 58077 61286 gene locus_tag LOCUS_26330 58077 61286 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UE7 protein_id gnl|my_center|LOCUS_26330 61423 64146 gene locus_tag LOCUS_26340 61423 64146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_26340 64845 64219 gene locus_tag LOCUS_26350 64845 64219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 66004 64850 gene locus_tag LOCUS_26360 66004 64850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 67501 66923 gene locus_tag LOCUS_26370 67501 66923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 68115 67537 gene locus_tag LOCUS_26380 68115 67537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 69905 68127 gene locus_tag LOCUS_26390 gene atsA 69905 68127 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_26390 70421 72865 gene locus_tag LOCUS_26400 70421 72865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_26400 73028 75445 gene locus_tag LOCUS_26410 73028 75445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence25 1211 189 gene locus_tag LOCUS_26420 1211 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1815 1306 gene locus_tag LOCUS_26430 1815 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2588 1929 gene locus_tag LOCUS_26440 gene rpe 2588 1929 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_26440 4307 2643 gene locus_tag LOCUS_26450 4307 2643 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_26450 4953 4294 gene locus_tag LOCUS_26460 4953 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 5082 5702 gene locus_tag LOCUS_26470 5082 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6735 5782 gene locus_tag LOCUS_26480 6735 5782 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_26480 8198 6792 gene locus_tag LOCUS_26490 8198 6792 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_26490 9623 8253 gene locus_tag LOCUS_26500 9623 8253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_26500 11006 9636 gene locus_tag LOCUS_26510 11006 9636 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_26510 11956 11036 gene locus_tag LOCUS_26520 11956 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 12085 13011 gene locus_tag LOCUS_26530 12085 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 13091 13348 gene locus_tag LOCUS_26540 13091 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 13374 13700 gene locus_tag LOCUS_26550 13374 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 14102 13761 gene locus_tag LOCUS_26560 gene phnA 14102 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061583.1 protein_id gnl|my_center|LOCUS_26560 15428 14178 gene locus_tag LOCUS_26570 15428 14178 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_26570 16525 15644 gene locus_tag LOCUS_26580 16525 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 18574 16535 gene locus_tag LOCUS_26590 18574 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 19017 20120 gene locus_tag LOCUS_26600 19017 20120 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_26600 20249 20944 gene locus_tag LOCUS_26610 gene rpiA 20249 20944 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHU6 protein_id gnl|my_center|LOCUS_26610 21031 21861 gene locus_tag LOCUS_26620 21031 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 22437 22006 gene locus_tag LOCUS_26630 22437 22006 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_26630 22582 23610 gene locus_tag LOCUS_26640 22582 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 24234 23746 gene locus_tag LOCUS_26650 24234 23746 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_26650 26032 24620 gene locus_tag LOCUS_26660 26032 24620 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_26660 26453 26037 gene locus_tag LOCUS_26670 26453 26037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 26802 26551 gene locus_tag LOCUS_26680 26802 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 27427 28866 gene locus_tag LOCUS_26690 27427 28866 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790898.1 protein_id gnl|my_center|LOCUS_26690 28967 29410 gene locus_tag LOCUS_26700 28967 29410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_26700 29420 30865 gene locus_tag LOCUS_26710 29420 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 31131 31640 gene locus_tag LOCUS_26720 31131 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 31704 32423 gene locus_tag LOCUS_26730 31704 32423 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLG8 protein_id gnl|my_center|LOCUS_26730 32420 33115 gene locus_tag LOCUS_26740 32420 33115 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_26740 33112 33984 gene locus_tag LOCUS_26750 33112 33984 CDS product urea amidolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_26750 34093 35604 gene locus_tag LOCUS_26760 34093 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_26760 36830 35667 gene locus_tag LOCUS_26770 gene rlmL 36830 35667 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_26770 37394 38776 gene locus_tag LOCUS_26780 37394 38776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_26780 38788 40137 gene locus_tag LOCUS_26790 38788 40137 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_26790 40491 43508 gene locus_tag LOCUS_26800 40491 43508 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_26800 43515 45185 gene locus_tag LOCUS_26810 43515 45185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_26810 45622 48630 gene locus_tag LOCUS_26820 45622 48630 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_26820 48648 50483 gene locus_tag LOCUS_26830 48648 50483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 51795 50773 gene locus_tag LOCUS_26840 51795 50773 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_26840 51964 53403 gene locus_tag LOCUS_26850 gene uxaC 51964 53403 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_26850 53406 54224 gene locus_tag LOCUS_26860 53406 54224 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_26860 54317 55492 gene locus_tag LOCUS_26870 gene uxuA 54317 55492 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_26870 55602 56156 gene locus_tag LOCUS_26880 gene maa 55602 56156 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123673.1 protein_id gnl|my_center|LOCUS_26880 56257 57189 gene locus_tag LOCUS_26890 56257 57189 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_26890 58772 57333 gene locus_tag LOCUS_26900 58772 57333 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_26900 60452 58884 gene locus_tag LOCUS_26910 60452 58884 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_26910 60939 61334 gene locus_tag LOCUS_26920 60939 61334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 63379 61697 gene locus_tag LOCUS_26930 63379 61697 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955487.1 protein_id gnl|my_center|LOCUS_26930 64611 63454 gene locus_tag LOCUS_26940 64611 63454 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_26940 64786 65751 gene locus_tag LOCUS_26950 64786 65751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 65748 66986 gene locus_tag LOCUS_26960 65748 66986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_26960 68159 67572 gene locus_tag LOCUS_26970 68159 67572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 69050 68535 gene locus_tag LOCUS_26980 69050 68535 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_26980 69688 69053 gene locus_tag LOCUS_26990 69688 69053 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_26990 71162 69666 gene locus_tag LOCUS_27000 71162 69666 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_27000 72001 71219 gene locus_tag LOCUS_27010 72001 71219 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_27010 72174 72623 gene locus_tag LOCUS_27020 72174 72623 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142371.1 protein_id gnl|my_center|LOCUS_27020 73510 72860 gene locus_tag LOCUS_27030 gene lolD 73510 72860 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_27030 73741 74955 gene locus_tag LOCUS_27040 gene sucC 73741 74955 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_27040 74994 75068 gene locus_tag LOCUS_t00110 74994 75068 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 3052 2159 gene locus_tag LOCUS_27050 gene cas1 3052 2159 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_27050 3691 3113 gene locus_tag LOCUS_27060 3691 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 8024 3708 gene locus_tag LOCUS_27070 gene cas9 8024 3708 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZR9 protein_id gnl|my_center|LOCUS_27070 8848 9102 gene locus_tag LOCUS_27080 8848 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 9406 9119 gene locus_tag LOCUS_27090 9406 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 9810 10472 gene locus_tag LOCUS_27100 9810 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 10523 11371 gene locus_tag LOCUS_27110 10523 11371 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_27110 12230 11391 gene locus_tag LOCUS_27120 12230 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 12338 12523 gene locus_tag LOCUS_27130 12338 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 12745 13401 gene locus_tag LOCUS_27140 12745 13401 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 protein_id gnl|my_center|LOCUS_27140 13747 16956 gene locus_tag LOCUS_27150 13747 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_27150 17090 18466 gene locus_tag LOCUS_27160 17090 18466 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_27160 18479 19819 gene locus_tag LOCUS_27170 18479 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 20253 21596 gene locus_tag LOCUS_27180 20253 21596 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB8 protein_id gnl|my_center|LOCUS_27180 23205 21928 gene locus_tag LOCUS_27190 23205 21928 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_27190 25177 23246 gene locus_tag LOCUS_27200 25177 23246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_27200 26443 25466 gene locus_tag LOCUS_27210 26443 25466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 27044 26505 gene locus_tag LOCUS_27220 27044 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 27862 27281 gene locus_tag LOCUS_27230 27862 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 27974 28480 gene locus_tag LOCUS_27240 27974 28480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 28646 30139 gene locus_tag LOCUS_27250 28646 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 30143 30403 gene locus_tag LOCUS_27260 30143 30403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 30400 30645 gene locus_tag LOCUS_27270 30400 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 31509 30637 gene locus_tag LOCUS_27280 31509 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 31845 31519 gene locus_tag LOCUS_27290 31845 31519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 31933 32325 gene locus_tag LOCUS_27300 31933 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 36145 32339 gene locus_tag LOCUS_27310 36145 32339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 38399 36156 gene locus_tag LOCUS_27320 38399 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 41015 38406 gene locus_tag LOCUS_27330 41015 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 41211 41020 gene locus_tag LOCUS_27340 41211 41020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 41648 41346 gene locus_tag LOCUS_27350 41648 41346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 42206 41763 gene locus_tag LOCUS_27360 42206 41763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 42632 42252 gene locus_tag LOCUS_27370 42632 42252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 43092 42634 gene locus_tag LOCUS_27380 43092 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 43418 43089 gene locus_tag LOCUS_27390 43418 43089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 43968 43420 gene locus_tag LOCUS_27400 43968 43420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_27400 44143 43970 gene locus_tag LOCUS_27410 44143 43970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 45523 44276 gene locus_tag LOCUS_27420 45523 44276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 46207 45593 gene locus_tag LOCUS_27430 46207 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 47423 46209 gene locus_tag LOCUS_27440 47423 46209 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965198.1 protein_id gnl|my_center|LOCUS_27440 47982 47467 gene locus_tag LOCUS_27450 47982 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 49702 48080 gene locus_tag LOCUS_27460 49702 48080 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309625.1 protein_id gnl|my_center|LOCUS_27460 50188 49709 gene locus_tag LOCUS_27470 50188 49709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 50949 50425 gene locus_tag LOCUS_27480 50949 50425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 51219 50983 gene locus_tag LOCUS_27490 51219 50983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 51489 52547 gene locus_tag LOCUS_27500 51489 52547 CDS product DUF4917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948270.1 protein_id gnl|my_center|LOCUS_27500 54409 52601 gene locus_tag LOCUS_27510 54409 52601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108554.1 protein_id gnl|my_center|LOCUS_27510 56290 55223 gene locus_tag LOCUS_27520 56290 55223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 58198 56297 gene locus_tag LOCUS_27530 58198 56297 CDS product type II restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_27530 59815 58526 gene locus_tag LOCUS_27540 59815 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 60080 61294 gene locus_tag LOCUS_27550 60080 61294 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_27550 61721 61338 gene locus_tag LOCUS_27560 61721 61338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_27560 63129 61810 gene locus_tag LOCUS_27570 63129 61810 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_27570 63798 63133 gene locus_tag LOCUS_27580 63798 63133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 64872 64330 gene locus_tag LOCUS_27590 gene hslV 64872 64330 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57115 protein_id gnl|my_center|LOCUS_27590 66605 64965 gene locus_tag LOCUS_27600 gene pdhC 66605 64965 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_27600 66727 67686 gene locus_tag LOCUS_27610 66727 67686 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_27610 67716 68414 gene locus_tag LOCUS_27620 gene yoqW 67716 68414 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_27620 68499 69497 gene locus_tag LOCUS_27630 gene fabH2 68499 69497 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_27630 69498 70052 gene locus_tag LOCUS_27640 69498 70052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 70224 71834 gene locus_tag LOCUS_27650 70224 71834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 71845 72042 gene locus_tag LOCUS_27660 71845 72042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 72758 72237 gene locus_tag LOCUS_27670 72758 72237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence27 629 183 gene locus_tag LOCUS_27680 629 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3111 712 gene locus_tag LOCUS_27690 gene nrdA 3111 712 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_27690 4135 3149 gene locus_tag LOCUS_27700 gene nrdB 4135 3149 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_27700 4709 5020 gene locus_tag LOCUS_27710 4709 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 5056 5316 gene locus_tag LOCUS_27720 gene rpmA 5056 5316 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_27720 6407 5778 gene locus_tag LOCUS_27730 gene glpG 6407 5778 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_27730 7409 6408 gene locus_tag LOCUS_27740 7409 6408 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_27740 9576 7372 gene locus_tag LOCUS_27750 gene rnr 9576 7372 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_27750 10379 9630 gene locus_tag LOCUS_27760 10379 9630 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_27760 10790 10389 gene locus_tag LOCUS_27770 10790 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_27770 11512 10790 gene locus_tag LOCUS_27780 gene lipB 11512 10790 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_27780 11597 11953 gene locus_tag LOCUS_27790 11597 11953 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_27790 11984 12511 gene locus_tag LOCUS_27800 11984 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 13391 12675 gene locus_tag LOCUS_27810 13391 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 13660 14862 gene locus_tag LOCUS_27820 gene aspC1 13660 14862 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_27820 15092 15802 gene locus_tag LOCUS_27830 15092 15802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_27830 16652 15828 gene locus_tag LOCUS_27840 16652 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 17672 16896 gene locus_tag LOCUS_27850 17672 16896 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_27850 18012 19040 gene locus_tag LOCUS_27860 18012 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 19107 20651 gene locus_tag LOCUS_27870 gene pcd 19107 20651 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_27870 20799 20874 gene locus_tag LOCUS_t00120 20799 20874 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20979 21054 gene locus_tag LOCUS_t00130 20979 21054 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21090 21338 gene locus_tag LOCUS_27880 21090 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 21455 21703 gene locus_tag LOCUS_27890 21455 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 23715 21889 gene locus_tag LOCUS_27900 23715 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 23819 25831 gene locus_tag LOCUS_27910 23819 25831 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_27910 27469 25994 gene locus_tag LOCUS_27920 27469 25994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_27920 30647 27501 gene locus_tag LOCUS_27930 30647 27501 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_27930 31637 31047 gene locus_tag LOCUS_27940 31637 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 32818 31634 gene locus_tag LOCUS_27950 32818 31634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 33615 32908 gene locus_tag LOCUS_27960 33615 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 35361 33619 gene locus_tag LOCUS_27970 35361 33619 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_27970 36192 35500 gene locus_tag LOCUS_27980 36192 35500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 36407 37084 gene locus_tag LOCUS_27990 36407 37084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_27990 37077 39599 gene locus_tag LOCUS_28000 37077 39599 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_28000 39794 39712 gene locus_tag LOCUS_t00140 39794 39712 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40173 39874 gene locus_tag LOCUS_28010 gene fjo15 40173 39874 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_28010 40943 40173 gene locus_tag LOCUS_28020 gene fjo14 40943 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_28020 41051 42040 gene locus_tag LOCUS_28030 41051 42040 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_28030 42009 42443 gene locus_tag LOCUS_28040 42009 42443 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543273.1 protein_id gnl|my_center|LOCUS_28040 42479 43054 gene locus_tag LOCUS_28050 42479 43054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 43413 45215 gene locus_tag LOCUS_28060 43413 45215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 45278 46051 gene locus_tag LOCUS_28070 45278 46051 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_28070 46052 47974 gene locus_tag LOCUS_28080 46052 47974 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_28080 47967 48575 gene locus_tag LOCUS_28090 47967 48575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 48562 49113 gene locus_tag LOCUS_28100 48562 49113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_28100 49113 49550 gene locus_tag LOCUS_28110 49113 49550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 49622 50305 gene locus_tag LOCUS_28120 49622 50305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 50307 51272 gene locus_tag LOCUS_28130 50307 51272 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_28130 51395 52594 gene locus_tag LOCUS_28140 gene pgk 51395 52594 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_28140 53513 52776 gene locus_tag LOCUS_28150 53513 52776 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_28150 54481 53510 gene locus_tag LOCUS_28160 54481 53510 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_28160 55678 54689 gene locus_tag LOCUS_28170 55678 54689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_28170 57041 55683 gene locus_tag LOCUS_28180 57041 55683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 57192 58415 gene locus_tag LOCUS_28190 57192 58415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_28190 58421 58954 gene locus_tag LOCUS_28200 58421 58954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 59983 59126 gene locus_tag LOCUS_28210 59983 59126 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_28210 60141 61034 gene locus_tag LOCUS_28220 60141 61034 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_28220 63000 61231 gene locus_tag LOCUS_28230 63000 61231 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_28230 63072 63557 gene locus_tag LOCUS_28240 63072 63557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 63643 63837 gene locus_tag LOCUS_28250 63643 63837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 65037 64162 gene locus_tag LOCUS_28260 gene fabD 65037 64162 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_28260 65703 65260 gene locus_tag LOCUS_28270 gene yuxK 65703 65260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_28270 68495 65700 gene locus_tag LOCUS_28280 68495 65700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 68832 69461 gene locus_tag LOCUS_28290 68832 69461 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence28 1908 406 gene locus_tag LOCUS_28300 1908 406 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_28300 4884 1927 gene locus_tag LOCUS_28310 4884 1927 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_28310 7083 5572 gene locus_tag LOCUS_28320 7083 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 7499 7308 gene locus_tag LOCUS_28330 7499 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 8625 7627 gene locus_tag LOCUS_28340 8625 7627 CDS product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124069.1 protein_id gnl|my_center|LOCUS_28340 9808 8639 gene locus_tag LOCUS_28350 9808 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_28350 11837 9927 gene locus_tag LOCUS_28360 11837 9927 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108748.1 protein_id gnl|my_center|LOCUS_28360 13250 11895 gene locus_tag LOCUS_28370 13250 11895 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_28370 15165 13375 gene locus_tag LOCUS_28380 15165 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 16957 15317 gene locus_tag LOCUS_28390 16957 15317 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120369.1 protein_id gnl|my_center|LOCUS_28390 18893 17106 gene locus_tag LOCUS_28400 18893 17106 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_28400 19370 19203 gene locus_tag LOCUS_28410 19370 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 20289 19507 gene locus_tag LOCUS_28420 20289 19507 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_28420 21208 20360 gene locus_tag LOCUS_28430 gene hpaG 21208 20360 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_28430 21980 21213 gene locus_tag LOCUS_28440 21980 21213 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_28440 23584 21977 gene locus_tag LOCUS_28450 23584 21977 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_28450 23697 24737 gene locus_tag LOCUS_28460 23697 24737 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_28460 26105 25665 gene locus_tag LOCUS_28470 26105 25665 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_28470 29489 26313 gene locus_tag LOCUS_28480 29489 26313 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_28480 30207 29521 gene locus_tag LOCUS_28490 30207 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 32175 30724 gene locus_tag LOCUS_28500 32175 30724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 34980 32572 gene locus_tag LOCUS_28510 34980 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 39259 34988 gene locus_tag LOCUS_28520 39259 34988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 42117 39256 gene locus_tag LOCUS_28530 42117 39256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 42873 42118 gene locus_tag LOCUS_28540 42873 42118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 46481 42894 gene locus_tag LOCUS_28550 46481 42894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 46906 46493 gene locus_tag LOCUS_28560 46906 46493 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_28560 47211 46912 gene locus_tag LOCUS_28570 47211 46912 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_28570 49015 47219 gene locus_tag LOCUS_28580 49015 47219 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_28580 49681 49019 gene locus_tag LOCUS_28590 49681 49019 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_28590 49865 49683 gene locus_tag LOCUS_28600 49865 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 50324 49869 gene locus_tag LOCUS_28610 50324 49869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 50785 50330 gene locus_tag LOCUS_28620 50785 50330 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_28620 52409 50823 gene locus_tag LOCUS_28630 52409 50823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 53422 52439 gene locus_tag LOCUS_28640 53422 52439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 54094 53432 gene locus_tag LOCUS_28650 54094 53432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 54230 54535 gene locus_tag LOCUS_28660 54230 54535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 55888 54530 gene locus_tag LOCUS_28670 55888 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 57884 55974 gene locus_tag LOCUS_28680 57884 55974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 58219 59133 gene locus_tag LOCUS_28690 58219 59133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 59160 59543 gene locus_tag LOCUS_28700 59160 59543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 60350 60796 gene locus_tag LOCUS_28710 60350 60796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 62917 61007 gene locus_tag LOCUS_28720 62917 61007 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_28720 63946 62975 gene locus_tag LOCUS_28730 gene porP 63946 62975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence29 343 507 gene locus_tag LOCUS_28740 343 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 993 580 gene locus_tag LOCUS_28750 993 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1137 2270 gene locus_tag LOCUS_28760 1137 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2352 3455 gene locus_tag LOCUS_28770 2352 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3511 4191 gene locus_tag LOCUS_28780 3511 4191 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_28780 4278 5279 gene locus_tag LOCUS_28790 4278 5279 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_28790 5908 5315 gene locus_tag LOCUS_28800 5908 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 7678 5969 gene locus_tag LOCUS_28810 7678 5969 CDS product aminopeptidase family M28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250863.1 protein_id gnl|my_center|LOCUS_28810 8293 7730 gene locus_tag LOCUS_28820 8293 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 9073 10602 gene locus_tag LOCUS_28830 gene guaA 9073 10602 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_28830 10912 12561 gene locus_tag LOCUS_28840 10912 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 12565 13860 gene locus_tag LOCUS_28850 gene hemL 12565 13860 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAQ7 protein_id gnl|my_center|LOCUS_28850 14101 13886 gene locus_tag LOCUS_28860 14101 13886 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_28860 14726 14654 gene locus_tag LOCUS_t00150 14726 14654 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14852 14780 gene locus_tag LOCUS_t00160 14852 14780 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15043 16053 gene locus_tag LOCUS_28870 gene gapA 15043 16053 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_28870 17122 16061 gene locus_tag LOCUS_28880 17122 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 17847 17119 gene locus_tag LOCUS_28890 17847 17119 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_28890 18463 17840 gene locus_tag LOCUS_28900 18463 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 19169 18576 gene locus_tag LOCUS_28910 19169 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_28910 20223 19171 gene locus_tag LOCUS_28920 20223 19171 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_28920 20555 20223 gene locus_tag LOCUS_28930 20555 20223 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_28930 20738 21373 gene locus_tag LOCUS_28940 20738 21373 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_28940 21726 21442 gene locus_tag LOCUS_28950 21726 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524257.1 protein_id gnl|my_center|LOCUS_28950 23159 21771 gene locus_tag LOCUS_28960 23159 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 24511 23156 gene locus_tag LOCUS_28970 24511 23156 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_28970 26225 24516 gene locus_tag LOCUS_28980 26225 24516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_28980 26895 26218 gene locus_tag LOCUS_28990 26895 26218 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_28990 27674 29023 gene locus_tag LOCUS_29000 27674 29023 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_29000 29391 29017 gene locus_tag LOCUS_29010 29391 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_29010 29672 29466 gene locus_tag LOCUS_29020 29672 29466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 30192 29674 gene locus_tag LOCUS_29030 30192 29674 CDS product DUF4920 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403439.1 protein_id gnl|my_center|LOCUS_29030 30417 32309 gene locus_tag LOCUS_29040 30417 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 32826 32380 gene locus_tag LOCUS_29050 32826 32380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 33659 32823 gene locus_tag LOCUS_29060 33659 32823 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788692.1 protein_id gnl|my_center|LOCUS_29060 35077 33737 gene locus_tag LOCUS_29070 35077 33737 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_29070 35326 35985 gene locus_tag LOCUS_29080 35326 35985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_29080 36105 36716 gene locus_tag LOCUS_29090 36105 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 36709 38088 gene locus_tag LOCUS_29100 36709 38088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 38553 38209 gene locus_tag LOCUS_29110 38553 38209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 40282 38615 gene locus_tag LOCUS_29120 40282 38615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_29120 40899 40321 gene locus_tag LOCUS_29130 gene msrA 40899 40321 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_29130 41185 40940 gene locus_tag LOCUS_29140 41185 40940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 41737 41195 gene locus_tag LOCUS_29150 41737 41195 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_29150 41891 43822 gene locus_tag LOCUS_29160 41891 43822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 45015 43825 gene locus_tag LOCUS_29170 45015 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 46199 45015 gene locus_tag LOCUS_29180 46199 45015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 47710 46247 gene locus_tag LOCUS_29190 47710 46247 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_29190 49262 47703 gene locus_tag LOCUS_29200 49262 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 49628 49266 gene locus_tag LOCUS_29210 49628 49266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 49940 51637 gene locus_tag LOCUS_29220 49940 51637 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_29220 51642 53027 gene locus_tag LOCUS_29230 51642 53027 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_29230 53049 54350 gene locus_tag LOCUS_29240 53049 54350 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_29240 54436 55605 gene locus_tag LOCUS_29250 54436 55605 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_29250 55608 57713 gene locus_tag LOCUS_29260 55608 57713 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_29260 57953 58852 gene locus_tag LOCUS_29270 57953 58852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 58991 59296 gene locus_tag LOCUS_29280 58991 59296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 60591 59680 gene locus_tag LOCUS_29290 60591 59680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 60725 62317 gene locus_tag LOCUS_29300 60725 62317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 62897 62340 gene locus_tag LOCUS_29310 62897 62340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 63287 62991 gene locus_tag LOCUS_29320 63287 62991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence30 1934 1203 gene locus_tag LOCUS_29330 1934 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2706 2098 gene locus_tag LOCUS_29340 2706 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4430 2910 gene locus_tag LOCUS_29350 4430 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 5156 4437 gene locus_tag LOCUS_29360 5156 4437 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_29360 5408 9397 gene locus_tag LOCUS_29370 5408 9397 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_29370 10504 9449 gene locus_tag LOCUS_29380 gene rmlB 10504 9449 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_29380 11558 10506 gene locus_tag LOCUS_29390 11558 10506 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_29390 12876 11710 gene locus_tag LOCUS_29400 12876 11710 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_29400 13840 12965 gene locus_tag LOCUS_29410 13840 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 13988 13842 gene locus_tag LOCUS_29420 13988 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 14282 15082 gene locus_tag LOCUS_29430 gene proC 14282 15082 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_29430 16477 15368 gene locus_tag LOCUS_29440 16477 15368 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_29440 17941 16481 gene locus_tag LOCUS_29450 gene gatB 17941 16481 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_29450 20482 17963 gene locus_tag LOCUS_29460 gene alaS 20482 17963 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0M6 protein_id gnl|my_center|LOCUS_29460 21206 22315 gene locus_tag LOCUS_29470 21206 22315 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384114.1 protein_id gnl|my_center|LOCUS_29470 22467 23045 gene locus_tag LOCUS_29480 22467 23045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_29480 23260 23754 gene locus_tag LOCUS_29490 23260 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 23775 24773 gene locus_tag LOCUS_29500 23775 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 24811 25446 gene locus_tag LOCUS_29510 24811 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 25502 26551 gene locus_tag LOCUS_29520 25502 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 26729 27682 gene locus_tag LOCUS_29530 gene corA 26729 27682 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPI1 protein_id gnl|my_center|LOCUS_29530 28389 27802 gene locus_tag LOCUS_29540 28389 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 29024 30118 gene locus_tag LOCUS_29550 29024 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 30487 31347 gene locus_tag LOCUS_29560 gene hisG 30487 31347 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_29560 31388 32683 gene locus_tag LOCUS_29570 gene hisD 31388 32683 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_29570 32680 33747 gene locus_tag LOCUS_29580 gene hisC 32680 33747 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 protein_id gnl|my_center|LOCUS_29580 33751 34848 gene locus_tag LOCUS_29590 gene hisB 33751 34848 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_29590 34959 35759 gene locus_tag LOCUS_29600 34959 35759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 36634 35756 gene locus_tag LOCUS_29610 36634 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_29610 36734 37489 gene locus_tag LOCUS_29620 36734 37489 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_29620 38681 37464 gene locus_tag LOCUS_29630 38681 37464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_29630 38721 39908 gene locus_tag LOCUS_29640 38721 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_29640 39954 40880 gene locus_tag LOCUS_29650 gene fmt 39954 40880 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_29650 40979 41908 gene locus_tag LOCUS_29660 40979 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 41973 42482 gene locus_tag LOCUS_29670 gene dfrA 41973 42482 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_29670 42475 43260 gene locus_tag LOCUS_29680 42475 43260 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_29680 43265 44515 gene locus_tag LOCUS_29690 43265 44515 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_29690 44611 45906 gene locus_tag LOCUS_29700 gene bfmBB 44611 45906 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_29700 48759 45937 gene locus_tag LOCUS_29710 48759 45937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 49688 48795 gene locus_tag LOCUS_29720 49688 48795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 50066 49827 gene locus_tag LOCUS_29730 50066 49827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 50479 50066 gene locus_tag LOCUS_29740 50479 50066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 53930 50553 gene locus_tag LOCUS_29750 gene icmF 53930 50553 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_29750 54170 55462 gene locus_tag LOCUS_29760 54170 55462 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_29760 55535 56881 gene locus_tag LOCUS_29770 gene xylE 55535 56881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_29770 56871 57734 gene locus_tag LOCUS_29780 56871 57734 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_29780 58270 57851 gene locus_tag LOCUS_29790 58270 57851 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_29790 58758 58285 gene locus_tag LOCUS_29800 gene greA 58758 58285 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_29800 59845 58910 gene locus_tag LOCUS_29810 59845 58910 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_29810 61226 59859 gene locus_tag LOCUS_29820 gene mgtE 61226 59859 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_29820 61998 61213 gene locus_tag LOCUS_29830 gene rsmA 61998 61213 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_29830 62121 63143 gene locus_tag LOCUS_29840 gene pdxA 62121 63143 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_29840 >Feature sequence31 400 645 gene locus_tag LOCUS_29850 400 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 716 1825 gene locus_tag LOCUS_29860 716 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1825 2256 gene locus_tag LOCUS_29870 1825 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2305 2760 gene locus_tag LOCUS_29880 2305 2760 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_29880 2753 3712 gene locus_tag LOCUS_29890 2753 3712 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_29890 3709 4728 gene locus_tag LOCUS_29900 gene ltaE 3709 4728 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_29900 4823 6085 gene locus_tag LOCUS_29910 4823 6085 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_29910 6235 6684 gene locus_tag LOCUS_29920 6235 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6745 7749 gene locus_tag LOCUS_29930 6745 7749 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_29930 7765 8085 gene locus_tag LOCUS_29940 7765 8085 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_29940 8443 9072 gene locus_tag LOCUS_29950 8443 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 9279 10028 gene locus_tag LOCUS_29960 9279 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 10171 10554 gene locus_tag LOCUS_29970 10171 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 10739 12229 gene locus_tag LOCUS_29980 10739 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 12396 12746 gene locus_tag LOCUS_29990 12396 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 12859 13578 gene locus_tag LOCUS_30000 12859 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_30000 15482 13584 gene locus_tag LOCUS_30010 15482 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 16759 15503 gene locus_tag LOCUS_30020 16759 15503 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZK4 protein_id gnl|my_center|LOCUS_30020 18522 17122 gene locus_tag LOCUS_30030 gene uxaB 18522 17122 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_30030 19573 18548 gene locus_tag LOCUS_30040 19573 18548 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_30040 20409 19621 gene locus_tag LOCUS_30050 20409 19621 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_30050 21292 20453 gene locus_tag LOCUS_30060 gene kduI1 21292 20453 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S4 protein_id gnl|my_center|LOCUS_30060 21871 22518 gene locus_tag LOCUS_30070 21871 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 22538 22921 gene locus_tag LOCUS_30080 22538 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 23060 24073 gene locus_tag LOCUS_30090 gene dlgD 23060 24073 CDS product 2,3-diketo-L-gulonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37672 protein_id gnl|my_center|LOCUS_30090 24070 25110 gene locus_tag LOCUS_30100 24070 25110 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_30100 26753 25107 gene locus_tag LOCUS_30110 26753 25107 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_30110 27235 28086 gene locus_tag LOCUS_30120 27235 28086 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_30120 28174 28599 gene locus_tag LOCUS_30130 28174 28599 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602519.1 protein_id gnl|my_center|LOCUS_30130 28599 29894 gene locus_tag LOCUS_30140 28599 29894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_30140 30050 30388 gene locus_tag LOCUS_30150 30050 30388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 30346 30666 gene locus_tag LOCUS_30160 30346 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 32431 30800 gene locus_tag LOCUS_30170 32431 30800 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_30170 34268 33042 gene locus_tag LOCUS_30180 34268 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 35802 34405 gene locus_tag LOCUS_30190 35802 34405 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_30190 36578 35868 gene locus_tag LOCUS_30200 gene ftsE 36578 35868 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_30200 36784 36581 gene locus_tag LOCUS_30210 36784 36581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 37488 36829 gene locus_tag LOCUS_30220 gene tal 37488 36829 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_30220 38517 38287 gene locus_tag LOCUS_30230 38517 38287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 38762 40174 gene locus_tag LOCUS_30240 gene trpE 38762 40174 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_30240 40209 40520 gene locus_tag LOCUS_30250 40209 40520 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_30250 40665 41231 gene locus_tag LOCUS_30260 40665 41231 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803788.1 protein_id gnl|my_center|LOCUS_30260 41364 42374 gene locus_tag LOCUS_30270 gene trpD 41364 42374 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_30270 42381 43202 gene locus_tag LOCUS_30280 gene trpC 42381 43202 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_30280 43223 43870 gene locus_tag LOCUS_30290 gene trpF 43223 43870 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_30290 43880 45058 gene locus_tag LOCUS_30300 gene trpB 43880 45058 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_30300 45478 46251 gene locus_tag LOCUS_30310 gene trpA 45478 46251 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_30310 46342 47361 gene locus_tag LOCUS_30320 gene aroF1 46342 47361 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_30320 48032 47514 gene locus_tag LOCUS_30330 48032 47514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 48225 50171 gene locus_tag LOCUS_30340 48225 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 50168 50899 gene locus_tag LOCUS_30350 50168 50899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 52293 51088 gene locus_tag LOCUS_30360 52293 51088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 52969 52544 gene locus_tag LOCUS_30370 52969 52544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 53606 53238 gene locus_tag LOCUS_30380 53606 53238 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_30380 53889 53596 gene locus_tag LOCUS_30390 53889 53596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_30390 54542 54063 gene locus_tag LOCUS_30400 54542 54063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 54815 55267 gene locus_tag LOCUS_30410 54815 55267 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_30410 55880 55425 gene locus_tag LOCUS_30420 55880 55425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 57279 55873 gene locus_tag LOCUS_30430 gene fjo17 57279 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_30430 58699 57413 gene locus_tag LOCUS_30440 gene purD 58699 57413 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_30440 60891 58714 gene locus_tag LOCUS_30450 60891 58714 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_30450 60988 61956 gene locus_tag LOCUS_30460 gene kdsD 60988 61956 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_30460 61965 63035 gene locus_tag LOCUS_30470 61965 63035 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence32 76 267 gene locus_tag LOCUS_30480 76 267 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30480 2839 308 gene locus_tag LOCUS_30490 2839 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3200 4696 gene locus_tag LOCUS_30500 3200 4696 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_30500 4980 6119 gene locus_tag LOCUS_30510 4980 6119 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_30510 6538 6161 gene locus_tag LOCUS_30520 6538 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 7929 6535 gene locus_tag LOCUS_30530 7929 6535 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_30530 8196 9017 gene locus_tag LOCUS_30540 8196 9017 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_30540 9018 12893 gene locus_tag LOCUS_30550 9018 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 13037 13372 gene locus_tag LOCUS_30560 13037 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 13366 14667 gene locus_tag LOCUS_30570 13366 14667 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_30570 15825 14704 gene locus_tag LOCUS_30580 15825 14704 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_30580 16636 15929 gene locus_tag LOCUS_30590 16636 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_30590 17881 16784 gene locus_tag LOCUS_30600 17881 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 18235 21183 gene locus_tag LOCUS_30610 18235 21183 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_30610 22056 21250 gene locus_tag LOCUS_30620 22056 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 22808 22074 gene locus_tag LOCUS_30630 22808 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 24254 23298 gene locus_tag LOCUS_30640 gene hutG 24254 23298 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ59 protein_id gnl|my_center|LOCUS_30640 24515 25138 gene locus_tag LOCUS_30650 24515 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_30650 27116 25188 gene locus_tag LOCUS_30660 gene hutU 27116 25188 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_30660 28523 27291 gene locus_tag LOCUS_30670 gene hutI 28523 27291 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFG1 protein_id gnl|my_center|LOCUS_30670 30206 28641 gene locus_tag LOCUS_30680 gene hutH 30206 28641 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_30680 30306 31172 gene locus_tag LOCUS_30690 30306 31172 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_30690 31247 31762 gene locus_tag LOCUS_30700 gene vanZ 31247 31762 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_30700 31959 32789 gene locus_tag LOCUS_30710 31959 32789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 34452 32767 gene locus_tag LOCUS_30720 gene menD 34452 32767 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_30720 35666 34449 gene locus_tag LOCUS_30730 35666 34449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 36031 35666 gene locus_tag LOCUS_30740 36031 35666 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_30740 36141 36764 gene locus_tag LOCUS_30750 gene gpm 36141 36764 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_30750 37161 36748 gene locus_tag LOCUS_30760 37161 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 38063 37275 gene locus_tag LOCUS_30770 38063 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_30770 39167 38067 gene locus_tag LOCUS_30780 gene yqfO 39167 38067 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_30780 39207 40262 gene locus_tag LOCUS_30790 gene lpxK 39207 40262 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_30790 40263 42224 gene locus_tag LOCUS_30800 40263 42224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_30800 42224 42838 gene locus_tag LOCUS_30810 gene miaE 42224 42838 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_30810 42945 44189 gene locus_tag LOCUS_30820 42945 44189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_30820 44640 44308 gene locus_tag LOCUS_30830 44640 44308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 47029 45020 gene locus_tag LOCUS_30840 gene glgB 47029 45020 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L3 protein_id gnl|my_center|LOCUS_30840 48651 47332 gene locus_tag LOCUS_30850 48651 47332 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_30850 48884 51046 gene locus_tag LOCUS_30860 gene glnA 48884 51046 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_30860 51589 54654 gene locus_tag LOCUS_30870 51589 54654 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_30870 54656 56254 gene locus_tag LOCUS_30880 54656 56254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_30880 57879 56605 gene locus_tag LOCUS_30890 57879 56605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 61217 57930 gene locus_tag LOCUS_30900 61217 57930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence33 127 54 gene locus_tag LOCUS_t00170 127 54 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 347 273 gene locus_tag LOCUS_t00180 347 273 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 473 399 gene locus_tag LOCUS_t00190 473 399 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 586 513 gene locus_tag LOCUS_t00200 586 513 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 696 625 gene locus_tag LOCUS_t00210 696 625 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1167 1751 gene locus_tag LOCUS_30910 1167 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1818 4373 gene locus_tag LOCUS_30920 1818 4373 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_30920 5535 4531 gene locus_tag LOCUS_30930 gene gap-2 5535 4531 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP87 protein_id gnl|my_center|LOCUS_30930 5774 6646 gene locus_tag LOCUS_30940 5774 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 9072 6841 gene locus_tag LOCUS_30950 gene icd 9072 6841 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_30950 10220 9423 gene locus_tag LOCUS_30960 10220 9423 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_30960 10771 10217 gene locus_tag LOCUS_30970 gene def 10771 10217 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_30970 11181 10768 gene locus_tag LOCUS_30980 11181 10768 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_30980 11939 11181 gene locus_tag LOCUS_30990 11939 11181 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_30990 12015 13757 gene locus_tag LOCUS_31000 12015 13757 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_31000 13884 14330 gene locus_tag LOCUS_31010 13884 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 14995 14405 gene locus_tag LOCUS_31020 14995 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 16525 15140 gene locus_tag LOCUS_31030 16525 15140 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_31030 17501 16566 gene locus_tag LOCUS_31040 17501 16566 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_31040 18318 17473 gene locus_tag LOCUS_31050 18318 17473 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_31050 19244 18315 gene locus_tag LOCUS_31060 gene hemC 19244 18315 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ26 protein_id gnl|my_center|LOCUS_31060 20146 19241 gene locus_tag LOCUS_31070 gene rimK 20146 19241 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_31070 20644 20207 gene locus_tag LOCUS_31080 gene rimK2 20644 20207 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_31080 21782 20646 gene locus_tag LOCUS_31090 gene holB 21782 20646 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_31090 22990 21794 gene locus_tag LOCUS_31100 22990 21794 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_31100 23308 23060 gene locus_tag LOCUS_31110 gene rpmE2 23308 23060 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_31110 23593 25293 gene locus_tag LOCUS_31120 23593 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 25354 27186 gene locus_tag LOCUS_31130 25354 27186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_31130 27216 27584 gene locus_tag LOCUS_31140 27216 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 27648 29186 gene locus_tag LOCUS_31150 27648 29186 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_31150 29373 29888 gene locus_tag LOCUS_31160 29373 29888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 30990 29890 gene locus_tag LOCUS_31170 gene metB 30990 29890 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66876 protein_id gnl|my_center|LOCUS_31170 31148 31678 gene locus_tag LOCUS_31180 31148 31678 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_31180 31675 32358 gene locus_tag LOCUS_31190 31675 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 32387 33145 gene locus_tag LOCUS_31200 32387 33145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 33735 33307 gene locus_tag LOCUS_31210 33735 33307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_31210 33886 34644 gene locus_tag LOCUS_31220 gene truA 33886 34644 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_31220 34651 36423 gene locus_tag LOCUS_31230 34651 36423 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_31230 36567 37154 gene locus_tag LOCUS_31240 36567 37154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 37157 37672 gene locus_tag LOCUS_31250 37157 37672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 37753 38289 gene locus_tag LOCUS_31260 37753 38289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 38414 39436 gene locus_tag LOCUS_31270 gene hemE 38414 39436 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_31270 40366 39560 gene locus_tag LOCUS_31280 40366 39560 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_31280 40448 40630 gene locus_tag LOCUS_31290 40448 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 40805 42718 gene locus_tag LOCUS_31300 gene dnaK 40805 42718 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_31300 42840 43214 gene locus_tag LOCUS_31310 gene groES-2 42840 43214 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_31310 43581 43297 gene locus_tag LOCUS_31320 43581 43297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 45045 43876 gene locus_tag LOCUS_31330 45045 43876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 46437 45139 gene locus_tag LOCUS_31340 46437 45139 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_31340 47926 46958 gene locus_tag LOCUS_31350 gene hemB 47926 46958 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_31350 48583 47930 gene locus_tag LOCUS_31360 48583 47930 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228939.1 protein_id gnl|my_center|LOCUS_31360 49926 48691 gene locus_tag LOCUS_31370 gene rocD 49926 48691 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_31370 50262 50504 gene locus_tag LOCUS_31380 gene rpmB 50262 50504 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_31380 50535 50717 gene locus_tag LOCUS_31390 gene rpmG 50535 50717 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_31390 50755 50907 gene locus_tag LOCUS_31400 50755 50907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 50999 51955 gene locus_tag LOCUS_31410 gene ftsY 50999 51955 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_31410 52074 52925 gene locus_tag LOCUS_31420 52074 52925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_31420 52928 53416 gene locus_tag LOCUS_31430 52928 53416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 53420 53599 gene locus_tag LOCUS_31440 53420 53599 CDS product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_31440 53652 53996 gene locus_tag LOCUS_31450 53652 53996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 55500 54007 gene locus_tag LOCUS_31460 55500 54007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_31460 55683 56447 gene locus_tag LOCUS_31470 55683 56447 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_31470 57406 56444 gene locus_tag LOCUS_31480 57406 56444 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_31480 58368 57406 gene locus_tag LOCUS_31490 58368 57406 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_31490 58920 58372 gene locus_tag LOCUS_31500 58920 58372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 59440 58928 gene locus_tag LOCUS_31510 59440 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 60677 59433 gene locus_tag LOCUS_31520 gene pyrC2 60677 59433 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_31520 61030 60930 gene locus_tag LOCUS_r00010 61030 60930 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence34 1354 380 gene locus_tag LOCUS_31530 gene trpS 1354 380 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_31530 1425 2519 gene locus_tag LOCUS_31540 1425 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2642 6361 gene locus_tag LOCUS_31550 2642 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 6761 6426 gene locus_tag LOCUS_31560 6761 6426 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_31560 7053 6751 gene locus_tag LOCUS_31570 7053 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 8255 7161 gene locus_tag LOCUS_31580 8255 7161 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_31580 9443 8931 gene locus_tag LOCUS_31590 9443 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 10735 9530 gene locus_tag LOCUS_31600 gene gcdH 10735 9530 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_31600 10855 11814 gene locus_tag LOCUS_31610 10855 11814 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_31610 11954 12247 gene locus_tag LOCUS_31620 11954 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 14215 12662 gene locus_tag LOCUS_31630 14215 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 14499 15983 gene locus_tag LOCUS_31640 14499 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403050.1 protein_id gnl|my_center|LOCUS_31640 16156 17472 gene locus_tag LOCUS_31650 16156 17472 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_31650 17528 18241 gene locus_tag LOCUS_31660 17528 18241 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XU70 protein_id gnl|my_center|LOCUS_31660 18392 19771 gene locus_tag LOCUS_31670 18392 19771 CDS product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_31670 19959 20249 gene locus_tag LOCUS_31680 19959 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 20443 20871 gene locus_tag LOCUS_31690 20443 20871 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_31690 21671 21123 gene locus_tag LOCUS_31700 21671 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 21854 22324 gene locus_tag LOCUS_31710 21854 22324 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_31710 23032 22433 gene locus_tag LOCUS_31720 23032 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 23912 23139 gene locus_tag LOCUS_31730 23912 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 protein_id gnl|my_center|LOCUS_31730 25262 23913 gene locus_tag LOCUS_31740 25262 23913 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_31740 25802 25587 gene locus_tag LOCUS_31750 25802 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066206.1 protein_id gnl|my_center|LOCUS_31750 25972 26430 gene locus_tag LOCUS_31760 25972 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 26456 26923 gene locus_tag LOCUS_31770 26456 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 27257 27009 gene locus_tag LOCUS_31780 27257 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 29428 27536 gene locus_tag LOCUS_31790 gene kefB 29428 27536 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_31790 30000 29440 gene locus_tag LOCUS_31800 30000 29440 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_31800 30446 30012 gene locus_tag LOCUS_31810 30446 30012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 31102 30608 gene locus_tag LOCUS_31820 31102 30608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 31514 31170 gene locus_tag LOCUS_31830 31514 31170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 32924 31578 gene locus_tag LOCUS_31840 32924 31578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 34340 33066 gene locus_tag LOCUS_31850 gene ugt 34340 33066 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038941.1 protein_id gnl|my_center|LOCUS_31850 34663 35523 gene locus_tag LOCUS_31860 34663 35523 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y837 protein_id gnl|my_center|LOCUS_31860 36551 35529 gene locus_tag LOCUS_31870 36551 35529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 36872 36555 gene locus_tag LOCUS_31880 gene ydzA 36872 36555 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_31880 37447 36875 gene locus_tag LOCUS_31890 37447 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 39823 37547 gene locus_tag LOCUS_31900 39823 37547 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_31900 40478 39924 gene locus_tag LOCUS_31910 40478 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 41486 40485 gene locus_tag LOCUS_31920 41486 40485 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_31920 42710 41565 gene locus_tag LOCUS_31930 42710 41565 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_31930 42828 43712 gene locus_tag LOCUS_31940 42828 43712 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_31940 43843 45222 gene locus_tag LOCUS_31950 43843 45222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 47495 45285 gene locus_tag LOCUS_31960 47495 45285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 49626 47668 gene locus_tag LOCUS_31970 49626 47668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 51259 49805 gene locus_tag LOCUS_31980 51259 49805 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_31980 53573 51261 gene locus_tag LOCUS_31990 53573 51261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 55172 53823 gene locus_tag LOCUS_32000 gene accC 55172 53823 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_32000 55662 55198 gene locus_tag LOCUS_32010 gene accB 55662 55198 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_32010 56322 55759 gene locus_tag LOCUS_32020 gene efp 56322 55759 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_32020 57352 56354 gene locus_tag LOCUS_32030 gene fabH2 57352 56354 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A137 protein_id gnl|my_center|LOCUS_32030 57774 57583 gene locus_tag LOCUS_32040 gene rpmF 57774 57583 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_32040 <58413 57793 gene locus_tag LOCUS_32050 <58413 57793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964470.1:DNA-binding protein >Feature sequence35 2228 651 gene locus_tag LOCUS_32060 2228 651 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_32060 4220 2709 gene locus_tag LOCUS_32070 gene wbpM 4220 2709 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_32070 5319 4855 gene locus_tag LOCUS_32080 5319 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 6609 5470 gene locus_tag LOCUS_32090 6609 5470 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_32090 7885 6728 gene locus_tag LOCUS_32100 7885 6728 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_32100 9974 8328 gene locus_tag LOCUS_32110 9974 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 11065 9971 gene locus_tag LOCUS_32120 11065 9971 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_32120 12359 11145 gene locus_tag LOCUS_32130 12359 11145 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_32130 13942 12359 gene locus_tag LOCUS_32140 13942 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 16162 14039 gene locus_tag LOCUS_32150 16162 14039 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_32150 16942 16175 gene locus_tag LOCUS_32160 gene hisF2 16942 16175 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_32160 17559 16945 gene locus_tag LOCUS_32170 gene hisH2 17559 16945 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_32170 18692 17556 gene locus_tag LOCUS_32180 gene wbpG 18692 17556 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_32180 19856 18696 gene locus_tag LOCUS_32190 19856 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 20461 19853 gene locus_tag LOCUS_32200 gene capH 20461 19853 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216898.1 protein_id gnl|my_center|LOCUS_32200 21679 20570 gene locus_tag LOCUS_32210 gene epsG 21679 20570 CDS product transmembrane protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71056 protein_id gnl|my_center|LOCUS_32210 22716 21721 gene locus_tag LOCUS_32220 22716 21721 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765267.1 protein_id gnl|my_center|LOCUS_32220 23854 22709 gene locus_tag LOCUS_32230 23854 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_32230 25439 24096 gene locus_tag LOCUS_32240 25439 24096 CDS product coenzyme F420 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975144.1 protein_id gnl|my_center|LOCUS_32240 26890 25457 gene locus_tag LOCUS_32250 26890 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107283.1 protein_id gnl|my_center|LOCUS_32250 28351 27041 gene locus_tag LOCUS_32260 28351 27041 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_32260 29598 28459 gene locus_tag LOCUS_32270 gene gmd 29598 28459 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 protein_id gnl|my_center|LOCUS_32270 30423 29710 gene locus_tag LOCUS_32280 30423 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 30551 30709 gene locus_tag LOCUS_32290 30551 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 31743 30814 gene locus_tag LOCUS_32300 gene wcaG 31743 30814 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_32300 32826 31825 gene locus_tag LOCUS_32310 32826 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 36244 33797 gene locus_tag LOCUS_32320 gene wzc 36244 33797 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_32320 37107 36250 gene locus_tag LOCUS_32330 gene wza 37107 36250 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_32330 37920 37204 gene locus_tag LOCUS_32340 gene kdsB 37920 37204 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_32340 40435 37976 gene locus_tag LOCUS_32350 gene wzc 40435 37976 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_32350 41256 40441 gene locus_tag LOCUS_32360 41256 40441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 41649 42512 gene locus_tag LOCUS_32370 41649 42512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 42682 43059 gene locus_tag LOCUS_32380 gene ywdK 42682 43059 CDS product UPF0382 membrane protein YwdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39619 protein_id gnl|my_center|LOCUS_32380 43062 44354 gene locus_tag LOCUS_32390 gene dacB 43062 44354 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_32390 44568 45425 gene locus_tag LOCUS_32400 44568 45425 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_32400 45389 45925 gene locus_tag LOCUS_32410 45389 45925 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_32410 45915 46508 gene locus_tag LOCUS_32420 45915 46508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 46554 47459 gene locus_tag LOCUS_32430 46554 47459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 48053 47592 gene locus_tag LOCUS_32440 48053 47592 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_32440 48578 49564 gene locus_tag LOCUS_32450 gene ykfA 48578 49564 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_32450 49673 50404 gene locus_tag LOCUS_32460 49673 50404 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_32460 50456 51067 gene locus_tag LOCUS_32470 50456 51067 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_32470 51054 52928 gene locus_tag LOCUS_32480 51054 52928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 52953 53402 gene locus_tag LOCUS_32490 52953 53402 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_32490 53414 54265 gene locus_tag LOCUS_32500 gene tktA 53414 54265 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_32500 54303 55271 gene locus_tag LOCUS_32510 gene tktC 54303 55271 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_32510 55383 55919 gene locus_tag LOCUS_32520 55383 55919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 58077 55972 gene locus_tag LOCUS_32530 58077 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence36 985 443 gene locus_tag LOCUS_32540 985 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2193 1027 gene locus_tag LOCUS_32550 2193 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 2959 2489 gene locus_tag LOCUS_32560 2959 2489 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_32560 4323 3253 gene locus_tag LOCUS_32570 4323 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 5516 4788 gene locus_tag LOCUS_32580 5516 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 6360 5509 gene locus_tag LOCUS_32590 6360 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 7618 6386 gene locus_tag LOCUS_32600 7618 6386 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108379.1 protein_id gnl|my_center|LOCUS_32600 7895 7602 gene locus_tag LOCUS_32610 7895 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 8509 7892 gene locus_tag LOCUS_32620 8509 7892 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_32620 9496 8516 gene locus_tag LOCUS_32630 9496 8516 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291518.1 protein_id gnl|my_center|LOCUS_32630 10116 9493 gene locus_tag LOCUS_32640 10116 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 10759 10130 gene locus_tag LOCUS_32650 10759 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 11489 10800 gene locus_tag LOCUS_32660 11489 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 13927 11486 gene locus_tag LOCUS_32670 13927 11486 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_32670 14247 13933 gene locus_tag LOCUS_32680 14247 13933 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107105.1 protein_id gnl|my_center|LOCUS_32680 14780 14322 gene locus_tag LOCUS_32690 14780 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 15096 14794 gene locus_tag LOCUS_32700 15096 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800207.1 protein_id gnl|my_center|LOCUS_32700 15541 15131 gene locus_tag LOCUS_32710 15541 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 16419 15625 gene locus_tag LOCUS_32720 16419 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 18808 18077 gene locus_tag LOCUS_32730 18808 18077 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_32730 19447 19091 gene locus_tag LOCUS_32740 19447 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 21480 19516 gene locus_tag LOCUS_32750 21480 19516 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_32750 22709 21519 gene locus_tag LOCUS_32760 22709 21519 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_32760 27185 22815 gene locus_tag LOCUS_32770 27185 22815 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_32770 28624 28959 gene locus_tag LOCUS_32780 28624 28959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 31985 31257 gene locus_tag LOCUS_32790 31985 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 33793 33999 gene locus_tag LOCUS_32800 33793 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 34063 34494 gene locus_tag LOCUS_32810 34063 34494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 34943 35191 gene locus_tag LOCUS_32820 34943 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 36583 35225 gene locus_tag LOCUS_32830 36583 35225 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108738.1 protein_id gnl|my_center|LOCUS_32830 39776 36600 gene locus_tag LOCUS_32840 39776 36600 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_32840 41200 39842 gene locus_tag LOCUS_32850 41200 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 42507 43073 gene locus_tag LOCUS_32860 42507 43073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 43991 43206 gene locus_tag LOCUS_32870 43991 43206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 44404 43988 gene locus_tag LOCUS_32880 44404 43988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 44997 44401 gene locus_tag LOCUS_32890 44997 44401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 45128 46117 gene locus_tag LOCUS_32900 45128 46117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 46122 47165 gene locus_tag LOCUS_32910 46122 47165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 47167 47826 gene locus_tag LOCUS_32920 47167 47826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 49474 47864 gene locus_tag LOCUS_32930 49474 47864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 50653 49487 gene locus_tag LOCUS_32940 50653 49487 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YX7 protein_id gnl|my_center|LOCUS_32940 53171 50673 gene locus_tag LOCUS_32950 53171 50673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 53797 53174 gene locus_tag LOCUS_32960 53797 53174 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_32960 55064 54498 gene locus_tag LOCUS_32970 55064 54498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 56180 55278 gene locus_tag LOCUS_32980 56180 55278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence37 2113 860 gene locus_tag LOCUS_32990 gene rhlE 2113 860 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_32990 2836 3174 gene locus_tag LOCUS_33000 2836 3174 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_33000 4409 3204 gene locus_tag LOCUS_33010 4409 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_33010 5529 4540 gene locus_tag LOCUS_33020 5529 4540 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_33020 6724 5501 gene locus_tag LOCUS_33030 6724 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 7476 6721 gene locus_tag LOCUS_33040 7476 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 8293 7463 gene locus_tag LOCUS_33050 8293 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 9249 8269 gene locus_tag LOCUS_33060 9249 8269 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_33060 9458 10084 gene locus_tag LOCUS_33070 9458 10084 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_33070 11489 10137 gene locus_tag LOCUS_33080 11489 10137 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_33080 12468 11707 gene locus_tag LOCUS_33090 12468 11707 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_33090 13643 12852 gene locus_tag LOCUS_33100 13643 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33100 13881 13627 gene locus_tag LOCUS_33110 13881 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33110 16934 14562 gene locus_tag LOCUS_33120 16934 14562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_33120 17208 18143 gene locus_tag LOCUS_33130 17208 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 18140 18817 gene locus_tag LOCUS_33140 18140 18817 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_33140 19067 20560 gene locus_tag LOCUS_33150 19067 20560 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_33150 21726 20632 gene locus_tag LOCUS_33160 21726 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 22475 21993 gene locus_tag LOCUS_33170 22475 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 23803 22643 gene locus_tag LOCUS_33180 23803 22643 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_33180 28244 23919 gene locus_tag LOCUS_33190 28244 23919 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_33190 29698 28319 gene locus_tag LOCUS_33200 29698 28319 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_33200 30363 29695 gene locus_tag LOCUS_33210 30363 29695 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_33210 30834 31511 gene locus_tag LOCUS_33220 30834 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 33158 31890 gene locus_tag LOCUS_33230 33158 31890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_33230 33569 34189 gene locus_tag LOCUS_33240 33569 34189 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_33240 34395 35309 gene locus_tag LOCUS_33250 34395 35309 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763536.1 protein_id gnl|my_center|LOCUS_33250 35507 38974 gene locus_tag LOCUS_33260 35507 38974 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_33260 39004 40464 gene locus_tag LOCUS_33270 39004 40464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_33270 40501 40944 gene locus_tag LOCUS_33280 40501 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 41050 42174 gene locus_tag LOCUS_33290 gene hisC 41050 42174 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_33290 42190 43326 gene locus_tag LOCUS_33300 42190 43326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 43497 44270 gene locus_tag LOCUS_33310 43497 44270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 45278 44292 gene locus_tag LOCUS_33320 45278 44292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_33320 46869 45445 gene locus_tag LOCUS_33330 46869 45445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_33330 47132 48037 gene locus_tag LOCUS_33340 47132 48037 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_33340 48486 48286 gene locus_tag LOCUS_33350 48486 48286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33350 50689 48629 gene locus_tag LOCUS_33360 gene metG 50689 48629 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_33360 51417 50785 gene locus_tag LOCUS_33370 gene acrR 51417 50785 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866995.1 protein_id gnl|my_center|LOCUS_33370 51992 52276 gene locus_tag LOCUS_33380 51992 52276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44191 protein_id gnl|my_center|LOCUS_33380 52475 53443 gene locus_tag LOCUS_33390 52475 53443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 53605 56058 gene locus_tag LOCUS_33400 53605 56058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence38 4148 3477 gene locus_tag LOCUS_33410 4148 3477 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_33410 5289 4171 gene locus_tag LOCUS_33420 5289 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 5817 5614 gene locus_tag LOCUS_33430 5817 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 7695 7946 gene locus_tag LOCUS_33440 7695 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 9336 7984 gene locus_tag LOCUS_33450 9336 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 12554 9348 gene locus_tag LOCUS_33460 12554 9348 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_33460 14203 12551 gene locus_tag LOCUS_33470 14203 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 15198 15497 gene locus_tag LOCUS_33480 15198 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 17140 16019 gene locus_tag LOCUS_33490 17140 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 18088 19005 gene locus_tag LOCUS_33500 18088 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 19716 19252 gene locus_tag LOCUS_33510 19716 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 20444 19731 gene locus_tag LOCUS_33520 20444 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 21183 20563 gene locus_tag LOCUS_33530 21183 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 21671 21189 gene locus_tag LOCUS_33540 21671 21189 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_33540 22210 22383 gene locus_tag LOCUS_33550 22210 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 22540 22707 gene locus_tag LOCUS_33560 22540 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 23748 22765 gene locus_tag LOCUS_33570 23748 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_33570 25019 23889 gene locus_tag LOCUS_33580 25019 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 24921 25112 gene locus_tag LOCUS_33590 24921 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 25502 25203 gene locus_tag LOCUS_33600 25502 25203 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 protein_id gnl|my_center|LOCUS_33600 27252 25954 gene locus_tag LOCUS_33610 27252 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 28694 27609 gene locus_tag LOCUS_33620 28694 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 30374 28704 gene locus_tag LOCUS_33630 30374 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 31539 30367 gene locus_tag LOCUS_33640 31539 30367 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_33640 32069 31536 gene locus_tag LOCUS_33650 32069 31536 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ13 protein_id gnl|my_center|LOCUS_33650 32980 32081 gene locus_tag LOCUS_33660 32980 32081 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_33660 33884 32973 gene locus_tag LOCUS_33670 gene cps3A 33884 32973 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101315.1 protein_id gnl|my_center|LOCUS_33670 34698 33877 gene locus_tag LOCUS_33680 34698 33877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 35719 34748 gene locus_tag LOCUS_33690 35719 34748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 36454 35729 gene locus_tag LOCUS_33700 36454 35729 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202928.1 protein_id gnl|my_center|LOCUS_33700 36517 37407 gene locus_tag LOCUS_33710 36517 37407 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_33710 38027 37347 gene locus_tag LOCUS_33720 38027 37347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 38954 38028 gene locus_tag LOCUS_33730 38954 38028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 40044 38944 gene locus_tag LOCUS_33740 40044 38944 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_33740 41909 40071 gene locus_tag LOCUS_33750 gene asnB 41909 40071 CDS product asparagine synthetase [glutamine-hydrolyzing] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54420 protein_id gnl|my_center|LOCUS_33750 43039 41894 gene locus_tag LOCUS_33760 43039 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 44298 43036 gene locus_tag LOCUS_33770 gene rfbB 44298 43036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_33770 45172 44291 gene locus_tag LOCUS_33780 45172 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 45785 45177 gene locus_tag LOCUS_33790 45785 45177 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_33790 46867 45782 gene locus_tag LOCUS_33800 46867 45782 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202147.1 protein_id gnl|my_center|LOCUS_33800 47092 46877 gene locus_tag LOCUS_33810 47092 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 47990 47094 gene locus_tag LOCUS_33820 47990 47094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 48802 47990 gene locus_tag LOCUS_33830 48802 47990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 50954 49857 gene locus_tag LOCUS_33840 50954 49857 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104557.1 protein_id gnl|my_center|LOCUS_33840 51586 51179 gene locus_tag LOCUS_33850 51586 51179 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496939.1 protein_id gnl|my_center|LOCUS_33850 51858 51571 gene locus_tag LOCUS_33860 51858 51571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 52697 52176 gene locus_tag LOCUS_33870 gene cysC 52697 52176 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNZ3 protein_id gnl|my_center|LOCUS_33870 >Feature sequence39 1254 91 gene locus_tag LOCUS_33880 1254 91 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_33880 2023 1307 gene locus_tag LOCUS_33890 2023 1307 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_33890 2667 2098 gene locus_tag LOCUS_33900 2667 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 5767 3068 gene locus_tag LOCUS_33910 5767 3068 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_33910 6152 7078 gene locus_tag LOCUS_33920 6152 7078 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202793.1 protein_id gnl|my_center|LOCUS_33920 7106 7687 gene locus_tag LOCUS_33930 gene rplY 7106 7687 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_33930 7767 8327 gene locus_tag LOCUS_33940 gene pth 7767 8327 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_33940 8593 9765 gene locus_tag LOCUS_33950 gene metZ 8593 9765 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_33950 10293 9832 gene locus_tag LOCUS_33960 10293 9832 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326945.1 protein_id gnl|my_center|LOCUS_33960 11957 10413 gene locus_tag LOCUS_33970 11957 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 12697 11954 gene locus_tag LOCUS_33980 gene cutC 12697 11954 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCA5 protein_id gnl|my_center|LOCUS_33980 13740 12697 gene locus_tag LOCUS_33990 gene aspG 13740 12697 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_33990 13853 14614 gene locus_tag LOCUS_34000 13853 14614 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_34000 18139 14615 gene locus_tag LOCUS_34010 18139 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 20004 18280 gene locus_tag LOCUS_34020 20004 18280 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_34020 23344 20057 gene locus_tag LOCUS_34030 23344 20057 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_34030 25546 23819 gene locus_tag LOCUS_34040 25546 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 26906 25899 gene locus_tag LOCUS_34050 26906 25899 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_34050 27371 27036 gene locus_tag LOCUS_34060 27371 27036 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF21 protein_id gnl|my_center|LOCUS_34060 28774 27410 gene locus_tag LOCUS_34070 gene hisS 28774 27410 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_34070 29819 29310 gene locus_tag LOCUS_34080 29819 29310 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_34080 29889 30287 gene locus_tag LOCUS_34090 29889 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 30284 31654 gene locus_tag LOCUS_34100 30284 31654 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_34100 31738 32715 gene locus_tag LOCUS_34110 gene pdhB 31738 32715 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_34110 35602 33089 gene locus_tag LOCUS_34120 35602 33089 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_34120 36081 37010 gene locus_tag LOCUS_34130 36081 37010 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_34130 37158 37904 gene locus_tag LOCUS_34140 37158 37904 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_34140 38323 37910 gene locus_tag LOCUS_34150 38323 37910 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_34150 38568 38320 gene locus_tag LOCUS_34160 38568 38320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 40030 38885 gene locus_tag LOCUS_34170 40030 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 40315 40067 gene locus_tag LOCUS_34180 40315 40067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 41914 40529 gene locus_tag LOCUS_34190 gene ffh 41914 40529 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_34190 42035 44455 gene locus_tag LOCUS_34200 42035 44455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_34200 44509 45039 gene locus_tag LOCUS_34210 44509 45039 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLE7 protein_id gnl|my_center|LOCUS_34210 45123 45527 gene locus_tag LOCUS_34220 45123 45527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 46670 45531 gene locus_tag LOCUS_34230 46670 45531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_34230 47643 46690 gene locus_tag LOCUS_34240 47643 46690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 47990 47640 gene locus_tag LOCUS_34250 47990 47640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_34250 48229 49083 gene locus_tag LOCUS_34260 48229 49083 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_34260 49239 49445 gene locus_tag LOCUS_34270 49239 49445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_34270 49604 49996 gene locus_tag LOCUS_34280 49604 49996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 50015 50905 gene locus_tag LOCUS_34290 50015 50905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 51717 50956 gene locus_tag LOCUS_34300 51717 50956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 51895 52509 gene locus_tag LOCUS_34310 51895 52509 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF51 protein_id gnl|my_center|LOCUS_34310 53311 52535 gene locus_tag LOCUS_34320 53311 52535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence40 703 3015 gene locus_tag LOCUS_34330 gene ccoI 703 3015 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_34330 3201 5330 gene locus_tag LOCUS_34340 gene ccoN/ccoO 3201 5330 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_34340 5342 5527 gene locus_tag LOCUS_34350 5342 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 5524 6459 gene locus_tag LOCUS_34360 5524 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 6515 7927 gene locus_tag LOCUS_34370 gene ccoG 6515 7927 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_34370 7953 8378 gene locus_tag LOCUS_34380 7953 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 8379 9080 gene locus_tag LOCUS_34390 8379 9080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_34390 10435 9077 gene locus_tag LOCUS_34400 gene hemN 10435 9077 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_34400 11602 10559 gene locus_tag LOCUS_34410 11602 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_34410 12479 11583 gene locus_tag LOCUS_34420 12479 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 13350 12472 gene locus_tag LOCUS_34430 13350 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_34430 13550 13807 gene locus_tag LOCUS_34440 13550 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 13807 16194 gene locus_tag LOCUS_34450 gene mutS2 13807 16194 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_34450 16725 16249 gene locus_tag LOCUS_34460 16725 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 17405 16785 gene locus_tag LOCUS_34470 17405 16785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_34470 18187 17408 gene locus_tag LOCUS_34480 gene lpxA 18187 17408 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_34480 19578 18184 gene locus_tag LOCUS_34490 gene fabZ 19578 18184 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_34490 20640 19618 gene locus_tag LOCUS_34500 gene lpxD 20640 19618 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_34500 21698 20658 gene locus_tag LOCUS_34510 21698 20658 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_34510 21950 23506 gene locus_tag LOCUS_34520 gene porX 21950 23506 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_34520 23515 23946 gene locus_tag LOCUS_34530 23515 23946 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_34530 23936 25147 gene locus_tag LOCUS_34540 gene ald 23936 25147 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_34540 25622 25149 gene locus_tag LOCUS_34550 25622 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 25834 28104 gene locus_tag LOCUS_34560 gene moeY 25834 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909410.1 protein_id gnl|my_center|LOCUS_34560 28110 28796 gene locus_tag LOCUS_34570 28110 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 28793 30895 gene locus_tag LOCUS_34580 28793 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 30888 31973 gene locus_tag LOCUS_34590 30888 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 32064 32603 gene locus_tag LOCUS_34600 gene ppa 32064 32603 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_34600 33434 32979 gene locus_tag LOCUS_34610 33434 32979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 34026 33421 gene locus_tag LOCUS_34620 34026 33421 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_34620 34090 36018 gene locus_tag LOCUS_34630 34090 36018 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_34630 36772 36053 gene locus_tag LOCUS_34640 36772 36053 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023523.1 protein_id gnl|my_center|LOCUS_34640 37319 36780 gene locus_tag LOCUS_34650 37319 36780 CDS product DUF4924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_34650 37477 38649 gene locus_tag LOCUS_34660 37477 38649 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_34660 38878 38675 gene locus_tag LOCUS_34670 38878 38675 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_34670 39430 38882 gene locus_tag LOCUS_34680 39430 38882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 40079 39576 gene locus_tag LOCUS_34690 gene purN 40079 39576 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_34690 41601 40360 gene locus_tag LOCUS_34700 gene proA 41601 40360 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_34700 42676 41594 gene locus_tag LOCUS_34710 gene proB 42676 41594 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 protein_id gnl|my_center|LOCUS_34710 43003 43719 gene locus_tag LOCUS_34720 43003 43719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 44625 43753 gene locus_tag LOCUS_34730 44625 43753 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_34730 45783 44845 gene locus_tag LOCUS_34740 45783 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 46733 45780 gene locus_tag LOCUS_34750 46733 45780 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_34750 48602 47016 gene locus_tag LOCUS_34760 48602 47016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_34760 48979 50319 gene locus_tag LOCUS_34770 48979 50319 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_34770 50331 51341 gene locus_tag LOCUS_34780 50331 51341 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_34780 52133 51351 gene locus_tag LOCUS_34790 52133 51351 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence41 2242 4089 gene locus_tag LOCUS_34800 2242 4089 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_34800 4332 4156 gene locus_tag LOCUS_34810 4332 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5660 4434 gene locus_tag LOCUS_34820 5660 4434 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_34820 5864 7360 gene locus_tag LOCUS_34830 gene accC 5864 7360 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_34830 7362 8660 gene locus_tag LOCUS_34840 7362 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_34840 8641 9228 gene locus_tag LOCUS_34850 8641 9228 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_34850 10647 9334 gene locus_tag LOCUS_34860 10647 9334 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_34860 12018 10651 gene locus_tag LOCUS_34870 12018 10651 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_34870 12643 12008 gene locus_tag LOCUS_34880 gene sdhB 12643 12008 CDS product putative L-serine dehydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_270097.1 protein_id gnl|my_center|LOCUS_34880 12841 13665 gene locus_tag LOCUS_34890 12841 13665 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545575.1 protein_id gnl|my_center|LOCUS_34890 13784 15427 gene locus_tag LOCUS_34900 gene yidK 13784 15427 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_34900 15440 16942 gene locus_tag LOCUS_34910 15440 16942 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_34910 16984 18297 gene locus_tag LOCUS_34920 gene xylA 16984 18297 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_34920 18455 22552 gene locus_tag LOCUS_34930 18455 22552 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_34930 22661 23659 gene locus_tag LOCUS_34940 22661 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 24094 27252 gene locus_tag LOCUS_34950 24094 27252 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_34950 27271 28935 gene locus_tag LOCUS_34960 27271 28935 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_34960 28966 30231 gene locus_tag LOCUS_34970 28966 30231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 30544 33831 gene locus_tag LOCUS_34980 30544 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 33942 35627 gene locus_tag LOCUS_34990 gene egl2 33942 35627 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_34990 35815 37716 gene locus_tag LOCUS_35000 35815 37716 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_35000 38894 37827 gene locus_tag LOCUS_35010 38894 37827 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_35010 39498 38899 gene locus_tag LOCUS_35020 39498 38899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 39622 40194 gene locus_tag LOCUS_35030 39622 40194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 40789 46140 gene locus_tag LOCUS_35040 40789 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 47696 46146 gene locus_tag LOCUS_35050 gene rfaG 47696 46146 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 protein_id gnl|my_center|LOCUS_35050 48323 47784 gene locus_tag LOCUS_35060 48323 47784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence42 1163 729 gene locus_tag LOCUS_35070 1163 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_35070 2411 1230 gene locus_tag LOCUS_35080 2411 1230 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_35080 4181 2562 gene locus_tag LOCUS_35090 4181 2562 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_35090 4454 7450 gene locus_tag LOCUS_35100 4454 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 7860 7558 gene locus_tag LOCUS_35110 7860 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9076 7904 gene locus_tag LOCUS_35120 9076 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 9329 9102 gene locus_tag LOCUS_35130 9329 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 9937 10944 gene locus_tag LOCUS_35140 9937 10944 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_35140 11316 15662 gene locus_tag LOCUS_35150 11316 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 15866 15940 gene locus_tag LOCUS_t00220 15866 15940 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16091 16165 gene locus_tag LOCUS_t00230 16091 16165 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16309 17256 gene locus_tag LOCUS_35160 gene accA 16309 17256 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_35160 17308 18147 gene locus_tag LOCUS_35170 17308 18147 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_35170 18137 18940 gene locus_tag LOCUS_35180 18137 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_35180 18937 19497 gene locus_tag LOCUS_35190 18937 19497 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_35190 19644 20804 gene locus_tag LOCUS_35200 19644 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 21200 22735 gene locus_tag LOCUS_35210 21200 22735 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_35210 24086 22896 gene locus_tag LOCUS_35220 gene argD 24086 22896 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_35220 24997 24101 gene locus_tag LOCUS_35230 24997 24101 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_35230 25325 26143 gene locus_tag LOCUS_35240 25325 26143 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_35240 26140 27099 gene locus_tag LOCUS_35250 26140 27099 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_35250 27086 27475 gene locus_tag LOCUS_35260 27086 27475 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_35260 27642 29600 gene locus_tag LOCUS_35270 gene gyrB 27642 29600 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 protein_id gnl|my_center|LOCUS_35270 29710 31833 gene locus_tag LOCUS_35280 gene ppk 29710 31833 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 protein_id gnl|my_center|LOCUS_35280 32736 31849 gene locus_tag LOCUS_35290 gene ppx 32736 31849 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_35290 32991 32779 gene locus_tag LOCUS_35300 32991 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 34862 33081 gene locus_tag LOCUS_35310 34862 33081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_35310 35141 34866 gene locus_tag LOCUS_35320 35141 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 35190 36086 gene locus_tag LOCUS_35330 35190 36086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_35330 36317 38194 gene locus_tag LOCUS_35340 36317 38194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 38210 40315 gene locus_tag LOCUS_35350 38210 40315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 41140 40622 gene locus_tag LOCUS_35360 41140 40622 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_35360 41928 41266 gene locus_tag LOCUS_35370 gene pcm 41928 41266 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_35370 42040 42636 gene locus_tag LOCUS_35380 gene ribE 42040 42636 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_35380 43212 42697 gene locus_tag LOCUS_35390 43212 42697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 44328 43231 gene locus_tag LOCUS_35400 44328 43231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_35400 45411 44401 gene locus_tag LOCUS_35410 45411 44401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202753.1 protein_id gnl|my_center|LOCUS_35410 46130 45552 gene locus_tag LOCUS_35420 46130 45552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 46269 46751 gene locus_tag LOCUS_35430 46269 46751 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_35430 47761 46748 gene locus_tag LOCUS_35440 gene murB 47761 46748 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_35440 47980 48924 gene locus_tag LOCUS_35450 47980 48924 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_35450 48967 50112 gene locus_tag LOCUS_35460 48967 50112 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_35460 50116 51081 gene locus_tag LOCUS_35470 50116 51081 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence43 1212 367 gene locus_tag LOCUS_35480 1212 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_35480 1399 2319 gene locus_tag LOCUS_35490 1399 2319 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 protein_id gnl|my_center|LOCUS_35490 2326 3168 gene locus_tag LOCUS_35500 2326 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 3979 3251 gene locus_tag LOCUS_35510 3979 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 4307 5335 gene locus_tag LOCUS_35520 gene holA 4307 5335 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_35520 5561 8548 gene locus_tag LOCUS_35530 5561 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_35530 8552 10270 gene locus_tag LOCUS_35540 8552 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_35540 10339 11124 gene locus_tag LOCUS_35550 10339 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 11126 11812 gene locus_tag LOCUS_35560 11126 11812 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_35560 11817 12206 gene locus_tag LOCUS_35570 11817 12206 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_35570 12213 13169 gene locus_tag LOCUS_35580 12213 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 13173 14504 gene locus_tag LOCUS_35590 13173 14504 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_35590 14505 15164 gene locus_tag LOCUS_35600 gene trmB 14505 15164 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_35600 15358 16056 gene locus_tag LOCUS_35610 gene cobB 15358 16056 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MN7 protein_id gnl|my_center|LOCUS_35610 16106 17032 gene locus_tag LOCUS_35620 16106 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142485.1 protein_id gnl|my_center|LOCUS_35620 17141 18262 gene locus_tag LOCUS_35630 17141 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 18277 19611 gene locus_tag LOCUS_35640 gene ycgA 18277 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55908 protein_id gnl|my_center|LOCUS_35640 19731 20654 gene locus_tag LOCUS_35650 19731 20654 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_35650 20931 20701 gene locus_tag LOCUS_35660 20931 20701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 20972 21832 gene locus_tag LOCUS_35670 20972 21832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 22955 22164 gene locus_tag LOCUS_35680 22955 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 23715 23329 gene locus_tag LOCUS_35690 23715 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 25116 23887 gene locus_tag LOCUS_35700 gene mntH 25116 23887 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_35700 25213 26211 gene locus_tag LOCUS_35710 25213 26211 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_35710 26201 27445 gene locus_tag LOCUS_35720 26201 27445 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_35720 27860 29206 gene locus_tag LOCUS_35730 27860 29206 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_35730 29210 30655 gene locus_tag LOCUS_35740 29210 30655 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_35740 30893 31372 gene locus_tag LOCUS_35750 30893 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 32036 31437 gene locus_tag LOCUS_35760 32036 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 34353 32047 gene locus_tag LOCUS_35770 34353 32047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_35770 34575 35939 gene locus_tag LOCUS_35780 34575 35939 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_35780 36845 35946 gene locus_tag LOCUS_35790 36845 35946 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 protein_id gnl|my_center|LOCUS_35790 37065 37838 gene locus_tag LOCUS_35800 37065 37838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 38827 38360 gene locus_tag LOCUS_35810 38827 38360 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067265.1 protein_id gnl|my_center|LOCUS_35810 38983 41310 gene locus_tag LOCUS_35820 gene topA 38983 41310 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_35820 41365 42480 gene locus_tag LOCUS_35830 41365 42480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_35830 44872 42515 gene locus_tag LOCUS_35840 gene ladS 44872 42515 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_35840 45895 45017 gene locus_tag LOCUS_35850 45895 45017 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889403.1 protein_id gnl|my_center|LOCUS_35850 46714 45947 gene locus_tag LOCUS_35860 46714 45947 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762581.1 protein_id gnl|my_center|LOCUS_35860 46829 47809 gene locus_tag LOCUS_35870 gene mecR 46829 47809 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_35870 47883 48305 gene locus_tag LOCUS_35880 47883 48305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 48470 49723 gene locus_tag LOCUS_35890 gene fabF 48470 49723 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_35890 >Feature sequence44 42 607 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgtgatttccattggaaagatacattttgaaag 1718 585 gene locus_tag LOCUS_35900 1718 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2202 1783 gene locus_tag LOCUS_35910 2202 1783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_35910 2488 2799 gene locus_tag LOCUS_35920 2488 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2852 5236 gene locus_tag LOCUS_35930 2852 5236 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_35930 6554 5394 gene locus_tag LOCUS_35940 6554 5394 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_35940 8759 6585 gene locus_tag LOCUS_35950 8759 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 9155 10948 gene locus_tag LOCUS_35960 gene lepA 9155 10948 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_35960 11224 11586 gene locus_tag LOCUS_35970 11224 11586 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_35970 11647 12531 gene locus_tag LOCUS_35980 gene folD 11647 12531 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_35980 12613 12697 gene locus_tag LOCUS_t00240 12613 12697 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13016 13558 gene locus_tag LOCUS_35990 13016 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 13685 16126 gene locus_tag LOCUS_36000 13685 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 17529 16129 gene locus_tag LOCUS_36010 17529 16129 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_36010 18108 19955 gene locus_tag LOCUS_36020 gene purF 18108 19955 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_36020 20094 21146 gene locus_tag LOCUS_36030 20094 21146 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_36030 21178 22215 gene locus_tag LOCUS_36040 21178 22215 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_36040 22232 23137 gene locus_tag LOCUS_36050 22232 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_36050 23218 24021 gene locus_tag LOCUS_36060 23218 24021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_36060 25495 24392 gene locus_tag LOCUS_36070 25495 24392 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_36070 25635 26213 gene locus_tag LOCUS_36080 25635 26213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 27019 26369 gene locus_tag LOCUS_36090 27019 26369 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_36090 28654 27050 gene locus_tag LOCUS_36100 gene sulP 28654 27050 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_36100 29084 28764 gene locus_tag LOCUS_36110 29084 28764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 30359 29589 gene locus_tag LOCUS_36120 30359 29589 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709789.1 protein_id gnl|my_center|LOCUS_36120 31801 30356 gene locus_tag LOCUS_36130 31801 30356 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_36130 33177 31798 gene locus_tag LOCUS_36140 33177 31798 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_36140 34537 33161 gene locus_tag LOCUS_36150 gene panF 34537 33161 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937399.1 protein_id gnl|my_center|LOCUS_36150 37499 35202 gene locus_tag LOCUS_36160 37499 35202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_36160 39032 37956 gene locus_tag LOCUS_36170 39032 37956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 39852 38989 gene locus_tag LOCUS_36180 39852 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 40920 40291 gene locus_tag LOCUS_36190 40920 40291 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_36190 42627 41074 gene locus_tag LOCUS_36200 42627 41074 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_36200 43595 42726 gene locus_tag LOCUS_36210 gene yedI 43595 42726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922688.1 protein_id gnl|my_center|LOCUS_36210 43746 44702 gene locus_tag LOCUS_36220 43746 44702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence45 592 1980 gene locus_tag LOCUS_36230 592 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 2136 2807 gene locus_tag LOCUS_36240 2136 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 2807 3793 gene locus_tag LOCUS_36250 2807 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3976 5139 gene locus_tag LOCUS_36260 3976 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 6591 5296 gene locus_tag LOCUS_36270 6591 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 8355 6955 gene locus_tag LOCUS_36280 8355 6955 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_36280 9958 8441 gene locus_tag LOCUS_36290 9958 8441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_36290 13366 9965 gene locus_tag LOCUS_36300 13366 9965 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_36300 14528 13518 gene locus_tag LOCUS_36310 14528 13518 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_36310 15372 14719 gene locus_tag LOCUS_36320 15372 14719 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_36320 16252 18549 gene locus_tag LOCUS_36330 16252 18549 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_36330 18720 18965 gene locus_tag LOCUS_36340 18720 18965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 19128 19790 gene locus_tag LOCUS_36350 19128 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 protein_id gnl|my_center|LOCUS_36350 20147 19872 gene locus_tag LOCUS_36360 20147 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 20603 20250 gene locus_tag LOCUS_36370 20603 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 21233 20907 gene locus_tag LOCUS_36380 21233 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 21909 22433 gene locus_tag LOCUS_36390 21909 22433 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_36390 22498 23316 gene locus_tag LOCUS_36400 22498 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 23362 23532 gene locus_tag LOCUS_36410 23362 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 23641 23877 gene locus_tag LOCUS_36420 23641 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 23977 25374 gene locus_tag LOCUS_36430 23977 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 25952 25497 gene locus_tag LOCUS_36440 25952 25497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 26472 26771 gene locus_tag LOCUS_36450 26472 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091022.1 protein_id gnl|my_center|LOCUS_36450 27984 26839 gene locus_tag LOCUS_36460 27984 26839 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_36460 28358 27984 gene locus_tag LOCUS_36470 28358 27984 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_36470 28965 28360 gene locus_tag LOCUS_36480 28965 28360 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RB0 protein_id gnl|my_center|LOCUS_36480 29697 28966 gene locus_tag LOCUS_36490 29697 28966 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_36490 30613 29690 gene locus_tag LOCUS_36500 30613 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 31782 30607 gene locus_tag LOCUS_36510 31782 30607 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964355.1 protein_id gnl|my_center|LOCUS_36510 32033 31779 gene locus_tag LOCUS_36520 32033 31779 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_36520 32616 32035 gene locus_tag LOCUS_36530 32616 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_36530 33738 32620 gene locus_tag LOCUS_36540 33738 32620 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_36540 34148 33723 gene locus_tag LOCUS_36550 34148 33723 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_36550 34779 34348 gene locus_tag LOCUS_36560 34779 34348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 35651 34776 gene locus_tag LOCUS_36570 35651 34776 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_36570 35899 35651 gene locus_tag LOCUS_36580 gene acpP 35899 35651 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1W5 protein_id gnl|my_center|LOCUS_36580 37110 35896 gene locus_tag LOCUS_36590 gene fabB 37110 35896 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_36590 37838 37107 gene locus_tag LOCUS_36600 37838 37107 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_36600 39384 37840 gene locus_tag LOCUS_36610 gene hutH2 39384 37840 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_36610 39670 43347 gene locus_tag LOCUS_36620 39670 43347 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_36620 43681 43427 gene locus_tag LOCUS_36630 43681 43427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 44638 44075 gene locus_tag LOCUS_36640 44638 44075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence46 176 1378 gene locus_tag LOCUS_36650 176 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1351 2124 gene locus_tag LOCUS_36660 1351 2124 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_36660 2993 2139 gene locus_tag LOCUS_36670 2993 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 4973 3384 gene locus_tag LOCUS_36680 4973 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_36680 8274 4996 gene locus_tag LOCUS_36690 8274 4996 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 protein_id gnl|my_center|LOCUS_36690 11234 8973 gene locus_tag LOCUS_36700 gene acn 11234 8973 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_36700 11621 13396 gene locus_tag LOCUS_36710 11621 13396 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_36710 14400 13393 gene locus_tag LOCUS_36720 14400 13393 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_36720 14540 14887 gene locus_tag LOCUS_36730 gene fdx1 14540 14887 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_36730 15012 15386 gene locus_tag LOCUS_36740 15012 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 15476 16561 gene locus_tag LOCUS_36750 15476 16561 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_36750 16569 17666 gene locus_tag LOCUS_36760 gene ychF 16569 17666 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_36760 17764 18660 gene locus_tag LOCUS_36770 17764 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 19178 18777 gene locus_tag LOCUS_36780 19178 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 20395 19292 gene locus_tag LOCUS_36790 gene paaE 20395 19292 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_36790 20615 21958 gene locus_tag LOCUS_36800 20615 21958 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_36800 23350 22412 gene locus_tag LOCUS_36810 23350 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_36810 24219 23356 gene locus_tag LOCUS_36820 24219 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_36820 24330 24752 gene locus_tag LOCUS_36830 24330 24752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 27087 24802 gene locus_tag LOCUS_36840 27087 24802 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088959.1 protein_id gnl|my_center|LOCUS_36840 27572 27114 gene locus_tag LOCUS_36850 27572 27114 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_36850 28906 27617 gene locus_tag LOCUS_36860 28906 27617 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_36860 29166 29240 gene locus_tag LOCUS_t00250 29166 29240 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 31276 29738 gene locus_tag LOCUS_36870 31276 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_36870 32308 31340 gene locus_tag LOCUS_36880 32308 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 32473 33324 gene locus_tag LOCUS_36890 32473 33324 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257513.1 protein_id gnl|my_center|LOCUS_36890 34542 33331 gene locus_tag LOCUS_36900 34542 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 36265 34547 gene locus_tag LOCUS_36910 36265 34547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 37269 36262 gene locus_tag LOCUS_36920 37269 36262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 37805 37266 gene locus_tag LOCUS_36930 37805 37266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 38629 39327 gene locus_tag LOCUS_36940 38629 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118034.1 protein_id gnl|my_center|LOCUS_36940 39511 40200 gene locus_tag LOCUS_36950 39511 40200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 40268 40873 gene locus_tag LOCUS_36960 40268 40873 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence47 735 920 gene locus_tag LOCUS_36970 735 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 1578 976 gene locus_tag LOCUS_36980 1578 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2261 2569 gene locus_tag LOCUS_36990 2261 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 5209 4502 gene locus_tag LOCUS_37000 5209 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 6955 5213 gene locus_tag LOCUS_37010 6955 5213 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_37010 8350 7016 gene locus_tag LOCUS_37020 8350 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 9043 8354 gene locus_tag LOCUS_37030 9043 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764129.1 protein_id gnl|my_center|LOCUS_37030 11027 9054 gene locus_tag LOCUS_37040 11027 9054 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_37040 14139 11050 gene locus_tag LOCUS_37050 14139 11050 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108996.1 protein_id gnl|my_center|LOCUS_37050 14956 17400 gene locus_tag LOCUS_37060 14956 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764126.1 protein_id gnl|my_center|LOCUS_37060 17614 17823 gene locus_tag LOCUS_37070 17614 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 18779 18486 gene locus_tag LOCUS_37080 18779 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 19420 22590 gene locus_tag LOCUS_37090 19420 22590 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_37090 22838 24019 gene locus_tag LOCUS_37100 22838 24019 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963799.1 protein_id gnl|my_center|LOCUS_37100 24698 24111 gene locus_tag LOCUS_37110 24698 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 26993 25443 gene locus_tag LOCUS_37120 26993 25443 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_37120 28507 27053 gene locus_tag LOCUS_37130 gene fucA 28507 27053 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120626.1 protein_id gnl|my_center|LOCUS_37130 30331 28787 gene locus_tag LOCUS_37140 30331 28787 CDS product sialic-acid O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124072.1 protein_id gnl|my_center|LOCUS_37140 32136 30457 gene locus_tag LOCUS_37150 32136 30457 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_37150 33776 32172 gene locus_tag LOCUS_37160 33776 32172 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123733.1 protein_id gnl|my_center|LOCUS_37160 35503 33989 gene locus_tag LOCUS_37170 35503 33989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_37170 38547 35521 gene locus_tag LOCUS_37180 38547 35521 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_37180 <40647 38911 gene locus_tag LOCUS_37190 <40647 38911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122060.1:cytochrome c >Feature sequence48 1 195 gene locus_tag LOCUS_37200 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 1599 421 gene locus_tag LOCUS_37210 1599 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1760 2191 gene locus_tag LOCUS_37220 1760 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 2599 2192 gene locus_tag LOCUS_37230 2599 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 3817 2717 gene locus_tag LOCUS_37240 gene msrA 3817 2717 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_37240 4013 4603 gene locus_tag LOCUS_37250 4013 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 5270 4614 gene locus_tag LOCUS_37260 5270 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5567 6682 gene locus_tag LOCUS_37270 5567 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_37270 7803 7042 gene locus_tag LOCUS_37280 7803 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_37280 8533 7808 gene locus_tag LOCUS_37290 8533 7808 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_37290 9696 8533 gene locus_tag LOCUS_37300 9696 8533 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_37300 11344 10505 gene locus_tag LOCUS_37310 11344 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 12348 11344 gene locus_tag LOCUS_37320 12348 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 12745 12431 gene locus_tag LOCUS_37330 12745 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_37330 12996 12724 gene locus_tag LOCUS_37340 12996 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 15995 13221 gene locus_tag LOCUS_37350 gene leuS 15995 13221 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_37350 16225 16857 gene locus_tag LOCUS_37360 gene queE 16225 16857 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_37360 16862 18784 gene locus_tag LOCUS_37370 16862 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 19319 22375 gene locus_tag LOCUS_37380 19319 22375 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_37380 22386 23969 gene locus_tag LOCUS_37390 22386 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 protein_id gnl|my_center|LOCUS_37390 23992 24837 gene locus_tag LOCUS_37400 23992 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 24995 25414 gene locus_tag LOCUS_37410 24995 25414 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_37410 25531 25914 gene locus_tag LOCUS_37420 25531 25914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 26087 27094 gene locus_tag LOCUS_37430 gene lpxB 26087 27094 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_37430 27159 27608 gene locus_tag LOCUS_37440 27159 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 28907 27681 gene locus_tag LOCUS_37450 gene clpX 28907 27681 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_37450 29581 28907 gene locus_tag LOCUS_37460 gene clpP 29581 28907 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_37460 30982 29657 gene locus_tag LOCUS_37470 30982 29657 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_37470 31156 31074 gene locus_tag LOCUS_t00260 31156 31074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31314 33530 gene locus_tag LOCUS_37480 gene relA 31314 33530 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_37480 33585 34073 gene locus_tag LOCUS_37490 33585 34073 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_37490 34078 34425 gene locus_tag LOCUS_37500 34078 34425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 34572 35843 gene locus_tag LOCUS_37510 gene purA 34572 35843 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_37510 35945 38281 gene locus_tag LOCUS_37520 35945 38281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 38278 39300 gene locus_tag LOCUS_37530 38278 39300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence49 1319 132 gene locus_tag LOCUS_37540 gene tuf 1319 132 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_37540 1454 1382 gene locus_tag LOCUS_t00270 1454 1382 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1575 1502 gene locus_tag LOCUS_t00280 1575 1502 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1822 1739 gene locus_tag LOCUS_t00290 1822 1739 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4522 1973 gene locus_tag LOCUS_37550 4522 1973 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_37550 4670 5164 gene locus_tag LOCUS_37560 gene pycA 4670 5164 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_37560 5351 6064 gene locus_tag LOCUS_37570 gene pyrH 5351 6064 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_37570 6071 6631 gene locus_tag LOCUS_37580 gene frr 6071 6631 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_37580 9342 6685 gene locus_tag LOCUS_37590 9342 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 9830 12814 gene locus_tag LOCUS_37600 9830 12814 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_37600 12834 14321 gene locus_tag LOCUS_37610 12834 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_37610 14678 15202 gene locus_tag LOCUS_37620 14678 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 15199 18498 gene locus_tag LOCUS_37630 15199 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 18596 21772 gene locus_tag LOCUS_37640 18596 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 21896 23236 gene locus_tag LOCUS_37650 21896 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 23412 25586 gene locus_tag LOCUS_37660 23412 25586 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_37660 26711 25818 gene locus_tag LOCUS_37670 26711 25818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 28928 27147 gene locus_tag LOCUS_37680 28928 27147 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_37680 30314 29175 gene locus_tag LOCUS_37690 30314 29175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 30617 30387 gene locus_tag LOCUS_37700 30617 30387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 31368 30802 gene locus_tag LOCUS_37710 gene nadD 31368 30802 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_37710 32044 31472 gene locus_tag LOCUS_37720 gene gmk 32044 31472 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_37720 32319 32047 gene locus_tag LOCUS_37730 32319 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 32941 32336 gene locus_tag LOCUS_37740 32941 32336 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_37740 33066 33905 gene locus_tag LOCUS_37750 33066 33905 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_37750 34064 34900 gene locus_tag LOCUS_37760 34064 34900 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_37760 35116 37383 gene locus_tag LOCUS_37770 gene uvrD 35116 37383 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_37770 >Feature sequence50 200 622 gene locus_tag LOCUS_37780 200 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1970 807 gene locus_tag LOCUS_37790 1970 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4350 2020 gene locus_tag LOCUS_37800 4350 2020 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_37800 6237 4762 gene locus_tag LOCUS_37810 6237 4762 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_37810 7158 6451 gene locus_tag LOCUS_37820 gene truC 7158 6451 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_37820 8558 7344 gene locus_tag LOCUS_37830 gene mnmA 8558 7344 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_37830 9800 8661 gene locus_tag LOCUS_37840 9800 8661 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921455.1 protein_id gnl|my_center|LOCUS_37840 10773 10099 gene locus_tag LOCUS_37850 10773 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_37850 11023 14370 gene locus_tag LOCUS_37860 11023 14370 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_37860 14411 16951 gene locus_tag LOCUS_37870 14411 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_37870 17067 17948 gene locus_tag LOCUS_37880 17067 17948 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_37880 18007 20385 gene locus_tag LOCUS_37890 18007 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 23910 20353 gene locus_tag LOCUS_37900 23910 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 24842 23994 gene locus_tag LOCUS_37910 24842 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 24941 26086 gene locus_tag LOCUS_37920 24941 26086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 26518 26165 gene locus_tag LOCUS_37930 26518 26165 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_37930 27425 26574 gene locus_tag LOCUS_37940 gene uspA 27425 26574 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_37940 28407 27487 gene locus_tag LOCUS_37950 gene menA 28407 27487 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_37950 29035 28427 gene locus_tag LOCUS_37960 gene bsaA 29035 28427 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_37960 30928 29138 gene locus_tag LOCUS_37970 gene argS 30928 29138 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_37970 31217 31047 gene locus_tag LOCUS_37980 31217 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 31385 31224 gene locus_tag LOCUS_37990 31385 31224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 32415 31465 gene locus_tag LOCUS_38000 gene rocF 32415 31465 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_38000 32742 33890 gene locus_tag LOCUS_38010 32742 33890 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_38010 33972 34448 gene locus_tag LOCUS_38020 33972 34448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 34579 35964 gene locus_tag LOCUS_38030 gene speA 34579 35964 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_38030 >Feature sequence51 1753 755 gene locus_tag LOCUS_38040 1753 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3282 1813 gene locus_tag LOCUS_38050 3282 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_38050 6638 3294 gene locus_tag LOCUS_38060 6638 3294 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_38060 7706 8749 gene locus_tag LOCUS_38070 7706 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 9105 9578 gene locus_tag LOCUS_38080 9105 9578 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_38080 9575 11794 gene locus_tag LOCUS_38090 9575 11794 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_38090 12690 12001 gene locus_tag LOCUS_38100 12690 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 13054 12677 gene locus_tag LOCUS_38110 13054 12677 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_38110 13880 13056 gene locus_tag LOCUS_38120 13880 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 14734 13877 gene locus_tag LOCUS_38130 14734 13877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_38130 14835 15368 gene locus_tag LOCUS_38140 14835 15368 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_38140 16504 15686 gene locus_tag LOCUS_38150 16504 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 17230 16529 gene locus_tag LOCUS_38160 17230 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 17562 18173 gene locus_tag LOCUS_38170 17562 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 18432 18220 gene locus_tag LOCUS_38180 18432 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 18538 19350 gene locus_tag LOCUS_38190 18538 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 19454 20638 gene locus_tag LOCUS_38200 19454 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 20857 23520 gene locus_tag LOCUS_38210 20857 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 26363 24105 gene locus_tag LOCUS_38220 26363 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 27108 26356 gene locus_tag LOCUS_38230 27108 26356 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_38230 29540 27129 gene locus_tag LOCUS_38240 29540 27129 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_38240 29988 29527 gene locus_tag LOCUS_38250 29988 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 31337 30048 gene locus_tag LOCUS_38260 31337 30048 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_38260 32008 31334 gene locus_tag LOCUS_38270 32008 31334 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence52 1786 179 gene locus_tag LOCUS_38280 1786 179 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_38280 3429 1876 gene locus_tag LOCUS_38290 3429 1876 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_38290 6154 3566 gene locus_tag LOCUS_38300 6154 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 7954 6314 gene locus_tag LOCUS_38310 7954 6314 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_38310 11358 7972 gene locus_tag LOCUS_38320 11358 7972 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_38320 12561 11515 gene locus_tag LOCUS_38330 12561 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 13201 12566 gene locus_tag LOCUS_38340 13201 12566 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_38340 15050 13539 gene locus_tag LOCUS_38350 15050 13539 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_38350 15940 15233 gene locus_tag LOCUS_38360 15940 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 17686 15944 gene locus_tag LOCUS_38370 17686 15944 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_38370 18166 18915 gene locus_tag LOCUS_38380 18166 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 18994 21456 gene locus_tag LOCUS_38390 18994 21456 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405046.1 protein_id gnl|my_center|LOCUS_38390 21529 21909 gene locus_tag LOCUS_38400 21529 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 22149 22223 gene locus_tag LOCUS_t00300 22149 22223 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22513 23742 gene locus_tag LOCUS_38410 22513 23742 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_38410 23828 24121 gene locus_tag LOCUS_38420 23828 24121 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_38420 24111 24359 gene locus_tag LOCUS_38430 24111 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 25839 25492 gene locus_tag LOCUS_38440 25839 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 26348 25971 gene locus_tag LOCUS_38450 26348 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_38450 26613 26341 gene locus_tag LOCUS_38460 26613 26341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_38460 27494 26754 gene locus_tag LOCUS_38470 27494 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 28041 27664 gene locus_tag LOCUS_38480 28041 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 28076 29287 gene locus_tag LOCUS_38490 28076 29287 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932135.1 protein_id gnl|my_center|LOCUS_38490 30280 29711 gene locus_tag LOCUS_38500 30280 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence53 500 1996 gene locus_tag LOCUS_38510 500 1996 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_38510 3223 2213 gene locus_tag LOCUS_38520 3223 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 3342 8894 gene locus_tag LOCUS_38530 3342 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 8896 9648 gene locus_tag LOCUS_38540 8896 9648 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNJ8 protein_id gnl|my_center|LOCUS_38540 9837 13253 gene locus_tag LOCUS_38550 9837 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 13404 16115 gene locus_tag LOCUS_38560 13404 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 16230 17459 gene locus_tag LOCUS_38570 16230 17459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946347.1 protein_id gnl|my_center|LOCUS_38570 17728 17534 gene locus_tag LOCUS_38580 17728 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 17966 17892 gene locus_tag LOCUS_t00310 17966 17892 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18148 18903 gene locus_tag LOCUS_38590 18148 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 19498 18950 gene locus_tag LOCUS_38600 19498 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 21024 19570 gene locus_tag LOCUS_38610 gene rpoN 21024 19570 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_38610 21202 22653 gene locus_tag LOCUS_38620 gene asnS 21202 22653 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_38620 23956 22769 gene locus_tag LOCUS_38630 23956 22769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_38630 25488 24019 gene locus_tag LOCUS_38640 25488 24019 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XD8 protein_id gnl|my_center|LOCUS_38640 26804 25491 gene locus_tag LOCUS_38650 26804 25491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_38650 27328 26864 gene locus_tag LOCUS_38660 27328 26864 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_38660 27965 27330 gene locus_tag LOCUS_38670 27965 27330 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_38670 28296 27967 gene locus_tag LOCUS_38680 28296 27967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 29154 28348 gene locus_tag LOCUS_38690 29154 28348 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_38690 >Feature sequence54 160 1569 gene locus_tag LOCUS_38700 gene arsA 160 1569 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_38700 2419 1616 gene locus_tag LOCUS_38710 2419 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2782 3690 gene locus_tag LOCUS_38720 2782 3690 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108591.1 protein_id gnl|my_center|LOCUS_38720 3742 5631 gene locus_tag LOCUS_38730 3742 5631 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_38730 6606 5803 gene locus_tag LOCUS_38740 6606 5803 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962923.1 protein_id gnl|my_center|LOCUS_38740 7257 6676 gene locus_tag LOCUS_38750 7257 6676 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_38750 7970 7389 gene locus_tag LOCUS_38760 7970 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_38760 9350 8052 gene locus_tag LOCUS_38770 9350 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 10342 9662 gene locus_tag LOCUS_38780 10342 9662 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_38780 11859 10339 gene locus_tag LOCUS_38790 11859 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 12010 12804 gene locus_tag LOCUS_38800 12010 12804 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_38800 12825 15506 gene locus_tag LOCUS_38810 12825 15506 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_38810 15531 15725 gene locus_tag LOCUS_38820 15531 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 16258 15680 gene locus_tag LOCUS_38830 gene yceI 16258 15680 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_38830 16909 16451 gene locus_tag LOCUS_38840 16909 16451 CDS product glcG protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920042.1 protein_id gnl|my_center|LOCUS_38840 17031 18131 gene locus_tag LOCUS_38850 gene gfo 17031 18131 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_38850 18378 18557 gene locus_tag LOCUS_38860 18378 18557 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_38860 19861 18665 gene locus_tag LOCUS_38870 19861 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 21099 19861 gene locus_tag LOCUS_38880 21099 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 23652 21331 gene locus_tag LOCUS_38890 23652 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 24823 23657 gene locus_tag LOCUS_38900 24823 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 25849 25271 gene locus_tag LOCUS_38910 25849 25271 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_38910 26757 25846 gene locus_tag LOCUS_38920 gene hemF 26757 25846 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_38920 29152 26777 gene locus_tag LOCUS_38930 29152 26777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence55 936 202 gene locus_tag LOCUS_38940 936 202 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_38940 1370 942 gene locus_tag LOCUS_38950 1370 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2448 1396 gene locus_tag LOCUS_38960 2448 1396 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_38960 3650 2481 gene locus_tag LOCUS_38970 3650 2481 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_38970 3904 5121 gene locus_tag LOCUS_38980 gene yegT 3904 5121 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_38980 5138 6016 gene locus_tag LOCUS_38990 5138 6016 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_38990 6045 7724 gene locus_tag LOCUS_39000 6045 7724 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_39000 7742 8302 gene locus_tag LOCUS_39010 7742 8302 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_39010 8396 9223 gene locus_tag LOCUS_39020 8396 9223 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_39020 9866 9225 gene locus_tag LOCUS_39030 9866 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 10253 9996 gene locus_tag LOCUS_39040 10253 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39040 10792 10199 gene locus_tag LOCUS_39050 10792 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 10838 11056 gene locus_tag LOCUS_39060 10838 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 11183 12346 gene locus_tag LOCUS_39070 11183 12346 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_39070 14170 12536 gene locus_tag LOCUS_39080 gene pafA 14170 12536 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_39080 14327 15883 gene locus_tag LOCUS_39090 14327 15883 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 protein_id gnl|my_center|LOCUS_39090 15991 16377 gene locus_tag LOCUS_39100 15991 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_39100 17058 16477 gene locus_tag LOCUS_39110 17058 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 17237 17620 gene locus_tag LOCUS_39120 17237 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 17627 18322 gene locus_tag LOCUS_39130 17627 18322 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_39130 18405 20042 gene locus_tag LOCUS_39140 gene pruA 18405 20042 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_39140 20931 20362 gene locus_tag LOCUS_39150 20931 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 21420 22610 gene locus_tag LOCUS_39160 21420 22610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 23690 22626 gene locus_tag LOCUS_39170 23690 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 24692 23946 gene locus_tag LOCUS_39180 24692 23946 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_39180 24987 26384 gene locus_tag LOCUS_39190 gene lpdA2 24987 26384 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_39190 26475 27008 gene locus_tag LOCUS_39200 26475 27008 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_39200 27008 27832 gene locus_tag LOCUS_39210 27008 27832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 28638 28066 gene locus_tag LOCUS_39220 28638 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39220 <29172 28651 gene locus_tag LOCUS_39230 <29172 28651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939300.1:ISL3 family transposase note possible pseudo, internal stop codon >Feature sequence56 567 1226 gene locus_tag LOCUS_39240 567 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 1276 1935 gene locus_tag LOCUS_39250 gene hisH 1276 1935 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_39250 2113 2829 gene locus_tag LOCUS_39260 gene hisA 2113 2829 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_39260 3059 3814 gene locus_tag LOCUS_39270 gene hisF 3059 3814 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_39270 3983 4582 gene locus_tag LOCUS_39280 gene hisIE 3983 4582 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_39280 4935 6536 gene locus_tag LOCUS_39290 4935 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 6533 7399 gene locus_tag LOCUS_39300 6533 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 7448 8899 gene locus_tag LOCUS_39310 7448 8899 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_39310 8912 10564 gene locus_tag LOCUS_39320 8912 10564 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_39320 12031 10712 gene locus_tag LOCUS_39330 12031 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 12479 12087 gene locus_tag LOCUS_39340 12479 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 12647 13633 gene locus_tag LOCUS_39350 12647 13633 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706684.1 protein_id gnl|my_center|LOCUS_39350 15502 13697 gene locus_tag LOCUS_39360 15502 13697 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_39360 16148 15711 gene locus_tag LOCUS_39370 16148 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 16409 16155 gene locus_tag LOCUS_39380 16409 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 17020 16406 gene locus_tag LOCUS_39390 17020 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 17679 17017 gene locus_tag LOCUS_39400 17679 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 18046 17699 gene locus_tag LOCUS_39410 18046 17699 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_39410 18275 19189 gene locus_tag LOCUS_39420 gene glsA 18275 19189 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I387 protein_id gnl|my_center|LOCUS_39420 19836 19381 gene locus_tag LOCUS_39430 19836 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 21079 21450 gene locus_tag LOCUS_39440 21079 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 21511 22308 gene locus_tag LOCUS_39450 21511 22308 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_39450 22311 23063 gene locus_tag LOCUS_39460 22311 23063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_39460 23060 24037 gene locus_tag LOCUS_39470 23060 24037 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_39470 25102 24044 gene locus_tag LOCUS_39480 25102 24044 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_39480 25259 28036 gene locus_tag LOCUS_39490 gene acoA 25259 28036 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMF6 protein_id gnl|my_center|LOCUS_39490 >Feature sequence57 479 889 gene locus_tag LOCUS_39500 479 889 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_39500 930 1364 gene locus_tag LOCUS_39510 930 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1381 1728 gene locus_tag LOCUS_39520 1381 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 1709 2410 gene locus_tag LOCUS_39530 1709 2410 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_39530 3088 2510 gene locus_tag LOCUS_39540 3088 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3167 3649 gene locus_tag LOCUS_39550 3167 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4897 3749 gene locus_tag LOCUS_39560 4897 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 5074 8079 gene locus_tag LOCUS_39570 5074 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 8151 9035 gene locus_tag LOCUS_39580 8151 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 9032 9766 gene locus_tag LOCUS_39590 gene bla 9032 9766 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_39590 9908 10630 gene locus_tag LOCUS_39600 gene fabG 9908 10630 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_39600 10691 11647 gene locus_tag LOCUS_39610 10691 11647 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_39610 12234 13193 gene locus_tag LOCUS_39620 12234 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 14424 13312 gene locus_tag LOCUS_39630 gene xynA 14424 13312 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_39630 14723 15910 gene locus_tag LOCUS_39640 14723 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 15910 17001 gene locus_tag LOCUS_39650 15910 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 17812 17216 gene locus_tag LOCUS_39660 17812 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_39660 18953 17871 gene locus_tag LOCUS_39670 18953 17871 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_39670 19395 18955 gene locus_tag LOCUS_39680 19395 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 20828 19392 gene locus_tag LOCUS_39690 gene putP 20828 19392 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_39690 22223 21120 gene locus_tag LOCUS_39700 22223 21120 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_39700 22470 22258 gene locus_tag LOCUS_39710 22470 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 23059 22463 gene locus_tag LOCUS_39720 23059 22463 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_39720 23530 23162 gene locus_tag LOCUS_39730 23530 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 24283 23741 gene locus_tag LOCUS_39740 24283 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 24876 24424 gene locus_tag LOCUS_39750 24876 24424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 25338 24895 gene locus_tag LOCUS_39760 25338 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 26296 25547 gene locus_tag LOCUS_39770 gene sdhB 26296 25547 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_39770 28258 26324 gene locus_tag LOCUS_39780 gene sdhA 28258 26324 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_39780 >Feature sequence58 1893 163 gene locus_tag LOCUS_39790 1893 163 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_39790 2081 4870 gene locus_tag LOCUS_39800 2081 4870 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A065 protein_id gnl|my_center|LOCUS_39800 5949 4906 gene locus_tag LOCUS_39810 5949 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_39810 6905 5949 gene locus_tag LOCUS_39820 6905 5949 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_39820 7992 6970 gene locus_tag LOCUS_39830 7992 6970 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 protein_id gnl|my_center|LOCUS_39830 9200 8106 gene locus_tag LOCUS_39840 gene hppD 9200 8106 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_39840 10277 9276 gene locus_tag LOCUS_39850 10277 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 11215 10313 gene locus_tag LOCUS_39860 11215 10313 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_39860 11926 11216 gene locus_tag LOCUS_39870 gene satE 11926 11216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262283.1 protein_id gnl|my_center|LOCUS_39870 12567 11926 gene locus_tag LOCUS_39880 12567 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 12867 14237 gene locus_tag LOCUS_39890 12867 14237 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_39890 14242 15117 gene locus_tag LOCUS_39900 14242 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 15240 16268 gene locus_tag LOCUS_39910 15240 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 16617 17264 gene locus_tag LOCUS_39920 16617 17264 CDS product NADH-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_39920 17775 17326 gene locus_tag LOCUS_39930 17775 17326 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_39930 18283 17798 gene locus_tag LOCUS_39940 gene msrA 18283 17798 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTB6 protein_id gnl|my_center|LOCUS_39940 19187 18309 gene locus_tag LOCUS_39950 gene lacX1 19187 18309 CDS product protein lacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027019.1 protein_id gnl|my_center|LOCUS_39950 20492 19263 gene locus_tag LOCUS_39960 20492 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_39960 20854 21741 gene locus_tag LOCUS_39970 20854 21741 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_39970 22167 22991 gene locus_tag LOCUS_39980 22167 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 22996 23397 gene locus_tag LOCUS_39990 22996 23397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 24027 23413 gene locus_tag LOCUS_40000 24027 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_40000 27181 24488 gene locus_tag LOCUS_40010 27181 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 27451 27729 gene locus_tag LOCUS_40020 27451 27729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence59 386 826 gene locus_tag LOCUS_40030 386 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 1058 2047 gene locus_tag LOCUS_40040 1058 2047 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_40040 2054 3646 gene locus_tag LOCUS_40050 gene lig2 2054 3646 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_40050 3643 6075 gene locus_tag LOCUS_40060 3643 6075 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_40060 6093 6734 gene locus_tag LOCUS_40070 6093 6734 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122833.1 protein_id gnl|my_center|LOCUS_40070 6881 9136 gene locus_tag LOCUS_40080 6881 9136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 protein_id gnl|my_center|LOCUS_40080 9476 10666 gene locus_tag LOCUS_40090 9476 10666 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_40090 10834 11727 gene locus_tag LOCUS_40100 10834 11727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969191.1 protein_id gnl|my_center|LOCUS_40100 12708 11797 gene locus_tag LOCUS_40110 12708 11797 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_40110 12769 13431 gene locus_tag LOCUS_40120 gene mda66 12769 13431 CDS product NADPH quinone reductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 protein_id gnl|my_center|LOCUS_40120 13428 13715 gene locus_tag LOCUS_40130 13428 13715 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705536.1 protein_id gnl|my_center|LOCUS_40130 14002 13793 gene locus_tag LOCUS_40140 14002 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 14592 14131 gene locus_tag LOCUS_40150 14592 14131 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_40150 15990 14860 gene locus_tag LOCUS_40160 15990 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 16427 15987 gene locus_tag LOCUS_40170 16427 15987 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_40170 16703 17080 gene locus_tag LOCUS_40180 16703 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_40180 17549 18067 gene locus_tag LOCUS_40190 17549 18067 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_40190 18242 19318 gene locus_tag LOCUS_40200 18242 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 19492 22851 gene locus_tag LOCUS_40210 19492 22851 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201911.1 protein_id gnl|my_center|LOCUS_40210 22865 24691 gene locus_tag LOCUS_40220 22865 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813804.1 protein_id gnl|my_center|LOCUS_40220 24685 25776 gene locus_tag LOCUS_40230 24685 25776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 >Feature sequence60 786 604 gene locus_tag LOCUS_40240 786 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 840 1559 gene locus_tag LOCUS_40250 840 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_40250 2324 2566 gene locus_tag LOCUS_40260 2324 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3673 3834 gene locus_tag LOCUS_40270 3673 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 3834 4439 gene locus_tag LOCUS_40280 3834 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4823 4581 gene locus_tag LOCUS_40290 4823 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5062 5706 gene locus_tag LOCUS_40300 5062 5706 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_40300 5814 6827 gene locus_tag LOCUS_40310 5814 6827 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_40310 6974 10516 gene locus_tag LOCUS_40320 6974 10516 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_40320 10528 12294 gene locus_tag LOCUS_40330 10528 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_40330 12371 13213 gene locus_tag LOCUS_40340 12371 13213 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_40340 13708 15321 gene locus_tag LOCUS_40350 13708 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 15964 16653 gene locus_tag LOCUS_40360 15964 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 17941 17366 gene locus_tag LOCUS_40370 17941 17366 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_40370 18156 19208 gene locus_tag LOCUS_40380 18156 19208 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_40380 19346 22858 gene locus_tag LOCUS_40390 19346 22858 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_40390 22869 24629 gene locus_tag LOCUS_40400 22869 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 >Feature sequence61 507 1721 gene locus_tag LOCUS_40410 507 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_40410 2282 3457 gene locus_tag LOCUS_40420 2282 3457 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_40420 3532 4659 gene locus_tag LOCUS_40430 gene irpA 3532 4659 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_40430 5693 6022 gene locus_tag LOCUS_40440 5693 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 6057 8423 gene locus_tag LOCUS_40450 gene fecA 6057 8423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_40450 9148 8873 gene locus_tag LOCUS_40460 9148 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 10355 9753 gene locus_tag LOCUS_40470 10355 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 10458 10664 gene locus_tag LOCUS_40480 10458 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 10747 11127 gene locus_tag LOCUS_40490 10747 11127 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_40490 11272 12534 gene locus_tag LOCUS_40500 gene hpaIIM 11272 12534 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1V6 protein_id gnl|my_center|LOCUS_40500 12534 13409 gene locus_tag LOCUS_40510 12534 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 13419 14495 gene locus_tag LOCUS_40520 gene hpaIIR 13419 14495 CDS product type II restriction endonuclease HpaII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 protein_id gnl|my_center|LOCUS_40520 14498 16744 gene locus_tag LOCUS_40530 14498 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 16745 17131 gene locus_tag LOCUS_40540 16745 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 17896 17186 gene locus_tag LOCUS_40550 17896 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 18882 18061 gene locus_tag LOCUS_40560 18882 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_40560 22655 19116 gene locus_tag LOCUS_40570 gene smc 22655 19116 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_40570 >Feature sequence62 491 123 gene locus_tag LOCUS_40580 491 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 1812 655 gene locus_tag LOCUS_40590 1812 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 3692 1815 gene locus_tag LOCUS_40600 3692 1815 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_40600 4389 3715 gene locus_tag LOCUS_40610 4389 3715 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958576.1 protein_id gnl|my_center|LOCUS_40610 5343 4393 gene locus_tag LOCUS_40620 5343 4393 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_40620 5511 6323 gene locus_tag LOCUS_40630 5511 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 6502 13596 gene locus_tag LOCUS_40640 6502 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 13802 14599 gene locus_tag LOCUS_40650 13802 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 15061 15528 gene locus_tag LOCUS_40660 15061 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 15556 16134 gene locus_tag LOCUS_40670 15556 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 16131 16973 gene locus_tag LOCUS_40680 16131 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 16960 19410 gene locus_tag LOCUS_40690 16960 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence63 58 1371 gene locus_tag LOCUS_40700 gene der 58 1371 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_40700 1448 1642 gene locus_tag LOCUS_40710 1448 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 1708 2331 gene locus_tag LOCUS_40720 1708 2331 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_40720 2802 2332 gene locus_tag LOCUS_40730 2802 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 3279 2896 gene locus_tag LOCUS_40740 gene dksA 3279 2896 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_40740 3844 3674 gene locus_tag LOCUS_40750 3844 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 6442 3914 gene locus_tag LOCUS_40760 6442 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 6611 7600 gene locus_tag LOCUS_40770 gene asd 6611 7600 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_40770 7600 8793 gene locus_tag LOCUS_40780 7600 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_40780 9095 8853 gene locus_tag LOCUS_40790 9095 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 9521 9168 gene locus_tag LOCUS_40800 9521 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 9751 9521 gene locus_tag LOCUS_40810 9751 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_40810 9977 9795 gene locus_tag LOCUS_40820 9977 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 12900 10081 gene locus_tag LOCUS_40830 gene carB 12900 10081 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_40830 13182 14177 gene locus_tag LOCUS_40840 13182 14177 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_40840 14186 14848 gene locus_tag LOCUS_40850 14186 14848 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_40850 15422 14916 gene locus_tag LOCUS_40860 15422 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 16618 15524 gene locus_tag LOCUS_40870 16618 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 16969 16745 gene locus_tag LOCUS_40880 16969 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence64 164 1009 gene locus_tag LOCUS_40890 164 1009 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_40890 1098 2252 gene locus_tag LOCUS_40900 1098 2252 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_40900 3447 2227 gene locus_tag LOCUS_40910 3447 2227 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_40910 3509 4153 gene locus_tag LOCUS_40920 3509 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4187 5266 gene locus_tag LOCUS_40930 gene idh 4187 5266 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_40930 5327 6085 gene locus_tag LOCUS_40940 5327 6085 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_40940 6247 7107 gene locus_tag LOCUS_40950 6247 7107 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_40950 7104 7952 gene locus_tag LOCUS_40960 7104 7952 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_40960 8563 9327 gene locus_tag LOCUS_40970 8563 9327 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_40970 9336 10643 gene locus_tag LOCUS_40980 gene fucP 9336 10643 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_40980 10745 11086 gene locus_tag LOCUS_40990 10745 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 11096 12013 gene locus_tag LOCUS_41000 11096 12013 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_41000 12187 12663 gene locus_tag LOCUS_41010 12187 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41010 12699 12878 gene locus_tag LOCUS_41020 12699 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41020 13443 12970 gene locus_tag LOCUS_41030 13443 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 15476 13731 gene locus_tag LOCUS_41040 gene ygaD 15476 13731 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_41040 15665 17038 gene locus_tag LOCUS_41050 15665 17038 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence65 136 807 gene locus_tag LOCUS_41060 136 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_41060 807 2114 gene locus_tag LOCUS_41070 gene murA 807 2114 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_41070 2478 4121 gene locus_tag LOCUS_41080 gene ilvD5 2478 4121 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_41080 4124 4885 gene locus_tag LOCUS_41090 4124 4885 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_41090 4878 5552 gene locus_tag LOCUS_41100 4878 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888523.1 protein_id gnl|my_center|LOCUS_41100 5862 6425 gene locus_tag LOCUS_41110 5862 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 6532 7413 gene locus_tag LOCUS_41120 6532 7413 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I615 protein_id gnl|my_center|LOCUS_41120 7567 8013 gene locus_tag LOCUS_41130 7567 8013 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_41130 8022 10451 gene locus_tag LOCUS_41140 8022 10451 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA41 protein_id gnl|my_center|LOCUS_41140 10541 12061 gene locus_tag LOCUS_41150 10541 12061 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_41150 12141 12899 gene locus_tag LOCUS_41160 12141 12899 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_41160 14609 13293 gene locus_tag LOCUS_41170 14609 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706109.1 protein_id gnl|my_center|LOCUS_41170 16325 14820 gene locus_tag LOCUS_41180 16325 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence66 2067 1393 gene locus_tag LOCUS_41190 gene folE2 2067 1393 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_41190 2467 2057 gene locus_tag LOCUS_41200 gene ygcM 2467 2057 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_41200 2693 2514 gene locus_tag LOCUS_41210 2693 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 2759 3451 gene locus_tag LOCUS_41220 2759 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_41220 5086 3431 gene locus_tag LOCUS_41230 5086 3431 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_41230 6987 5347 gene locus_tag LOCUS_41240 6987 5347 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_41240 7827 6997 gene locus_tag LOCUS_41250 gene kdsA 7827 6997 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX5 protein_id gnl|my_center|LOCUS_41250 8419 7835 gene locus_tag LOCUS_41260 gene kdsC 8419 7835 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_41260 9942 8401 gene locus_tag LOCUS_41270 9942 8401 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_41270 10109 11011 gene locus_tag LOCUS_41280 10109 11011 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_41280 11064 11987 gene locus_tag LOCUS_41290 11064 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 12813 11989 gene locus_tag LOCUS_41300 gene uspA 12813 11989 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_41300 13376 12915 gene locus_tag LOCUS_41310 13376 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 13451 13960 gene locus_tag LOCUS_41320 13451 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_41320 14137 14745 gene locus_tag LOCUS_41330 14137 14745 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_41330 15762 15049 gene locus_tag LOCUS_41340 15762 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence67 1239 118 gene locus_tag LOCUS_41350 1239 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 1817 1341 gene locus_tag LOCUS_41360 1817 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2205 1897 gene locus_tag LOCUS_41370 2205 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2736 2248 gene locus_tag LOCUS_41380 2736 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 3388 2786 gene locus_tag LOCUS_41390 gene engB 3388 2786 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_41390 3513 4235 gene locus_tag LOCUS_41400 gene menG 3513 4235 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_41400 4289 5005 gene locus_tag LOCUS_41410 4289 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 5297 5055 gene locus_tag LOCUS_41420 5297 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 5554 6318 gene locus_tag LOCUS_41430 5554 6318 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_41430 6315 7061 gene locus_tag LOCUS_41440 6315 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 7128 7865 gene locus_tag LOCUS_41450 7128 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 7984 8565 gene locus_tag LOCUS_41460 7984 8565 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_41460 8576 9649 gene locus_tag LOCUS_41470 8576 9649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_41470 9854 10681 gene locus_tag LOCUS_41480 9854 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 11589 10678 gene locus_tag LOCUS_41490 gene fjo11 11589 10678 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_41490 12628 11753 gene locus_tag LOCUS_41500 12628 11753 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_41500 >Feature sequence68 2365 191 gene locus_tag LOCUS_41510 2365 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 2674 3606 gene locus_tag LOCUS_41520 2674 3606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117796.1 protein_id gnl|my_center|LOCUS_41520 3818 4837 gene locus_tag LOCUS_41530 3818 4837 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_41530 4842 5657 gene locus_tag LOCUS_41540 4842 5657 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_41540 5960 6301 gene locus_tag LOCUS_41550 5960 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_41550 6448 6939 gene locus_tag LOCUS_41560 6448 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018094.1 protein_id gnl|my_center|LOCUS_41560 7047 8084 gene locus_tag LOCUS_41570 7047 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 10873 8111 gene locus_tag LOCUS_41580 10873 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 >Feature sequence69 261 1532 gene locus_tag LOCUS_41590 261 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 1519 2973 gene locus_tag LOCUS_41600 1519 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4296 2977 gene locus_tag LOCUS_41610 4296 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 4997 4737 gene locus_tag LOCUS_41620 4997 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 5114 5040 gene locus_tag LOCUS_t00320 5114 5040 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5492 5887 gene locus_tag LOCUS_41630 5492 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_41630 5960 7750 gene locus_tag LOCUS_41640 5960 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 7811 8086 gene locus_tag LOCUS_41650 gene rpsO 7811 8086 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_41650 8185 10305 gene locus_tag LOCUS_41660 gene pnp 8185 10305 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_41660 >Feature sequence70 857 1261 gene locus_tag LOCUS_41670 857 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 1306 2181 gene locus_tag LOCUS_41680 1306 2181 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_41680 3315 4847 gene locus_tag LOCUS_41690 3315 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5477 6412 gene locus_tag LOCUS_41700 5477 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 7246 6878 gene locus_tag LOCUS_41710 7246 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 7459 7965 gene locus_tag LOCUS_41720 7459 7965 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_41720 8185 9099 gene locus_tag LOCUS_41730 gene ykcC 8185 9099 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_41730 9426 10085 gene locus_tag LOCUS_41740 9426 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence71 131 634 gene locus_tag LOCUS_41750 131 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 774 1211 gene locus_tag LOCUS_41760 774 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 1387 1623 gene locus_tag LOCUS_41770 1387 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 1620 1895 gene locus_tag LOCUS_41780 1620 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2124 2495 gene locus_tag LOCUS_41790 2124 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 5904 2767 gene locus_tag LOCUS_41800 5904 2767 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_41800 7089 5974 gene locus_tag LOCUS_41810 gene acrA 7089 5974 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_41810 8437 7118 gene locus_tag LOCUS_41820 8437 7118 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_41820 8971 8483 gene locus_tag LOCUS_41830 8971 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 9285 9367 gene locus_tag LOCUS_t00330 9285 9367 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence72 730 1167 gene locus_tag LOCUS_41840 730 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 1174 1779 gene locus_tag LOCUS_41850 1174 1779 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_296358.1 protein_id gnl|my_center|LOCUS_41850 1782 4049 gene locus_tag LOCUS_41860 1782 4049 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_41860 4882 5094 gene locus_tag LOCUS_41870 4882 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 5106 5861 gene locus_tag LOCUS_41880 5106 5861 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence73 935 42 gene locus_tag LOCUS_41890 gene era 935 42 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV2 protein_id gnl|my_center|LOCUS_41890 1264 1337 gene locus_tag LOCUS_t00340 1264 1337 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2544 1534 gene locus_tag LOCUS_41900 2544 1534 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_41900 2724 3611 gene locus_tag LOCUS_41910 2724 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 3604 4470 gene locus_tag LOCUS_41920 3604 4470 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_41920 5625 4558 gene locus_tag LOCUS_41930 gene leuB 5625 4558 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_41930 >Feature sequence74 572 129 gene locus_tag LOCUS_41940 gene rplI 572 129 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_41940 863 612 gene locus_tag LOCUS_41950 gene rpsR 863 612 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH8 protein_id gnl|my_center|LOCUS_41950 1231 860 gene locus_tag LOCUS_41960 gene rpsF 1231 860 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_41960 2457 1528 gene locus_tag LOCUS_41970 2457 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 2482 3072 gene locus_tag LOCUS_41980 gene tpm 2482 3072 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_41980 3840 3061 gene locus_tag LOCUS_41990 3840 3061 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_41990 4228 3842 gene locus_tag LOCUS_42000 gene apaG 4228 3842 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257425.1 protein_id gnl|my_center|LOCUS_42000 4290 4952 gene locus_tag LOCUS_42010 gene ung 4290 4952 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5V6 protein_id gnl|my_center|LOCUS_42010 >Feature sequence75 353 1135 gene locus_tag LOCUS_42020 353 1135 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_42020 1138 2049 gene locus_tag LOCUS_42030 1138 2049 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_42030 2133 2651 gene locus_tag LOCUS_42040 2133 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 2655 3377 gene locus_tag LOCUS_42050 gene dapB 2655 3377 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_42050 3393 4466 gene locus_tag LOCUS_42060 3393 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence76 329 1609 gene locus_tag LOCUS_42070 329 1609 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272692.1 protein_id gnl|my_center|LOCUS_42070 2134 1706 gene locus_tag LOCUS_42080 2134 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 2908 2327 gene locus_tag LOCUS_42090 2908 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence77 644 492 gene locus_tag LOCUS_42100 644 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 1036 641 gene locus_tag LOCUS_42110 1036 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 2223 1174 gene locus_tag LOCUS_42120 2223 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence78 133 942 gene locus_tag LOCUS_42130 133 942 CDS product putative integrase/recombinase y4qK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55632 protein_id gnl|my_center|LOCUS_42130 1329 2111 gene locus_tag LOCUS_42140 1329 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140