>Feature sequence001 4221 2980 gene locus_tag LOCUS_00010 4221 2980 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_00010 5027 4203 gene locus_tag LOCUS_00020 gene rph 5027 4203 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2H7 protein_id gnl|my_center|LOCUS_00020 5916 5098 gene locus_tag LOCUS_00030 gene murI 5916 5098 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_00030 6606 5923 gene locus_tag LOCUS_00040 6606 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8183 6603 gene locus_tag LOCUS_00050 8183 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8547 8622 gene locus_tag LOCUS_t00010 8547 8622 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9092 8778 gene locus_tag LOCUS_00060 9092 8778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_00060 9494 9970 gene locus_tag LOCUS_00070 9494 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9977 10711 gene locus_tag LOCUS_00080 9977 10711 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_00080 11596 10796 gene locus_tag LOCUS_00090 11596 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11936 12511 gene locus_tag LOCUS_00100 11936 12511 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_00100 12508 14646 gene locus_tag LOCUS_00110 12508 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14863 16212 gene locus_tag LOCUS_00120 14863 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16817 16263 gene locus_tag LOCUS_00130 16817 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18438 16831 gene locus_tag LOCUS_00140 18438 16831 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_00140 19407 18460 gene locus_tag LOCUS_00150 19407 18460 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYG1 protein_id gnl|my_center|LOCUS_00150 20417 19407 gene locus_tag LOCUS_00160 20417 19407 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_00160 22738 20615 gene locus_tag LOCUS_00170 22738 20615 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404836.1 protein_id gnl|my_center|LOCUS_00170 23359 22919 gene locus_tag LOCUS_00180 23359 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23530 25950 gene locus_tag LOCUS_00190 gene dinG 23530 25950 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_00190 25977 26249 gene locus_tag LOCUS_00200 25977 26249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26249 26635 gene locus_tag LOCUS_00210 26249 26635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27692 26676 gene locus_tag LOCUS_00220 27692 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29338 27701 gene locus_tag LOCUS_00230 29338 27701 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_00230 29373 31667 gene locus_tag LOCUS_00240 29373 31667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31949 33439 gene locus_tag LOCUS_00250 31949 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33702 35075 gene locus_tag LOCUS_00260 33702 35075 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_00260 35155 35559 gene locus_tag LOCUS_00270 35155 35559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52996 protein_id gnl|my_center|LOCUS_00270 35567 36856 gene locus_tag LOCUS_00280 35567 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089905.1 protein_id gnl|my_center|LOCUS_00280 37671 36838 gene locus_tag LOCUS_00290 37671 36838 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 protein_id gnl|my_center|LOCUS_00290 37813 38406 gene locus_tag LOCUS_00300 37813 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38555 38941 gene locus_tag LOCUS_00310 38555 38941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706237.1 protein_id gnl|my_center|LOCUS_00310 39514 38996 gene locus_tag LOCUS_00320 39514 38996 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815T1 protein_id gnl|my_center|LOCUS_00320 41711 39606 gene locus_tag LOCUS_00330 41711 39606 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_00330 42230 41805 gene locus_tag LOCUS_00340 42230 41805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43310 42339 gene locus_tag LOCUS_00350 gene serB 43310 42339 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338897.1 protein_id gnl|my_center|LOCUS_00350 44556 43366 gene locus_tag LOCUS_00360 44556 43366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44828 46672 gene locus_tag LOCUS_00370 44828 46672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_00370 46786 47673 gene locus_tag LOCUS_00380 46786 47673 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_00380 47736 50531 gene locus_tag LOCUS_00390 47736 50531 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_00390 50551 51294 gene locus_tag LOCUS_00400 50551 51294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51409 52056 gene locus_tag LOCUS_00410 51409 52056 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_00410 52230 52652 gene locus_tag LOCUS_00420 52230 52652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52922 55276 gene locus_tag LOCUS_00430 52922 55276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 57342 55252 gene locus_tag LOCUS_00440 gene glyS 57342 55252 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKV5 protein_id gnl|my_center|LOCUS_00440 58664 57339 gene locus_tag LOCUS_00450 58664 57339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 59443 58661 gene locus_tag LOCUS_00460 59443 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 60864 59482 gene locus_tag LOCUS_00470 gene mgtE 60864 59482 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0I3 protein_id gnl|my_center|LOCUS_00470 63448 60941 gene locus_tag LOCUS_00480 63448 60941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 64289 63633 gene locus_tag LOCUS_00490 64289 63633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 64915 64322 gene locus_tag LOCUS_00500 64915 64322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_00500 65064 64912 gene locus_tag LOCUS_00510 65064 64912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 66602 65253 gene locus_tag LOCUS_00520 66602 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_00520 67200 66631 gene locus_tag LOCUS_00530 67200 66631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 70402 67235 gene locus_tag LOCUS_00540 70402 67235 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_00540 72373 70667 gene locus_tag LOCUS_00550 gene cusB 72373 70667 CDS product copper/silver efflux pump MFP component CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074194.1 protein_id gnl|my_center|LOCUS_00550 73836 72370 gene locus_tag LOCUS_00560 73836 72370 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_00560 74348 73917 gene locus_tag LOCUS_00570 74348 73917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 74728 75732 gene locus_tag LOCUS_00580 74728 75732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75816 76952 gene locus_tag LOCUS_00590 75816 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_00590 77009 78556 gene locus_tag LOCUS_00600 77009 78556 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_00600 78581 82174 gene locus_tag LOCUS_00610 gene recC 78581 82174 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPC2 protein_id gnl|my_center|LOCUS_00610 82171 85998 gene locus_tag LOCUS_00620 gene recB 82171 85998 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI1 protein_id gnl|my_center|LOCUS_00620 85991 88117 gene locus_tag LOCUS_00630 gene recD 85991 88117 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY6 protein_id gnl|my_center|LOCUS_00630 88682 89407 gene locus_tag LOCUS_00640 88682 89407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 89914 90165 gene locus_tag LOCUS_00650 89914 90165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 90451 94656 gene locus_tag LOCUS_00660 90451 94656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 94844 97135 gene locus_tag LOCUS_00670 94844 97135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 97135 97914 gene locus_tag LOCUS_00680 97135 97914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 97949 99109 gene locus_tag LOCUS_00690 97949 99109 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776724.1 protein_id gnl|my_center|LOCUS_00690 102138 99163 gene locus_tag LOCUS_00700 102138 99163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 102521 104668 gene locus_tag LOCUS_00710 102521 104668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 105897 104824 gene locus_tag LOCUS_00720 105897 104824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 106269 106859 gene locus_tag LOCUS_00730 106269 106859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 110587 106916 gene locus_tag LOCUS_00740 110587 106916 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_00740 111130 111729 gene locus_tag LOCUS_00750 111130 111729 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_00750 111726 112085 gene locus_tag LOCUS_00760 111726 112085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_00760 113720 112110 gene locus_tag LOCUS_00770 113720 112110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 114117 113761 gene locus_tag LOCUS_00780 114117 113761 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGN4 protein_id gnl|my_center|LOCUS_00780 114559 114134 gene locus_tag LOCUS_00790 gene rsbW 114559 114134 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_00790 114760 114602 gene locus_tag LOCUS_00800 114760 114602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 116598 115099 gene locus_tag LOCUS_00810 116598 115099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 116677 117711 gene locus_tag LOCUS_00820 116677 117711 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_00820 117791 118519 gene locus_tag LOCUS_00830 117791 118519 CDS product oxidoreductase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524799.1 protein_id gnl|my_center|LOCUS_00830 119860 118529 gene locus_tag LOCUS_00840 119860 118529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 121056 120019 gene locus_tag LOCUS_00850 gene moaA 121056 120019 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJ29 protein_id gnl|my_center|LOCUS_00850 122368 121100 gene locus_tag LOCUS_00860 122368 121100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 123696 122365 gene locus_tag LOCUS_00870 123696 122365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 124006 125157 gene locus_tag LOCUS_00880 124006 125157 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_00880 125154 126365 gene locus_tag LOCUS_00890 125154 126365 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277803.1 protein_id gnl|my_center|LOCUS_00890 126365 127792 gene locus_tag LOCUS_00900 126365 127792 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_00900 130118 127800 gene locus_tag LOCUS_00910 130118 127800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 130117 130317 gene locus_tag LOCUS_00920 130117 130317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 130372 131700 gene locus_tag LOCUS_00930 130372 131700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 132204 131740 gene locus_tag LOCUS_00940 132204 131740 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_00940 136883 132201 gene locus_tag LOCUS_00950 136883 132201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 138487 137192 gene locus_tag LOCUS_00960 138487 137192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 141136 138716 gene locus_tag LOCUS_00970 141136 138716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 141732 141238 gene locus_tag LOCUS_00980 141732 141238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 141926 143698 gene locus_tag LOCUS_00990 141926 143698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 144117 144428 gene locus_tag LOCUS_01000 144117 144428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 144566 145714 gene locus_tag LOCUS_01010 gene ampS 144566 145714 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_01010 145711 146268 gene locus_tag LOCUS_01020 gene mogA 145711 146268 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_01020 146323 147147 gene locus_tag LOCUS_01030 146323 147147 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_01030 149586 147157 gene locus_tag LOCUS_01040 149586 147157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 150968 149724 gene locus_tag LOCUS_01050 150968 149724 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7K8 protein_id gnl|my_center|LOCUS_01050 153733 151220 gene locus_tag LOCUS_01060 153733 151220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 153844 156327 gene locus_tag LOCUS_01070 153844 156327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_01070 157530 156334 gene locus_tag LOCUS_01080 157530 156334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 157827 158294 gene locus_tag LOCUS_01090 157827 158294 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_01090 158702 158313 gene locus_tag LOCUS_01100 gene vapC11 158702 158313 CDS product ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA5 protein_id gnl|my_center|LOCUS_01100 158908 158705 gene locus_tag LOCUS_01110 158908 158705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 159836 158964 gene locus_tag LOCUS_01120 159836 158964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 160168 162072 gene locus_tag LOCUS_01130 160168 162072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 163193 162267 gene locus_tag LOCUS_01140 163193 162267 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_01140 164050 163373 gene locus_tag LOCUS_01150 164050 163373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 166493 164634 gene locus_tag LOCUS_01160 166493 164634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_01160 166729 167871 gene locus_tag LOCUS_01170 gene pilT-4 166729 167871 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_01170 167875 169080 gene locus_tag LOCUS_01180 gene pilC 167875 169080 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_01180 169198 170847 gene locus_tag LOCUS_01190 gene pilS 169198 170847 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_01190 170847 172277 gene locus_tag LOCUS_01200 gene pilR 170847 172277 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_01200 174392 172287 gene locus_tag LOCUS_01210 gene pepO 174392 172287 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_01210 174586 176196 gene locus_tag LOCUS_01220 174586 176196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 176319 177026 gene locus_tag LOCUS_01230 176319 177026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_01230 178453 177047 gene locus_tag LOCUS_01240 178453 177047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 179554 178709 gene locus_tag LOCUS_01250 179554 178709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 179826 180197 gene locus_tag LOCUS_01260 179826 180197 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_01260 180240 182492 gene locus_tag LOCUS_01270 180240 182492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 183543 182515 gene locus_tag LOCUS_01280 gene adhP 183543 182515 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_01280 183854 185674 gene locus_tag LOCUS_01290 183854 185674 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_01290 185676 187595 gene locus_tag LOCUS_01300 185676 187595 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_01300 187666 188028 gene locus_tag LOCUS_01310 187666 188028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 188274 188633 gene locus_tag LOCUS_01320 188274 188633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 190738 189311 gene locus_tag LOCUS_01330 190738 189311 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_01330 190898 191578 gene locus_tag LOCUS_01340 190898 191578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 191598 192245 gene locus_tag LOCUS_01350 191598 192245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 194285 192261 gene locus_tag LOCUS_01360 194285 192261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 194614 195912 gene locus_tag LOCUS_01370 194614 195912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 196550 199138 gene locus_tag LOCUS_01380 196550 199138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 199674 200771 gene locus_tag LOCUS_01390 199674 200771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 201723 200818 gene locus_tag LOCUS_01400 gene ytmA 201723 200818 CDS product putative peptidase YtmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34493 protein_id gnl|my_center|LOCUS_01400 202211 201834 gene locus_tag LOCUS_01410 gene vapc5 202211 201834 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P4M9 protein_id gnl|my_center|LOCUS_01410 202459 202208 gene locus_tag LOCUS_01420 202459 202208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 205813 202499 gene locus_tag LOCUS_01430 205813 202499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 206988 205810 gene locus_tag LOCUS_01440 gene sbcD 206988 205810 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT45 protein_id gnl|my_center|LOCUS_01440 208890 207187 gene locus_tag LOCUS_01450 208890 207187 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_01450 210044 208887 gene locus_tag LOCUS_01460 210044 208887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_01460 213303 210133 gene locus_tag LOCUS_01470 213303 210133 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_01470 215079 213334 gene locus_tag LOCUS_01480 215079 213334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 215494 215066 gene locus_tag LOCUS_01490 215494 215066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 216735 215491 gene locus_tag LOCUS_01500 216735 215491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 217349 216789 gene locus_tag LOCUS_01510 217349 216789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 220158 217408 gene locus_tag LOCUS_01520 220158 217408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 221452 220199 gene locus_tag LOCUS_01530 221452 220199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 222708 221452 gene locus_tag LOCUS_01540 222708 221452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 223172 224320 gene locus_tag LOCUS_01550 gene rlmL 223172 224320 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_01550 224398 224520 gene locus_tag LOCUS_01560 224398 224520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 224548 224934 gene locus_tag LOCUS_01570 224548 224934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 225281 226318 gene locus_tag LOCUS_01580 225281 226318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 226396 226626 gene locus_tag LOCUS_01590 226396 226626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 226705 226968 gene locus_tag LOCUS_01600 226705 226968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 229279 227045 gene locus_tag LOCUS_01610 229279 227045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 230680 229463 gene locus_tag LOCUS_01620 230680 229463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 231925 230705 gene locus_tag LOCUS_01630 231925 230705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 234189 232087 gene locus_tag LOCUS_01640 234189 232087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 235415 234390 gene locus_tag LOCUS_01650 235415 234390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 236835 235636 gene locus_tag LOCUS_01660 gene mdeA 236835 235636 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_01660 238097 237069 gene locus_tag LOCUS_01670 238097 237069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 238361 239497 gene locus_tag LOCUS_01680 238361 239497 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_01680 239494 240276 gene locus_tag LOCUS_01690 239494 240276 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117832.1 protein_id gnl|my_center|LOCUS_01690 240273 242240 gene locus_tag LOCUS_01700 240273 242240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 242604 242254 gene locus_tag LOCUS_01710 242604 242254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 242858 242619 gene locus_tag LOCUS_01720 242858 242619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 243435 242863 gene locus_tag LOCUS_01730 243435 242863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 243519 244862 gene locus_tag LOCUS_01740 gene pepQ 243519 244862 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8I1 protein_id gnl|my_center|LOCUS_01740 245674 246024 gene locus_tag LOCUS_01750 245674 246024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 246046 247266 gene locus_tag LOCUS_01760 246046 247266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 247390 248778 gene locus_tag LOCUS_01770 247390 248778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 248844 253064 gene locus_tag LOCUS_01780 248844 253064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 253069 254523 gene locus_tag LOCUS_01790 253069 254523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 254752 257019 gene locus_tag LOCUS_01800 254752 257019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 257115 257606 gene locus_tag LOCUS_01810 257115 257606 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_01810 257710 258153 gene locus_tag LOCUS_01820 257710 258153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_01820 258215 258571 gene locus_tag LOCUS_01830 258215 258571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_01830 258705 259055 gene locus_tag LOCUS_01840 258705 259055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_01840 259473 259219 gene locus_tag LOCUS_01850 259473 259219 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_01850 260843 259731 gene locus_tag LOCUS_01860 260843 259731 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_01860 261871 260840 gene locus_tag LOCUS_01870 261871 260840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 262443 261961 gene locus_tag LOCUS_01880 262443 261961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 265145 262440 gene locus_tag LOCUS_01890 265145 262440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 265419 265796 gene locus_tag LOCUS_01900 265419 265796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 265930 266727 gene locus_tag LOCUS_01910 265930 266727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 268837 266729 gene locus_tag LOCUS_01920 gene greA 268837 266729 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7G4 protein_id gnl|my_center|LOCUS_01920 269000 269812 gene locus_tag LOCUS_01930 269000 269812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 269928 270839 gene locus_tag LOCUS_01940 269928 270839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 270836 271852 gene locus_tag LOCUS_01950 270836 271852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 271888 272550 gene locus_tag LOCUS_01960 271888 272550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 272550 273392 gene locus_tag LOCUS_01970 272550 273392 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_01970 275417 273537 gene locus_tag LOCUS_01980 275417 273537 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222851.1 protein_id gnl|my_center|LOCUS_01980 277324 275561 gene locus_tag LOCUS_01990 277324 275561 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01990 278619 277516 gene locus_tag LOCUS_02000 278619 277516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 280754 278616 gene locus_tag LOCUS_02010 280754 278616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 282100 280898 gene locus_tag LOCUS_02020 282100 280898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_02020 283272 282097 gene locus_tag LOCUS_02030 283272 282097 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 protein_id gnl|my_center|LOCUS_02030 283471 286935 gene locus_tag LOCUS_02040 283471 286935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 287129 288760 gene locus_tag LOCUS_02050 287129 288760 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_02050 290452 288887 gene locus_tag LOCUS_02060 290452 288887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 290592 291899 gene locus_tag LOCUS_02070 290592 291899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 291922 292971 gene locus_tag LOCUS_02080 gene queA 291922 292971 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_02080 293054 294292 gene locus_tag LOCUS_02090 293054 294292 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088189.1 protein_id gnl|my_center|LOCUS_02090 297481 294398 gene locus_tag LOCUS_02100 297481 294398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 299498 297807 gene locus_tag LOCUS_02110 299498 297807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 300592 299495 gene locus_tag LOCUS_02120 300592 299495 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_02120 301713 300589 gene locus_tag LOCUS_02130 301713 300589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_02130 302627 301710 gene locus_tag LOCUS_02140 302627 301710 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_02140 302692 303378 gene locus_tag LOCUS_02150 gene trpF 302692 303378 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGP7 protein_id gnl|my_center|LOCUS_02150 303833 303552 gene locus_tag LOCUS_02160 303833 303552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 304197 304652 gene locus_tag LOCUS_02170 304197 304652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 307865 304749 gene locus_tag LOCUS_02180 gene acrD 307865 304749 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_02180 309556 307994 gene locus_tag LOCUS_02190 309556 307994 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_02190 309736 310581 gene locus_tag LOCUS_02200 309736 310581 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_02200 310762 311985 gene locus_tag LOCUS_02210 310762 311985 CDS product alkaline D-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267017.1 protein_id gnl|my_center|LOCUS_02210 312147 312467 gene locus_tag LOCUS_02220 312147 312467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 313437 312568 gene locus_tag LOCUS_02230 313437 312568 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399938.1 protein_id gnl|my_center|LOCUS_02230 314395 313607 gene locus_tag LOCUS_02240 314395 313607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 314955 314740 gene locus_tag LOCUS_02250 314955 314740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 315112 316545 gene locus_tag LOCUS_02260 315112 316545 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 protein_id gnl|my_center|LOCUS_02260 316700 317164 gene locus_tag LOCUS_02270 316700 317164 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_02270 317301 317831 gene locus_tag LOCUS_02280 317301 317831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 318055 320001 gene locus_tag LOCUS_02290 318055 320001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 320526 321929 gene locus_tag LOCUS_02300 320526 321929 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_02300 321968 323284 gene locus_tag LOCUS_02310 321968 323284 CDS product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635954.2 protein_id gnl|my_center|LOCUS_02310 323362 324768 gene locus_tag LOCUS_02320 323362 324768 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_02320 324816 325115 gene locus_tag LOCUS_02330 324816 325115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 325121 325552 gene locus_tag LOCUS_02340 325121 325552 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_02340 325555 326037 gene locus_tag LOCUS_02350 325555 326037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 328734 326053 gene locus_tag LOCUS_02360 328734 326053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 332367 328915 gene locus_tag LOCUS_02370 332367 328915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_02370 329061 329156 gene locus_tag LOCUS_t00020 329061 329156 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 332610 334829 gene locus_tag LOCUS_02380 332610 334829 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_02380 334826 336703 gene locus_tag LOCUS_02390 334826 336703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 337849 337025 gene locus_tag LOCUS_02400 337849 337025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 338151 339536 gene locus_tag LOCUS_02410 338151 339536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029003.1 protein_id gnl|my_center|LOCUS_02410 339605 341293 gene locus_tag LOCUS_02420 339605 341293 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_02420 341936 341340 gene locus_tag LOCUS_02430 341936 341340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 342384 341980 gene locus_tag LOCUS_02440 342384 341980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 342630 342481 gene locus_tag LOCUS_02450 342630 342481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 343622 342639 gene locus_tag LOCUS_02460 343622 342639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_02460 343642 344598 gene locus_tag LOCUS_02470 343642 344598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 346363 344540 gene locus_tag LOCUS_02480 346363 344540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 348087 346363 gene locus_tag LOCUS_02490 348087 346363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 348364 349584 gene locus_tag LOCUS_02500 348364 349584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 349977 349600 gene locus_tag LOCUS_02510 349977 349600 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_02510 350210 349974 gene locus_tag LOCUS_02520 350210 349974 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_02520 350408 351424 gene locus_tag LOCUS_02530 350408 351424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_02530 351421 352818 gene locus_tag LOCUS_02540 351421 352818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 354593 352821 gene locus_tag LOCUS_02550 354593 352821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 354774 355907 gene locus_tag LOCUS_02560 354774 355907 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_02560 356590 355934 gene locus_tag LOCUS_02570 356590 355934 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_02570 359218 356615 gene locus_tag LOCUS_02580 359218 356615 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_02580 359423 359698 gene locus_tag LOCUS_02590 359423 359698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 359724 360152 gene locus_tag LOCUS_02600 gene ntrR1 359724 360152 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7APC4 protein_id gnl|my_center|LOCUS_02600 361428 360187 gene locus_tag LOCUS_02610 361428 360187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809693.1 protein_id gnl|my_center|LOCUS_02610 364635 361765 gene locus_tag LOCUS_02620 364635 361765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 365187 365963 gene locus_tag LOCUS_02630 365187 365963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 365963 366625 gene locus_tag LOCUS_02640 365963 366625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 366622 367431 gene locus_tag LOCUS_02650 366622 367431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 367428 368840 gene locus_tag LOCUS_02660 367428 368840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 368866 370323 gene locus_tag LOCUS_02670 368866 370323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 370320 371690 gene locus_tag LOCUS_02680 370320 371690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 371705 372679 gene locus_tag LOCUS_02690 371705 372679 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809293.1 protein_id gnl|my_center|LOCUS_02690 374672 373050 gene locus_tag LOCUS_02700 374672 373050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 376092 374749 gene locus_tag LOCUS_02710 376092 374749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 376361 377881 gene locus_tag LOCUS_02720 376361 377881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_02720 378949 377897 gene locus_tag LOCUS_02730 378949 377897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 379189 379641 gene locus_tag LOCUS_02740 379189 379641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 379762 381024 gene locus_tag LOCUS_02750 gene erg3 379762 381024 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_02750 381714 381112 gene locus_tag LOCUS_02760 381714 381112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 383104 382229 gene locus_tag LOCUS_02770 383104 382229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 385823 384816 gene locus_tag LOCUS_02780 385823 384816 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_02780 386054 387388 gene locus_tag LOCUS_02790 386054 387388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 387414 388217 gene locus_tag LOCUS_02800 387414 388217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 388220 389458 gene locus_tag LOCUS_02810 388220 389458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 390855 389455 gene locus_tag LOCUS_02820 390855 389455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 392461 390869 gene locus_tag LOCUS_02830 392461 390869 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_02830 393890 392583 gene locus_tag LOCUS_02840 393890 392583 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_02840 394221 395507 gene locus_tag LOCUS_02850 394221 395507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 397074 395614 gene locus_tag LOCUS_02860 397074 395614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 397950 397195 gene locus_tag LOCUS_02870 397950 397195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 399047 398445 gene locus_tag LOCUS_02880 399047 398445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 399832 399323 gene locus_tag LOCUS_02890 399832 399323 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_02890 400439 399897 gene locus_tag LOCUS_02900 400439 399897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_02900 400751 401443 gene locus_tag LOCUS_02910 400751 401443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 401501 402460 gene locus_tag LOCUS_02920 401501 402460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 402535 403809 gene locus_tag LOCUS_02930 402535 403809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 404160 403813 gene locus_tag LOCUS_02940 404160 403813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 404774 404241 gene locus_tag LOCUS_02950 404774 404241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 405970 404771 gene locus_tag LOCUS_02960 405970 404771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 406985 405975 gene locus_tag LOCUS_02970 406985 405975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_02970 407330 409216 gene locus_tag LOCUS_02980 407330 409216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 409213 410043 gene locus_tag LOCUS_02990 409213 410043 CDS product nodulation protein NodH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970900.1 protein_id gnl|my_center|LOCUS_02990 410293 411696 gene locus_tag LOCUS_03000 410293 411696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 413096 412068 gene locus_tag LOCUS_03010 413096 412068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 414044 413265 gene locus_tag LOCUS_03020 gene plsC 414044 413265 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q9 protein_id gnl|my_center|LOCUS_03020 416575 414068 gene locus_tag LOCUS_03030 416575 414068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 417822 416572 gene locus_tag LOCUS_03040 417822 416572 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_03040 419087 417819 gene locus_tag LOCUS_03050 419087 417819 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_03050 419258 420073 gene locus_tag LOCUS_03060 419258 420073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 420185 420814 gene locus_tag LOCUS_03070 420185 420814 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_03070 420795 423599 gene locus_tag LOCUS_03080 420795 423599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 424524 423625 gene locus_tag LOCUS_03090 424524 423625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 425012 424788 gene locus_tag LOCUS_03100 425012 424788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 425584 425009 gene locus_tag LOCUS_03110 425584 425009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_03110 428064 425581 gene locus_tag LOCUS_03120 428064 425581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 428115 428726 gene locus_tag LOCUS_03130 428115 428726 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_03130 428732 429130 gene locus_tag LOCUS_03140 428732 429130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 430063 429140 gene locus_tag LOCUS_03150 430063 429140 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_03150 432089 430161 gene locus_tag LOCUS_03160 432089 430161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 432528 432133 gene locus_tag LOCUS_03170 432528 432133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 432971 432591 gene locus_tag LOCUS_03180 432971 432591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_03180 433266 435488 gene locus_tag LOCUS_03190 433266 435488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 436241 435615 gene locus_tag LOCUS_03200 436241 435615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 436328 436579 gene locus_tag LOCUS_03210 436328 436579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 438156 436576 gene locus_tag LOCUS_03220 gene glyS 438156 436576 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S046 protein_id gnl|my_center|LOCUS_03220 439434 438487 gene locus_tag LOCUS_03230 439434 438487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703674.1 protein_id gnl|my_center|LOCUS_03230 439939 439445 gene locus_tag LOCUS_03240 439939 439445 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 protein_id gnl|my_center|LOCUS_03240 441522 440143 gene locus_tag LOCUS_03250 441522 440143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 441937 443334 gene locus_tag LOCUS_03260 441937 443334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_03260 444340 443321 gene locus_tag LOCUS_03270 444340 443321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 445302 444337 gene locus_tag LOCUS_03280 445302 444337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 446351 445392 gene locus_tag LOCUS_03290 446351 445392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 448540 446360 gene locus_tag LOCUS_03300 448540 446360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 450447 448678 gene locus_tag LOCUS_03310 450447 448678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 452090 450651 gene locus_tag LOCUS_03320 452090 450651 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_03320 452599 452219 gene locus_tag LOCUS_03330 452599 452219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66611 protein_id gnl|my_center|LOCUS_03330 453159 452689 gene locus_tag LOCUS_03340 gene rlmH 453159 452689 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKY9 protein_id gnl|my_center|LOCUS_03340 453895 453182 gene locus_tag LOCUS_03350 453895 453182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 453961 454947 gene locus_tag LOCUS_03360 453961 454947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056343.1 protein_id gnl|my_center|LOCUS_03360 455108 456475 gene locus_tag LOCUS_03370 gene manB 455108 456475 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_03370 457196 457681 gene locus_tag LOCUS_03380 457196 457681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 457678 458415 gene locus_tag LOCUS_03390 457678 458415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 459308 458418 gene locus_tag LOCUS_03400 459308 458418 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948306.1 protein_id gnl|my_center|LOCUS_03400 462391 459482 gene locus_tag LOCUS_03410 462391 459482 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_03410 466878 462454 gene locus_tag LOCUS_03420 466878 462454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 470092 467111 gene locus_tag LOCUS_03430 470092 467111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 470230 471813 gene locus_tag LOCUS_03440 470230 471813 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_03440 474279 471817 gene locus_tag LOCUS_03450 474279 471817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_03450 474549 476819 gene locus_tag LOCUS_03460 474549 476819 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_03460 476857 477573 gene locus_tag LOCUS_03470 476857 477573 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_03470 477570 478895 gene locus_tag LOCUS_03480 gene colS 477570 478895 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038221.1 protein_id gnl|my_center|LOCUS_03480 479132 479716 gene locus_tag LOCUS_03490 479132 479716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 479713 482388 gene locus_tag LOCUS_03500 479713 482388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 483636 482419 gene locus_tag LOCUS_03510 483636 482419 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_03510 485348 483633 gene locus_tag LOCUS_03520 485348 483633 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_03520 486530 485382 gene locus_tag LOCUS_03530 486530 485382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338170.1 protein_id gnl|my_center|LOCUS_03530 487619 486558 gene locus_tag LOCUS_03540 487619 486558 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804128.1 protein_id gnl|my_center|LOCUS_03540 487917 488135 gene locus_tag LOCUS_03550 487917 488135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 488195 488626 gene locus_tag LOCUS_03560 488195 488626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 491205 488629 gene locus_tag LOCUS_03570 491205 488629 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_03570 491505 492068 gene locus_tag LOCUS_03580 491505 492068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 492227 494491 gene locus_tag LOCUS_03590 492227 494491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 494806 497469 gene locus_tag LOCUS_03600 494806 497469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 497563 498192 gene locus_tag LOCUS_03610 497563 498192 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_03610 501065 498411 gene locus_tag LOCUS_03620 501065 498411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 502495 501233 gene locus_tag LOCUS_03630 502495 501233 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_03630 502563 503042 gene locus_tag LOCUS_03640 502563 503042 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 protein_id gnl|my_center|LOCUS_03640 503694 503056 gene locus_tag LOCUS_03650 503694 503056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 503962 503819 gene locus_tag LOCUS_03660 503962 503819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 504300 505568 gene locus_tag LOCUS_03670 504300 505568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 505646 508477 gene locus_tag LOCUS_03680 505646 508477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 508474 510447 gene locus_tag LOCUS_03690 508474 510447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 511634 510465 gene locus_tag LOCUS_03700 gene agxT 511634 510465 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_03700 512878 511742 gene locus_tag LOCUS_03710 512878 511742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 513919 513026 gene locus_tag LOCUS_03720 513919 513026 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_03720 514074 514553 gene locus_tag LOCUS_03730 514074 514553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 514566 516362 gene locus_tag LOCUS_03740 514566 516362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 516409 517803 gene locus_tag LOCUS_03750 516409 517803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 518247 520169 gene locus_tag LOCUS_03760 gene dnaK 518247 520169 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_03760 520247 520624 gene locus_tag LOCUS_03770 520247 520624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 520757 521638 gene locus_tag LOCUS_03780 520757 521638 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_03780 521663 523105 gene locus_tag LOCUS_03790 521663 523105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 523102 524316 gene locus_tag LOCUS_03800 523102 524316 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_03800 524408 525004 gene locus_tag LOCUS_03810 524408 525004 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_03810 525187 526206 gene locus_tag LOCUS_03820 525187 526206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 527410 526214 gene locus_tag LOCUS_03830 gene lysA 527410 526214 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971789.1 protein_id gnl|my_center|LOCUS_03830 528681 527446 gene locus_tag LOCUS_03840 528681 527446 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHD7 protein_id gnl|my_center|LOCUS_03840 529538 528678 gene locus_tag LOCUS_03850 gene dapD 529538 528678 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403729.1 protein_id gnl|my_center|LOCUS_03850 530572 529535 gene locus_tag LOCUS_03860 gene dapA 530572 529535 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M1 protein_id gnl|my_center|LOCUS_03860 531349 530579 gene locus_tag LOCUS_03870 531349 530579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 532446 531346 gene locus_tag LOCUS_03880 gene argE 532446 531346 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_03880 533438 532443 gene locus_tag LOCUS_03890 533438 532443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 533688 533999 gene locus_tag LOCUS_03900 533688 533999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 535788 534067 gene locus_tag LOCUS_03910 535788 534067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142452.1 protein_id gnl|my_center|LOCUS_03910 537597 535903 gene locus_tag LOCUS_03920 537597 535903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142452.1 protein_id gnl|my_center|LOCUS_03920 538044 539768 gene locus_tag LOCUS_03930 538044 539768 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_03930 539765 540235 gene locus_tag LOCUS_03940 gene folA 539765 540235 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIQ9 protein_id gnl|my_center|LOCUS_03940 540253 541122 gene locus_tag LOCUS_03950 540253 541122 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_03950 541398 542432 gene locus_tag LOCUS_03960 541398 542432 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_03960 542545 545964 gene locus_tag LOCUS_03970 542545 545964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03970 546064 548046 gene locus_tag LOCUS_03980 546064 548046 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_03980 548087 549946 gene locus_tag LOCUS_03990 gene pepF 548087 549946 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_03990 549943 551142 gene locus_tag LOCUS_04000 549943 551142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 551260 552456 gene locus_tag LOCUS_04010 551260 552456 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528425.1 protein_id gnl|my_center|LOCUS_04010 552453 554342 gene locus_tag LOCUS_04020 552453 554342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 555172 554333 gene locus_tag LOCUS_04030 555172 554333 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_04030 555965 555165 gene locus_tag LOCUS_04040 gene pstB 555965 555165 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A5 protein_id gnl|my_center|LOCUS_04040 556831 555962 gene locus_tag LOCUS_04050 gene pstA 556831 555962 CDS product phosphate ABC transporter, permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020933.1 protein_id gnl|my_center|LOCUS_04050 557795 556839 gene locus_tag LOCUS_04060 557795 556839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 558891 557800 gene locus_tag LOCUS_04070 558891 557800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 559885 558926 gene locus_tag LOCUS_04080 559885 558926 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_04080 560333 561517 gene locus_tag LOCUS_04090 560333 561517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 561662 562342 gene locus_tag LOCUS_04100 gene phoB 561662 562342 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_04100 562367 563323 gene locus_tag LOCUS_04110 562367 563323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 563415 563843 gene locus_tag LOCUS_04120 563415 563843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_04120 567124 563873 gene locus_tag LOCUS_04130 567124 563873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 567478 568239 gene locus_tag LOCUS_04140 567478 568239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 568250 570217 gene locus_tag LOCUS_04150 568250 570217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 570740 571204 gene locus_tag LOCUS_04160 570740 571204 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_04160 571539 572237 gene locus_tag LOCUS_04170 571539 572237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 572237 574285 gene locus_tag LOCUS_04180 572237 574285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 574948 574361 gene locus_tag LOCUS_04190 574948 574361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 575632 575862 gene locus_tag LOCUS_04200 575632 575862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 575914 576567 gene locus_tag LOCUS_04210 gene psd 575914 576567 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y8 protein_id gnl|my_center|LOCUS_04210 576564 577382 gene locus_tag LOCUS_04220 gene pssA 576564 577382 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_04220 577382 578350 gene locus_tag LOCUS_04230 gene asd 577382 578350 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_04230 581799 578380 gene locus_tag LOCUS_04240 gene acrD 581799 578380 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_04240 582939 581809 gene locus_tag LOCUS_04250 582939 581809 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_04250 584286 583336 gene locus_tag LOCUS_04260 584286 583336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 584709 587159 gene locus_tag LOCUS_04270 584709 587159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_04270 587319 587858 gene locus_tag LOCUS_04280 587319 587858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 588651 587845 gene locus_tag LOCUS_04290 588651 587845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 589406 591229 gene locus_tag LOCUS_04300 589406 591229 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_04300 591275 592432 gene locus_tag LOCUS_04310 591275 592432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 595632 592660 gene locus_tag LOCUS_04320 595632 592660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 597578 596172 gene locus_tag LOCUS_04330 597578 596172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 598352 597744 gene locus_tag LOCUS_04340 598352 597744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 604079 598356 gene locus_tag LOCUS_04350 604079 598356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 616428 604231 gene locus_tag LOCUS_04360 616428 604231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 616752 618578 gene locus_tag LOCUS_04370 616752 618578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 619917 618517 gene locus_tag LOCUS_04380 619917 618517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 622724 619920 gene locus_tag LOCUS_04390 622724 619920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 623155 627165 gene locus_tag LOCUS_04400 623155 627165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 627237 628655 gene locus_tag LOCUS_04410 627237 628655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 629591 628668 gene locus_tag LOCUS_04420 629591 628668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 633915 629785 gene locus_tag LOCUS_04430 633915 629785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 634774 633917 gene locus_tag LOCUS_04440 gene nadK 634774 633917 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_04440 635526 634771 gene locus_tag LOCUS_04450 635526 634771 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_04450 636489 635581 gene locus_tag LOCUS_04460 636489 635581 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_04460 637886 636486 gene locus_tag LOCUS_04470 637886 636486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 637905 639143 gene locus_tag LOCUS_04480 637905 639143 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887438.1 protein_id gnl|my_center|LOCUS_04480 639140 639685 gene locus_tag LOCUS_04490 639140 639685 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_04490 639901 641190 gene locus_tag LOCUS_04500 639901 641190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 641722 641267 gene locus_tag LOCUS_04510 641722 641267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 642016 642306 gene locus_tag LOCUS_04520 642016 642306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 643276 642416 gene locus_tag LOCUS_04530 643276 642416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 643578 644162 gene locus_tag LOCUS_04540 643578 644162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 644520 645530 gene locus_tag LOCUS_04550 644520 645530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 645538 646722 gene locus_tag LOCUS_04560 645538 646722 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 protein_id gnl|my_center|LOCUS_04560 647810 646680 gene locus_tag LOCUS_04570 647810 646680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 647927 649291 gene locus_tag LOCUS_04580 647927 649291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_04580 650213 649269 gene locus_tag LOCUS_04590 gene glsA 650213 649269 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MM2 protein_id gnl|my_center|LOCUS_04590 650374 651807 gene locus_tag LOCUS_04600 650374 651807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 651840 652940 gene locus_tag LOCUS_04610 651840 652940 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404714.1 protein_id gnl|my_center|LOCUS_04610 652943 656353 gene locus_tag LOCUS_04620 652943 656353 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_04620 656417 656803 gene locus_tag LOCUS_04630 gene gcvH 656417 656803 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_04630 656800 657210 gene locus_tag LOCUS_04640 656800 657210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 658732 657332 gene locus_tag LOCUS_04650 658732 657332 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 protein_id gnl|my_center|LOCUS_04650 658980 659705 gene locus_tag LOCUS_04660 658980 659705 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 protein_id gnl|my_center|LOCUS_04660 659702 660457 gene locus_tag LOCUS_04670 659702 660457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 660454 660759 gene locus_tag LOCUS_04680 660454 660759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 661580 660756 gene locus_tag LOCUS_04690 661580 660756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_04690 662122 661577 gene locus_tag LOCUS_04700 662122 661577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 663061 662141 gene locus_tag LOCUS_04710 663061 662141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 663578 663096 gene locus_tag LOCUS_04720 663578 663096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 664188 663562 gene locus_tag LOCUS_04730 gene nadD 664188 663562 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX21 protein_id gnl|my_center|LOCUS_04730 665339 664185 gene locus_tag LOCUS_04740 gene obg 665339 664185 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_04740 665688 665431 gene locus_tag LOCUS_04750 gene rpmA 665688 665431 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_04750 666043 665705 gene locus_tag LOCUS_04760 gene rplU 666043 665705 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV02 protein_id gnl|my_center|LOCUS_04760 666975 668150 gene locus_tag LOCUS_04770 666975 668150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 668186 668353 gene locus_tag LOCUS_04780 668186 668353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 669752 668361 gene locus_tag LOCUS_04790 669752 668361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 670302 671807 gene locus_tag LOCUS_04800 670302 671807 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_04800 671999 673717 gene locus_tag LOCUS_04810 671999 673717 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_04810 673847 674836 gene locus_tag LOCUS_04820 673847 674836 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_04820 674833 675855 gene locus_tag LOCUS_04830 674833 675855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 675915 676409 gene locus_tag LOCUS_04840 675915 676409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 678636 676423 gene locus_tag LOCUS_04850 678636 676423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 679309 678794 gene locus_tag LOCUS_04860 679309 678794 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_04860 679737 679306 gene locus_tag LOCUS_04870 679737 679306 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_04870 680285 679761 gene locus_tag LOCUS_04880 680285 679761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 680923 680411 gene locus_tag LOCUS_04890 680923 680411 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_04890 682149 680935 gene locus_tag LOCUS_04900 682149 680935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 683537 682191 gene locus_tag LOCUS_04910 683537 682191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 686125 683735 gene locus_tag LOCUS_04920 686125 683735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 688155 686365 gene locus_tag LOCUS_04930 688155 686365 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_04930 688721 691240 gene locus_tag LOCUS_04940 688721 691240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 691457 692896 gene locus_tag LOCUS_04950 691457 692896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 692883 694343 gene locus_tag LOCUS_04960 692883 694343 CDS product ketoisovalerate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_04960 696127 694424 gene locus_tag LOCUS_04970 696127 694424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 696603 697262 gene locus_tag LOCUS_04980 696603 697262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 698577 697300 gene locus_tag LOCUS_04990 gene kynU 698577 697300 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 protein_id gnl|my_center|LOCUS_04990 701153 698649 gene locus_tag LOCUS_05000 701153 698649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_05000 702871 701348 gene locus_tag LOCUS_05010 702871 701348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 703607 702972 gene locus_tag LOCUS_05020 gene upp 703607 702972 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_05020 706340 703650 gene locus_tag LOCUS_05030 706340 703650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 706574 707377 gene locus_tag LOCUS_05040 706574 707377 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_05040 707832 707404 gene locus_tag LOCUS_05050 gene vapC43 707832 707404 CDS product ribonuclease VapC43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF55 protein_id gnl|my_center|LOCUS_05050 708089 707829 gene locus_tag LOCUS_05060 708089 707829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 708251 710398 gene locus_tag LOCUS_05070 708251 710398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 710548 712884 gene locus_tag LOCUS_05080 710548 712884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 712881 713756 gene locus_tag LOCUS_05090 712881 713756 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_05090 713746 714765 gene locus_tag LOCUS_05100 713746 714765 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937987.1 protein_id gnl|my_center|LOCUS_05100 715111 714785 gene locus_tag LOCUS_05110 715111 714785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 717913 715502 gene locus_tag LOCUS_05120 717913 715502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 718496 718038 gene locus_tag LOCUS_05130 718496 718038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_05130 718978 718493 gene locus_tag LOCUS_05140 718978 718493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 719535 719023 gene locus_tag LOCUS_05150 719535 719023 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808390.1 protein_id gnl|my_center|LOCUS_05150 720371 719565 gene locus_tag LOCUS_05160 720371 719565 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_05160 724226 720396 gene locus_tag LOCUS_05170 724226 720396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 726534 724330 gene locus_tag LOCUS_05180 726534 724330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_05180 726754 727044 gene locus_tag LOCUS_05190 726754 727044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 728406 727054 gene locus_tag LOCUS_05200 728406 727054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 729249 728485 gene locus_tag LOCUS_05210 729249 728485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 730283 729378 gene locus_tag LOCUS_05220 730283 729378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 733028 730527 gene locus_tag LOCUS_05230 733028 730527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 738358 733166 gene locus_tag LOCUS_05240 738358 733166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 739717 738743 gene locus_tag LOCUS_05250 739717 738743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 740331 739714 gene locus_tag LOCUS_05260 740331 739714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 740959 740324 gene locus_tag LOCUS_05270 740959 740324 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_05270 741521 744613 gene locus_tag LOCUS_05280 741521 744613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 745299 744610 gene locus_tag LOCUS_05290 745299 744610 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_05290 745622 745446 gene locus_tag LOCUS_05300 745622 745446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 747114 745825 gene locus_tag LOCUS_05310 747114 745825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_05310 748960 747116 gene locus_tag LOCUS_05320 748960 747116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 749830 749294 gene locus_tag LOCUS_05330 749830 749294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 752276 749871 gene locus_tag LOCUS_05340 752276 749871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 752636 754036 gene locus_tag LOCUS_05350 752636 754036 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_05350 754070 754735 gene locus_tag LOCUS_05360 gene alkA 754070 754735 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_05360 754789 755274 gene locus_tag LOCUS_05370 gene flaR 754789 755274 CDS product DNA topology modulation protein FlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704762.1 protein_id gnl|my_center|LOCUS_05370 758668 755315 gene locus_tag LOCUS_05380 758668 755315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 758564 759004 gene locus_tag LOCUS_05390 758564 759004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 759020 759286 gene locus_tag LOCUS_05400 759020 759286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 760640 759504 gene locus_tag LOCUS_05410 760640 759504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 761778 760630 gene locus_tag LOCUS_05420 761778 760630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 762728 761778 gene locus_tag LOCUS_05430 762728 761778 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_05430 764058 762700 gene locus_tag LOCUS_05440 764058 762700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 764513 764181 gene locus_tag LOCUS_05450 764513 764181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05450 768497 764799 gene locus_tag LOCUS_05460 768497 764799 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_05460 768762 770675 gene locus_tag LOCUS_05470 gene edd 768762 770675 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_05470 770767 771384 gene locus_tag LOCUS_05480 770767 771384 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709432.1 protein_id gnl|my_center|LOCUS_05480 771381 772859 gene locus_tag LOCUS_05490 gene zwf 771381 772859 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_05490 772862 773569 gene locus_tag LOCUS_05500 gene pgl 772862 773569 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_05500 773591 774070 gene locus_tag LOCUS_05510 gene ytoQ 773591 774070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_05510 776169 774184 gene locus_tag LOCUS_05520 776169 774184 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_05520 776458 777537 gene locus_tag LOCUS_05530 776458 777537 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 protein_id gnl|my_center|LOCUS_05530 777552 778010 gene locus_tag LOCUS_05540 777552 778010 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_05540 778007 778465 gene locus_tag LOCUS_05550 778007 778465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 779838 778480 gene locus_tag LOCUS_05560 779838 778480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 780843 779941 gene locus_tag LOCUS_05570 780843 779941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245396.1 protein_id gnl|my_center|LOCUS_05570 780943 782307 gene locus_tag LOCUS_05580 780943 782307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 782426 784738 gene locus_tag LOCUS_05590 782426 784738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 785793 784735 gene locus_tag LOCUS_05600 785793 784735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 788126 785976 gene locus_tag LOCUS_05610 gene ymxG 788126 785976 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_05610 789662 788139 gene locus_tag LOCUS_05620 789662 788139 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403996.1 protein_id gnl|my_center|LOCUS_05620 790824 789931 gene locus_tag LOCUS_05630 790824 789931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 792413 790908 gene locus_tag LOCUS_05640 792413 790908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 792898 792731 gene locus_tag LOCUS_05650 792898 792731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 794031 792898 gene locus_tag LOCUS_05660 794031 792898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 794722 794078 gene locus_tag LOCUS_05670 794722 794078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence002 1500 823 gene locus_tag LOCUS_05680 gene nth 1500 823 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_05680 3760 1520 gene locus_tag LOCUS_05690 3760 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4113 3760 gene locus_tag LOCUS_05700 4113 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5049 4222 gene locus_tag LOCUS_05710 5049 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5262 6497 gene locus_tag LOCUS_05720 gene moeA 5262 6497 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_05720 6497 7114 gene locus_tag LOCUS_05730 6497 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7501 8424 gene locus_tag LOCUS_05740 7501 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 8908 8549 gene locus_tag LOCUS_05750 8908 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9437 9027 gene locus_tag LOCUS_05760 9437 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15259 9524 gene locus_tag LOCUS_05770 15259 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17550 15673 gene locus_tag LOCUS_05780 17550 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 18277 19083 gene locus_tag LOCUS_05790 18277 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 19792 19511 gene locus_tag LOCUS_05800 19792 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 24311 19962 gene locus_tag LOCUS_05810 24311 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 26807 24510 gene locus_tag LOCUS_05820 26807 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 27038 27466 gene locus_tag LOCUS_05830 27038 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 27463 29643 gene locus_tag LOCUS_05840 27463 29643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 29913 31748 gene locus_tag LOCUS_05850 29913 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 31903 32877 gene locus_tag LOCUS_05860 31903 32877 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814542.1 protein_id gnl|my_center|LOCUS_05860 35029 32936 gene locus_tag LOCUS_05870 35029 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_05870 37313 35088 gene locus_tag LOCUS_05880 37313 35088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 37713 38321 gene locus_tag LOCUS_05890 37713 38321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 38424 38969 gene locus_tag LOCUS_05900 38424 38969 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_05900 39242 41032 gene locus_tag LOCUS_05910 39242 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 41352 43217 gene locus_tag LOCUS_05920 41352 43217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 46358 43479 gene locus_tag LOCUS_05930 46358 43479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 52969 46451 gene locus_tag LOCUS_05940 52969 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 53549 53028 gene locus_tag LOCUS_05950 53549 53028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 60093 53668 gene locus_tag LOCUS_05960 60093 53668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 60288 60887 gene locus_tag LOCUS_05970 60288 60887 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_05970 61599 60997 gene locus_tag LOCUS_05980 61599 60997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 61762 63198 gene locus_tag LOCUS_05990 61762 63198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_05990 63207 64475 gene locus_tag LOCUS_06000 63207 64475 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_06000 64829 64479 gene locus_tag LOCUS_06010 64829 64479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 65050 64826 gene locus_tag LOCUS_06020 65050 64826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_06020 66253 65153 gene locus_tag LOCUS_06030 66253 65153 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 protein_id gnl|my_center|LOCUS_06030 66827 66390 gene locus_tag LOCUS_06040 66827 66390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 67899 66955 gene locus_tag LOCUS_06050 gene glpQ 67899 66955 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_06050 68068 70173 gene locus_tag LOCUS_06060 68068 70173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 72793 70442 gene locus_tag LOCUS_06070 gene glnS 72793 70442 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_06070 74985 72871 gene locus_tag LOCUS_06080 74985 72871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 75382 75777 gene locus_tag LOCUS_06090 75382 75777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 76139 77101 gene locus_tag LOCUS_06100 76139 77101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 78504 77104 gene locus_tag LOCUS_06110 78504 77104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 79057 78629 gene locus_tag LOCUS_06120 79057 78629 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_06120 79481 79044 gene locus_tag LOCUS_06130 79481 79044 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083756006.1 protein_id gnl|my_center|LOCUS_06130 80680 79535 gene locus_tag LOCUS_06140 80680 79535 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_06140 83634 80737 gene locus_tag LOCUS_06150 83634 80737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 84476 83925 gene locus_tag LOCUS_06160 84476 83925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 84580 85923 gene locus_tag LOCUS_06170 84580 85923 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_06170 87066 85915 gene locus_tag LOCUS_06180 87066 85915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 88019 87063 gene locus_tag LOCUS_06190 88019 87063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 88119 89930 gene locus_tag LOCUS_06200 88119 89930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 92798 89934 gene locus_tag LOCUS_06210 gene ileS 92798 89934 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AR5 protein_id gnl|my_center|LOCUS_06210 93650 94654 gene locus_tag LOCUS_06220 gene iolS 93650 94654 CDS product protein IolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46336 protein_id gnl|my_center|LOCUS_06220 96909 94651 gene locus_tag LOCUS_06230 96909 94651 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_06230 97550 96981 gene locus_tag LOCUS_06240 97550 96981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 99018 97591 gene locus_tag LOCUS_06250 99018 97591 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 protein_id gnl|my_center|LOCUS_06250 99938 99021 gene locus_tag LOCUS_06260 99938 99021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_06260 99964 100365 gene locus_tag LOCUS_06270 99964 100365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 100449 100661 gene locus_tag LOCUS_06280 100449 100661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 100658 101050 gene locus_tag LOCUS_06290 gene vapC 100658 101050 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGR2 protein_id gnl|my_center|LOCUS_06290 103992 101065 gene locus_tag LOCUS_06300 gene gcvP 103992 101065 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_06300 104595 106310 gene locus_tag LOCUS_06310 104595 106310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 106861 106514 gene locus_tag LOCUS_06320 gene hiuH 106861 106514 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7Q6 protein_id gnl|my_center|LOCUS_06320 108375 106924 gene locus_tag LOCUS_06330 108375 106924 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_06330 108938 108372 gene locus_tag LOCUS_06340 108938 108372 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_06340 109969 108935 gene locus_tag LOCUS_06350 gene alc 109969 108935 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J8 protein_id gnl|my_center|LOCUS_06350 111417 109993 gene locus_tag LOCUS_06360 gene allB 111417 109993 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_06360 112433 111414 gene locus_tag LOCUS_06370 112433 111414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 114873 112456 gene locus_tag LOCUS_06380 114873 112456 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_06380 116302 114848 gene locus_tag LOCUS_06390 116302 114848 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_06390 118695 116686 gene locus_tag LOCUS_06400 gene ligA 118695 116686 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_06400 120358 118715 gene locus_tag LOCUS_06410 gene betA 120358 118715 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_06410 120395 122584 gene locus_tag LOCUS_06420 gene recD2 120395 122584 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_06420 122956 123876 gene locus_tag LOCUS_06430 122956 123876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 123845 124675 gene locus_tag LOCUS_06440 123845 124675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 124996 125715 gene locus_tag LOCUS_06450 124996 125715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 125764 126549 gene locus_tag LOCUS_06460 125764 126549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 126611 126841 gene locus_tag LOCUS_06470 126611 126841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 127125 128828 gene locus_tag LOCUS_06480 127125 128828 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_06480 130430 128829 gene locus_tag LOCUS_06490 130430 128829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 130818 131492 gene locus_tag LOCUS_06500 130818 131492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 131684 131758 gene locus_tag LOCUS_t00030 131684 131758 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 132305 132640 gene locus_tag LOCUS_06510 132305 132640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 132597 132761 gene locus_tag LOCUS_06520 132597 132761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 134310 134618 gene locus_tag LOCUS_06530 134310 134618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 135226 134966 gene locus_tag LOCUS_06540 gene rpmE2 135226 134966 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DTN5 protein_id gnl|my_center|LOCUS_06540 137642 135246 gene locus_tag LOCUS_06550 137642 135246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_06550 138124 137783 gene locus_tag LOCUS_06560 138124 137783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 138926 139924 gene locus_tag LOCUS_06570 138926 139924 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_06570 140054 140911 gene locus_tag LOCUS_06580 140054 140911 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_06580 140908 141399 gene locus_tag LOCUS_06590 140908 141399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_06590 141506 142318 gene locus_tag LOCUS_06600 141506 142318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 142433 143866 gene locus_tag LOCUS_06610 142433 143866 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_06610 143868 144644 gene locus_tag LOCUS_06620 143868 144644 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK17 protein_id gnl|my_center|LOCUS_06620 144758 146476 gene locus_tag LOCUS_06630 144758 146476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 147385 146501 gene locus_tag LOCUS_06640 147385 146501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 147823 147524 gene locus_tag LOCUS_06650 gene vapI 147823 147524 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_06650 148127 147846 gene locus_tag LOCUS_06660 148127 147846 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_06660 148496 148191 gene locus_tag LOCUS_06670 148496 148191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 151752 148612 gene locus_tag LOCUS_06680 151752 148612 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_06680 152873 151749 gene locus_tag LOCUS_06690 152873 151749 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_06690 154429 153050 gene locus_tag LOCUS_06700 154429 153050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 153979 153884 gene locus_tag LOCUS_t00040 153979 153884 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 157016 154494 gene locus_tag LOCUS_06710 157016 154494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 157259 158482 gene locus_tag LOCUS_06720 157259 158482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_06720 160208 158505 gene locus_tag LOCUS_06730 160208 158505 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_06730 160916 160620 gene locus_tag LOCUS_06740 160916 160620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 162391 160913 gene locus_tag LOCUS_06750 162391 160913 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_06750 163917 162391 gene locus_tag LOCUS_06760 163917 162391 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_06760 164267 163914 gene locus_tag LOCUS_06770 164267 163914 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_06770 164686 164267 gene locus_tag LOCUS_06780 164686 164267 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_06780 165228 164683 gene locus_tag LOCUS_06790 165228 164683 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_06790 165595 165248 gene locus_tag LOCUS_06800 165595 165248 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_06800 165900 165592 gene locus_tag LOCUS_06810 165900 165592 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_06810 166448 165897 gene locus_tag LOCUS_06820 166448 165897 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_06820 168231 166507 gene locus_tag LOCUS_06830 168231 166507 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_06830 168554 168228 gene locus_tag LOCUS_06840 168554 168228 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_06840 170385 168712 gene locus_tag LOCUS_06850 170385 168712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 172484 170784 gene locus_tag LOCUS_06860 172484 170784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 173621 172527 gene locus_tag LOCUS_06870 gene pilT-3 173621 172527 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_06870 175464 173635 gene locus_tag LOCUS_06880 175464 173635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 176246 175488 gene locus_tag LOCUS_06890 176246 175488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 176763 176578 gene locus_tag LOCUS_06900 176763 176578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 176744 177760 gene locus_tag LOCUS_06910 176744 177760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 177945 179774 gene locus_tag LOCUS_06920 gene lpdA 177945 179774 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD04 protein_id gnl|my_center|LOCUS_06920 179957 181162 gene locus_tag LOCUS_06930 179957 181162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 181159 182175 gene locus_tag LOCUS_06940 181159 182175 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_06940 182172 182693 gene locus_tag LOCUS_06950 182172 182693 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 184375 182750 gene locus_tag LOCUS_06960 184375 182750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 184699 186060 gene locus_tag LOCUS_06970 184699 186060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117833.1 protein_id gnl|my_center|LOCUS_06970 186057 187022 gene locus_tag LOCUS_06980 186057 187022 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_06980 187678 187028 gene locus_tag LOCUS_06990 187678 187028 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_06990 188669 187758 gene locus_tag LOCUS_07000 188669 187758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 189841 188690 gene locus_tag LOCUS_07010 189841 188690 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583473.1 protein_id gnl|my_center|LOCUS_07010 190731 189877 gene locus_tag LOCUS_07020 190731 189877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 193331 190728 gene locus_tag LOCUS_07030 193331 190728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 195624 193288 gene locus_tag LOCUS_07040 195624 193288 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_07040 197139 195628 gene locus_tag LOCUS_07050 197139 195628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 197240 198430 gene locus_tag LOCUS_07060 197240 198430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_07060 198900 198427 gene locus_tag LOCUS_07070 198900 198427 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706613.1 protein_id gnl|my_center|LOCUS_07070 199105 200175 gene locus_tag LOCUS_07080 199105 200175 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_07080 200156 200995 gene locus_tag LOCUS_07090 200156 200995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 203729 201102 gene locus_tag LOCUS_07100 203729 201102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 203692 204711 gene locus_tag LOCUS_07110 203692 204711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 204864 206549 gene locus_tag LOCUS_07120 204864 206549 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_07120 207632 206565 gene locus_tag LOCUS_07130 207632 206565 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_07130 207828 208970 gene locus_tag LOCUS_07140 207828 208970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 211062 208954 gene locus_tag LOCUS_07150 211062 208954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 212203 211088 gene locus_tag LOCUS_07160 gene ald 212203 211088 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_07160 212838 212200 gene locus_tag LOCUS_07170 212838 212200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 213083 213008 gene locus_tag LOCUS_t00050 213083 213008 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 213257 213583 gene locus_tag LOCUS_07180 213257 213583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 214670 213618 gene locus_tag LOCUS_07190 214670 213618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 215001 214663 gene locus_tag LOCUS_07200 215001 214663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 215000 216217 gene locus_tag LOCUS_07210 215000 216217 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089743.1 protein_id gnl|my_center|LOCUS_07210 217287 216286 gene locus_tag LOCUS_07220 gene etfA 217287 216286 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_07220 218081 217287 gene locus_tag LOCUS_07230 218081 217287 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_07230 218562 219287 gene locus_tag LOCUS_07240 218562 219287 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_07240 219292 219720 gene locus_tag LOCUS_07250 219292 219720 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_07250 219730 220521 gene locus_tag LOCUS_07260 219730 220521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 220541 221902 gene locus_tag LOCUS_07270 gene tolB 220541 221902 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_07270 222145 222696 gene locus_tag LOCUS_07280 222145 222696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 222738 223556 gene locus_tag LOCUS_07290 222738 223556 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_07290 223800 224066 gene locus_tag LOCUS_07300 gene rpsT 223800 224066 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67643 protein_id gnl|my_center|LOCUS_07300 224803 224225 gene locus_tag LOCUS_07310 224803 224225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 225860 224868 gene locus_tag LOCUS_07320 225860 224868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 226465 225920 gene locus_tag LOCUS_07330 gene nusB 226465 225920 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_07330 226998 226501 gene locus_tag LOCUS_07340 gene ribH 226998 226501 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66529 protein_id gnl|my_center|LOCUS_07340 227305 227229 gene locus_tag LOCUS_t00060 227305 227229 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 227787 227362 gene locus_tag LOCUS_07350 227787 227362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 228137 227823 gene locus_tag LOCUS_07360 228137 227823 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931987.1 protein_id gnl|my_center|LOCUS_07360 229665 228352 gene locus_tag LOCUS_07370 gene der 229665 228352 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_07370 230222 229662 gene locus_tag LOCUS_07380 230222 229662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 230433 230519 gene locus_tag LOCUS_t00070 230433 230519 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 230965 230588 gene locus_tag LOCUS_07390 230965 230588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 232249 230996 gene locus_tag LOCUS_07400 232249 230996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 233421 232270 gene locus_tag LOCUS_07410 233421 232270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 233769 233512 gene locus_tag LOCUS_07420 233769 233512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 234389 234057 gene locus_tag LOCUS_07430 234389 234057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 234788 234402 gene locus_tag LOCUS_07440 234788 234402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 235201 234902 gene locus_tag LOCUS_07450 235201 234902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 235562 235254 gene locus_tag LOCUS_07460 235562 235254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_07460 237169 235640 gene locus_tag LOCUS_07470 237169 235640 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_07470 237851 237231 gene locus_tag LOCUS_07480 gene rex 237851 237231 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL25 protein_id gnl|my_center|LOCUS_07480 239749 237986 gene locus_tag LOCUS_07490 239749 237986 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07490 241113 239746 gene locus_tag LOCUS_07500 241113 239746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 242402 241245 gene locus_tag LOCUS_07510 gene clpX 242402 241245 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_07510 242601 243155 gene locus_tag LOCUS_07520 242601 243155 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_07520 243163 243861 gene locus_tag LOCUS_07530 243163 243861 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405389.1 protein_id gnl|my_center|LOCUS_07530 243936 245015 gene locus_tag LOCUS_07540 gene ansA 243936 245015 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404454.1 protein_id gnl|my_center|LOCUS_07540 246389 245043 gene locus_tag LOCUS_07550 246389 245043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 246915 246538 gene locus_tag LOCUS_07560 246915 246538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 247214 246912 gene locus_tag LOCUS_07570 247214 246912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 249589 247211 gene locus_tag LOCUS_07580 249589 247211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 250096 249704 gene locus_tag LOCUS_07590 250096 249704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 250443 250096 gene locus_tag LOCUS_07600 250443 250096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 250625 252184 gene locus_tag LOCUS_07610 250625 252184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 252195 252605 gene locus_tag LOCUS_07620 252195 252605 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_07620 252598 254178 gene locus_tag LOCUS_07630 252598 254178 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_07630 255693 254236 gene locus_tag LOCUS_07640 255693 254236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 256016 256366 gene locus_tag LOCUS_07650 256016 256366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 256366 257328 gene locus_tag LOCUS_07660 256366 257328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 258522 257332 gene locus_tag LOCUS_07670 258522 257332 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHD7 protein_id gnl|my_center|LOCUS_07670 258598 260001 gene locus_tag LOCUS_07680 258598 260001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 259998 261359 gene locus_tag LOCUS_07690 259998 261359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 261443 262954 gene locus_tag LOCUS_07700 261443 262954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 264094 263012 gene locus_tag LOCUS_07710 264094 263012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 264878 264396 gene locus_tag LOCUS_07720 264878 264396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_07720 265773 264982 gene locus_tag LOCUS_07730 265773 264982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 266054 270490 gene locus_tag LOCUS_07740 266054 270490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 270678 271391 gene locus_tag LOCUS_07750 gene hfsD 270678 271391 CDS product polysaccharide secretin protein HfsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 protein_id gnl|my_center|LOCUS_07750 271488 272954 gene locus_tag LOCUS_07760 271488 272954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920289.1 protein_id gnl|my_center|LOCUS_07760 272968 274551 gene locus_tag LOCUS_07770 272968 274551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 274619 275863 gene locus_tag LOCUS_07780 274619 275863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 277057 275897 gene locus_tag LOCUS_07790 277057 275897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_07790 279128 277146 gene locus_tag LOCUS_07800 279128 277146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 279666 279244 gene locus_tag LOCUS_07810 279666 279244 CDS product blasticidin S-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703859.1 protein_id gnl|my_center|LOCUS_07810 279738 281273 gene locus_tag LOCUS_07820 279738 281273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 281275 282483 gene locus_tag LOCUS_07830 281275 282483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 282480 283754 gene locus_tag LOCUS_07840 282480 283754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 285664 283649 gene locus_tag LOCUS_07850 285664 283649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 285837 287345 gene locus_tag LOCUS_07860 285837 287345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 287308 288222 gene locus_tag LOCUS_07870 287308 288222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 288219 290672 gene locus_tag LOCUS_07880 288219 290672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 290681 291565 gene locus_tag LOCUS_07890 290681 291565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 292362 291541 gene locus_tag LOCUS_07900 292362 291541 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_07900 292677 292531 gene locus_tag LOCUS_07910 292677 292531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 296368 293276 gene locus_tag LOCUS_07920 296368 293276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 296936 296799 gene locus_tag LOCUS_07930 296936 296799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 297175 297038 gene locus_tag LOCUS_07940 297175 297038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 297969 299108 gene locus_tag LOCUS_07950 gene aroC 297969 299108 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_07950 299105 299305 gene locus_tag LOCUS_07960 299105 299305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 299468 299950 gene locus_tag LOCUS_07970 299468 299950 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_07970 299947 300642 gene locus_tag LOCUS_07980 gene lolD1 299947 300642 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_07980 300627 304139 gene locus_tag LOCUS_07990 300627 304139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_07990 304194 304652 gene locus_tag LOCUS_08000 304194 304652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 305181 304699 gene locus_tag LOCUS_08010 305181 304699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 305692 306258 gene locus_tag LOCUS_08020 305692 306258 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_08020 306270 307100 gene locus_tag LOCUS_08030 306270 307100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 307103 310345 gene locus_tag LOCUS_08040 307103 310345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 311654 310689 gene locus_tag LOCUS_08050 311654 310689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_08050 312354 312448 gene locus_tag LOCUS_t00080 312354 312448 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 314362 312479 gene locus_tag LOCUS_08060 gene mutL 314362 312479 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB42 protein_id gnl|my_center|LOCUS_08060 315632 314421 gene locus_tag LOCUS_08070 315632 314421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 317188 315629 gene locus_tag LOCUS_08080 317188 315629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 318618 317200 gene locus_tag LOCUS_08090 gene algI 318618 317200 CDS product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q6 protein_id gnl|my_center|LOCUS_08090 319484 318807 gene locus_tag LOCUS_08100 319484 318807 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_08100 319874 319494 gene locus_tag LOCUS_08110 319874 319494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 320228 321172 gene locus_tag LOCUS_08120 320228 321172 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204207.1 protein_id gnl|my_center|LOCUS_08120 322461 321169 gene locus_tag LOCUS_08130 322461 321169 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_08130 322676 326923 gene locus_tag LOCUS_08140 322676 326923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 329730 326944 gene locus_tag LOCUS_08150 329730 326944 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(328636..328638),aa:Sec) note codon on position 365 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08150 331262 329742 gene locus_tag LOCUS_08160 331262 329742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 331575 332690 gene locus_tag LOCUS_08170 331575 332690 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_08170 333436 332696 gene locus_tag LOCUS_08180 gene fdhD 333436 332696 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_08180 333675 335321 gene locus_tag LOCUS_08190 333675 335321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 335340 336917 gene locus_tag LOCUS_08200 335340 336917 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_08200 338744 336921 gene locus_tag LOCUS_08210 338744 336921 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08210 339172 340047 gene locus_tag LOCUS_08220 339172 340047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 344222 340077 gene locus_tag LOCUS_08230 344222 340077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 348171 344290 gene locus_tag LOCUS_08240 348171 344290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 351032 348333 gene locus_tag LOCUS_08250 351032 348333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 350997 351215 gene locus_tag LOCUS_08260 350997 351215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 352030 351224 gene locus_tag LOCUS_08270 352030 351224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 352626 352027 gene locus_tag LOCUS_08280 gene algU 352626 352027 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_08280 356038 352649 gene locus_tag LOCUS_08290 356038 352649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120599.1 protein_id gnl|my_center|LOCUS_08290 356214 358316 gene locus_tag LOCUS_08300 356214 358316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 358750 358328 gene locus_tag LOCUS_08310 gene arsC 358750 358328 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_08310 359583 358747 gene locus_tag LOCUS_08320 359583 358747 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_08320 359819 360532 gene locus_tag LOCUS_08330 359819 360532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 360578 362053 gene locus_tag LOCUS_08340 360578 362053 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_08340 362975 362046 gene locus_tag LOCUS_08350 362975 362046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 363085 365139 gene locus_tag LOCUS_08360 363085 365139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 366629 365148 gene locus_tag LOCUS_08370 366629 365148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 <368119 366861 gene locus_tag LOCUS_08380 <368119 366861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674154.1:pullulanase >Feature sequence003 1430 354 gene locus_tag LOCUS_08390 1430 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2047 1490 gene locus_tag LOCUS_08400 2047 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2347 3717 gene locus_tag LOCUS_08410 2347 3717 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_08410 9214 3809 gene locus_tag LOCUS_08420 9214 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10442 9501 gene locus_tag LOCUS_08430 10442 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15848 10449 gene locus_tag LOCUS_08440 15848 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16705 16013 gene locus_tag LOCUS_08450 16705 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18255 16738 gene locus_tag LOCUS_08460 18255 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 18914 18270 gene locus_tag LOCUS_08470 18914 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 19508 18918 gene locus_tag LOCUS_08480 19508 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 21474 19696 gene locus_tag LOCUS_08490 21474 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 22262 21474 gene locus_tag LOCUS_08500 gene pilD 22262 21474 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_08500 22946 22413 gene locus_tag LOCUS_08510 22946 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 24715 23267 gene locus_tag LOCUS_08520 24715 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 24726 26414 gene locus_tag LOCUS_08530 24726 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 26514 28388 gene locus_tag LOCUS_08540 26514 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 28476 30119 gene locus_tag LOCUS_08550 28476 30119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_08550 30116 30448 gene locus_tag LOCUS_08560 30116 30448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_08560 32139 30601 gene locus_tag LOCUS_08570 32139 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 32329 33861 gene locus_tag LOCUS_08580 gene accC 32329 33861 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_08580 33861 34379 gene locus_tag LOCUS_08590 33861 34379 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_08590 34618 34385 gene locus_tag LOCUS_08600 34618 34385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 34991 34611 gene locus_tag LOCUS_08610 34991 34611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 35994 35101 gene locus_tag LOCUS_08620 35994 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_08620 37057 36026 gene locus_tag LOCUS_08630 gene ruvB 37057 36026 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEJ5 protein_id gnl|my_center|LOCUS_08630 37669 37073 gene locus_tag LOCUS_08640 gene ruvA 37669 37073 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_08640 39650 37695 gene locus_tag LOCUS_08650 39650 37695 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_08650 40022 41368 gene locus_tag LOCUS_08660 40022 41368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 41495 42520 gene locus_tag LOCUS_08670 gene mreB-1 41495 42520 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08670 42524 43450 gene locus_tag LOCUS_08680 42524 43450 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL21 protein_id gnl|my_center|LOCUS_08680 43447 43983 gene locus_tag LOCUS_08690 43447 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 44018 45820 gene locus_tag LOCUS_08700 gene mrdA 44018 45820 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_08700 45771 46913 gene locus_tag LOCUS_08710 gene rodA 45771 46913 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_08710 46946 48490 gene locus_tag LOCUS_08720 gene cafA 46946 48490 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_08720 48494 50740 gene locus_tag LOCUS_08730 48494 50740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 51388 50789 gene locus_tag LOCUS_08740 51388 50789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 52239 51571 gene locus_tag LOCUS_08750 52239 51571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 54323 52449 gene locus_tag LOCUS_08760 54323 52449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 55536 54313 gene locus_tag LOCUS_08770 gene tqsA 55536 54313 CDS product pheromone autoinducer 2 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366785.1 protein_id gnl|my_center|LOCUS_08770 55994 55638 gene locus_tag LOCUS_08780 55994 55638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 56547 56110 gene locus_tag LOCUS_08790 gene dut 56547 56110 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_08790 57331 56567 gene locus_tag LOCUS_08800 57331 56567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 57810 57325 gene locus_tag LOCUS_08810 gene oxpG 57810 57325 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_08810 58359 57856 gene locus_tag LOCUS_08820 gene pulG 58359 57856 CDS product type II secretion system pseudopilin PulG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_08820 60491 58566 gene locus_tag LOCUS_08830 60491 58566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 61074 60505 gene locus_tag LOCUS_08840 61074 60505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 61763 61071 gene locus_tag LOCUS_08850 61763 61071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 63166 61760 gene locus_tag LOCUS_08860 63166 61760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 64129 63170 gene locus_tag LOCUS_08870 64129 63170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 65807 64119 gene locus_tag LOCUS_08880 gene pulE 65807 64119 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_08880 67080 65866 gene locus_tag LOCUS_08890 gene pulF 67080 65866 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_08890 67906 67085 gene locus_tag LOCUS_08900 67906 67085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 69215 68529 gene locus_tag LOCUS_08910 69215 68529 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_08910 69365 70666 gene locus_tag LOCUS_08920 gene waaA 69365 70666 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_08920 70663 71694 gene locus_tag LOCUS_08930 gene lpxK 70663 71694 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AU2 protein_id gnl|my_center|LOCUS_08930 71840 72682 gene locus_tag LOCUS_08940 71840 72682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 73080 72730 gene locus_tag LOCUS_08950 73080 72730 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141375.1 protein_id gnl|my_center|LOCUS_08950 73558 73109 gene locus_tag LOCUS_08960 73558 73109 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_08960 74895 73558 gene locus_tag LOCUS_08970 74895 73558 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_08970 76220 74892 gene locus_tag LOCUS_08980 76220 74892 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_08980 77008 76232 gene locus_tag LOCUS_08990 77008 76232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_08990 78515 77067 gene locus_tag LOCUS_09000 gene ycf24 78515 77067 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_09000 79098 78643 gene locus_tag LOCUS_09010 79098 78643 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_09010 79669 81429 gene locus_tag LOCUS_09020 79669 81429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 82161 81514 gene locus_tag LOCUS_09030 82161 81514 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_09030 82106 82273 gene locus_tag LOCUS_09040 82106 82273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 82307 82381 gene locus_tag LOCUS_t00090 82307 82381 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 82447 83811 gene locus_tag LOCUS_09050 82447 83811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 83851 84771 gene locus_tag LOCUS_09060 83851 84771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_09060 84812 86125 gene locus_tag LOCUS_09070 gene fahA 84812 86125 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_09070 86156 88150 gene locus_tag LOCUS_09080 86156 88150 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_09080 88462 89742 gene locus_tag LOCUS_09090 88462 89742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 89918 90130 gene locus_tag LOCUS_09100 89918 90130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 90378 91133 gene locus_tag LOCUS_09110 90378 91133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 91137 92201 gene locus_tag LOCUS_09120 91137 92201 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_09120 92210 92794 gene locus_tag LOCUS_09130 92210 92794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_09130 92791 93072 gene locus_tag LOCUS_09140 92791 93072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 93187 95010 gene locus_tag LOCUS_09150 93187 95010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 95169 97325 gene locus_tag LOCUS_09160 95169 97325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 97332 98480 gene locus_tag LOCUS_09170 97332 98480 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_09170 100343 98565 gene locus_tag LOCUS_09180 100343 98565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 103227 100462 gene locus_tag LOCUS_09190 103227 100462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 103823 103224 gene locus_tag LOCUS_09200 103823 103224 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_09200 104865 103975 gene locus_tag LOCUS_09210 104865 103975 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_09210 105016 106008 gene locus_tag LOCUS_09220 105016 106008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 107057 106812 gene locus_tag LOCUS_09230 107057 106812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 107548 106997 gene locus_tag LOCUS_09240 107548 106997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 109055 107586 gene locus_tag LOCUS_09250 gene panF 109055 107586 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_09250 109398 109057 gene locus_tag LOCUS_09260 109398 109057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 109463 110194 gene locus_tag LOCUS_09270 gene smuG1 109463 110194 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_09270 110199 111671 gene locus_tag LOCUS_09280 110199 111671 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 protein_id gnl|my_center|LOCUS_09280 112137 111709 gene locus_tag LOCUS_09290 112137 111709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 112658 112338 gene locus_tag LOCUS_09300 112658 112338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 113013 113270 gene locus_tag LOCUS_09310 113013 113270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 113267 114208 gene locus_tag LOCUS_09320 113267 114208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 114548 115309 gene locus_tag LOCUS_09330 114548 115309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 115510 116289 gene locus_tag LOCUS_09340 115510 116289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 116543 116313 gene locus_tag LOCUS_09350 116543 116313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 117021 116500 gene locus_tag LOCUS_09360 117021 116500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 117954 117076 gene locus_tag LOCUS_09370 117954 117076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 121681 118112 gene locus_tag LOCUS_09380 121681 118112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 122682 121693 gene locus_tag LOCUS_09390 122682 121693 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706832.1 protein_id gnl|my_center|LOCUS_09390 124268 122679 gene locus_tag LOCUS_09400 124268 122679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 124604 124272 gene locus_tag LOCUS_09410 124604 124272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 125093 124692 gene locus_tag LOCUS_09420 125093 124692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 127542 125305 gene locus_tag LOCUS_09430 127542 125305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 128276 127599 gene locus_tag LOCUS_09440 128276 127599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 128603 129343 gene locus_tag LOCUS_09450 gene lepB 128603 129343 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP9 protein_id gnl|my_center|LOCUS_09450 129421 130098 gene locus_tag LOCUS_09460 129421 130098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 130270 130638 gene locus_tag LOCUS_09470 130270 130638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 130723 132498 gene locus_tag LOCUS_09480 130723 132498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 132911 132501 gene locus_tag LOCUS_09490 132911 132501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 133792 132911 gene locus_tag LOCUS_09500 133792 132911 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_09500 134524 133868 gene locus_tag LOCUS_09510 gene soj 134524 133868 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_09510 135391 134753 gene locus_tag LOCUS_09520 135391 134753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 137075 135684 gene locus_tag LOCUS_09530 137075 135684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 138914 137187 gene locus_tag LOCUS_09540 138914 137187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 139228 139019 gene locus_tag LOCUS_09550 139228 139019 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS22 protein_id gnl|my_center|LOCUS_09550 139563 139225 gene locus_tag LOCUS_09560 139563 139225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 140357 140268 gene locus_tag LOCUS_t00100 140357 140268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 140539 140450 gene locus_tag LOCUS_t00110 140539 140450 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 141029 140562 gene locus_tag LOCUS_09570 gene tadA 141029 140562 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEQ5 protein_id gnl|my_center|LOCUS_09570 141395 142975 gene locus_tag LOCUS_09580 141395 142975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 142972 143265 gene locus_tag LOCUS_09590 gene yaaK 142972 143265 CDS product nucleoid-associated protein YaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24281 protein_id gnl|my_center|LOCUS_09590 143286 143870 gene locus_tag LOCUS_09600 gene recR 143286 143870 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_09600 143873 145237 gene locus_tag LOCUS_09610 gene argD 143873 145237 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJU9 protein_id gnl|my_center|LOCUS_09610 145234 145818 gene locus_tag LOCUS_09620 145234 145818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 145877 146872 gene locus_tag LOCUS_09630 145877 146872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 148200 146917 gene locus_tag LOCUS_09640 gene dnaA 148200 146917 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG6 protein_id gnl|my_center|LOCUS_09640 148444 149511 gene locus_tag LOCUS_09650 148444 149511 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140868.1 protein_id gnl|my_center|LOCUS_09650 149796 150890 gene locus_tag LOCUS_09660 149796 150890 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_09660 150913 151992 gene locus_tag LOCUS_09670 gene recF 150913 151992 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7H0 protein_id gnl|my_center|LOCUS_09670 152358 154829 gene locus_tag LOCUS_09680 gene gyrB 152358 154829 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE9 protein_id gnl|my_center|LOCUS_09680 154951 157632 gene locus_tag LOCUS_09690 gene gyrA 154951 157632 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_09690 157735 158391 gene locus_tag LOCUS_09700 gene tal 157735 158391 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYD1 protein_id gnl|my_center|LOCUS_09700 158535 159926 gene locus_tag LOCUS_09710 158535 159926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_09710 159931 160479 gene locus_tag LOCUS_09720 159931 160479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 160476 161513 gene locus_tag LOCUS_09730 160476 161513 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_09730 161706 162998 gene locus_tag LOCUS_09740 161706 162998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 163180 165813 gene locus_tag LOCUS_09750 163180 165813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 167551 165818 gene locus_tag LOCUS_09760 167551 165818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 167882 169705 gene locus_tag LOCUS_09770 167882 169705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 169892 172033 gene locus_tag LOCUS_09780 169892 172033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 172033 173250 gene locus_tag LOCUS_09790 172033 173250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 173316 174617 gene locus_tag LOCUS_09800 173316 174617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 174865 177807 gene locus_tag LOCUS_09810 174865 177807 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039200.1 protein_id gnl|my_center|LOCUS_09810 177909 179783 gene locus_tag LOCUS_09820 177909 179783 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09820 179854 181701 gene locus_tag LOCUS_09830 179854 181701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 181977 183638 gene locus_tag LOCUS_09840 181977 183638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 183635 185698 gene locus_tag LOCUS_09850 183635 185698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 186008 186379 gene locus_tag LOCUS_09860 186008 186379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 186938 186495 gene locus_tag LOCUS_09870 186938 186495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 186913 187200 gene locus_tag LOCUS_09880 186913 187200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 187399 187581 gene locus_tag LOCUS_09890 187399 187581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 189041 187824 gene locus_tag LOCUS_09900 189041 187824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 189312 191024 gene locus_tag LOCUS_09910 189312 191024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 191082 191852 gene locus_tag LOCUS_09920 191082 191852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 191852 193873 gene locus_tag LOCUS_09930 191852 193873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 194968 193883 gene locus_tag LOCUS_09940 gene mtnA 194968 193883 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX9 protein_id gnl|my_center|LOCUS_09940 195100 196113 gene locus_tag LOCUS_09950 gene eutD 195100 196113 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582992.1 protein_id gnl|my_center|LOCUS_09950 196110 197393 gene locus_tag LOCUS_09960 gene purD 196110 197393 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_09960 197680 198414 gene locus_tag LOCUS_09970 197680 198414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 198411 198803 gene locus_tag LOCUS_09980 198411 198803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 198813 199838 gene locus_tag LOCUS_09990 gene pdxA 198813 199838 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3U3 protein_id gnl|my_center|LOCUS_09990 200007 201614 gene locus_tag LOCUS_10000 gene pckA2 200007 201614 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_10000 203126 201615 gene locus_tag LOCUS_10010 203126 201615 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_10010 203188 206190 gene locus_tag LOCUS_10020 203188 206190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 206281 208515 gene locus_tag LOCUS_10030 206281 208515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_10030 209553 208525 gene locus_tag LOCUS_10040 209553 208525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 210976 209678 gene locus_tag LOCUS_10050 210976 209678 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_10050 211306 211010 gene locus_tag LOCUS_10060 211306 211010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173644.1 protein_id gnl|my_center|LOCUS_10060 212698 211400 gene locus_tag LOCUS_10070 212698 211400 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_10070 213585 212695 gene locus_tag LOCUS_10080 213585 212695 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 protein_id gnl|my_center|LOCUS_10080 214886 213672 gene locus_tag LOCUS_10090 214886 213672 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_10090 215121 215474 gene locus_tag LOCUS_10100 215121 215474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 215720 215508 gene locus_tag LOCUS_10110 215720 215508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 215974 215741 gene locus_tag LOCUS_10120 215974 215741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 216519 216094 gene locus_tag LOCUS_10130 216519 216094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 217211 216624 gene locus_tag LOCUS_10140 217211 216624 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8I4 protein_id gnl|my_center|LOCUS_10140 217389 220139 gene locus_tag LOCUS_10150 217389 220139 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_10150 220484 220873 gene locus_tag LOCUS_10160 gene queD 220484 220873 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_10160 220885 221571 gene locus_tag LOCUS_10170 gene queE 220885 221571 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_10170 223916 221574 gene locus_tag LOCUS_10180 223916 221574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 226336 223913 gene locus_tag LOCUS_10190 226336 223913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_10190 226405 227274 gene locus_tag LOCUS_10200 226405 227274 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_10200 227426 228106 gene locus_tag LOCUS_10210 227426 228106 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_10210 228115 229539 gene locus_tag LOCUS_10220 228115 229539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 229536 232346 gene locus_tag LOCUS_10230 229536 232346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 233349 232333 gene locus_tag LOCUS_10240 233349 232333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 236048 233403 gene locus_tag LOCUS_10250 236048 233403 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_10250 237227 236157 gene locus_tag LOCUS_10260 237227 236157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 239210 237525 gene locus_tag LOCUS_10270 239210 237525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 241129 239207 gene locus_tag LOCUS_10280 241129 239207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 242153 241143 gene locus_tag LOCUS_10290 242153 241143 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_10290 244108 242150 gene locus_tag LOCUS_10300 244108 242150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 245583 244291 gene locus_tag LOCUS_10310 245583 244291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 247051 245618 gene locus_tag LOCUS_10320 247051 245618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 247971 247051 gene locus_tag LOCUS_10330 247971 247051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 248180 249208 gene locus_tag LOCUS_10340 248180 249208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_10340 250104 249759 gene locus_tag LOCUS_tm00010 250104 249759 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 250709 250206 gene locus_tag LOCUS_10350 250709 250206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 251728 250745 gene locus_tag LOCUS_10360 251728 250745 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_10360 251764 252510 gene locus_tag LOCUS_10370 251764 252510 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_10370 252656 254095 gene locus_tag LOCUS_10380 252656 254095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 254092 254838 gene locus_tag LOCUS_10390 254092 254838 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_10390 256654 254867 gene locus_tag LOCUS_10400 256654 254867 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_10400 257201 256695 gene locus_tag LOCUS_10410 257201 256695 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_10410 258047 257328 gene locus_tag LOCUS_10420 gene yggS 258047 257328 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_10420 258869 258102 gene locus_tag LOCUS_10430 258869 258102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 259083 259008 gene locus_tag LOCUS_t00120 259083 259008 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 261202 259142 gene locus_tag LOCUS_10440 261202 259142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 261652 262500 gene locus_tag LOCUS_10450 261652 262500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 262874 263083 gene locus_tag LOCUS_10460 gene rpsU 262874 263083 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKU0 protein_id gnl|my_center|LOCUS_10460 263212 265665 gene locus_tag LOCUS_10470 gene mutS2 263212 265665 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FQ9 protein_id gnl|my_center|LOCUS_10470 265667 267481 gene locus_tag LOCUS_10480 gene dnaG 265667 267481 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3X9 protein_id gnl|my_center|LOCUS_10480 267554 269257 gene locus_tag LOCUS_10490 gene rpoD 267554 269257 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_10490 269753 269343 gene locus_tag LOCUS_10500 gene vapC21 269753 269343 CDS product ribonuclease VapC21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF91 protein_id gnl|my_center|LOCUS_10500 269962 269750 gene locus_tag LOCUS_10510 269962 269750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 270109 270519 gene locus_tag LOCUS_10520 gene mecI 270109 270519 CDS product mecA-type methicillin resistance repressor MecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369214.1 protein_id gnl|my_center|LOCUS_10520 270516 272192 gene locus_tag LOCUS_10530 270516 272192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 273863 272268 gene locus_tag LOCUS_10540 273863 272268 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_10540 274012 274983 gene locus_tag LOCUS_10550 gene thrB 274012 274983 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_10550 276316 275159 gene locus_tag LOCUS_10560 gene hemH 276316 275159 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTB6 protein_id gnl|my_center|LOCUS_10560 277611 276394 gene locus_tag LOCUS_10570 277611 276394 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_10570 278653 277628 gene locus_tag LOCUS_10580 278653 277628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 279647 278754 gene locus_tag LOCUS_10590 279647 278754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 280815 279655 gene locus_tag LOCUS_10600 280815 279655 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_10600 281732 280983 gene locus_tag LOCUS_10610 281732 280983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 282563 281841 gene locus_tag LOCUS_10620 282563 281841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 283383 282691 gene locus_tag LOCUS_10630 283383 282691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 284544 283390 gene locus_tag LOCUS_10640 284544 283390 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_10640 285662 284574 gene locus_tag LOCUS_10650 285662 284574 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_10650 286495 285842 gene locus_tag LOCUS_10660 gene miaE 286495 285842 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_10660 286777 288330 gene locus_tag LOCUS_10670 286777 288330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 288375 290018 gene locus_tag LOCUS_10680 288375 290018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 290056 291639 gene locus_tag LOCUS_10690 290056 291639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 292667 291672 gene locus_tag LOCUS_10700 292667 291672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 293896 292826 gene locus_tag LOCUS_10710 gene ychF 293896 292826 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1T1 protein_id gnl|my_center|LOCUS_10710 295509 294199 gene locus_tag LOCUS_10720 295509 294199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 296884 295571 gene locus_tag LOCUS_10730 296884 295571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 297018 298610 gene locus_tag LOCUS_10740 297018 298610 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_10740 298800 299036 gene locus_tag LOCUS_10750 298800 299036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 299049 299492 gene locus_tag LOCUS_10760 gene rpiB 299049 299492 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_10760 299592 300845 gene locus_tag LOCUS_10770 gene glyA 299592 300845 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_10770 300888 302219 gene locus_tag LOCUS_10780 300888 302219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 303365 302316 gene locus_tag LOCUS_10790 303365 302316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 304630 303362 gene locus_tag LOCUS_10800 gene folC 304630 303362 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_10800 305564 304713 gene locus_tag LOCUS_10810 gene accD 305564 304713 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_10810 305837 305610 gene locus_tag LOCUS_10820 305837 305610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 309955 306071 gene locus_tag LOCUS_10830 309955 306071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 310435 311181 gene locus_tag LOCUS_10840 310435 311181 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS2 protein_id gnl|my_center|LOCUS_10840 311192 311725 gene locus_tag LOCUS_10850 gene ruvC 311192 311725 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC90 protein_id gnl|my_center|LOCUS_10850 312105 312806 gene locus_tag LOCUS_10860 312105 312806 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_10860 312844 313281 gene locus_tag LOCUS_10870 gene exbD 312844 313281 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_10870 313285 313776 gene locus_tag LOCUS_10880 313285 313776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 313875 314600 gene locus_tag LOCUS_10890 313875 314600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 314641 315459 gene locus_tag LOCUS_10900 314641 315459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 315596 316753 gene locus_tag LOCUS_10910 315596 316753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 317795 316857 gene locus_tag LOCUS_10920 317795 316857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 318541 317792 gene locus_tag LOCUS_10930 gene ftsE 318541 317792 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_10930 320028 318538 gene locus_tag LOCUS_10940 gene gatB 320028 318538 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_10940 320167 320814 gene locus_tag LOCUS_10950 320167 320814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 321893 320808 gene locus_tag LOCUS_10960 gene rlmN 321893 320808 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_10960 322254 321898 gene locus_tag LOCUS_10970 322254 321898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 322544 322726 gene locus_tag LOCUS_10980 gene tatA 322544 322726 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM8 protein_id gnl|my_center|LOCUS_10980 323458 322754 gene locus_tag LOCUS_10990 323458 322754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 323909 323652 gene locus_tag LOCUS_11000 323909 323652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 325252 324023 gene locus_tag LOCUS_11010 325252 324023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 326310 325570 gene locus_tag LOCUS_11020 326310 325570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 327293 326430 gene locus_tag LOCUS_11030 327293 326430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 327964 327290 gene locus_tag LOCUS_11040 327964 327290 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP3 protein_id gnl|my_center|LOCUS_11040 328782 327961 gene locus_tag LOCUS_11050 328782 327961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 330208 328892 gene locus_tag LOCUS_11060 330208 328892 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_11060 331108 330290 gene locus_tag LOCUS_11070 gene cdsA 331108 330290 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH16 protein_id gnl|my_center|LOCUS_11070 331993 331166 gene locus_tag LOCUS_11080 331993 331166 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_11080 332837 332028 gene locus_tag LOCUS_11090 gene truA 332837 332028 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 protein_id gnl|my_center|LOCUS_11090 334108 332822 gene locus_tag LOCUS_11100 334108 332822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 334171 335643 gene locus_tag LOCUS_11110 334171 335643 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_11110 339942 335743 gene locus_tag LOCUS_11120 339942 335743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 341402 339939 gene locus_tag LOCUS_11130 341402 339939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 341629 342870 gene locus_tag LOCUS_11140 341629 342870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 345485 343062 gene locus_tag LOCUS_11150 345485 343062 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_11150 347912 345588 gene locus_tag LOCUS_11160 gene pcrA 347912 345588 CDS product ATP-dependent DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34580 protein_id gnl|my_center|LOCUS_11160 348157 349683 gene locus_tag LOCUS_11170 348157 349683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 350308 349697 gene locus_tag LOCUS_11180 350308 349697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932590.1 protein_id gnl|my_center|LOCUS_11180 351594 350347 gene locus_tag LOCUS_11190 351594 350347 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_11190 353486 351663 gene locus_tag LOCUS_11200 gene glmS 353486 351663 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_11200 354983 353529 gene locus_tag LOCUS_11210 gene glmU 354983 353529 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH7 protein_id gnl|my_center|LOCUS_11210 356126 355056 gene locus_tag LOCUS_11220 356126 355056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 356709 356089 gene locus_tag LOCUS_11230 356709 356089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 357315 356731 gene locus_tag LOCUS_11240 gene mglA 357315 356731 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11240 357819 357331 gene locus_tag LOCUS_11250 gene mglB 357819 357331 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_11250 358461 360179 gene locus_tag LOCUS_11260 358461 360179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 360242 361282 gene locus_tag LOCUS_11270 360242 361282 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_11270 361976 361293 gene locus_tag LOCUS_11280 361976 361293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence004 1748 4072 gene locus_tag LOCUS_11290 1748 4072 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_11290 4069 4593 gene locus_tag LOCUS_11300 4069 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4590 6350 gene locus_tag LOCUS_11310 4590 6350 CDS product gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706182.1 protein_id gnl|my_center|LOCUS_11310 6594 6821 gene locus_tag LOCUS_11320 6594 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7078 7308 gene locus_tag LOCUS_11330 7078 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7386 10535 gene locus_tag LOCUS_11340 7386 10535 CDS product lanthionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_11340 10766 10690 gene locus_tag LOCUS_t00130 10766 10690 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10928 12628 gene locus_tag LOCUS_11350 10928 12628 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_11350 12638 13273 gene locus_tag LOCUS_11360 12638 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 13270 15486 gene locus_tag LOCUS_11370 13270 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 17510 15759 gene locus_tag LOCUS_11380 17510 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 21032 17793 gene locus_tag LOCUS_11390 21032 17793 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_11390 22383 21052 gene locus_tag LOCUS_11400 gene nolF 22383 21052 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537778.1 protein_id gnl|my_center|LOCUS_11400 24067 22607 gene locus_tag LOCUS_11410 24067 22607 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_11410 24762 24064 gene locus_tag LOCUS_11420 24762 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 25082 27289 gene locus_tag LOCUS_11430 25082 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 27529 28194 gene locus_tag LOCUS_11440 27529 28194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 28196 29242 gene locus_tag LOCUS_11450 28196 29242 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CM4 protein_id gnl|my_center|LOCUS_11450 29256 30908 gene locus_tag LOCUS_11460 29256 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 30951 33344 gene locus_tag LOCUS_11470 gene napA 30951 33344 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLR4 protein_id gnl|my_center|LOCUS_11470 33391 34098 gene locus_tag LOCUS_11480 33391 34098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 34191 35435 gene locus_tag LOCUS_11490 34191 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_11490 37467 35467 gene locus_tag LOCUS_11500 37467 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 37951 37481 gene locus_tag LOCUS_11510 37951 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 38359 56148 gene locus_tag LOCUS_11520 38359 56148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 60073 56087 gene locus_tag LOCUS_11530 60073 56087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 64376 60318 gene locus_tag LOCUS_11540 64376 60318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 64576 74955 gene locus_tag LOCUS_11550 64576 74955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 74952 76031 gene locus_tag LOCUS_11560 74952 76031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 77933 75999 gene locus_tag LOCUS_11570 77933 75999 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331299.1 protein_id gnl|my_center|LOCUS_11570 79430 78042 gene locus_tag LOCUS_11580 79430 78042 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_11580 79828 86334 gene locus_tag LOCUS_11590 79828 86334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 86331 86744 gene locus_tag LOCUS_11600 86331 86744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 86991 89669 gene locus_tag LOCUS_11610 gene valS 86991 89669 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL27 protein_id gnl|my_center|LOCUS_11610 89707 90234 gene locus_tag LOCUS_11620 89707 90234 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141970.1 protein_id gnl|my_center|LOCUS_11620 90262 91296 gene locus_tag LOCUS_11630 90262 91296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 92317 91313 gene locus_tag LOCUS_11640 92317 91313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 97201 92474 gene locus_tag LOCUS_11650 97201 92474 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_11650 98944 97631 gene locus_tag LOCUS_11660 98944 97631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_11660 101079 98950 gene locus_tag LOCUS_11670 101079 98950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 101437 101225 gene locus_tag LOCUS_11680 101437 101225 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_11680 102470 101550 gene locus_tag LOCUS_11690 102470 101550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 104901 102616 gene locus_tag LOCUS_11700 104901 102616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 105955 104948 gene locus_tag LOCUS_11710 gene batA 105955 104948 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_11710 106473 105952 gene locus_tag LOCUS_11720 106473 105952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 107411 106470 gene locus_tag LOCUS_11730 107411 106470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 108442 107456 gene locus_tag LOCUS_11740 108442 107456 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_11740 108550 109347 gene locus_tag LOCUS_11750 108550 109347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_11750 109344 110324 gene locus_tag LOCUS_11760 109344 110324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 113049 110326 gene locus_tag LOCUS_11770 113049 110326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_11770 113363 113046 gene locus_tag LOCUS_11780 113363 113046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 113831 115204 gene locus_tag LOCUS_11790 113831 115204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 115156 115557 gene locus_tag LOCUS_11800 115156 115557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 115728 115600 gene locus_tag LOCUS_11810 115728 115600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 119083 115919 gene locus_tag LOCUS_11820 119083 115919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_11820 120006 119116 gene locus_tag LOCUS_11830 120006 119116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 120732 120037 gene locus_tag LOCUS_11840 120732 120037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 121208 121897 gene locus_tag LOCUS_11850 121208 121897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 122769 122002 gene locus_tag LOCUS_11860 122769 122002 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189909.1 protein_id gnl|my_center|LOCUS_11860 123668 122775 gene locus_tag LOCUS_11870 gene hbd 123668 122775 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_11870 123963 125846 gene locus_tag LOCUS_11880 123963 125846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 125988 127223 gene locus_tag LOCUS_11890 125988 127223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_11890 127264 128544 gene locus_tag LOCUS_11900 127264 128544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 131051 128562 gene locus_tag LOCUS_11910 131051 128562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_11910 132092 131172 gene locus_tag LOCUS_11920 132092 131172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 132901 132518 gene locus_tag LOCUS_11930 132901 132518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 132894 134600 gene locus_tag LOCUS_11940 132894 134600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 135171 134665 gene locus_tag LOCUS_11950 135171 134665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 136331 135279 gene locus_tag LOCUS_11960 136331 135279 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865348.1 protein_id gnl|my_center|LOCUS_11960 137584 136328 gene locus_tag LOCUS_11970 137584 136328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 138784 137654 gene locus_tag LOCUS_11980 gene rlmD 138784 137654 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N719 protein_id gnl|my_center|LOCUS_11980 140040 138799 gene locus_tag LOCUS_11990 140040 138799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 141215 140151 gene locus_tag LOCUS_12000 141215 140151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_12000 142128 141784 gene locus_tag LOCUS_12010 142128 141784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 142324 143310 gene locus_tag LOCUS_12020 142324 143310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 144143 145804 gene locus_tag LOCUS_12030 gene ilvD 144143 145804 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51785 protein_id gnl|my_center|LOCUS_12030 145934 146968 gene locus_tag LOCUS_12040 145934 146968 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_12040 146979 148703 gene locus_tag LOCUS_12050 146979 148703 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJ01 protein_id gnl|my_center|LOCUS_12050 148700 149299 gene locus_tag LOCUS_12060 148700 149299 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_12060 149400 150452 gene locus_tag LOCUS_12070 gene ilvC 149400 150452 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC26 protein_id gnl|my_center|LOCUS_12070 150544 151506 gene locus_tag LOCUS_12080 150544 151506 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_103723.2 protein_id gnl|my_center|LOCUS_12080 152306 151512 gene locus_tag LOCUS_12090 152306 151512 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729816.1 protein_id gnl|my_center|LOCUS_12090 153090 152488 gene locus_tag LOCUS_12100 153090 152488 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_12100 153622 153317 gene locus_tag LOCUS_12110 153622 153317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 155276 153672 gene locus_tag LOCUS_12120 gene prnC 155276 153672 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118477.1 protein_id gnl|my_center|LOCUS_12120 156299 155310 gene locus_tag LOCUS_12130 156299 155310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 157626 156292 gene locus_tag LOCUS_12140 157626 156292 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_12140 157748 161047 gene locus_tag LOCUS_12150 157748 161047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 161164 163413 gene locus_tag LOCUS_12160 161164 163413 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140315.1 protein_id gnl|my_center|LOCUS_12160 163686 166112 gene locus_tag LOCUS_12170 163686 166112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_12170 166291 167442 gene locus_tag LOCUS_12180 gene pntA 166291 167442 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_12180 167439 167726 gene locus_tag LOCUS_12190 167439 167726 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_12190 167723 169150 gene locus_tag LOCUS_12200 167723 169150 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H2 protein_id gnl|my_center|LOCUS_12200 169198 170952 gene locus_tag LOCUS_12210 169198 170952 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969826.1 protein_id gnl|my_center|LOCUS_12210 170988 171680 gene locus_tag LOCUS_12220 170988 171680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 171803 174013 gene locus_tag LOCUS_12230 gene relA 171803 174013 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_12230 174600 174184 gene locus_tag LOCUS_12240 174600 174184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 174974 176029 gene locus_tag LOCUS_12250 gene pilM 174974 176029 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_12250 176032 176667 gene locus_tag LOCUS_12260 176032 176667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 176716 177294 gene locus_tag LOCUS_12270 176716 177294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 177291 177863 gene locus_tag LOCUS_12280 177291 177863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 178105 180582 gene locus_tag LOCUS_12290 178105 180582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 180705 181277 gene locus_tag LOCUS_12300 180705 181277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 181331 183154 gene locus_tag LOCUS_12310 181331 183154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 183357 184433 gene locus_tag LOCUS_12320 183357 184433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 184673 186631 gene locus_tag LOCUS_12330 184673 186631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 186621 186974 gene locus_tag LOCUS_12340 186621 186974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 187039 187533 gene locus_tag LOCUS_12350 gene accB 187039 187533 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_12350 187560 188921 gene locus_tag LOCUS_12360 gene accC 187560 188921 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_12360 188950 189660 gene locus_tag LOCUS_12370 gene thiE 188950 189660 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_12370 189657 191135 gene locus_tag LOCUS_12380 189657 191135 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_12380 191132 191266 gene locus_tag LOCUS_12390 191132 191266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 191263 191856 gene locus_tag LOCUS_12400 gene aroK 191263 191856 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I9 protein_id gnl|my_center|LOCUS_12400 191882 192625 gene locus_tag LOCUS_12410 191882 192625 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_12410 192662 193921 gene locus_tag LOCUS_12420 192662 193921 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_12420 194429 193962 gene locus_tag LOCUS_12430 194429 193962 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_12430 194725 194426 gene locus_tag LOCUS_12440 194725 194426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 195923 194775 gene locus_tag LOCUS_12450 195923 194775 CDS product bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786370.1 protein_id gnl|my_center|LOCUS_12450 196080 196823 gene locus_tag LOCUS_12460 gene sfsA 196080 196823 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_12460 198234 197032 gene locus_tag LOCUS_12470 198234 197032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 198546 202658 gene locus_tag LOCUS_12480 198546 202658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 202734 203054 gene locus_tag LOCUS_12490 202734 203054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 203420 203079 gene locus_tag LOCUS_12500 203420 203079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 203898 203665 gene locus_tag LOCUS_12510 203898 203665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 204128 203895 gene locus_tag LOCUS_12520 204128 203895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 205855 204176 gene locus_tag LOCUS_12530 gene asnB 205855 204176 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_12530 206321 207076 gene locus_tag LOCUS_12540 206321 207076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 209840 207090 gene locus_tag LOCUS_12550 209840 207090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 210487 209837 gene locus_tag LOCUS_12560 210487 209837 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120523.1 protein_id gnl|my_center|LOCUS_12560 210935 210603 gene locus_tag LOCUS_12570 210935 210603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 211225 210932 gene locus_tag LOCUS_12580 211225 210932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 214571 211278 gene locus_tag LOCUS_12590 214571 211278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 215140 214568 gene locus_tag LOCUS_12600 215140 214568 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_12600 216135 215146 gene locus_tag LOCUS_12610 gene selD 216135 215146 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_12610 219988 216383 gene locus_tag LOCUS_12620 219988 216383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 220404 225281 gene locus_tag LOCUS_12630 220404 225281 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_12630 227698 225278 gene locus_tag LOCUS_12640 227698 225278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_12640 229877 227850 gene locus_tag LOCUS_12650 229877 227850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 230979 229888 gene locus_tag LOCUS_12660 230979 229888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 231351 232424 gene locus_tag LOCUS_12670 gene clpX 231351 232424 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67356 protein_id gnl|my_center|LOCUS_12670 232421 232942 gene locus_tag LOCUS_12680 232421 232942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_12680 233068 233490 gene locus_tag LOCUS_12690 233068 233490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 233502 238601 gene locus_tag LOCUS_12700 233502 238601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 238601 238942 gene locus_tag LOCUS_12710 238601 238942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 240487 239396 gene locus_tag LOCUS_12720 gene cfa 240487 239396 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946865.1 protein_id gnl|my_center|LOCUS_12720 241830 240613 gene locus_tag LOCUS_12730 gene cfa 241830 240613 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946865.1 protein_id gnl|my_center|LOCUS_12730 242272 247074 gene locus_tag LOCUS_12740 242272 247074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 247065 247892 gene locus_tag LOCUS_12750 247065 247892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 247889 257068 gene locus_tag LOCUS_12760 247889 257068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 257469 257074 gene locus_tag LOCUS_12770 257469 257074 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_12770 257720 257466 gene locus_tag LOCUS_12780 257720 257466 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_12780 260988 257767 gene locus_tag LOCUS_12790 260988 257767 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J9 protein_id gnl|my_center|LOCUS_12790 261141 261665 gene locus_tag LOCUS_12800 261141 261665 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389206.1 protein_id gnl|my_center|LOCUS_12800 261775 262137 gene locus_tag LOCUS_12810 261775 262137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 262198 262680 gene locus_tag LOCUS_12820 262198 262680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 263150 263998 gene locus_tag LOCUS_12830 263150 263998 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708196.1 protein_id gnl|my_center|LOCUS_12830 264008 265216 gene locus_tag LOCUS_12840 264008 265216 CDS product putative transposase y4qJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55631 protein_id gnl|my_center|LOCUS_12840 265565 266326 gene locus_tag LOCUS_12850 265565 266326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 266581 267480 gene locus_tag LOCUS_12860 266581 267480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 267543 267977 gene locus_tag LOCUS_12870 267543 267977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 268380 269129 gene locus_tag LOCUS_12880 268380 269129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116045.1 protein_id gnl|my_center|LOCUS_12880 269375 270166 gene locus_tag LOCUS_12890 269375 270166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 270228 270605 gene locus_tag LOCUS_12900 270228 270605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 270683 271306 gene locus_tag LOCUS_12910 270683 271306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 271412 272014 gene locus_tag LOCUS_12920 271412 272014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 272305 274314 gene locus_tag LOCUS_12930 272305 274314 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 protein_id gnl|my_center|LOCUS_12930 274341 274880 gene locus_tag LOCUS_12940 274341 274880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 274949 275644 gene locus_tag LOCUS_12950 274949 275644 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_12950 275674 276570 gene locus_tag LOCUS_12960 gene lipZ 275674 276570 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_12960 276567 277070 gene locus_tag LOCUS_12970 276567 277070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence005 <1 1686 gene locus_tag LOCUS_12980 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119333.1:RNA-binding protein 1683 3560 gene locus_tag LOCUS_12990 1683 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3865 6756 gene locus_tag LOCUS_13000 3865 6756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_13000 7042 8562 gene locus_tag LOCUS_13010 7042 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 8861 11020 gene locus_tag LOCUS_13020 8861 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 11386 13287 gene locus_tag LOCUS_13030 11386 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 13422 14120 gene locus_tag LOCUS_13040 13422 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 17709 14149 gene locus_tag LOCUS_13050 17709 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_13050 18602 17706 gene locus_tag LOCUS_13060 18602 17706 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_13060 19199 18612 gene locus_tag LOCUS_13070 19199 18612 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 protein_id gnl|my_center|LOCUS_13070 19725 19288 gene locus_tag LOCUS_13080 19725 19288 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P546 protein_id gnl|my_center|LOCUS_13080 19800 22067 gene locus_tag LOCUS_13090 19800 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 22157 23245 gene locus_tag LOCUS_13100 22157 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 23756 23256 gene locus_tag LOCUS_13110 23756 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 23916 26378 gene locus_tag LOCUS_13120 23916 26378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13120 28231 26393 gene locus_tag LOCUS_13130 28231 26393 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228219.1 protein_id gnl|my_center|LOCUS_13130 28403 28669 gene locus_tag LOCUS_13140 28403 28669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_13140 28674 30356 gene locus_tag LOCUS_13150 28674 30356 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_13150 30400 30618 gene locus_tag LOCUS_13160 30400 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 30856 30590 gene locus_tag LOCUS_13170 30856 30590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 31002 32930 gene locus_tag LOCUS_13180 gene acsA 31002 32930 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_13180 33636 33091 gene locus_tag LOCUS_13190 33636 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 33787 34458 gene locus_tag LOCUS_13200 33787 34458 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_13200 34548 35201 gene locus_tag LOCUS_13210 34548 35201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 35926 35279 gene locus_tag LOCUS_13220 35926 35279 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_13220 36381 38063 gene locus_tag LOCUS_13230 36381 38063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 41720 38073 gene locus_tag LOCUS_13240 41720 38073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 43232 41853 gene locus_tag LOCUS_13250 43232 41853 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_13250 45391 43229 gene locus_tag LOCUS_13260 45391 43229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 47637 45496 gene locus_tag LOCUS_13270 47637 45496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 52021 47753 gene locus_tag LOCUS_13280 52021 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 52719 52114 gene locus_tag LOCUS_13290 52719 52114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 54071 52716 gene locus_tag LOCUS_13300 54071 52716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 54608 54075 gene locus_tag LOCUS_13310 54608 54075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 55408 55803 gene locus_tag LOCUS_13320 55408 55803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 55967 57118 gene locus_tag LOCUS_13330 55967 57118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 57146 58861 gene locus_tag LOCUS_13340 57146 58861 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_13340 59223 60482 gene locus_tag LOCUS_13350 59223 60482 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_13350 60605 61297 gene locus_tag LOCUS_13360 60605 61297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_13360 61592 62278 gene locus_tag LOCUS_13370 61592 62278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_13370 62680 63618 gene locus_tag LOCUS_13380 62680 63618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 63842 64966 gene locus_tag LOCUS_13390 gene idiA 63842 64966 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_13390 65004 66653 gene locus_tag LOCUS_13400 65004 66653 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_13400 66650 67777 gene locus_tag LOCUS_13410 66650 67777 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_13410 68390 70171 gene locus_tag LOCUS_13420 68390 70171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 73170 70168 gene locus_tag LOCUS_13430 73170 70168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 73444 75054 gene locus_tag LOCUS_13440 73444 75054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 76131 75448 gene locus_tag LOCUS_13450 76131 75448 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_13450 76130 78508 gene locus_tag LOCUS_13460 76130 78508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 78517 78705 gene locus_tag LOCUS_13470 78517 78705 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_13470 79160 78741 gene locus_tag LOCUS_13480 79160 78741 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_13480 79390 79157 gene locus_tag LOCUS_13490 79390 79157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 80793 79558 gene locus_tag LOCUS_13500 80793 79558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 81677 80817 gene locus_tag LOCUS_13510 81677 80817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_13510 82094 84502 gene locus_tag LOCUS_13520 82094 84502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13520 85770 84601 gene locus_tag LOCUS_13530 85770 84601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 86018 85851 gene locus_tag LOCUS_13540 86018 85851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 87398 86238 gene locus_tag LOCUS_13550 87398 86238 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_13550 87589 89532 gene locus_tag LOCUS_13560 87589 89532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_13560 89977 93249 gene locus_tag LOCUS_13570 gene dnaE2 89977 93249 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT5 protein_id gnl|my_center|LOCUS_13570 93357 94052 gene locus_tag LOCUS_13580 93357 94052 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_13580 94049 94894 gene locus_tag LOCUS_13590 94049 94894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 94878 95672 gene locus_tag LOCUS_13600 94878 95672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 97061 95778 gene locus_tag LOCUS_13610 97061 95778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 98302 97352 gene locus_tag LOCUS_13620 98302 97352 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_13620 99013 98351 gene locus_tag LOCUS_13630 99013 98351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 100556 99174 gene locus_tag LOCUS_13640 gene mtaD 100556 99174 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_13640 100775 100620 gene locus_tag LOCUS_13650 gene rpmG 100775 100620 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_13650 100944 100868 gene locus_tag LOCUS_t00140 100944 100868 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 101100 101024 gene locus_tag LOCUS_t00150 101100 101024 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 101402 102001 gene locus_tag LOCUS_13660 gene sodA 101402 102001 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_13660 102360 102671 gene locus_tag LOCUS_13670 102360 102671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 102902 102978 gene locus_tag LOCUS_t00160 102902 102978 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 102951 104414 gene locus_tag LOCUS_13680 gene tilS 102951 104414 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V1 protein_id gnl|my_center|LOCUS_13680 104523 106487 gene locus_tag LOCUS_13690 gene ftsH-2 104523 106487 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_13690 106484 107395 gene locus_tag LOCUS_13700 gene folP 106484 107395 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6K0 protein_id gnl|my_center|LOCUS_13700 107439 108233 gene locus_tag LOCUS_13710 107439 108233 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_13710 108259 108957 gene locus_tag LOCUS_13720 108259 108957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 108954 110333 gene locus_tag LOCUS_13730 gene glmM 108954 110333 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C70 protein_id gnl|my_center|LOCUS_13730 110330 111067 gene locus_tag LOCUS_13740 gene pdxJ 110330 111067 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A795 protein_id gnl|my_center|LOCUS_13740 113296 111131 gene locus_tag LOCUS_13750 113296 111131 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_13750 115232 113652 gene locus_tag LOCUS_13760 115232 113652 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH9 protein_id gnl|my_center|LOCUS_13760 116504 115398 gene locus_tag LOCUS_13770 116504 115398 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_13770 116949 116542 gene locus_tag LOCUS_13780 116949 116542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 118198 116990 gene locus_tag LOCUS_13790 118198 116990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_13790 118716 118195 gene locus_tag LOCUS_13800 gene moaC 118716 118195 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_13800 118827 119600 gene locus_tag LOCUS_13810 118827 119600 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_13810 119958 119683 gene locus_tag LOCUS_13820 gene hup 119958 119683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_13820 121600 120230 gene locus_tag LOCUS_13830 gene rsmB 121600 120230 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_13830 122708 121725 gene locus_tag LOCUS_13840 gene fmt 122708 121725 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_13840 125302 122711 gene locus_tag LOCUS_13850 125302 122711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 126178 125615 gene locus_tag LOCUS_13860 126178 125615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 126903 126178 gene locus_tag LOCUS_13870 gene pstB 126903 126178 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLN1 protein_id gnl|my_center|LOCUS_13870 127221 126910 gene locus_tag LOCUS_13880 127221 126910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 128635 127412 gene locus_tag LOCUS_13890 128635 127412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 129873 129031 gene locus_tag LOCUS_13900 gene rsmA 129873 129031 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM60 protein_id gnl|my_center|LOCUS_13900 130303 131334 gene locus_tag LOCUS_13910 130303 131334 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_13910 131338 132258 gene locus_tag LOCUS_13920 131338 132258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 132255 133562 gene locus_tag LOCUS_13930 132255 133562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 133559 134575 gene locus_tag LOCUS_13940 133559 134575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_13940 134580 135626 gene locus_tag LOCUS_13950 gene batB 134580 135626 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_13950 135654 136760 gene locus_tag LOCUS_13960 135654 136760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 136774 138534 gene locus_tag LOCUS_13970 136774 138534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 138531 139268 gene locus_tag LOCUS_13980 138531 139268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 139423 140571 gene locus_tag LOCUS_13990 139423 140571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 141062 140835 gene locus_tag LOCUS_14000 141062 140835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 140953 143742 gene locus_tag LOCUS_14010 140953 143742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 143872 144435 gene locus_tag LOCUS_14020 143872 144435 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_14020 145810 144461 gene locus_tag LOCUS_14030 145810 144461 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_14030 146152 146544 gene locus_tag LOCUS_14040 146152 146544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 146704 149121 gene locus_tag LOCUS_14050 146704 149121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14050 149472 149984 gene locus_tag LOCUS_14060 149472 149984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258086.1 protein_id gnl|my_center|LOCUS_14060 150116 150349 gene locus_tag LOCUS_14070 150116 150349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887090.1 protein_id gnl|my_center|LOCUS_14070 150346 150774 gene locus_tag LOCUS_14080 gene vapC 150346 150774 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK03 protein_id gnl|my_center|LOCUS_14080 150932 152584 gene locus_tag LOCUS_14090 150932 152584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 153594 152599 gene locus_tag LOCUS_14100 153594 152599 CDS product carbon monoxide dehydrogenase F protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727163.1 protein_id gnl|my_center|LOCUS_14100 156035 153600 gene locus_tag LOCUS_14110 156035 153600 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_14110 156538 156032 gene locus_tag LOCUS_14120 156538 156032 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_14120 157425 156538 gene locus_tag LOCUS_14130 157425 156538 CDS product carbon monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_14130 158065 157454 gene locus_tag LOCUS_14140 158065 157454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 159349 158075 gene locus_tag LOCUS_14150 159349 158075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_14150 160272 159346 gene locus_tag LOCUS_14160 160272 159346 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 protein_id gnl|my_center|LOCUS_14160 161381 160812 gene locus_tag LOCUS_14170 161381 160812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 161611 162780 gene locus_tag LOCUS_14180 161611 162780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 163355 162789 gene locus_tag LOCUS_14190 163355 162789 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_14190 164293 163400 gene locus_tag LOCUS_14200 164293 163400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 164860 164339 gene locus_tag LOCUS_14210 164860 164339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 165069 167342 gene locus_tag LOCUS_14220 165069 167342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_14220 167345 168415 gene locus_tag LOCUS_14230 gene fabH 167345 168415 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S83 protein_id gnl|my_center|LOCUS_14230 168412 169986 gene locus_tag LOCUS_14240 168412 169986 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_14240 169983 170795 gene locus_tag LOCUS_14250 169983 170795 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039212.1 protein_id gnl|my_center|LOCUS_14250 170839 172338 gene locus_tag LOCUS_14260 170839 172338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 172522 176391 gene locus_tag LOCUS_14270 172522 176391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 176981 176382 gene locus_tag LOCUS_14280 176981 176382 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_14280 177254 178195 gene locus_tag LOCUS_14290 177254 178195 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_14290 178192 182550 gene locus_tag LOCUS_14300 178192 182550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 183761 182565 gene locus_tag LOCUS_14310 183761 182565 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_14310 186188 183798 gene locus_tag LOCUS_14320 186188 183798 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_14320 187156 186236 gene locus_tag LOCUS_14330 187156 186236 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_14330 187326 193799 gene locus_tag LOCUS_14340 187326 193799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 198646 193889 gene locus_tag LOCUS_14350 198646 193889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 199116 201707 gene locus_tag LOCUS_14360 199116 201707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 201961 202170 gene locus_tag LOCUS_14370 201961 202170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 203696 202353 gene locus_tag LOCUS_14380 203696 202353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104878.1 protein_id gnl|my_center|LOCUS_14380 207739 204014 gene locus_tag LOCUS_14390 207739 204014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 212046 208159 gene locus_tag LOCUS_14400 212046 208159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 212757 212308 gene locus_tag LOCUS_14410 212757 212308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 213376 212762 gene locus_tag LOCUS_14420 213376 212762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 213564 216017 gene locus_tag LOCUS_14430 213564 216017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14430 216032 216301 gene locus_tag LOCUS_14440 216032 216301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 216348 217454 gene locus_tag LOCUS_14450 216348 217454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_14450 220476 217669 gene locus_tag LOCUS_14460 gene ppc 220476 217669 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 protein_id gnl|my_center|LOCUS_14460 221100 220519 gene locus_tag LOCUS_14470 gene bioY 221100 220519 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537705.1 protein_id gnl|my_center|LOCUS_14470 222710 221103 gene locus_tag LOCUS_14480 222710 221103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 223327 222806 gene locus_tag LOCUS_14490 223327 222806 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106016.1 protein_id gnl|my_center|LOCUS_14490 225036 223375 gene locus_tag LOCUS_14500 225036 223375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 226186 225320 gene locus_tag LOCUS_14510 226186 225320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 226675 227727 gene locus_tag LOCUS_14520 226675 227727 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_14520 227754 228122 gene locus_tag LOCUS_14530 227754 228122 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 protein_id gnl|my_center|LOCUS_14530 229305 228181 gene locus_tag LOCUS_14540 229305 228181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_14540 232061 229308 gene locus_tag LOCUS_14550 232061 229308 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_14550 233038 232058 gene locus_tag LOCUS_14560 233038 232058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_14560 235448 233049 gene locus_tag LOCUS_14570 235448 233049 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_14570 236646 235963 gene locus_tag LOCUS_14580 gene msrA 236646 235963 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S284 protein_id gnl|my_center|LOCUS_14580 236856 237779 gene locus_tag LOCUS_14590 236856 237779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 237791 239140 gene locus_tag LOCUS_14600 237791 239140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 240229 239249 gene locus_tag LOCUS_14610 gene rsgA 240229 239249 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_14610 240882 242645 gene locus_tag LOCUS_14620 240882 242645 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_14620 242677 244134 gene locus_tag LOCUS_14630 242677 244134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 245103 244159 gene locus_tag LOCUS_14640 245103 244159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 246185 245169 gene locus_tag LOCUS_14650 gene fabH 246185 245169 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5G0 protein_id gnl|my_center|LOCUS_14650 246601 246275 gene locus_tag LOCUS_14660 246601 246275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 248493 246640 gene locus_tag LOCUS_14670 248493 246640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 250310 248583 gene locus_tag LOCUS_14680 250310 248583 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_14680 250519 251046 gene locus_tag LOCUS_14690 250519 251046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 251036 254002 gene locus_tag LOCUS_14700 251036 254002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 256352 254004 gene locus_tag LOCUS_14710 256352 254004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_14710 257696 256476 gene locus_tag LOCUS_14720 257696 256476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962613.1 protein_id gnl|my_center|LOCUS_14720 258593 257739 gene locus_tag LOCUS_14730 258593 257739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 259819 258626 gene locus_tag LOCUS_14740 259819 258626 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence006 <1 1209 gene locus_tag LOCUS_14750 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797467.1:MFS transporter 2855 1218 gene locus_tag LOCUS_14760 2855 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4535 3027 gene locus_tag LOCUS_14770 4535 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_14770 5449 4610 gene locus_tag LOCUS_14780 5449 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_14780 6200 5571 gene locus_tag LOCUS_14790 6200 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_14790 7185 6277 gene locus_tag LOCUS_14800 7185 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7413 7874 gene locus_tag LOCUS_14810 7413 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7871 9175 gene locus_tag LOCUS_14820 7871 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9802 9161 gene locus_tag LOCUS_14830 9802 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 10306 12987 gene locus_tag LOCUS_14840 10306 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 15831 13165 gene locus_tag LOCUS_14850 15831 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 16540 15824 gene locus_tag LOCUS_14860 16540 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 16973 16611 gene locus_tag LOCUS_14870 16973 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 17317 18456 gene locus_tag LOCUS_14880 17317 18456 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 protein_id gnl|my_center|LOCUS_14880 18487 20469 gene locus_tag LOCUS_14890 gene asnB 18487 20469 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14890 23185 20492 gene locus_tag LOCUS_14900 23185 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14900 23526 23182 gene locus_tag LOCUS_14910 23526 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 23642 23965 gene locus_tag LOCUS_14920 23642 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 24179 26644 gene locus_tag LOCUS_14930 24179 26644 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888457.1 protein_id gnl|my_center|LOCUS_14930 26841 28280 gene locus_tag LOCUS_14940 26841 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 28679 28299 gene locus_tag LOCUS_14950 28679 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 29468 28713 gene locus_tag LOCUS_14960 29468 28713 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_14960 30528 29515 gene locus_tag LOCUS_14970 30528 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 30576 31145 gene locus_tag LOCUS_14980 30576 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 31426 32199 gene locus_tag LOCUS_14990 31426 32199 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_14990 32237 33316 gene locus_tag LOCUS_15000 gene fni 32237 33316 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD5 protein_id gnl|my_center|LOCUS_15000 33330 34619 gene locus_tag LOCUS_15010 33330 34619 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_15010 34651 35745 gene locus_tag LOCUS_15020 34651 35745 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_15020 35810 36826 gene locus_tag LOCUS_15030 gene mvaD 35810 36826 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_15030 36823 37671 gene locus_tag LOCUS_15040 36823 37671 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_15040 39615 37897 gene locus_tag LOCUS_15050 39615 37897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 41336 39630 gene locus_tag LOCUS_15060 41336 39630 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_15060 42046 41333 gene locus_tag LOCUS_15070 42046 41333 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_15070 43306 42107 gene locus_tag LOCUS_15080 43306 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 44682 43312 gene locus_tag LOCUS_15090 44682 43312 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_15090 44927 47056 gene locus_tag LOCUS_15100 44927 47056 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_15100 47472 49286 gene locus_tag LOCUS_15110 47472 49286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 49729 50058 gene locus_tag LOCUS_15120 49729 50058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 51098 50115 gene locus_tag LOCUS_15130 gene mdh 51098 50115 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_15130 51552 52421 gene locus_tag LOCUS_15140 51552 52421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 52539 53135 gene locus_tag LOCUS_15150 52539 53135 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 protein_id gnl|my_center|LOCUS_15150 54393 53125 gene locus_tag LOCUS_15160 54393 53125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_15160 56762 54399 gene locus_tag LOCUS_15170 56762 54399 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_15170 57601 56825 gene locus_tag LOCUS_15180 57601 56825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_15180 58719 57808 gene locus_tag LOCUS_15190 58719 57808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_15190 59897 58809 gene locus_tag LOCUS_15200 59897 58809 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_15200 61612 59894 gene locus_tag LOCUS_15210 61612 59894 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_15210 61862 62350 gene locus_tag LOCUS_15220 61862 62350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 62487 63515 gene locus_tag LOCUS_15230 62487 63515 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_15230 63512 64189 gene locus_tag LOCUS_15240 63512 64189 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_15240 64355 66670 gene locus_tag LOCUS_15250 64355 66670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 66667 69015 gene locus_tag LOCUS_15260 66667 69015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15260 69057 70265 gene locus_tag LOCUS_15270 69057 70265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 72829 70595 gene locus_tag LOCUS_15280 72829 70595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 73712 73014 gene locus_tag LOCUS_15290 73712 73014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 74275 73697 gene locus_tag LOCUS_15300 74275 73697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 76095 74548 gene locus_tag LOCUS_15310 gene purH 76095 74548 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_15310 77004 76186 gene locus_tag LOCUS_15320 77004 76186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 78306 77107 gene locus_tag LOCUS_15330 78306 77107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 78471 79280 gene locus_tag LOCUS_15340 78471 79280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_15340 79337 79837 gene locus_tag LOCUS_15350 79337 79837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 79921 80544 gene locus_tag LOCUS_15360 79921 80544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 82456 80552 gene locus_tag LOCUS_15370 82456 80552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 84469 82586 gene locus_tag LOCUS_15380 84469 82586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 86229 84466 gene locus_tag LOCUS_15390 86229 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 86567 87907 gene locus_tag LOCUS_15400 86567 87907 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_15400 89011 87917 gene locus_tag LOCUS_15410 89011 87917 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_15410 89957 89022 gene locus_tag LOCUS_15420 89957 89022 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_15420 90448 89954 gene locus_tag LOCUS_15430 gene ptpA 90448 89954 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_15430 90520 91077 gene locus_tag LOCUS_15440 90520 91077 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_15440 91892 91092 gene locus_tag LOCUS_15450 91892 91092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_15450 92737 91889 gene locus_tag LOCUS_15460 92737 91889 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_15460 93699 92734 gene locus_tag LOCUS_15470 93699 92734 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_15470 95168 93696 gene locus_tag LOCUS_15480 95168 93696 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_15480 95783 95364 gene locus_tag LOCUS_15490 95783 95364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 96526 95789 gene locus_tag LOCUS_15500 gene aat 96526 95789 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_15500 96872 97831 gene locus_tag LOCUS_15510 96872 97831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 97831 99510 gene locus_tag LOCUS_15520 97831 99510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 99523 100062 gene locus_tag LOCUS_15530 99523 100062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 100072 100542 gene locus_tag LOCUS_15540 100072 100542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 101850 102191 gene locus_tag LOCUS_15550 101850 102191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 102205 102726 gene locus_tag LOCUS_15560 102205 102726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 102779 103195 gene locus_tag LOCUS_15570 102779 103195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 103199 104218 gene locus_tag LOCUS_15580 103199 104218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 104215 105018 gene locus_tag LOCUS_15590 104215 105018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 105039 105371 gene locus_tag LOCUS_15600 105039 105371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 105401 105913 gene locus_tag LOCUS_15610 105401 105913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 105910 107496 gene locus_tag LOCUS_15620 105910 107496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 107498 109192 gene locus_tag LOCUS_15630 107498 109192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 109210 110187 gene locus_tag LOCUS_15640 109210 110187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 110239 114420 gene locus_tag LOCUS_15650 110239 114420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 114526 115860 gene locus_tag LOCUS_15660 gene sucC 114526 115860 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3H9 protein_id gnl|my_center|LOCUS_15660 115860 116732 gene locus_tag LOCUS_15670 gene sucD 115860 116732 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_15670 116770 117453 gene locus_tag LOCUS_15680 116770 117453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 117602 118024 gene locus_tag LOCUS_15690 gene ndk 117602 118024 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP5 protein_id gnl|my_center|LOCUS_15690 118439 118687 gene locus_tag LOCUS_15700 118439 118687 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706824.1 protein_id gnl|my_center|LOCUS_15700 118684 119514 gene locus_tag LOCUS_15710 118684 119514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_15710 120962 119535 gene locus_tag LOCUS_15720 120962 119535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 121101 122060 gene locus_tag LOCUS_15730 121101 122060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 123669 122071 gene locus_tag LOCUS_15740 123669 122071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 124880 123666 gene locus_tag LOCUS_15750 124880 123666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 125489 124881 gene locus_tag LOCUS_15760 125489 124881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 125763 126581 gene locus_tag LOCUS_15770 125763 126581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 128223 126589 gene locus_tag LOCUS_15780 gene fhs 128223 126589 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_15780 129778 128471 gene locus_tag LOCUS_15790 129778 128471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 129996 131273 gene locus_tag LOCUS_15800 129996 131273 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_15800 132582 131278 gene locus_tag LOCUS_15810 132582 131278 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026863.1 protein_id gnl|my_center|LOCUS_15810 133425 132748 gene locus_tag LOCUS_15820 133425 132748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 133782 133489 gene locus_tag LOCUS_15830 133782 133489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 134987 133842 gene locus_tag LOCUS_15840 gene wecE 134987 133842 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_15840 135261 136121 gene locus_tag LOCUS_15850 135261 136121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 136453 137436 gene locus_tag LOCUS_15860 gene omcK 136453 137436 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_15860 137449 139212 gene locus_tag LOCUS_15870 137449 139212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 139225 139629 gene locus_tag LOCUS_15880 139225 139629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 140111 139695 gene locus_tag LOCUS_15890 140111 139695 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_15890 142659 140236 gene locus_tag LOCUS_15900 142659 140236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 144163 142883 gene locus_tag LOCUS_15910 144163 142883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 144357 144827 gene locus_tag LOCUS_15920 144357 144827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 144875 146272 gene locus_tag LOCUS_15930 144875 146272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 147660 146332 gene locus_tag LOCUS_15940 147660 146332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 147978 149591 gene locus_tag LOCUS_15950 147978 149591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 150846 149653 gene locus_tag LOCUS_15960 150846 149653 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_15960 151148 153598 gene locus_tag LOCUS_15970 151148 153598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_15970 154160 157774 gene locus_tag LOCUS_15980 154160 157774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 158257 162918 gene locus_tag LOCUS_15990 158257 162918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 163135 163731 gene locus_tag LOCUS_16000 163135 163731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 163791 164543 gene locus_tag LOCUS_16010 163791 164543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 164612 167977 gene locus_tag LOCUS_16020 164612 167977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 168074 168826 gene locus_tag LOCUS_16030 168074 168826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 168922 169680 gene locus_tag LOCUS_16040 168922 169680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 173545 169739 gene locus_tag LOCUS_16050 173545 169739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 175009 173864 gene locus_tag LOCUS_16060 175009 173864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 175584 175051 gene locus_tag LOCUS_16070 175584 175051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_16070 176139 175723 gene locus_tag LOCUS_16080 176139 175723 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918964.1 protein_id gnl|my_center|LOCUS_16080 176319 176972 gene locus_tag LOCUS_16090 176319 176972 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_16090 176969 179521 gene locus_tag LOCUS_16100 176969 179521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 179576 180031 gene locus_tag LOCUS_16110 179576 180031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 180203 181945 gene locus_tag LOCUS_16120 180203 181945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 183706 181958 gene locus_tag LOCUS_16130 gene hflX 183706 181958 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_16130 184378 183773 gene locus_tag LOCUS_16140 184378 183773 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889047.1 protein_id gnl|my_center|LOCUS_16140 184559 185944 gene locus_tag LOCUS_16150 184559 185944 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_16150 186009 187088 gene locus_tag LOCUS_16160 186009 187088 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117808.1 protein_id gnl|my_center|LOCUS_16160 187289 188599 gene locus_tag LOCUS_16170 187289 188599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 192954 188623 gene locus_tag LOCUS_16180 192954 188623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 200403 193237 gene locus_tag LOCUS_16190 200403 193237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 201747 201025 gene locus_tag LOCUS_16200 201747 201025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 202849 201749 gene locus_tag LOCUS_16210 202849 201749 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_16210 203034 204023 gene locus_tag LOCUS_16220 gene moxR 203034 204023 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_16220 204020 205414 gene locus_tag LOCUS_16230 204020 205414 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_16230 205431 207278 gene locus_tag LOCUS_16240 205431 207278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 207659 207282 gene locus_tag LOCUS_16250 207659 207282 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_16250 208213 207665 gene locus_tag LOCUS_16260 gene hpt 208213 207665 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_16260 208424 209986 gene locus_tag LOCUS_16270 208424 209986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 210304 210011 gene locus_tag LOCUS_16280 210304 210011 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_16280 210915 212069 gene locus_tag LOCUS_16290 210915 212069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 212910 212176 gene locus_tag LOCUS_16300 212910 212176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 213397 214992 gene locus_tag LOCUS_16310 213397 214992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 217461 215203 gene locus_tag LOCUS_16320 217461 215203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 218201 217620 gene locus_tag LOCUS_16330 218201 217620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 219699 218296 gene locus_tag LOCUS_16340 219699 218296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 220138 221250 gene locus_tag LOCUS_16350 220138 221250 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_16350 221491 223551 gene locus_tag LOCUS_16360 221491 223551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence007 781 164 gene locus_tag LOCUS_16370 781 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1593 988 gene locus_tag LOCUS_16380 1593 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1649 1975 gene locus_tag LOCUS_16390 1649 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2740 2231 gene locus_tag LOCUS_16400 2740 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4373 2934 gene locus_tag LOCUS_16410 4373 2934 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_16410 4653 6170 gene locus_tag LOCUS_16420 4653 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7972 6152 gene locus_tag LOCUS_16430 7972 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15875 8067 gene locus_tag LOCUS_16440 15875 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 18331 16139 gene locus_tag LOCUS_16450 18331 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_16450 18567 19829 gene locus_tag LOCUS_16460 18567 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 21529 19907 gene locus_tag LOCUS_16470 21529 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 23553 21736 gene locus_tag LOCUS_16480 23553 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 25598 23958 gene locus_tag LOCUS_16490 25598 23958 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_16490 25685 26200 gene locus_tag LOCUS_16500 25685 26200 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_16500 26203 27888 gene locus_tag LOCUS_16510 26203 27888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 28185 31004 gene locus_tag LOCUS_16520 28185 31004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 31187 32071 gene locus_tag LOCUS_16530 31187 32071 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_16530 32185 33693 gene locus_tag LOCUS_16540 32185 33693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 35187 33778 gene locus_tag LOCUS_16550 35187 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 38225 35457 gene locus_tag LOCUS_16560 38225 35457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 38820 38215 gene locus_tag LOCUS_16570 38820 38215 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_16570 40933 39074 gene locus_tag LOCUS_16580 40933 39074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 41293 40961 gene locus_tag LOCUS_16590 41293 40961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 44278 41501 gene locus_tag LOCUS_16600 44278 41501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 51194 44319 gene locus_tag LOCUS_16610 51194 44319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 51795 53033 gene locus_tag LOCUS_16620 51795 53033 CDS product secretion protein HylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919655.1 protein_id gnl|my_center|LOCUS_16620 53030 56272 gene locus_tag LOCUS_16630 53030 56272 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_16630 56269 57780 gene locus_tag LOCUS_16640 56269 57780 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_16640 59328 57796 gene locus_tag LOCUS_16650 59328 57796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 59635 60249 gene locus_tag LOCUS_16660 59635 60249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 60582 62951 gene locus_tag LOCUS_16670 60582 62951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 62962 63495 gene locus_tag LOCUS_16680 62962 63495 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_16680 63504 64289 gene locus_tag LOCUS_16690 63504 64289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 65418 66698 gene locus_tag LOCUS_16700 65418 66698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_16700 66695 68824 gene locus_tag LOCUS_16710 66695 68824 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_16710 68815 69201 gene locus_tag LOCUS_16720 68815 69201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 69198 69851 gene locus_tag LOCUS_16730 69198 69851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_16730 69861 71333 gene locus_tag LOCUS_16740 69861 71333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 71363 71674 gene locus_tag LOCUS_16750 71363 71674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_16750 71702 72847 gene locus_tag LOCUS_16760 71702 72847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_16760 72844 73338 gene locus_tag LOCUS_16770 72844 73338 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_16770 73338 73670 gene locus_tag LOCUS_16780 73338 73670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 73684 74043 gene locus_tag LOCUS_16790 73684 74043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_16790 74043 76751 gene locus_tag LOCUS_16800 74043 76751 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_16800 76748 79303 gene locus_tag LOCUS_16810 76748 79303 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258038.1 protein_id gnl|my_center|LOCUS_16810 79300 81570 gene locus_tag LOCUS_16820 79300 81570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_16820 81597 85073 gene locus_tag LOCUS_16830 81597 85073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 85235 85486 gene locus_tag LOCUS_16840 85235 85486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 85860 88433 gene locus_tag LOCUS_16850 85860 88433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 89049 89942 gene locus_tag LOCUS_16860 89049 89942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 90180 92888 gene locus_tag LOCUS_16870 gene secA 90180 92888 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ1 protein_id gnl|my_center|LOCUS_16870 94181 92952 gene locus_tag LOCUS_16880 94181 92952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 94592 95866 gene locus_tag LOCUS_16890 94592 95866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 95915 96676 gene locus_tag LOCUS_16900 95915 96676 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_16900 96673 97593 gene locus_tag LOCUS_16910 gene ilvE2 96673 97593 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_16910 97961 97641 gene locus_tag LOCUS_16920 97961 97641 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_16920 98431 97958 gene locus_tag LOCUS_16930 98431 97958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 99012 98428 gene locus_tag LOCUS_16940 99012 98428 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_16940 99788 99099 gene locus_tag LOCUS_16950 99788 99099 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933742.1 protein_id gnl|my_center|LOCUS_16950 100627 99785 gene locus_tag LOCUS_16960 100627 99785 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_16960 101437 100640 gene locus_tag LOCUS_16970 gene trpA 101437 100640 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_16970 102741 101434 gene locus_tag LOCUS_16980 gene trpB1 102741 101434 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_16980 103480 102716 gene locus_tag LOCUS_16990 gene trpF 103480 102716 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3V7 protein_id gnl|my_center|LOCUS_16990 104324 103533 gene locus_tag LOCUS_17000 gene trpC 104324 103533 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT7 protein_id gnl|my_center|LOCUS_17000 104607 105407 gene locus_tag LOCUS_17010 gene yokD 104607 105407 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783332.1 protein_id gnl|my_center|LOCUS_17010 106590 105394 gene locus_tag LOCUS_17020 106590 105394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 107456 106770 gene locus_tag LOCUS_17030 107456 106770 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_17030 108279 107566 gene locus_tag LOCUS_17040 108279 107566 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_17040 108449 109597 gene locus_tag LOCUS_17050 108449 109597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 111041 109791 gene locus_tag LOCUS_17060 111041 109791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 111440 113329 gene locus_tag LOCUS_17070 111440 113329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 114869 113355 gene locus_tag LOCUS_17080 114869 113355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 115607 114945 gene locus_tag LOCUS_17090 115607 114945 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265774.1 protein_id gnl|my_center|LOCUS_17090 115735 116637 gene locus_tag LOCUS_17100 115735 116637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268499.1 protein_id gnl|my_center|LOCUS_17100 119044 116630 gene locus_tag LOCUS_17110 119044 116630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 119636 120100 gene locus_tag LOCUS_17120 119636 120100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 120243 122033 gene locus_tag LOCUS_17130 120243 122033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 125130 122005 gene locus_tag LOCUS_17140 125130 122005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 125270 126085 gene locus_tag LOCUS_17150 125270 126085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 128268 126463 gene locus_tag LOCUS_17160 128268 126463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 130678 128261 gene locus_tag LOCUS_17170 130678 128261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 130865 132172 gene locus_tag LOCUS_17180 130865 132172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 132169 133302 gene locus_tag LOCUS_17190 132169 133302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 133314 136433 gene locus_tag LOCUS_17200 133314 136433 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_17200 138902 136467 gene locus_tag LOCUS_17210 138902 136467 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_17210 139217 139927 gene locus_tag LOCUS_17220 139217 139927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404083.1 protein_id gnl|my_center|LOCUS_17220 139924 142584 gene locus_tag LOCUS_17230 139924 142584 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_17230 142979 142773 gene locus_tag LOCUS_17240 142979 142773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 142908 143996 gene locus_tag LOCUS_17250 142908 143996 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_17250 144622 143975 gene locus_tag LOCUS_17260 144622 143975 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207426.1 protein_id gnl|my_center|LOCUS_17260 146958 144622 gene locus_tag LOCUS_17270 146958 144622 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204019.1 protein_id gnl|my_center|LOCUS_17270 147222 147938 gene locus_tag LOCUS_17280 147222 147938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 protein_id gnl|my_center|LOCUS_17280 147980 149323 gene locus_tag LOCUS_17290 147980 149323 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089359.1 protein_id gnl|my_center|LOCUS_17290 150837 149239 gene locus_tag LOCUS_17300 150837 149239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941912.1 protein_id gnl|my_center|LOCUS_17300 151526 150834 gene locus_tag LOCUS_17310 151526 150834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 152287 151523 gene locus_tag LOCUS_17320 152287 151523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 154344 152380 gene locus_tag LOCUS_17330 154344 152380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941908.1 protein_id gnl|my_center|LOCUS_17330 159624 154453 gene locus_tag LOCUS_17340 159624 154453 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941907.1 protein_id gnl|my_center|LOCUS_17340 162230 159927 gene locus_tag LOCUS_17350 162230 159927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 162904 162227 gene locus_tag LOCUS_17360 162904 162227 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_17360 163114 164076 gene locus_tag LOCUS_17370 gene troA 163114 164076 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_17370 164073 164942 gene locus_tag LOCUS_17380 164073 164942 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_17380 164942 166237 gene locus_tag LOCUS_17390 164942 166237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 166234 167343 gene locus_tag LOCUS_17400 166234 167343 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_17400 168830 167358 gene locus_tag LOCUS_17410 168830 167358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 183661 169082 gene locus_tag LOCUS_17420 183661 169082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 184542 185495 gene locus_tag LOCUS_17430 184542 185495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 185501 186613 gene locus_tag LOCUS_17440 gene ahbD 185501 186613 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_17440 186847 187335 gene locus_tag LOCUS_17450 186847 187335 CDS product osteoblast specific factor 2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403040.1 protein_id gnl|my_center|LOCUS_17450 187572 187384 gene locus_tag LOCUS_17460 187572 187384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 187676 188242 gene locus_tag LOCUS_17470 187676 188242 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_17470 188239 189126 gene locus_tag LOCUS_17480 188239 189126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 189191 189367 gene locus_tag LOCUS_17490 189191 189367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 190038 189544 gene locus_tag LOCUS_17500 190038 189544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_17500 190236 195995 gene locus_tag LOCUS_17510 190236 195995 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387865.1 protein_id gnl|my_center|LOCUS_17510 195999 198197 gene locus_tag LOCUS_17520 195999 198197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 198115 198786 gene locus_tag LOCUS_17530 198115 198786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17530 198874 200643 gene locus_tag LOCUS_17540 198874 200643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 200709 201635 gene locus_tag LOCUS_17550 200709 201635 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_17550 201632 202243 gene locus_tag LOCUS_17560 201632 202243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 202479 202240 gene locus_tag LOCUS_17570 202479 202240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 203592 202492 gene locus_tag LOCUS_17580 gene pyrD 203592 202492 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK9 protein_id gnl|my_center|LOCUS_17580 203954 203589 gene locus_tag LOCUS_17590 203954 203589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_17590 204413 205264 gene locus_tag LOCUS_17600 204413 205264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 206866 205331 gene locus_tag LOCUS_17610 206866 205331 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_17610 207361 206942 gene locus_tag LOCUS_17620 207361 206942 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_17620 207627 207358 gene locus_tag LOCUS_17630 207627 207358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 209445 207715 gene locus_tag LOCUS_17640 209445 207715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 212739 209626 gene locus_tag LOCUS_17650 gene nolG 212739 209626 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_17650 213929 212736 gene locus_tag LOCUS_17660 213929 212736 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261803.1 protein_id gnl|my_center|LOCUS_17660 216327 213931 gene locus_tag LOCUS_17670 216327 213931 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402869.1 protein_id gnl|my_center|LOCUS_17670 217437 216559 gene locus_tag LOCUS_17680 217437 216559 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921559.1 protein_id gnl|my_center|LOCUS_17680 218040 217447 gene locus_tag LOCUS_17690 218040 217447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 220399 218096 gene locus_tag LOCUS_17700 220399 218096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_17700 221407 220508 gene locus_tag LOCUS_17710 221407 220508 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_17710 221872 221411 gene locus_tag LOCUS_17720 gene nudI 221872 221411 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYZ5 protein_id gnl|my_center|LOCUS_17720 221953 222534 gene locus_tag LOCUS_17730 221953 222534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 222641 226324 gene locus_tag LOCUS_17740 222641 226324 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404793.1 protein_id gnl|my_center|LOCUS_17740 228320 226341 gene locus_tag LOCUS_17750 228320 226341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 228518 231229 gene locus_tag LOCUS_17760 gene ppdK 228518 231229 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_17760 232296 231235 gene locus_tag LOCUS_17770 232296 231235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 232560 233186 gene locus_tag LOCUS_17780 232560 233186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 234638 233265 gene locus_tag LOCUS_17790 gene dhs1 234638 233265 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_17790 235602 235015 gene locus_tag LOCUS_17800 235602 235015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 236010 236771 gene locus_tag LOCUS_17810 236010 236771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 236775 237311 gene locus_tag LOCUS_17820 236775 237311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 241469 237345 gene locus_tag LOCUS_17830 241469 237345 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_17830 242111 241686 gene locus_tag LOCUS_17840 242111 241686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 243240 242116 gene locus_tag LOCUS_17850 243240 242116 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_17850 243438 244622 gene locus_tag LOCUS_17860 243438 244622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 246081 244639 gene locus_tag LOCUS_17870 246081 244639 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 protein_id gnl|my_center|LOCUS_17870 247568 246114 gene locus_tag LOCUS_17880 247568 246114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 247918 248169 gene locus_tag LOCUS_17890 247918 248169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence008 2149 1352 gene locus_tag LOCUS_17900 2149 1352 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_17900 4773 2347 gene locus_tag LOCUS_17910 4773 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 6509 5124 gene locus_tag LOCUS_17920 6509 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7750 6506 gene locus_tag LOCUS_17930 7750 6506 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_17930 7918 9570 gene locus_tag LOCUS_17940 7918 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 10438 9725 gene locus_tag LOCUS_17950 10438 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 11013 10435 gene locus_tag LOCUS_17960 gene algU 11013 10435 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_17960 11355 12827 gene locus_tag LOCUS_17970 gene guaB 11355 12827 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_17970 14045 12876 gene locus_tag LOCUS_17980 gene argE 14045 12876 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_17980 14263 16701 gene locus_tag LOCUS_17990 14263 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_17990 17592 16894 gene locus_tag LOCUS_18000 17592 16894 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_18000 18611 17589 gene locus_tag LOCUS_18010 18611 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 18790 18563 gene locus_tag LOCUS_18020 18790 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 18814 19482 gene locus_tag LOCUS_18030 18814 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 19770 21632 gene locus_tag LOCUS_18040 19770 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 22229 21672 gene locus_tag LOCUS_18050 22229 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 24644 22281 gene locus_tag LOCUS_18060 24644 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 24773 25411 gene locus_tag LOCUS_18070 24773 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 25966 25502 gene locus_tag LOCUS_18080 25966 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 26597 26067 gene locus_tag LOCUS_18090 gene folA 26597 26067 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_18090 27457 26663 gene locus_tag LOCUS_18100 gene thyA 27457 26663 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ5 protein_id gnl|my_center|LOCUS_18100 27774 29636 gene locus_tag LOCUS_18110 27774 29636 CDS product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS9 protein_id gnl|my_center|LOCUS_18110 29758 30621 gene locus_tag LOCUS_18120 29758 30621 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976165.1 protein_id gnl|my_center|LOCUS_18120 30663 32372 gene locus_tag LOCUS_18130 30663 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 33436 32360 gene locus_tag LOCUS_18140 33436 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 34919 33555 gene locus_tag LOCUS_18150 gene ald 34919 33555 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIY9 protein_id gnl|my_center|LOCUS_18150 36198 34921 gene locus_tag LOCUS_18160 gene tyrS 36198 34921 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_18160 36611 36195 gene locus_tag LOCUS_18170 36611 36195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 36534 36806 gene locus_tag LOCUS_18180 36534 36806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 36964 39258 gene locus_tag LOCUS_18190 36964 39258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 39255 40139 gene locus_tag LOCUS_18200 39255 40139 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_18200 40267 41187 gene locus_tag LOCUS_18210 40267 41187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 41201 42118 gene locus_tag LOCUS_18220 41201 42118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 42115 42852 gene locus_tag LOCUS_18230 42115 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 42849 43721 gene locus_tag LOCUS_18240 42849 43721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_18240 43818 45002 gene locus_tag LOCUS_18250 43818 45002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_18250 46023 45013 gene locus_tag LOCUS_18260 46023 45013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 47996 46230 gene locus_tag LOCUS_18270 47996 46230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 49951 48221 gene locus_tag LOCUS_18280 49951 48221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 51810 49951 gene locus_tag LOCUS_18290 51810 49951 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18290 53750 51972 gene locus_tag LOCUS_18300 53750 51972 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_18300 53888 54946 gene locus_tag LOCUS_18310 53888 54946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 55672 55034 gene locus_tag LOCUS_18320 55672 55034 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 protein_id gnl|my_center|LOCUS_18320 56573 55893 gene locus_tag LOCUS_18330 56573 55893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 57529 56603 gene locus_tag LOCUS_18340 gene xerD 57529 56603 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJD6 protein_id gnl|my_center|LOCUS_18340 59001 57760 gene locus_tag LOCUS_18350 59001 57760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 60217 59087 gene locus_tag LOCUS_18360 60217 59087 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_18360 61048 60281 gene locus_tag LOCUS_18370 61048 60281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 61279 63039 gene locus_tag LOCUS_18380 61279 63039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_18380 64662 63421 gene locus_tag LOCUS_18390 64662 63421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 65695 64739 gene locus_tag LOCUS_18400 65695 64739 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_18400 65979 66542 gene locus_tag LOCUS_18410 gene efp 65979 66542 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_18410 66595 67518 gene locus_tag LOCUS_18420 gene epmA 66595 67518 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_18420 67559 68890 gene locus_tag LOCUS_18430 67559 68890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064410.1 protein_id gnl|my_center|LOCUS_18430 68887 69612 gene locus_tag LOCUS_18440 68887 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064409.1 protein_id gnl|my_center|LOCUS_18440 69853 70791 gene locus_tag LOCUS_18450 69853 70791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 71198 70872 gene locus_tag LOCUS_18460 71198 70872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 71427 72203 gene locus_tag LOCUS_18470 71427 72203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 73638 72508 gene locus_tag LOCUS_18480 73638 72508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 74493 73801 gene locus_tag LOCUS_18490 74493 73801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 75098 74712 gene locus_tag LOCUS_18500 75098 74712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 75266 77269 gene locus_tag LOCUS_18510 75266 77269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 77263 77358 gene locus_tag LOCUS_t00170 77263 77358 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 77266 78567 gene locus_tag LOCUS_18520 77266 78567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 78564 79484 gene locus_tag LOCUS_18530 78564 79484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_18530 79484 82516 gene locus_tag LOCUS_18540 gene hsdR2 79484 82516 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_18540 82559 84052 gene locus_tag LOCUS_18550 82559 84052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 84064 84579 gene locus_tag LOCUS_18560 84064 84579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 84820 84745 gene locus_tag LOCUS_t00180 84820 84745 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 85613 84870 gene locus_tag LOCUS_18570 85613 84870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 85671 86402 gene locus_tag LOCUS_18580 85671 86402 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_18580 86469 87620 gene locus_tag LOCUS_18590 86469 87620 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 protein_id gnl|my_center|LOCUS_18590 87617 88114 gene locus_tag LOCUS_18600 87617 88114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 88199 90331 gene locus_tag LOCUS_18610 88199 90331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 90328 91053 gene locus_tag LOCUS_18620 90328 91053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 91050 91466 gene locus_tag LOCUS_18630 91050 91466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 91481 92158 gene locus_tag LOCUS_18640 91481 92158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 92210 93988 gene locus_tag LOCUS_18650 92210 93988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056425.1 protein_id gnl|my_center|LOCUS_18650 94048 95013 gene locus_tag LOCUS_18660 94048 95013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 95164 95967 gene locus_tag LOCUS_18670 95164 95967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 95976 96377 gene locus_tag LOCUS_18680 95976 96377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 96509 96835 gene locus_tag LOCUS_18690 96509 96835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 96957 97331 gene locus_tag LOCUS_18700 96957 97331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 98974 97391 gene locus_tag LOCUS_18710 98974 97391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 99151 100233 gene locus_tag LOCUS_18720 gene ddl 99151 100233 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_18720 100230 101135 gene locus_tag LOCUS_18730 100230 101135 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_18730 101605 102603 gene locus_tag LOCUS_18740 101605 102603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121719.1 protein_id gnl|my_center|LOCUS_18740 102585 104558 gene locus_tag LOCUS_18750 102585 104558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 104590 106602 gene locus_tag LOCUS_18760 104590 106602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 107132 106608 gene locus_tag LOCUS_18770 107132 106608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 107797 107471 gene locus_tag LOCUS_18780 107797 107471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 111481 108008 gene locus_tag LOCUS_18790 111481 108008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 113378 111885 gene locus_tag LOCUS_18800 113378 111885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 114387 113560 gene locus_tag LOCUS_18810 114387 113560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 115783 114509 gene locus_tag LOCUS_18820 115783 114509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_18820 116888 115791 gene locus_tag LOCUS_18830 116888 115791 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_18830 117404 116940 gene locus_tag LOCUS_18840 117404 116940 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_18840 118390 117407 gene locus_tag LOCUS_18850 118390 117407 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_18850 118777 119478 gene locus_tag LOCUS_18860 118777 119478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 119496 120134 gene locus_tag LOCUS_18870 gene cynT 119496 120134 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_18870 120478 120131 gene locus_tag LOCUS_18880 120478 120131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 120668 121444 gene locus_tag LOCUS_18890 120668 121444 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097194.1 protein_id gnl|my_center|LOCUS_18890 121686 122237 gene locus_tag LOCUS_18900 121686 122237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 122535 124112 gene locus_tag LOCUS_18910 122535 124112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_18910 124875 124177 gene locus_tag LOCUS_18920 124875 124177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 125387 125100 gene locus_tag LOCUS_18930 125387 125100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 125271 126782 gene locus_tag LOCUS_18940 125271 126782 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_18940 127655 126957 gene locus_tag LOCUS_18950 127655 126957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 128309 128947 gene locus_tag LOCUS_18960 128309 128947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 128991 129644 gene locus_tag LOCUS_18970 128991 129644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 129851 131401 gene locus_tag LOCUS_18980 129851 131401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 131639 132076 gene locus_tag LOCUS_18990 131639 132076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 132142 132681 gene locus_tag LOCUS_19000 gene sigW 132142 132681 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_19000 132678 133046 gene locus_tag LOCUS_19010 132678 133046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 133103 133618 gene locus_tag LOCUS_19020 133103 133618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 136784 133644 gene locus_tag LOCUS_19030 136784 133644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 137246 136980 gene locus_tag LOCUS_19040 137246 136980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 138056 137307 gene locus_tag LOCUS_19050 138056 137307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 138532 138053 gene locus_tag LOCUS_19060 138532 138053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 138817 140136 gene locus_tag LOCUS_19070 138817 140136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 140140 143118 gene locus_tag LOCUS_19080 140140 143118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 143226 145361 gene locus_tag LOCUS_19090 143226 145361 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_19090 145565 148840 gene locus_tag LOCUS_19100 145565 148840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 149321 150619 gene locus_tag LOCUS_19110 149321 150619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 150620 152389 gene locus_tag LOCUS_19120 150620 152389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 152386 153243 gene locus_tag LOCUS_19130 152386 153243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 153240 154100 gene locus_tag LOCUS_19140 153240 154100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 154115 155827 gene locus_tag LOCUS_19150 154115 155827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 155835 157286 gene locus_tag LOCUS_19160 155835 157286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 160105 157220 gene locus_tag LOCUS_19170 160105 157220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 160234 160536 gene locus_tag LOCUS_19180 160234 160536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142290.1 protein_id gnl|my_center|LOCUS_19180 160526 160951 gene locus_tag LOCUS_19190 160526 160951 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142289.1 protein_id gnl|my_center|LOCUS_19190 161304 160984 gene locus_tag LOCUS_19200 161304 160984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 161810 161301 gene locus_tag LOCUS_19210 gene gntK 161810 161301 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJI4 protein_id gnl|my_center|LOCUS_19210 162920 161814 gene locus_tag LOCUS_19220 gene gnl 162920 161814 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039182.1 protein_id gnl|my_center|LOCUS_19220 164350 162986 gene locus_tag LOCUS_19230 164350 162986 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_19230 166752 164347 gene locus_tag LOCUS_19240 gene bglX 166752 164347 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229136.1 protein_id gnl|my_center|LOCUS_19240 169365 166981 gene locus_tag LOCUS_19250 169365 166981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 169928 169686 gene locus_tag LOCUS_19260 169928 169686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 172590 169978 gene locus_tag LOCUS_19270 172590 169978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 173618 172605 gene locus_tag LOCUS_19280 173618 172605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 174499 173606 gene locus_tag LOCUS_19290 174499 173606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 175791 174490 gene locus_tag LOCUS_19300 175791 174490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 177049 175877 gene locus_tag LOCUS_19310 177049 175877 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_19310 177237 182894 gene locus_tag LOCUS_19320 177237 182894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 183077 184105 gene locus_tag LOCUS_19330 gene nadA 183077 184105 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S63 protein_id gnl|my_center|LOCUS_19330 184102 185763 gene locus_tag LOCUS_19340 gene nadB 184102 185763 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R32 protein_id gnl|my_center|LOCUS_19340 189789 185926 gene locus_tag LOCUS_19350 189789 185926 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_19350 190639 189926 gene locus_tag LOCUS_19360 190639 189926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 190765 190971 gene locus_tag LOCUS_19370 190765 190971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 193444 191030 gene locus_tag LOCUS_19380 193444 191030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_19380 196971 193507 gene locus_tag LOCUS_19390 196971 193507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 197174 198139 gene locus_tag LOCUS_19400 197174 198139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 199973 198162 gene locus_tag LOCUS_19410 199973 198162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 200248 202494 gene locus_tag LOCUS_19420 200248 202494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 202518 202916 gene locus_tag LOCUS_19430 202518 202916 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_19430 202929 205088 gene locus_tag LOCUS_19440 202929 205088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 205289 205597 gene locus_tag LOCUS_19450 205289 205597 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8A5 protein_id gnl|my_center|LOCUS_19450 207128 205818 gene locus_tag LOCUS_19460 gene hemA 207128 205818 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_19460 207954 207130 gene locus_tag LOCUS_19470 207954 207130 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_19470 208144 209745 gene locus_tag LOCUS_19480 gene lysS 208144 209745 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_19480 210183 209866 gene locus_tag LOCUS_19490 210183 209866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 211477 210197 gene locus_tag LOCUS_19500 211477 210197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_19500 212272 211694 gene locus_tag LOCUS_19510 212272 211694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 212853 212269 gene locus_tag LOCUS_19520 212853 212269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 213646 212825 gene locus_tag LOCUS_19530 213646 212825 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886661.1 protein_id gnl|my_center|LOCUS_19530 213870 214688 gene locus_tag LOCUS_19540 gene uppP1 213870 214688 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_19540 216110 214962 gene locus_tag LOCUS_19550 216110 214962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 217324 216146 gene locus_tag LOCUS_19560 217324 216146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 217449 218231 gene locus_tag LOCUS_19570 gene lolD 217449 218231 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0B3 protein_id gnl|my_center|LOCUS_19570 218371 220791 gene locus_tag LOCUS_19580 gene clpC 218371 220791 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880827.1 protein_id gnl|my_center|LOCUS_19580 221052 223454 gene locus_tag LOCUS_19590 221052 223454 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_19590 223582 224145 gene locus_tag LOCUS_19600 223582 224145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 224158 225240 gene locus_tag LOCUS_19610 gene lpxD 224158 225240 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5W6 protein_id gnl|my_center|LOCUS_19610 225237 225719 gene locus_tag LOCUS_19620 gene fabZ 225237 225719 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25928 protein_id gnl|my_center|LOCUS_19620 225794 226603 gene locus_tag LOCUS_19630 gene lpxA 225794 226603 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I3 protein_id gnl|my_center|LOCUS_19630 226607 227575 gene locus_tag LOCUS_19640 gene gnnA 226607 227575 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_19640 227658 228536 gene locus_tag LOCUS_19650 gene mtnP 227658 228536 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_19650 228553 229323 gene locus_tag LOCUS_19660 gene surE 228553 229323 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG98 protein_id gnl|my_center|LOCUS_19660 229339 229998 gene locus_tag LOCUS_19670 gene pcm 229339 229998 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG96 protein_id gnl|my_center|LOCUS_19670 229995 230303 gene locus_tag LOCUS_19680 gene acyP 229995 230303 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 protein_id gnl|my_center|LOCUS_19680 230350 230868 gene locus_tag LOCUS_19690 gene apt 230350 230868 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_19690 230947 231023 gene locus_tag LOCUS_t00190 230947 231023 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 231066 231803 gene locus_tag LOCUS_19700 231066 231803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 232141 234471 gene locus_tag LOCUS_19710 232141 234471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 234598 236724 gene locus_tag LOCUS_19720 gene bfrA 234598 236724 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 protein_id gnl|my_center|LOCUS_19720 236748 239234 gene locus_tag LOCUS_19730 236748 239234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 239330 240259 gene locus_tag LOCUS_19740 239330 240259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 240337 241803 gene locus_tag LOCUS_19750 240337 241803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 244077 241840 gene locus_tag LOCUS_19760 244077 241840 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_19760 245203 244172 gene locus_tag LOCUS_19770 gene corA 245203 244172 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_19770 245415 246227 gene locus_tag LOCUS_19780 245415 246227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403574.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence009 659 3499 gene locus_tag LOCUS_19790 659 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3712 5238 gene locus_tag LOCUS_19800 3712 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5345 6631 gene locus_tag LOCUS_19810 gene abcT4 5345 6631 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880682.1 protein_id gnl|my_center|LOCUS_19810 6645 7796 gene locus_tag LOCUS_19820 6645 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 7819 8862 gene locus_tag LOCUS_19830 7819 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_19830 8876 9574 gene locus_tag LOCUS_19840 8876 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 9568 11493 gene locus_tag LOCUS_19850 9568 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11498 13549 gene locus_tag LOCUS_19860 11498 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 14711 13557 gene locus_tag LOCUS_19870 14711 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 14792 15898 gene locus_tag LOCUS_19880 14792 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 16007 16234 gene locus_tag LOCUS_19890 16007 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 16221 16799 gene locus_tag LOCUS_19900 16221 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 16865 17422 gene locus_tag LOCUS_19910 16865 17422 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_19910 17419 20133 gene locus_tag LOCUS_19920 17419 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 20254 20754 gene locus_tag LOCUS_19930 20254 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 22180 20762 gene locus_tag LOCUS_19940 22180 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 22371 24203 gene locus_tag LOCUS_19950 22371 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 24200 25489 gene locus_tag LOCUS_19960 24200 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 25486 26838 gene locus_tag LOCUS_19970 25486 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 27134 28990 gene locus_tag LOCUS_19980 27134 28990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 29336 29010 gene locus_tag LOCUS_19990 29336 29010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_19990 29776 29333 gene locus_tag LOCUS_20000 29776 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 30407 29793 gene locus_tag LOCUS_20010 gene rpoE 30407 29793 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_20010 30476 31405 gene locus_tag LOCUS_20020 30476 31405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 31742 31494 gene locus_tag LOCUS_20030 31742 31494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 31735 32676 gene locus_tag LOCUS_20040 31735 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 33073 34062 gene locus_tag LOCUS_20050 33073 34062 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_20050 35049 34093 gene locus_tag LOCUS_20060 35049 34093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 35853 35122 gene locus_tag LOCUS_20070 35853 35122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 35884 38193 gene locus_tag LOCUS_20080 gene maeB 35884 38193 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_20080 38341 38940 gene locus_tag LOCUS_20090 38341 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 41289 39334 gene locus_tag LOCUS_20100 41289 39334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 42737 41652 gene locus_tag LOCUS_20110 42737 41652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_20110 43201 42734 gene locus_tag LOCUS_20120 43201 42734 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCR4 protein_id gnl|my_center|LOCUS_20120 43399 44577 gene locus_tag LOCUS_20130 gene fadA 43399 44577 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_20130 44748 47201 gene locus_tag LOCUS_20140 44748 47201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 47310 48383 gene locus_tag LOCUS_20150 47310 48383 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_20150 48376 49227 gene locus_tag LOCUS_20160 gene rmlD 48376 49227 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_20160 49224 50195 gene locus_tag LOCUS_20170 49224 50195 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_20170 50255 51172 gene locus_tag LOCUS_20180 50255 51172 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_20180 51153 52568 gene locus_tag LOCUS_20190 51153 52568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 52604 53527 gene locus_tag LOCUS_20200 gene xerC 52604 53527 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW0 protein_id gnl|my_center|LOCUS_20200 53596 54123 gene locus_tag LOCUS_20210 gene hslV 53596 54123 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ1 protein_id gnl|my_center|LOCUS_20210 54132 55526 gene locus_tag LOCUS_20220 gene hslU 54132 55526 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66574 protein_id gnl|my_center|LOCUS_20220 55561 56604 gene locus_tag LOCUS_20230 55561 56604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 56786 57637 gene locus_tag LOCUS_20240 gene dapF 56786 57637 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAX9 protein_id gnl|my_center|LOCUS_20240 57645 58181 gene locus_tag LOCUS_20250 57645 58181 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890466.1 protein_id gnl|my_center|LOCUS_20250 58833 58195 gene locus_tag LOCUS_20260 58833 58195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 59201 58914 gene locus_tag LOCUS_20270 gene relK 59201 58914 CDS product toxin RelK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF09 protein_id gnl|my_center|LOCUS_20270 59498 59214 gene locus_tag LOCUS_20280 59498 59214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 60899 59565 gene locus_tag LOCUS_20290 60899 59565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 64675 60896 gene locus_tag LOCUS_20300 64675 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 66528 64687 gene locus_tag LOCUS_20310 66528 64687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 68221 66530 gene locus_tag LOCUS_20320 68221 66530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 70074 68218 gene locus_tag LOCUS_20330 70074 68218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 70926 70078 gene locus_tag LOCUS_20340 70926 70078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 73301 70923 gene locus_tag LOCUS_20350 73301 70923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 75062 73680 gene locus_tag LOCUS_20360 gene trmFO 75062 73680 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_20360 76566 75088 gene locus_tag LOCUS_20370 76566 75088 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_20370 78434 76563 gene locus_tag LOCUS_20380 78434 76563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 79708 78422 gene locus_tag LOCUS_20390 gene fabF 79708 78422 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS9 protein_id gnl|my_center|LOCUS_20390 80975 79719 gene locus_tag LOCUS_20400 80975 79719 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_20400 81405 81130 gene locus_tag LOCUS_20410 81405 81130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 81786 82805 gene locus_tag LOCUS_20420 gene add 81786 82805 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNI7 protein_id gnl|my_center|LOCUS_20420 83266 84399 gene locus_tag LOCUS_20430 gene metA 83266 84399 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V8 protein_id gnl|my_center|LOCUS_20430 84399 85676 gene locus_tag LOCUS_20440 gene metB 84399 85676 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_20440 85687 87120 gene locus_tag LOCUS_20450 85687 87120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 88259 87063 gene locus_tag LOCUS_20460 88259 87063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 89635 88256 gene locus_tag LOCUS_20470 89635 88256 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_20470 89915 89655 gene locus_tag LOCUS_20480 89915 89655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 90571 90059 gene locus_tag LOCUS_20490 90571 90059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 90704 91588 gene locus_tag LOCUS_20500 90704 91588 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_20500 91718 92275 gene locus_tag LOCUS_20510 91718 92275 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_20510 94338 92305 gene locus_tag LOCUS_20520 gene uvrd 94338 92305 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S575 protein_id gnl|my_center|LOCUS_20520 94915 94397 gene locus_tag LOCUS_20530 94915 94397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 95157 96536 gene locus_tag LOCUS_20540 95157 96536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 97101 96787 gene locus_tag LOCUS_20550 97101 96787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 97435 97995 gene locus_tag LOCUS_20560 97435 97995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 98787 97984 gene locus_tag LOCUS_20570 gene apaH 98787 97984 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST8 protein_id gnl|my_center|LOCUS_20570 99838 98828 gene locus_tag LOCUS_20580 99838 98828 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404767.1 protein_id gnl|my_center|LOCUS_20580 101028 99859 gene locus_tag LOCUS_20590 101028 99859 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_20590 101309 101025 gene locus_tag LOCUS_20600 101309 101025 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_20600 101763 102539 gene locus_tag LOCUS_20610 gene parA 101763 102539 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_20610 103121 102579 gene locus_tag LOCUS_20620 103121 102579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 104429 103212 gene locus_tag LOCUS_20630 104429 103212 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_20630 106107 104434 gene locus_tag LOCUS_20640 106107 104434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 106196 106630 gene locus_tag LOCUS_20650 106196 106630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 106627 107580 gene locus_tag LOCUS_20660 gene metF 106627 107580 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_20660 107728 109197 gene locus_tag LOCUS_20670 gene dacB 107728 109197 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_20670 109912 109208 gene locus_tag LOCUS_20680 109912 109208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 112046 109983 gene locus_tag LOCUS_20690 112046 109983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 112253 113437 gene locus_tag LOCUS_20700 112253 113437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 113401 113928 gene locus_tag LOCUS_20710 113401 113928 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_20710 115144 113951 gene locus_tag LOCUS_20720 115144 113951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 117354 115336 gene locus_tag LOCUS_20730 117354 115336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 118907 117381 gene locus_tag LOCUS_20740 gene hsdM 118907 117381 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_20740 119185 120333 gene locus_tag LOCUS_20750 gene ald 119185 120333 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403664.1 protein_id gnl|my_center|LOCUS_20750 120330 121628 gene locus_tag LOCUS_20760 120330 121628 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_20760 121724 122554 gene locus_tag LOCUS_20770 121724 122554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 122551 122994 gene locus_tag LOCUS_20780 122551 122994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 122969 123598 gene locus_tag LOCUS_20790 122969 123598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 123613 124488 gene locus_tag LOCUS_20800 123613 124488 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_20800 124562 124858 gene locus_tag LOCUS_20810 124562 124858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 124855 125298 gene locus_tag LOCUS_20820 124855 125298 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_20820 125305 127845 gene locus_tag LOCUS_20830 gene thrA 125305 127845 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_20830 127944 129410 gene locus_tag LOCUS_20840 127944 129410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 129407 131113 gene locus_tag LOCUS_20850 129407 131113 CDS product Mur ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021312.1 protein_id gnl|my_center|LOCUS_20850 131243 132781 gene locus_tag LOCUS_20860 131243 132781 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_20860 135414 132997 gene locus_tag LOCUS_20870 135414 132997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20870 136294 135719 gene locus_tag LOCUS_20880 gene tag 136294 135719 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_20880 137543 136413 gene locus_tag LOCUS_20890 137543 136413 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_20890 138018 137536 gene locus_tag LOCUS_20900 138018 137536 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_20900 138323 139750 gene locus_tag LOCUS_20910 138323 139750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 139757 142576 gene locus_tag LOCUS_20920 139757 142576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 142702 144864 gene locus_tag LOCUS_20930 142702 144864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 144878 145750 gene locus_tag LOCUS_20940 144878 145750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 146249 148375 gene locus_tag LOCUS_20950 146249 148375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 148476 149789 gene locus_tag LOCUS_20960 148476 149789 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_20960 149786 150697 gene locus_tag LOCUS_20970 149786 150697 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_20970 150694 151653 gene locus_tag LOCUS_20980 150694 151653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_20980 152830 151664 gene locus_tag LOCUS_20990 152830 151664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 154050 152845 gene locus_tag LOCUS_21000 154050 152845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 156441 154435 gene locus_tag LOCUS_21010 156441 154435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 158366 156438 gene locus_tag LOCUS_21020 158366 156438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 160147 158363 gene locus_tag LOCUS_21030 160147 158363 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_21030 161102 160296 gene locus_tag LOCUS_21040 161102 160296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 162361 161162 gene locus_tag LOCUS_21050 162361 161162 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_21050 162841 162374 gene locus_tag LOCUS_21060 gene folK 162841 162374 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 163283 162951 gene locus_tag LOCUS_21070 163283 162951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 164639 163425 gene locus_tag LOCUS_21080 164639 163425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 165940 164639 gene locus_tag LOCUS_21090 gene adh 165940 164639 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_21090 166895 166068 gene locus_tag LOCUS_21100 166895 166068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 168151 166892 gene locus_tag LOCUS_21110 168151 166892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 170982 168259 gene locus_tag LOCUS_21120 170982 168259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 171177 171944 gene locus_tag LOCUS_21130 171177 171944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 172644 172048 gene locus_tag LOCUS_21140 172644 172048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 174922 172889 gene locus_tag LOCUS_21150 174922 172889 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_21150 175883 175053 gene locus_tag LOCUS_21160 175883 175053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 177178 175988 gene locus_tag LOCUS_21170 177178 175988 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405047.1 protein_id gnl|my_center|LOCUS_21170 180078 177226 gene locus_tag LOCUS_21180 180078 177226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 181353 180439 gene locus_tag LOCUS_21190 181353 180439 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_21190 182087 181350 gene locus_tag LOCUS_21200 gene bioD 182087 181350 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AMS4 protein_id gnl|my_center|LOCUS_21200 183295 182084 gene locus_tag LOCUS_21210 gene bioF 183295 182084 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709027.1 protein_id gnl|my_center|LOCUS_21210 184323 183292 gene locus_tag LOCUS_21220 gene bioB 184323 183292 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_21220 184431 184862 gene locus_tag LOCUS_21230 184431 184862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 185322 184936 gene locus_tag LOCUS_21240 185322 184936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_21240 185640 186083 gene locus_tag LOCUS_21250 185640 186083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 186080 186334 gene locus_tag LOCUS_21260 186080 186334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 187013 186366 gene locus_tag LOCUS_21270 187013 186366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 187732 187145 gene locus_tag LOCUS_21280 187732 187145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 188561 187854 gene locus_tag LOCUS_21290 188561 187854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 188683 189528 gene locus_tag LOCUS_21300 188683 189528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_21300 190018 189551 gene locus_tag LOCUS_21310 190018 189551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 190713 190102 gene locus_tag LOCUS_21320 190713 190102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 191870 191073 gene locus_tag LOCUS_21330 gene ydjF 191870 191073 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54617 protein_id gnl|my_center|LOCUS_21330 194577 191920 gene locus_tag LOCUS_21340 194577 191920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 194838 196973 gene locus_tag LOCUS_21350 194838 196973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 196970 198421 gene locus_tag LOCUS_21360 196970 198421 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_21360 200894 199650 gene locus_tag LOCUS_21370 200894 199650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 201323 202252 gene locus_tag LOCUS_21380 201323 202252 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226603.1 protein_id gnl|my_center|LOCUS_21380 202314 203204 gene locus_tag LOCUS_21390 202314 203204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 203201 204298 gene locus_tag LOCUS_21400 203201 204298 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205053.1 protein_id gnl|my_center|LOCUS_21400 204295 206991 gene locus_tag LOCUS_21410 204295 206991 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555901.1 protein_id gnl|my_center|LOCUS_21410 206991 208130 gene locus_tag LOCUS_21420 206991 208130 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040218.1 protein_id gnl|my_center|LOCUS_21420 208132 209163 gene locus_tag LOCUS_21430 208132 209163 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527001.1 protein_id gnl|my_center|LOCUS_21430 209278 212673 gene locus_tag LOCUS_21440 209278 212673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_21440 212670 213422 gene locus_tag LOCUS_21450 212670 213422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 215125 213560 gene locus_tag LOCUS_21460 215125 213560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 216563 215148 gene locus_tag LOCUS_21470 gene mpl 216563 215148 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_21470 216873 217922 gene locus_tag LOCUS_21480 216873 217922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 219003 218260 gene locus_tag LOCUS_21490 219003 218260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 219756 219151 gene locus_tag LOCUS_21500 gene pdxH 219756 219151 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221982.1 protein_id gnl|my_center|LOCUS_21500 219907 222897 gene locus_tag LOCUS_21510 219907 222897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 223249 223797 gene locus_tag LOCUS_21520 223249 223797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 223985 225568 gene locus_tag LOCUS_21530 223985 225568 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946542.1 protein_id gnl|my_center|LOCUS_21530 226380 225775 gene locus_tag LOCUS_21540 gene tdk 226380 225775 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL9 protein_id gnl|my_center|LOCUS_21540 226452 226832 gene locus_tag LOCUS_21550 226452 226832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_21550 228806 227463 gene locus_tag LOCUS_21560 228806 227463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 230089 228902 gene locus_tag LOCUS_21570 230089 228902 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_21570 230255 232870 gene locus_tag LOCUS_21580 230255 232870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 232969 235620 gene locus_tag LOCUS_21590 232969 235620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 235617 236258 gene locus_tag LOCUS_21600 gene maf-1 235617 236258 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFB0 protein_id gnl|my_center|LOCUS_21600 236980 236582 gene locus_tag LOCUS_21610 236980 236582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence010 1322 150 gene locus_tag LOCUS_21620 1322 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4340 1548 gene locus_tag LOCUS_21630 4340 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4635 6818 gene locus_tag LOCUS_21640 4635 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8576 7155 gene locus_tag LOCUS_21650 8576 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 9840 8605 gene locus_tag LOCUS_21660 gene ftsA 9840 8605 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_21660 10957 9854 gene locus_tag LOCUS_21670 10957 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 12345 10954 gene locus_tag LOCUS_21680 gene murC 12345 10954 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_21680 13457 12345 gene locus_tag LOCUS_21690 gene murG 13457 12345 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWC0 protein_id gnl|my_center|LOCUS_21690 14592 13507 gene locus_tag LOCUS_21700 14592 13507 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_21700 16114 14582 gene locus_tag LOCUS_21710 gene murD 16114 14582 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D4 protein_id gnl|my_center|LOCUS_21710 17216 16131 gene locus_tag LOCUS_21720 gene mraY 17216 16131 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_21720 18637 17216 gene locus_tag LOCUS_21730 gene murF 18637 17216 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_21730 20165 18624 gene locus_tag LOCUS_21740 gene murE 20165 18624 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_21740 22096 20165 gene locus_tag LOCUS_21750 gene ftsI 22096 20165 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_21750 22437 22093 gene locus_tag LOCUS_21760 22437 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 23416 22448 gene locus_tag LOCUS_21770 gene rsmH 23416 22448 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_21770 23935 23495 gene locus_tag LOCUS_21780 gene mraZ 23935 23495 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45056 protein_id gnl|my_center|LOCUS_21780 24413 25759 gene locus_tag LOCUS_21790 24413 25759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 25958 28318 gene locus_tag LOCUS_21800 25958 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 29617 28217 gene locus_tag LOCUS_21810 gene mdtK 29617 28217 CDS product multidrug resistance protein MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBB6 protein_id gnl|my_center|LOCUS_21810 31846 29891 gene locus_tag LOCUS_21820 31846 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 31965 32336 gene locus_tag LOCUS_21830 31965 32336 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_21830 32765 32448 gene locus_tag LOCUS_21840 32765 32448 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258010.1 protein_id gnl|my_center|LOCUS_21840 33507 32776 gene locus_tag LOCUS_21850 33507 32776 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_21850 35208 33538 gene locus_tag LOCUS_21860 35208 33538 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_21860 36257 35214 gene locus_tag LOCUS_21870 36257 35214 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_21870 37111 36254 gene locus_tag LOCUS_21880 37111 36254 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_21880 37638 37108 gene locus_tag LOCUS_21890 37638 37108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 38860 37631 gene locus_tag LOCUS_21900 38860 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_21900 39587 38883 gene locus_tag LOCUS_21910 39587 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 40128 39577 gene locus_tag LOCUS_21920 40128 39577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_21920 41518 40121 gene locus_tag LOCUS_21930 41518 40121 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_21930 44610 41542 gene locus_tag LOCUS_21940 44610 41542 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_21940 45384 44725 gene locus_tag LOCUS_21950 45384 44725 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_21950 46358 45744 gene locus_tag LOCUS_21960 46358 45744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 47046 46468 gene locus_tag LOCUS_21970 47046 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 48380 47058 gene locus_tag LOCUS_21980 48380 47058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_21980 49734 48361 gene locus_tag LOCUS_21990 49734 48361 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_21990 49839 50111 gene locus_tag LOCUS_22000 49839 50111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 50083 50595 gene locus_tag LOCUS_22010 50083 50595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 50600 51406 gene locus_tag LOCUS_22020 gene cphB 50600 51406 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_22020 51409 54195 gene locus_tag LOCUS_22030 gene cphA 51409 54195 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_22030 54273 55067 gene locus_tag LOCUS_22040 gene kynA 54273 55067 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_22040 55091 56299 gene locus_tag LOCUS_22050 55091 56299 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_22050 59133 56296 gene locus_tag LOCUS_22060 59133 56296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 61918 59462 gene locus_tag LOCUS_22070 61918 59462 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_22070 62176 64134 gene locus_tag LOCUS_22080 62176 64134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 64131 64937 gene locus_tag LOCUS_22090 64131 64937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 65314 64946 gene locus_tag LOCUS_22100 gene spoIIAA 65314 64946 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_22100 66613 65465 gene locus_tag LOCUS_22110 66613 65465 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_22110 66877 69462 gene locus_tag LOCUS_22120 66877 69462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 69564 70229 gene locus_tag LOCUS_22130 gene rpoE 69564 70229 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_22130 70250 70780 gene locus_tag LOCUS_22140 70250 70780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 70777 71523 gene locus_tag LOCUS_22150 70777 71523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 71623 72831 gene locus_tag LOCUS_22160 71623 72831 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_22160 73072 74154 gene locus_tag LOCUS_22170 73072 74154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 74189 75637 gene locus_tag LOCUS_22180 74189 75637 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_22180 75638 76672 gene locus_tag LOCUS_22190 75638 76672 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_22190 76741 77226 gene locus_tag LOCUS_22200 76741 77226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 77223 78299 gene locus_tag LOCUS_22210 77223 78299 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_22210 78410 80134 gene locus_tag LOCUS_22220 gene pilB 78410 80134 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_22220 80537 83155 gene locus_tag LOCUS_22230 80537 83155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 83240 83593 gene locus_tag LOCUS_22240 83240 83593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 84256 83711 gene locus_tag LOCUS_22250 84256 83711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 85884 84379 gene locus_tag LOCUS_22260 85884 84379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 86759 86058 gene locus_tag LOCUS_22270 86759 86058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 87805 86759 gene locus_tag LOCUS_22280 gene manC 87805 86759 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_22280 88561 87860 gene locus_tag LOCUS_22290 88561 87860 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_22290 89203 88619 gene locus_tag LOCUS_22300 89203 88619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 89574 90221 gene locus_tag LOCUS_22310 gene ppa 89574 90221 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67501 protein_id gnl|my_center|LOCUS_22310 90408 92444 gene locus_tag LOCUS_22320 90408 92444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 92608 93552 gene locus_tag LOCUS_22330 92608 93552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 93832 93572 gene locus_tag LOCUS_22340 93832 93572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 94728 93970 gene locus_tag LOCUS_22350 94728 93970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989617.1 protein_id gnl|my_center|LOCUS_22350 94767 95624 gene locus_tag LOCUS_22360 94767 95624 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404077.1 protein_id gnl|my_center|LOCUS_22360 95743 96291 gene locus_tag LOCUS_22370 95743 96291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 96293 98959 gene locus_tag LOCUS_22380 96293 98959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 99114 100079 gene locus_tag LOCUS_22390 99114 100079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 100066 100932 gene locus_tag LOCUS_22400 100066 100932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 100929 101930 gene locus_tag LOCUS_22410 100929 101930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_22410 101930 102742 gene locus_tag LOCUS_22420 101930 102742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 103996 102746 gene locus_tag LOCUS_22430 103996 102746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 104167 106272 gene locus_tag LOCUS_22440 104167 106272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 106269 108527 gene locus_tag LOCUS_22450 106269 108527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 108520 111216 gene locus_tag LOCUS_22460 108520 111216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 111316 113088 gene locus_tag LOCUS_22470 111316 113088 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_22470 113102 114664 gene locus_tag LOCUS_22480 113102 114664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 114696 115100 gene locus_tag LOCUS_22490 114696 115100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 115113 115922 gene locus_tag LOCUS_22500 115113 115922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 117034 116147 gene locus_tag LOCUS_22510 117034 116147 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968103.1 protein_id gnl|my_center|LOCUS_22510 117552 117031 gene locus_tag LOCUS_22520 117552 117031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 120601 117566 gene locus_tag LOCUS_22530 120601 117566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 120802 122604 gene locus_tag LOCUS_22540 120802 122604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 123183 122620 gene locus_tag LOCUS_22550 123183 122620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 125278 123356 gene locus_tag LOCUS_22560 gene asnB 125278 123356 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_22560 126701 125289 gene locus_tag LOCUS_22570 126701 125289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 127879 126698 gene locus_tag LOCUS_22580 127879 126698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 128070 128813 gene locus_tag LOCUS_22590 128070 128813 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_22590 130529 128985 gene locus_tag LOCUS_22600 130529 128985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 130693 133032 gene locus_tag LOCUS_22610 130693 133032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 133046 134659 gene locus_tag LOCUS_22620 133046 134659 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022165.1 protein_id gnl|my_center|LOCUS_22620 134718 134948 gene locus_tag LOCUS_22630 134718 134948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 134952 135239 gene locus_tag LOCUS_22640 134952 135239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 135290 136156 gene locus_tag LOCUS_22650 135290 136156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 136166 137443 gene locus_tag LOCUS_22660 136166 137443 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_22660 137440 138276 gene locus_tag LOCUS_22670 137440 138276 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_22670 138273 140087 gene locus_tag LOCUS_22680 138273 140087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 140084 141241 gene locus_tag LOCUS_22690 140084 141241 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_22690 141741 141238 gene locus_tag LOCUS_22700 141741 141238 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709628.1 protein_id gnl|my_center|LOCUS_22700 141931 144153 gene locus_tag LOCUS_22710 gene ppk 141931 144153 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI61 protein_id gnl|my_center|LOCUS_22710 145732 144155 gene locus_tag LOCUS_22720 145732 144155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 147262 145841 gene locus_tag LOCUS_22730 147262 145841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 148212 147259 gene locus_tag LOCUS_22740 148212 147259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 148631 148209 gene locus_tag LOCUS_22750 148631 148209 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110359.1 protein_id gnl|my_center|LOCUS_22750 149405 148638 gene locus_tag LOCUS_22760 149405 148638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 150345 149398 gene locus_tag LOCUS_22770 150345 149398 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_22770 151712 150447 gene locus_tag LOCUS_22780 gene wlbF 151712 150447 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064734.1 protein_id gnl|my_center|LOCUS_22780 151992 152198 gene locus_tag LOCUS_22790 gene rpmE 151992 152198 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A8 protein_id gnl|my_center|LOCUS_22790 152280 153371 gene locus_tag LOCUS_22800 gene prfA 152280 153371 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIQ7 protein_id gnl|my_center|LOCUS_22800 153455 154996 gene locus_tag LOCUS_22810 153455 154996 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_22810 155190 155729 gene locus_tag LOCUS_22820 155190 155729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 155713 157188 gene locus_tag LOCUS_22830 gene xseA 155713 157188 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_22830 157236 157460 gene locus_tag LOCUS_22840 157236 157460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 160231 157445 gene locus_tag LOCUS_22850 160231 157445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 162688 160454 gene locus_tag LOCUS_22860 162688 160454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 162838 164175 gene locus_tag LOCUS_22870 162838 164175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 164990 164211 gene locus_tag LOCUS_22880 164990 164211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 166135 164987 gene locus_tag LOCUS_22890 166135 164987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 166647 166177 gene locus_tag LOCUS_22900 gene phnB 166647 166177 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_22900 166894 168531 gene locus_tag LOCUS_22910 166894 168531 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_22910 168558 168845 gene locus_tag LOCUS_22920 168558 168845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22920 168842 169780 gene locus_tag LOCUS_22930 gene pyrF 168842 169780 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_22930 169777 172224 gene locus_tag LOCUS_22940 169777 172224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_22940 172355 173185 gene locus_tag LOCUS_22950 172355 173185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 173205 174566 gene locus_tag LOCUS_22960 gene ndh 173205 174566 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_22960 176287 174509 gene locus_tag LOCUS_22970 176287 174509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 177498 176401 gene locus_tag LOCUS_22980 177498 176401 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_22980 180617 177519 gene locus_tag LOCUS_22990 180617 177519 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_22990 182149 180800 gene locus_tag LOCUS_23000 182149 180800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 183573 182311 gene locus_tag LOCUS_23010 183573 182311 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_23010 183812 185569 gene locus_tag LOCUS_23020 gene hsdM 183812 185569 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_23020 185566 186780 gene locus_tag LOCUS_23030 185566 186780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 186846 187499 gene locus_tag LOCUS_23040 186846 187499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 188216 187521 gene locus_tag LOCUS_23050 188216 187521 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_23050 188413 188931 gene locus_tag LOCUS_23060 188413 188931 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_23060 188992 189462 gene locus_tag LOCUS_23070 188992 189462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 191503 189467 gene locus_tag LOCUS_23080 191503 189467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 193452 191500 gene locus_tag LOCUS_23090 193452 191500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 194522 193500 gene locus_tag LOCUS_23100 194522 193500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461396.1 protein_id gnl|my_center|LOCUS_23100 194959 194519 gene locus_tag LOCUS_23110 194959 194519 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_23110 198961 195011 gene locus_tag LOCUS_23120 198961 195011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 201968 198954 gene locus_tag LOCUS_23130 201968 198954 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_23130 203113 201968 gene locus_tag LOCUS_23140 203113 201968 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_23140 203854 203153 gene locus_tag LOCUS_23150 203854 203153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 206625 203851 gene locus_tag LOCUS_23160 206625 203851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 207551 206622 gene locus_tag LOCUS_23170 207551 206622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402933.1 protein_id gnl|my_center|LOCUS_23170 209165 207810 gene locus_tag LOCUS_23180 209165 207810 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence011 525 148 gene locus_tag LOCUS_23190 525 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1206 832 gene locus_tag LOCUS_23200 1206 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2147 1197 gene locus_tag LOCUS_23210 2147 1197 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528486.1 protein_id gnl|my_center|LOCUS_23210 3169 2222 gene locus_tag LOCUS_23220 gene trpD 3169 2222 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94326 protein_id gnl|my_center|LOCUS_23220 3849 3271 gene locus_tag LOCUS_23230 3849 3271 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_23230 5393 3930 gene locus_tag LOCUS_23240 gene trpE 5393 3930 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_23240 6136 5390 gene locus_tag LOCUS_23250 gene hisI 6136 5390 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSW7 protein_id gnl|my_center|LOCUS_23250 6993 6133 gene locus_tag LOCUS_23260 gene hisF 6993 6133 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S295 protein_id gnl|my_center|LOCUS_23260 8303 6990 gene locus_tag LOCUS_23270 gene hisD 8303 6990 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8M7 protein_id gnl|my_center|LOCUS_23270 10356 8353 gene locus_tag LOCUS_23280 10356 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 13435 10433 gene locus_tag LOCUS_23290 13435 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 13802 13425 gene locus_tag LOCUS_23300 13802 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 14625 13879 gene locus_tag LOCUS_23310 gene hisA 14625 13879 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60581 protein_id gnl|my_center|LOCUS_23310 15314 14625 gene locus_tag LOCUS_23320 gene hisH 15314 14625 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S299 protein_id gnl|my_center|LOCUS_23320 16441 15377 gene locus_tag LOCUS_23330 gene hisC 16441 15377 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2C4 protein_id gnl|my_center|LOCUS_23330 17206 16580 gene locus_tag LOCUS_23340 gene hisG 17206 16580 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2C2 protein_id gnl|my_center|LOCUS_23340 18210 17206 gene locus_tag LOCUS_23350 gene hisZ 18210 17206 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM14 protein_id gnl|my_center|LOCUS_23350 21909 18562 gene locus_tag LOCUS_23360 21909 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 26077 21992 gene locus_tag LOCUS_23370 26077 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 27014 26250 gene locus_tag LOCUS_23380 27014 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 29269 27350 gene locus_tag LOCUS_23390 gene hutH 29269 27350 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHT8 protein_id gnl|my_center|LOCUS_23390 30900 29410 gene locus_tag LOCUS_23400 gene hisS 30900 29410 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWD2 protein_id gnl|my_center|LOCUS_23400 32482 31073 gene locus_tag LOCUS_23410 32482 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_23410 32756 33286 gene locus_tag LOCUS_23420 32756 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 33418 34104 gene locus_tag LOCUS_23430 33418 34104 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_23430 36368 34101 gene locus_tag LOCUS_23440 36368 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 36583 37113 gene locus_tag LOCUS_23450 36583 37113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 37643 37146 gene locus_tag LOCUS_23460 gene yigI 37643 37146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_23460 39523 37640 gene locus_tag LOCUS_23470 39523 37640 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23470 39967 42216 gene locus_tag LOCUS_23480 39967 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 45238 42260 gene locus_tag LOCUS_23490 45238 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_23490 45515 60520 gene locus_tag LOCUS_23500 45515 60520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 60517 61446 gene locus_tag LOCUS_23510 60517 61446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 62090 61443 gene locus_tag LOCUS_23520 62090 61443 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_23520 62382 64283 gene locus_tag LOCUS_23530 62382 64283 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_23530 64449 65264 gene locus_tag LOCUS_23540 64449 65264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 65274 66071 gene locus_tag LOCUS_23550 65274 66071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 66323 67336 gene locus_tag LOCUS_23560 66323 67336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 67457 68632 gene locus_tag LOCUS_23570 67457 68632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 72851 68664 gene locus_tag LOCUS_23580 72851 68664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 74295 72832 gene locus_tag LOCUS_23590 74295 72832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 74588 79510 gene locus_tag LOCUS_23600 74588 79510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 79814 81907 gene locus_tag LOCUS_23610 79814 81907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 82199 84109 gene locus_tag LOCUS_23620 82199 84109 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_23620 84106 85695 gene locus_tag LOCUS_23630 84106 85695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 85699 87942 gene locus_tag LOCUS_23640 85699 87942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 87939 89642 gene locus_tag LOCUS_23650 87939 89642 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_23650 89646 90482 gene locus_tag LOCUS_23660 89646 90482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 90504 92096 gene locus_tag LOCUS_23670 90504 92096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 92113 93156 gene locus_tag LOCUS_23680 92113 93156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 93153 95390 gene locus_tag LOCUS_23690 93153 95390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 95558 96673 gene locus_tag LOCUS_23700 95558 96673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_23700 96675 99698 gene locus_tag LOCUS_23710 96675 99698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_23710 99770 100906 gene locus_tag LOCUS_23720 99770 100906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 100906 102087 gene locus_tag LOCUS_23730 100906 102087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 102084 102989 gene locus_tag LOCUS_23740 102084 102989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 105648 102991 gene locus_tag LOCUS_23750 105648 102991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 106352 105654 gene locus_tag LOCUS_23760 106352 105654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 107068 106349 gene locus_tag LOCUS_23770 107068 106349 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_23770 108072 107071 gene locus_tag LOCUS_23780 108072 107071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 108394 110874 gene locus_tag LOCUS_23790 108394 110874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 112313 110835 gene locus_tag LOCUS_23800 112313 110835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23800 112477 112310 gene locus_tag LOCUS_23810 112477 112310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 115576 112574 gene locus_tag LOCUS_23820 115576 112574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 116397 115582 gene locus_tag LOCUS_23830 116397 115582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 117134 116394 gene locus_tag LOCUS_23840 117134 116394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 117366 119624 gene locus_tag LOCUS_23850 117366 119624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 120622 119642 gene locus_tag LOCUS_23860 120622 119642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 121363 120791 gene locus_tag LOCUS_23870 121363 120791 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_23870 121604 121689 gene locus_tag LOCUS_t00200 121604 121689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 122667 122107 gene locus_tag LOCUS_23880 122667 122107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 122919 126353 gene locus_tag LOCUS_23890 122919 126353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 126417 129929 gene locus_tag LOCUS_23900 126417 129929 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BR0 protein_id gnl|my_center|LOCUS_23900 130015 131409 gene locus_tag LOCUS_23910 130015 131409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 131867 131322 gene locus_tag LOCUS_23920 131867 131322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 133063 131993 gene locus_tag LOCUS_23930 133063 131993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 133619 133077 gene locus_tag LOCUS_23940 133619 133077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23940 134725 133652 gene locus_tag LOCUS_23950 134725 133652 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_23950 135782 134754 gene locus_tag LOCUS_23960 gene ftsY 135782 134754 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_23960 136183 135818 gene locus_tag LOCUS_23970 136183 135818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 138031 136205 gene locus_tag LOCUS_23980 138031 136205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 139318 138230 gene locus_tag LOCUS_23990 gene aroB 139318 138230 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_23990 139205 139411 gene locus_tag LOCUS_24000 139205 139411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 139528 141858 gene locus_tag LOCUS_24010 139528 141858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 142114 143703 gene locus_tag LOCUS_24020 142114 143703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 143856 145697 gene locus_tag LOCUS_24030 143856 145697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 147120 145705 gene locus_tag LOCUS_24040 147120 145705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 148672 147131 gene locus_tag LOCUS_24050 148672 147131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 149541 148669 gene locus_tag LOCUS_24060 149541 148669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 149747 150427 gene locus_tag LOCUS_24070 149747 150427 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_24070 150445 152184 gene locus_tag LOCUS_24080 gene agpS 150445 152184 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_24080 153837 152191 gene locus_tag LOCUS_24090 153837 152191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 156203 153963 gene locus_tag LOCUS_24100 156203 153963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 156399 156965 gene locus_tag LOCUS_24110 156399 156965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 157062 158186 gene locus_tag LOCUS_24120 157062 158186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 158186 159367 gene locus_tag LOCUS_24130 158186 159367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 161173 159563 gene locus_tag LOCUS_24140 161173 159563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_24140 161775 161176 gene locus_tag LOCUS_24150 gene cpcT1 161775 161176 CDS product chromophore lyase CpcT/CpeT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH3 protein_id gnl|my_center|LOCUS_24150 162189 164606 gene locus_tag LOCUS_24160 gene deaD 162189 164606 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_24160 164889 166811 gene locus_tag LOCUS_24170 164889 166811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 167071 169371 gene locus_tag LOCUS_24180 167071 169371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 171149 169470 gene locus_tag LOCUS_24190 171149 169470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 171451 172062 gene locus_tag LOCUS_24200 171451 172062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 172059 172865 gene locus_tag LOCUS_24210 gene tatC 172059 172865 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ6 protein_id gnl|my_center|LOCUS_24210 173551 172886 gene locus_tag LOCUS_24220 173551 172886 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_24220 174555 173548 gene locus_tag LOCUS_24230 gene htrB 174555 173548 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_24230 174205 174129 gene locus_tag LOCUS_t00210 174205 174129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 175105 174569 gene locus_tag LOCUS_24240 175105 174569 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122486.1 protein_id gnl|my_center|LOCUS_24240 176082 175105 gene locus_tag LOCUS_24250 gene kpsF 176082 175105 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P717 protein_id gnl|my_center|LOCUS_24250 176924 176079 gene locus_tag LOCUS_24260 gene kdsA 176924 176079 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61654 protein_id gnl|my_center|LOCUS_24260 178579 176921 gene locus_tag LOCUS_24270 gene pyrG 178579 176921 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT4 protein_id gnl|my_center|LOCUS_24270 179515 178775 gene locus_tag LOCUS_24280 gene kdsB 179515 178775 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_24280 179695 180873 gene locus_tag LOCUS_24290 179695 180873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 180946 183156 gene locus_tag LOCUS_24300 180946 183156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 183402 185204 gene locus_tag LOCUS_24310 183402 185204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 185383 185177 gene locus_tag LOCUS_24320 185383 185177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 185832 185434 gene locus_tag LOCUS_24330 185832 185434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 186134 185829 gene locus_tag LOCUS_24340 186134 185829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 189081 186121 gene locus_tag LOCUS_24350 189081 186121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 189656 189078 gene locus_tag LOCUS_24360 189656 189078 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_24360 189905 192523 gene locus_tag LOCUS_24370 189905 192523 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_24370 192800 194932 gene locus_tag LOCUS_24380 192800 194932 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_24380 199900 194996 gene locus_tag LOCUS_24390 199900 194996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 200718 200050 gene locus_tag LOCUS_24400 200718 200050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 202693 200921 gene locus_tag LOCUS_24410 202693 200921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 203385 202699 gene locus_tag LOCUS_24420 203385 202699 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence012 <1 1149 gene locus_tag LOCUS_24430 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525720.1:oxidoreductase 2680 1151 gene locus_tag LOCUS_24440 2680 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3015 5885 gene locus_tag LOCUS_24450 3015 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6192 9089 gene locus_tag LOCUS_24460 6192 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 9343 10380 gene locus_tag LOCUS_24470 9343 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 10591 12654 gene locus_tag LOCUS_24480 10591 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 12651 14642 gene locus_tag LOCUS_24490 12651 14642 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_24490 14639 16324 gene locus_tag LOCUS_24500 14639 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 16321 18279 gene locus_tag LOCUS_24510 16321 18279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 18692 18276 gene locus_tag LOCUS_24520 18692 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 19792 18689 gene locus_tag LOCUS_24530 19792 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_24530 21423 19789 gene locus_tag LOCUS_24540 21423 19789 CDS product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_24540 21722 21543 gene locus_tag LOCUS_24550 21722 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 23798 21957 gene locus_tag LOCUS_24560 23798 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 24106 25980 gene locus_tag LOCUS_24570 24106 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 26738 25977 gene locus_tag LOCUS_24580 26738 25977 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120235.1 protein_id gnl|my_center|LOCUS_24580 28285 26789 gene locus_tag LOCUS_24590 28285 26789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 protein_id gnl|my_center|LOCUS_24590 28545 30344 gene locus_tag LOCUS_24600 gene lepA2 28545 30344 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_24600 30341 31690 gene locus_tag LOCUS_24610 gene hemN 30341 31690 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_24610 31703 32056 gene locus_tag LOCUS_24620 31703 32056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_24620 32059 33384 gene locus_tag LOCUS_24630 32059 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639137.2 protein_id gnl|my_center|LOCUS_24630 33422 34246 gene locus_tag LOCUS_24640 33422 34246 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_24640 34387 35481 gene locus_tag LOCUS_24650 gene rnd 34387 35481 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 protein_id gnl|my_center|LOCUS_24650 35809 37209 gene locus_tag LOCUS_24660 gene cyp138 35809 37209 CDS product putative cytochrome P450 138 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPM3 protein_id gnl|my_center|LOCUS_24660 37512 38807 gene locus_tag LOCUS_24670 gene adh 37512 38807 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_24670 38846 40135 gene locus_tag LOCUS_24680 38846 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 40525 41880 gene locus_tag LOCUS_24690 40525 41880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 43073 41955 gene locus_tag LOCUS_24700 43073 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_24700 43951 43133 gene locus_tag LOCUS_24710 43951 43133 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_24710 45069 43954 gene locus_tag LOCUS_24720 45069 43954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24720 46272 45070 gene locus_tag LOCUS_24730 46272 45070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24730 47581 46538 gene locus_tag LOCUS_24740 47581 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 49894 47846 gene locus_tag LOCUS_24750 49894 47846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 52888 50708 gene locus_tag LOCUS_24760 52888 50708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 53103 54347 gene locus_tag LOCUS_24770 53103 54347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 54414 54752 gene locus_tag LOCUS_24780 54414 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 57002 54768 gene locus_tag LOCUS_24790 gene clpA 57002 54768 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_24790 57363 57019 gene locus_tag LOCUS_24800 57363 57019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 57581 58669 gene locus_tag LOCUS_24810 57581 58669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_24810 61982 58911 gene locus_tag LOCUS_24820 61982 58911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 61350 61422 gene locus_tag LOCUS_t00220 61350 61422 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 63209 62202 gene locus_tag LOCUS_24830 gene truD 63209 62202 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_24830 66202 63362 gene locus_tag LOCUS_24840 66202 63362 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_24840 68142 66199 gene locus_tag LOCUS_24850 68142 66199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 69086 68142 gene locus_tag LOCUS_24860 69086 68142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 70588 69083 gene locus_tag LOCUS_24870 70588 69083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 71520 70585 gene locus_tag LOCUS_24880 71520 70585 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_24880 73340 71517 gene locus_tag LOCUS_24890 73340 71517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 74398 73337 gene locus_tag LOCUS_24900 74398 73337 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_24900 75972 74395 gene locus_tag LOCUS_24910 75972 74395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 77347 76181 gene locus_tag LOCUS_24920 77347 76181 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_24920 78802 77360 gene locus_tag LOCUS_24930 78802 77360 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552128.1 protein_id gnl|my_center|LOCUS_24930 79258 78980 gene locus_tag LOCUS_24940 79258 78980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 79229 80416 gene locus_tag LOCUS_24950 79229 80416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 protein_id gnl|my_center|LOCUS_24950 80420 82456 gene locus_tag LOCUS_24960 80420 82456 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_24960 82588 83376 gene locus_tag LOCUS_24970 82588 83376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 83461 83985 gene locus_tag LOCUS_24980 83461 83985 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395673.1 protein_id gnl|my_center|LOCUS_24980 83966 84721 gene locus_tag LOCUS_24990 83966 84721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 84715 85764 gene locus_tag LOCUS_25000 84715 85764 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_25000 86031 87209 gene locus_tag LOCUS_25010 86031 87209 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_25010 88889 87150 gene locus_tag LOCUS_25020 88889 87150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 89591 88941 gene locus_tag LOCUS_25030 89591 88941 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_25030 89855 91213 gene locus_tag LOCUS_25040 89855 91213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 protein_id gnl|my_center|LOCUS_25040 92214 91141 gene locus_tag LOCUS_25050 92214 91141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 92586 94076 gene locus_tag LOCUS_25060 92586 94076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 94609 94061 gene locus_tag LOCUS_25070 94609 94061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 94762 94625 gene locus_tag LOCUS_25080 94762 94625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 96145 94829 gene locus_tag LOCUS_25090 96145 94829 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_25090 98610 96145 gene locus_tag LOCUS_25100 98610 96145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 103081 98618 gene locus_tag LOCUS_25110 103081 98618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 104486 103302 gene locus_tag LOCUS_25120 104486 103302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 104716 108519 gene locus_tag LOCUS_25130 gene smc 104716 108519 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_25130 108779 109159 gene locus_tag LOCUS_25140 108779 109159 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_25140 109156 111834 gene locus_tag LOCUS_25150 109156 111834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_25150 112498 111842 gene locus_tag LOCUS_25160 112498 111842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 113304 112495 gene locus_tag LOCUS_25170 113304 112495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 117017 113451 gene locus_tag LOCUS_25180 117017 113451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 117679 117071 gene locus_tag LOCUS_25190 117679 117071 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_25190 117837 118283 gene locus_tag LOCUS_25200 117837 118283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 118293 118931 gene locus_tag LOCUS_25210 118293 118931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 119185 118937 gene locus_tag LOCUS_25220 119185 118937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 119117 119359 gene locus_tag LOCUS_25230 119117 119359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 119935 119438 gene locus_tag LOCUS_25240 119935 119438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 123171 120391 gene locus_tag LOCUS_25250 123171 120391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 123601 125376 gene locus_tag LOCUS_25260 123601 125376 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_25260 125472 127040 gene locus_tag LOCUS_25270 125472 127040 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481484.1 protein_id gnl|my_center|LOCUS_25270 127350 129062 gene locus_tag LOCUS_25280 127350 129062 CDS product ubiquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405397.1 protein_id gnl|my_center|LOCUS_25280 130116 129046 gene locus_tag LOCUS_25290 130116 129046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 130442 130206 gene locus_tag LOCUS_25300 130442 130206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 130911 131762 gene locus_tag LOCUS_25310 130911 131762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 132239 131778 gene locus_tag LOCUS_25320 132239 131778 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_25320 132570 132367 gene locus_tag LOCUS_25330 132570 132367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_25330 133801 132770 gene locus_tag LOCUS_25340 gene dhaA 133801 132770 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_25340 133785 134522 gene locus_tag LOCUS_25350 133785 134522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 134884 137469 gene locus_tag LOCUS_25360 134884 137469 CDS product deacylase/carboxypeptidase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405360.1 protein_id gnl|my_center|LOCUS_25360 137496 139337 gene locus_tag LOCUS_25370 137496 139337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 139344 142268 gene locus_tag LOCUS_25380 139344 142268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 145169 142329 gene locus_tag LOCUS_25390 145169 142329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 146127 145555 gene locus_tag LOCUS_25400 146127 145555 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_25400 147449 146124 gene locus_tag LOCUS_25410 147449 146124 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_25410 149086 147614 gene locus_tag LOCUS_25420 149086 147614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 150628 149138 gene locus_tag LOCUS_25430 150628 149138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 152207 150612 gene locus_tag LOCUS_25440 152207 150612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 154571 152739 gene locus_tag LOCUS_25450 154571 152739 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_25450 155709 154561 gene locus_tag LOCUS_25460 gene ansA 155709 154561 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_25460 155995 156666 gene locus_tag LOCUS_25470 155995 156666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 157327 156668 gene locus_tag LOCUS_25480 157327 156668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 157926 157324 gene locus_tag LOCUS_25490 157926 157324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 158828 157923 gene locus_tag LOCUS_25500 158828 157923 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727758.1 protein_id gnl|my_center|LOCUS_25500 159469 158822 gene locus_tag LOCUS_25510 159469 158822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_25510 160402 159470 gene locus_tag LOCUS_25520 160402 159470 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108046.1 protein_id gnl|my_center|LOCUS_25520 160966 160454 gene locus_tag LOCUS_25530 160966 160454 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 protein_id gnl|my_center|LOCUS_25530 161112 162635 gene locus_tag LOCUS_25540 161112 162635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 162756 163283 gene locus_tag LOCUS_25550 162756 163283 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_25550 163295 163831 gene locus_tag LOCUS_25560 163295 163831 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_25560 163848 164366 gene locus_tag LOCUS_25570 163848 164366 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_25570 164397 165095 gene locus_tag LOCUS_25580 164397 165095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 166838 165096 gene locus_tag LOCUS_25590 166838 165096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 167155 169692 gene locus_tag LOCUS_25600 gene leuS 167155 169692 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816T0 protein_id gnl|my_center|LOCUS_25600 169777 172710 gene locus_tag LOCUS_25610 169777 172710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 172876 173178 gene locus_tag LOCUS_25620 172876 173178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence013 5423 3807 gene locus_tag LOCUS_25630 5423 3807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_25630 5713 6354 gene locus_tag LOCUS_25640 gene fabR 5713 6354 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM60 protein_id gnl|my_center|LOCUS_25640 8097 6514 gene locus_tag LOCUS_25650 8097 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8318 10081 gene locus_tag LOCUS_25660 8318 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 10204 10755 gene locus_tag LOCUS_25670 10204 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113021.1 protein_id gnl|my_center|LOCUS_25670 11411 10788 gene locus_tag LOCUS_25680 11411 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 11319 11711 gene locus_tag LOCUS_25690 11319 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 12243 12443 gene locus_tag LOCUS_25700 12243 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 12778 12410 gene locus_tag LOCUS_25710 12778 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 13123 12815 gene locus_tag LOCUS_25720 13123 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 13058 14863 gene locus_tag LOCUS_25730 13058 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 14913 16850 gene locus_tag LOCUS_25740 14913 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 16843 19077 gene locus_tag LOCUS_25750 16843 19077 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027333.1 protein_id gnl|my_center|LOCUS_25750 19947 19192 gene locus_tag LOCUS_25760 19947 19192 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_25760 22152 20002 gene locus_tag LOCUS_25770 gene nicT 22152 20002 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_25770 22758 22309 gene locus_tag LOCUS_25780 22758 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 23762 22995 gene locus_tag LOCUS_25790 23762 22995 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256334.1 protein_id gnl|my_center|LOCUS_25790 23883 25226 gene locus_tag LOCUS_25800 23883 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 25331 26692 gene locus_tag LOCUS_25810 25331 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 26689 28140 gene locus_tag LOCUS_25820 26689 28140 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_25820 29387 28122 gene locus_tag LOCUS_25830 29387 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 29572 33792 gene locus_tag LOCUS_25840 29572 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 33795 34748 gene locus_tag LOCUS_25850 33795 34748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 34745 35497 gene locus_tag LOCUS_25860 34745 35497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 40139 35667 gene locus_tag LOCUS_25870 40139 35667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 40270 41454 gene locus_tag LOCUS_25880 40270 41454 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_25880 41461 43050 gene locus_tag LOCUS_25890 41461 43050 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_25890 43450 43136 gene locus_tag LOCUS_25900 43450 43136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 44618 43473 gene locus_tag LOCUS_25910 44618 43473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_25910 46939 44777 gene locus_tag LOCUS_25920 46939 44777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 48570 47110 gene locus_tag LOCUS_25930 48570 47110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 50293 48716 gene locus_tag LOCUS_25940 50293 48716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 58397 50553 gene locus_tag LOCUS_25950 58397 50553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 58654 58331 gene locus_tag LOCUS_25960 58654 58331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 58689 59477 gene locus_tag LOCUS_25970 58689 59477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 59369 60883 gene locus_tag LOCUS_25980 59369 60883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 60984 61166 gene locus_tag LOCUS_25990 60984 61166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 61465 61142 gene locus_tag LOCUS_26000 61465 61142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 61382 63361 gene locus_tag LOCUS_26010 61382 63361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 64151 63378 gene locus_tag LOCUS_26020 64151 63378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 64363 64755 gene locus_tag LOCUS_26030 64363 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 64752 65687 gene locus_tag LOCUS_26040 64752 65687 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_26040 65778 68588 gene locus_tag LOCUS_26050 65778 68588 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 protein_id gnl|my_center|LOCUS_26050 68585 68980 gene locus_tag LOCUS_26060 68585 68980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 68977 70494 gene locus_tag LOCUS_26070 68977 70494 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_26070 70491 70868 gene locus_tag LOCUS_26080 70491 70868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 70868 71164 gene locus_tag LOCUS_26090 70868 71164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 71157 71498 gene locus_tag LOCUS_26100 71157 71498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 72181 71537 gene locus_tag LOCUS_26110 72181 71537 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_26110 73012 72296 gene locus_tag LOCUS_26120 73012 72296 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886082.1 protein_id gnl|my_center|LOCUS_26120 74457 73111 gene locus_tag LOCUS_26130 74457 73111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 74969 74550 gene locus_tag LOCUS_26140 74969 74550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 78485 75330 gene locus_tag LOCUS_26150 78485 75330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 80457 78478 gene locus_tag LOCUS_26160 80457 78478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 80751 81365 gene locus_tag LOCUS_26170 gene sigE 80751 81365 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA23 protein_id gnl|my_center|LOCUS_26170 81383 82171 gene locus_tag LOCUS_26180 81383 82171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 82168 84948 gene locus_tag LOCUS_26190 82168 84948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_26190 85071 85229 gene locus_tag LOCUS_26200 85071 85229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 85311 86738 gene locus_tag LOCUS_26210 85311 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 88185 86782 gene locus_tag LOCUS_26220 88185 86782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 88479 89336 gene locus_tag LOCUS_26230 88479 89336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 89333 90727 gene locus_tag LOCUS_26240 89333 90727 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_26240 94427 90780 gene locus_tag LOCUS_26250 94427 90780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 94627 97239 gene locus_tag LOCUS_26260 94627 97239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 97236 97796 gene locus_tag LOCUS_26270 97236 97796 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_26270 100091 97896 gene locus_tag LOCUS_26280 100091 97896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 100829 100257 gene locus_tag LOCUS_26290 100829 100257 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_26290 103486 100826 gene locus_tag LOCUS_26300 103486 100826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 121342 103664 gene locus_tag LOCUS_26310 121342 103664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 122348 121443 gene locus_tag LOCUS_26320 122348 121443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 128827 122357 gene locus_tag LOCUS_26330 128827 122357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 129568 130131 gene locus_tag LOCUS_26340 129568 130131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 130355 131686 gene locus_tag LOCUS_26350 130355 131686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 131699 132250 gene locus_tag LOCUS_26360 131699 132250 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294692.1 protein_id gnl|my_center|LOCUS_26360 133495 132296 gene locus_tag LOCUS_26370 133495 132296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 135057 133492 gene locus_tag LOCUS_26380 135057 133492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 135334 138576 gene locus_tag LOCUS_26390 135334 138576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 139542 138613 gene locus_tag LOCUS_26400 139542 138613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 141898 139544 gene locus_tag LOCUS_26410 141898 139544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 142189 142013 gene locus_tag LOCUS_26420 142189 142013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 142554 144518 gene locus_tag LOCUS_26430 142554 144518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 144673 146823 gene locus_tag LOCUS_26440 144673 146823 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_26440 149855 146865 gene locus_tag LOCUS_26450 149855 146865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 150813 149890 gene locus_tag LOCUS_26460 150813 149890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 151674 150817 gene locus_tag LOCUS_26470 151674 150817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 154257 151993 gene locus_tag LOCUS_26480 154257 151993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 154680 156341 gene locus_tag LOCUS_26490 154680 156341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 157023 156373 gene locus_tag LOCUS_26500 157023 156373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 158074 157067 gene locus_tag LOCUS_26510 158074 157067 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967889.1 protein_id gnl|my_center|LOCUS_26510 158248 158961 gene locus_tag LOCUS_26520 158248 158961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 159289 158972 gene locus_tag LOCUS_26530 159289 158972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 159513 159316 gene locus_tag LOCUS_26540 159513 159316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 159627 161525 gene locus_tag LOCUS_26550 159627 161525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 162396 161575 gene locus_tag LOCUS_26560 162396 161575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 162881 163288 gene locus_tag LOCUS_26570 162881 163288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 163522 166008 gene locus_tag LOCUS_26580 163522 166008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_26580 166542 166027 gene locus_tag LOCUS_26590 166542 166027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 166957 166544 gene locus_tag LOCUS_26600 166957 166544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 168596 167034 gene locus_tag LOCUS_26610 168596 167034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26610 169925 168696 gene locus_tag LOCUS_26620 169925 168696 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_26620 169924 170178 gene locus_tag LOCUS_26630 169924 170178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 <170975 170175 gene locus_tag LOCUS_26640 <170975 170175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140720.1:hybrid sensor histidine kinase/response regulator >Feature sequence014 672 2597 gene locus_tag LOCUS_26650 672 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 3757 2651 gene locus_tag LOCUS_26660 3757 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4006 7074 gene locus_tag LOCUS_26670 4006 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 7207 11355 gene locus_tag LOCUS_26680 7207 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 11394 12434 gene locus_tag LOCUS_26690 11394 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 12531 13568 gene locus_tag LOCUS_26700 12531 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 14825 13737 gene locus_tag LOCUS_26710 14825 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 15192 15797 gene locus_tag LOCUS_26720 15192 15797 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_26720 15794 18229 gene locus_tag LOCUS_26730 15794 18229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 18402 20501 gene locus_tag LOCUS_26740 18402 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 20636 22675 gene locus_tag LOCUS_26750 20636 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 23275 22697 gene locus_tag LOCUS_26760 23275 22697 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9L5 protein_id gnl|my_center|LOCUS_26760 23529 24437 gene locus_tag LOCUS_26770 23529 24437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 25813 24443 gene locus_tag LOCUS_26780 25813 24443 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S447 protein_id gnl|my_center|LOCUS_26780 26421 28697 gene locus_tag LOCUS_26790 26421 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 28880 29149 gene locus_tag LOCUS_26800 28880 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 29146 29649 gene locus_tag LOCUS_26810 29146 29649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 29646 30692 gene locus_tag LOCUS_26820 29646 30692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 30692 31474 gene locus_tag LOCUS_26830 30692 31474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 31488 32390 gene locus_tag LOCUS_26840 31488 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 33807 32353 gene locus_tag LOCUS_26850 33807 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 36456 34036 gene locus_tag LOCUS_26860 36456 34036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 37643 36456 gene locus_tag LOCUS_26870 37643 36456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 38272 37640 gene locus_tag LOCUS_26880 38272 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 40044 38329 gene locus_tag LOCUS_26890 40044 38329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 43295 40224 gene locus_tag LOCUS_26900 43295 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 46560 46243 gene locus_tag LOCUS_26910 46560 46243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 47713 46562 gene locus_tag LOCUS_26920 47713 46562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 48146 47706 gene locus_tag LOCUS_26930 48146 47706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 49102 48134 gene locus_tag LOCUS_26940 49102 48134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 50295 49102 gene locus_tag LOCUS_26950 50295 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 50777 50295 gene locus_tag LOCUS_26960 50777 50295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 55457 53829 gene locus_tag LOCUS_26970 55457 53829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 57386 55608 gene locus_tag LOCUS_26980 57386 55608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037549.1 protein_id gnl|my_center|LOCUS_26980 59416 57521 gene locus_tag LOCUS_26990 59416 57521 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_26990 60227 59454 gene locus_tag LOCUS_27000 60227 59454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 60554 60375 gene locus_tag LOCUS_27010 60554 60375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 60614 60949 gene locus_tag LOCUS_27020 60614 60949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 61007 61222 gene locus_tag LOCUS_27030 61007 61222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 62681 61314 gene locus_tag LOCUS_27040 62681 61314 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943835.1 protein_id gnl|my_center|LOCUS_27040 62759 64117 gene locus_tag LOCUS_27050 62759 64117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 64214 66679 gene locus_tag LOCUS_27060 64214 66679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 68058 66715 gene locus_tag LOCUS_27070 68058 66715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 68949 69536 gene locus_tag LOCUS_27080 68949 69536 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_27080 69523 70803 gene locus_tag LOCUS_27090 69523 70803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 71137 74094 gene locus_tag LOCUS_27100 71137 74094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 74087 75064 gene locus_tag LOCUS_27110 74087 75064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 75080 75403 gene locus_tag LOCUS_27120 75080 75403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 75413 77398 gene locus_tag LOCUS_27130 75413 77398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 77426 77758 gene locus_tag LOCUS_27140 77426 77758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 77866 78204 gene locus_tag LOCUS_27150 77866 78204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 78294 80117 gene locus_tag LOCUS_27160 78294 80117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_27160 80114 80998 gene locus_tag LOCUS_27170 80114 80998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 81006 81806 gene locus_tag LOCUS_27180 81006 81806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 81868 83412 gene locus_tag LOCUS_27190 81868 83412 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118742.1 protein_id gnl|my_center|LOCUS_27190 83829 83527 gene locus_tag LOCUS_27200 83829 83527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_27200 84000 84377 gene locus_tag LOCUS_27210 84000 84377 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185699.1 protein_id gnl|my_center|LOCUS_27210 84694 84431 gene locus_tag LOCUS_27220 84694 84431 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_27220 84998 84792 gene locus_tag LOCUS_27230 84998 84792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 84949 85677 gene locus_tag LOCUS_27240 84949 85677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 87854 85857 gene locus_tag LOCUS_27250 87854 85857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 88381 90666 gene locus_tag LOCUS_27260 88381 90666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 91324 90710 gene locus_tag LOCUS_27270 91324 90710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 91602 93185 gene locus_tag LOCUS_27280 91602 93185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 93274 93723 gene locus_tag LOCUS_27290 93274 93723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 94371 93748 gene locus_tag LOCUS_27300 94371 93748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 94787 94539 gene locus_tag LOCUS_27310 94787 94539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 95166 96830 gene locus_tag LOCUS_27320 95166 96830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 98410 96848 gene locus_tag LOCUS_27330 98410 96848 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_27330 98602 102105 gene locus_tag LOCUS_27340 98602 102105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 102221 104470 gene locus_tag LOCUS_27350 102221 104470 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_27350 104483 105328 gene locus_tag LOCUS_27360 104483 105328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_27360 105796 105338 gene locus_tag LOCUS_27370 105796 105338 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 protein_id gnl|my_center|LOCUS_27370 105976 108426 gene locus_tag LOCUS_27380 105976 108426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 108688 110004 gene locus_tag LOCUS_27390 108688 110004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 109995 110960 gene locus_tag LOCUS_27400 109995 110960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 112213 110963 gene locus_tag LOCUS_27410 112213 110963 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876053.1 protein_id gnl|my_center|LOCUS_27410 112989 112222 gene locus_tag LOCUS_27420 112989 112222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 114020 112986 gene locus_tag LOCUS_27430 114020 112986 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_27430 115333 114017 gene locus_tag LOCUS_27440 115333 114017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 116097 115330 gene locus_tag LOCUS_27450 116097 115330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 116240 117451 gene locus_tag LOCUS_27460 116240 117451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 117448 118179 gene locus_tag LOCUS_27470 117448 118179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 118176 119483 gene locus_tag LOCUS_27480 118176 119483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 120174 119491 gene locus_tag LOCUS_27490 120174 119491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 121331 120171 gene locus_tag LOCUS_27500 121331 120171 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339559.1 protein_id gnl|my_center|LOCUS_27500 121644 122483 gene locus_tag LOCUS_27510 121644 122483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 122686 122949 gene locus_tag LOCUS_27520 122686 122949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 123109 125598 gene locus_tag LOCUS_27530 gene secA 123109 125598 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0J2 protein_id gnl|my_center|LOCUS_27530 125723 128353 gene locus_tag LOCUS_27540 125723 128353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 129694 128570 gene locus_tag LOCUS_27550 129694 128570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 130605 129787 gene locus_tag LOCUS_27560 130605 129787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 130912 131334 gene locus_tag LOCUS_27570 gene fur 130912 131334 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_27570 131509 133704 gene locus_tag LOCUS_27580 131509 133704 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_27580 133937 134965 gene locus_tag LOCUS_27590 133937 134965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 139054 134987 gene locus_tag LOCUS_27600 139054 134987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 139309 139944 gene locus_tag LOCUS_27610 139309 139944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 140035 141300 gene locus_tag LOCUS_27620 140035 141300 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896017.1 protein_id gnl|my_center|LOCUS_27620 141524 142024 gene locus_tag LOCUS_27630 141524 142024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 142036 142755 gene locus_tag LOCUS_27640 142036 142755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 143526 142762 gene locus_tag LOCUS_27650 143526 142762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108665.1 protein_id gnl|my_center|LOCUS_27650 144902 143577 gene locus_tag LOCUS_27660 144902 143577 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_27660 145040 145291 gene locus_tag LOCUS_27670 145040 145291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 146899 145310 gene locus_tag LOCUS_27680 146899 145310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 147685 147131 gene locus_tag LOCUS_27690 147685 147131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 148431 147847 gene locus_tag LOCUS_27700 148431 147847 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_27700 149517 148543 gene locus_tag LOCUS_27710 149517 148543 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_27710 150470 149514 gene locus_tag LOCUS_27720 150470 149514 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_27720 151254 150568 gene locus_tag LOCUS_27730 151254 150568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 151849 151247 gene locus_tag LOCUS_27740 151849 151247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 153232 151901 gene locus_tag LOCUS_27750 153232 151901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 153473 154528 gene locus_tag LOCUS_27760 153473 154528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 155426 154710 gene locus_tag LOCUS_27770 155426 154710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 156741 155518 gene locus_tag LOCUS_27780 156741 155518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 156868 157452 gene locus_tag LOCUS_27790 156868 157452 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_27790 157519 160299 gene locus_tag LOCUS_27800 157519 160299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 160714 160310 gene locus_tag LOCUS_27810 160714 160310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 161278 162165 gene locus_tag LOCUS_27820 161278 162165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence015 1697 2683 gene locus_tag LOCUS_27830 1697 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2960 3868 gene locus_tag LOCUS_27840 2960 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 6782 3873 gene locus_tag LOCUS_27850 6782 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 7053 9257 gene locus_tag LOCUS_27860 7053 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 9335 10123 gene locus_tag LOCUS_27870 9335 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 10142 11710 gene locus_tag LOCUS_27880 10142 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 11710 13245 gene locus_tag LOCUS_27890 11710 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 13335 14324 gene locus_tag LOCUS_27900 gene yjgM 13335 14324 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_27900 16680 14392 gene locus_tag LOCUS_27910 16680 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 19501 16955 gene locus_tag LOCUS_27920 19501 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 20859 19501 gene locus_tag LOCUS_27930 20859 19501 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_27930 22127 20856 gene locus_tag LOCUS_27940 22127 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27940 24406 22244 gene locus_tag LOCUS_27950 24406 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 24718 25449 gene locus_tag LOCUS_27960 24718 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926062.1 protein_id gnl|my_center|LOCUS_27960 25572 26516 gene locus_tag LOCUS_27970 25572 26516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 28977 26533 gene locus_tag LOCUS_27980 28977 26533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 29299 29922 gene locus_tag LOCUS_27990 29299 29922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_27990 29954 30949 gene locus_tag LOCUS_28000 29954 30949 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 protein_id gnl|my_center|LOCUS_28000 33550 30971 gene locus_tag LOCUS_28010 gene fyuA 33550 30971 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_28010 34158 35144 gene locus_tag LOCUS_28020 34158 35144 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_28020 35141 36142 gene locus_tag LOCUS_28030 35141 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 36491 37519 gene locus_tag LOCUS_28040 gene trpS 36491 37519 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA78 protein_id gnl|my_center|LOCUS_28040 37775 38884 gene locus_tag LOCUS_28050 37775 38884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 39276 39638 gene locus_tag LOCUS_28060 39276 39638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225039.1 protein_id gnl|my_center|LOCUS_28060 39685 40470 gene locus_tag LOCUS_28070 39685 40470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 41545 40478 gene locus_tag LOCUS_28080 41545 40478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 42837 41542 gene locus_tag LOCUS_28090 42837 41542 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_28090 43304 45232 gene locus_tag LOCUS_28100 43304 45232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 47019 45331 gene locus_tag LOCUS_28110 47019 45331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 48696 47158 gene locus_tag LOCUS_28120 48696 47158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_28120 48958 49344 gene locus_tag LOCUS_28130 48958 49344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 49341 50492 gene locus_tag LOCUS_28140 49341 50492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 50503 52542 gene locus_tag LOCUS_28150 gene pknB 50503 52542 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337392.1 protein_id gnl|my_center|LOCUS_28150 52577 54346 gene locus_tag LOCUS_28160 gene cya 52577 54346 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_28160 54393 54593 gene locus_tag LOCUS_28170 54393 54593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 54633 54860 gene locus_tag LOCUS_28180 54633 54860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 57304 54857 gene locus_tag LOCUS_28190 57304 54857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 58278 57844 gene locus_tag LOCUS_28200 58278 57844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 58368 58832 gene locus_tag LOCUS_28210 58368 58832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 58860 59276 gene locus_tag LOCUS_28220 58860 59276 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_28220 59377 59568 gene locus_tag LOCUS_28230 59377 59568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 59644 61329 gene locus_tag LOCUS_28240 59644 61329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_28240 62530 61337 gene locus_tag LOCUS_28250 62530 61337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207673.1 protein_id gnl|my_center|LOCUS_28250 62802 62545 gene locus_tag LOCUS_28260 62802 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 65449 62831 gene locus_tag LOCUS_28270 65449 62831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28270 65812 65480 gene locus_tag LOCUS_28280 gene ywzG 65812 65480 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_28280 65955 67673 gene locus_tag LOCUS_28290 65955 67673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 69149 67764 gene locus_tag LOCUS_28300 69149 67764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 70056 69157 gene locus_tag LOCUS_28310 70056 69157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_28310 73394 70083 gene locus_tag LOCUS_28320 73394 70083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 74117 73515 gene locus_tag LOCUS_28330 74117 73515 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_28330 74314 75210 gene locus_tag LOCUS_28340 74314 75210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 75249 76760 gene locus_tag LOCUS_28350 gene dacB 75249 76760 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_28350 77288 76797 gene locus_tag LOCUS_28360 77288 76797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 78511 77285 gene locus_tag LOCUS_28370 78511 77285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_28370 78750 78502 gene locus_tag LOCUS_28380 78750 78502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 79889 78753 gene locus_tag LOCUS_28390 gene apbE 79889 78753 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_28390 80506 80066 gene locus_tag LOCUS_28400 80506 80066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 83467 80882 gene locus_tag LOCUS_28410 83467 80882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 83767 84948 gene locus_tag LOCUS_28420 gene alaS 83767 84948 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181813.1 protein_id gnl|my_center|LOCUS_28420 85350 86936 gene locus_tag LOCUS_28430 85350 86936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 87921 86968 gene locus_tag LOCUS_28440 87921 86968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036722.1 protein_id gnl|my_center|LOCUS_28440 89460 87997 gene locus_tag LOCUS_28450 gene purB 89460 87997 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_28450 89715 90977 gene locus_tag LOCUS_28460 gene arcA 89715 90977 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZA0 protein_id gnl|my_center|LOCUS_28460 91133 92929 gene locus_tag LOCUS_28470 91133 92929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 92926 93510 gene locus_tag LOCUS_28480 92926 93510 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762369.1 protein_id gnl|my_center|LOCUS_28480 94946 93888 gene locus_tag LOCUS_28490 94946 93888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 95084 96013 gene locus_tag LOCUS_28500 95084 96013 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_28500 99532 96236 gene locus_tag LOCUS_28510 99532 96236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_28510 100614 99598 gene locus_tag LOCUS_28520 100614 99598 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_28520 101798 100779 gene locus_tag LOCUS_28530 101798 100779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 103629 101791 gene locus_tag LOCUS_28540 103629 101791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 105506 103626 gene locus_tag LOCUS_28550 105506 103626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 105505 107619 gene locus_tag LOCUS_28560 105505 107619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 109251 107806 gene locus_tag LOCUS_28570 109251 107806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 109533 112079 gene locus_tag LOCUS_28580 109533 112079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 114860 112269 gene locus_tag LOCUS_28590 114860 112269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 115154 117415 gene locus_tag LOCUS_28600 115154 117415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 117677 118399 gene locus_tag LOCUS_28610 117677 118399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 118691 119866 gene locus_tag LOCUS_28620 118691 119866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 121260 119863 gene locus_tag LOCUS_28630 121260 119863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 123438 121447 gene locus_tag LOCUS_28640 123438 121447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 123709 124539 gene locus_tag LOCUS_28650 123709 124539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 124749 125438 gene locus_tag LOCUS_28660 124749 125438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 126274 125420 gene locus_tag LOCUS_28670 126274 125420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 126744 126283 gene locus_tag LOCUS_28680 126744 126283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_28680 128997 126784 gene locus_tag LOCUS_28690 128997 126784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 129165 129605 gene locus_tag LOCUS_28700 129165 129605 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_28700 130176 131735 gene locus_tag LOCUS_28710 130176 131735 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_28710 131737 132687 gene locus_tag LOCUS_28720 131737 132687 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039035.1 protein_id gnl|my_center|LOCUS_28720 132726 133838 gene locus_tag LOCUS_28730 132726 133838 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_28730 133867 135396 gene locus_tag LOCUS_28740 133867 135396 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081192.1 protein_id gnl|my_center|LOCUS_28740 135393 136292 gene locus_tag LOCUS_28750 135393 136292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 136289 137227 gene locus_tag LOCUS_28760 136289 137227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 138005 137439 gene locus_tag LOCUS_28770 138005 137439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_28770 138674 138048 gene locus_tag LOCUS_28780 138674 138048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 139347 138724 gene locus_tag LOCUS_28790 139347 138724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325274.1 protein_id gnl|my_center|LOCUS_28790 139760 141511 gene locus_tag LOCUS_28800 139760 141511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 141678 145052 gene locus_tag LOCUS_28810 141678 145052 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_28810 145180 146334 gene locus_tag LOCUS_28820 145180 146334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 146343 148241 gene locus_tag LOCUS_28830 gene asnB 146343 148241 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942597.1 protein_id gnl|my_center|LOCUS_28830 148238 148786 gene locus_tag LOCUS_28840 148238 148786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 149182 148823 gene locus_tag LOCUS_28850 149182 148823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 149508 149182 gene locus_tag LOCUS_28860 149508 149182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 150184 149540 gene locus_tag LOCUS_28870 150184 149540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 150320 152749 gene locus_tag LOCUS_28880 150320 152749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 153308 152742 gene locus_tag LOCUS_28890 153308 152742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 153486 153749 gene locus_tag LOCUS_28900 153486 153749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 153874 154527 gene locus_tag LOCUS_28910 153874 154527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 155906 154530 gene locus_tag LOCUS_28920 155906 154530 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_28920 156788 155949 gene locus_tag LOCUS_28930 156788 155949 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_28930 156953 157441 gene locus_tag LOCUS_28940 156953 157441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_28940 158077 157454 gene locus_tag LOCUS_28950 158077 157454 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107194.1 protein_id gnl|my_center|LOCUS_28950 158700 158284 gene locus_tag LOCUS_28960 158700 158284 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_28960 158927 158697 gene locus_tag LOCUS_28970 158927 158697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 159508 158987 gene locus_tag LOCUS_28980 159508 158987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 <160394 159757 gene locus_tag LOCUS_28990 <160394 159757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase >Feature sequence016 1758 298 gene locus_tag LOCUS_29000 1758 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3659 2175 gene locus_tag LOCUS_29010 3659 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_29010 5109 3682 gene locus_tag LOCUS_29020 5109 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_29020 6692 5214 gene locus_tag LOCUS_29030 6692 5214 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_29030 6814 7203 gene locus_tag LOCUS_29040 6814 7203 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_29040 7208 8305 gene locus_tag LOCUS_29050 7208 8305 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_29050 9092 8292 gene locus_tag LOCUS_29060 9092 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 9484 9089 gene locus_tag LOCUS_29070 9484 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 10818 9481 gene locus_tag LOCUS_29080 10818 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 11960 10830 gene locus_tag LOCUS_29090 11960 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 12649 11978 gene locus_tag LOCUS_29100 12649 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 13135 12674 gene locus_tag LOCUS_29110 13135 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 15614 13233 gene locus_tag LOCUS_29120 15614 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 17694 15874 gene locus_tag LOCUS_29130 17694 15874 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_29130 28721 18003 gene locus_tag LOCUS_29140 28721 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 29617 28991 gene locus_tag LOCUS_29150 29617 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 29616 32069 gene locus_tag LOCUS_29160 29616 32069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 33614 32280 gene locus_tag LOCUS_29170 33614 32280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 35191 33665 gene locus_tag LOCUS_29180 35191 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 36490 35219 gene locus_tag LOCUS_29190 36490 35219 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_29190 36794 38188 gene locus_tag LOCUS_29200 36794 38188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 38190 39422 gene locus_tag LOCUS_29210 38190 39422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 39629 40243 gene locus_tag LOCUS_29220 39629 40243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 41042 40263 gene locus_tag LOCUS_29230 41042 40263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_29230 42775 41039 gene locus_tag LOCUS_29240 gene cbiO 42775 41039 CDS product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_29240 43944 42772 gene locus_tag LOCUS_29250 43944 42772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 45267 43948 gene locus_tag LOCUS_29260 gene mntH 45267 43948 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_29260 47000 45264 gene locus_tag LOCUS_29270 47000 45264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 47088 51065 gene locus_tag LOCUS_29280 47088 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 51128 53080 gene locus_tag LOCUS_29290 gene gaa 51128 53080 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_29290 53264 55345 gene locus_tag LOCUS_29300 53264 55345 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_29300 56215 55430 gene locus_tag LOCUS_29310 56215 55430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 56543 57301 gene locus_tag LOCUS_29320 56543 57301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 57376 58419 gene locus_tag LOCUS_29330 57376 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202342.1 protein_id gnl|my_center|LOCUS_29330 59386 58472 gene locus_tag LOCUS_29340 59386 58472 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_29340 60231 59398 gene locus_tag LOCUS_29350 60231 59398 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_29350 62588 60234 gene locus_tag LOCUS_29360 62588 60234 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_29360 63065 62598 gene locus_tag LOCUS_29370 63065 62598 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_29370 63301 64116 gene locus_tag LOCUS_29380 63301 64116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 64850 64158 gene locus_tag LOCUS_29390 64850 64158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 65355 65579 gene locus_tag LOCUS_29400 65355 65579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 65620 67800 gene locus_tag LOCUS_29410 65620 67800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 68688 67810 gene locus_tag LOCUS_29420 68688 67810 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_29420 70199 68685 gene locus_tag LOCUS_29430 gene glpK 70199 68685 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N7 protein_id gnl|my_center|LOCUS_29430 70454 70804 gene locus_tag LOCUS_29440 70454 70804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 70925 72421 gene locus_tag LOCUS_29450 70925 72421 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_29450 73101 72430 gene locus_tag LOCUS_29460 73101 72430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 74794 73292 gene locus_tag LOCUS_29470 gene selA 74794 73292 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61735 protein_id gnl|my_center|LOCUS_29470 74880 74781 gene locus_tag LOCUS_t00230 74880 74781 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 76310 75012 gene locus_tag LOCUS_29480 76310 75012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 79056 76384 gene locus_tag LOCUS_29490 gene polA 79056 76384 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_29490 79133 79417 gene locus_tag LOCUS_29500 79133 79417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 80248 79475 gene locus_tag LOCUS_29510 80248 79475 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_29510 81616 80291 gene locus_tag LOCUS_29520 81616 80291 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_29520 82140 82886 gene locus_tag LOCUS_29530 82140 82886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 82876 84435 gene locus_tag LOCUS_29540 gene merA 82876 84435 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_29540 85957 84428 gene locus_tag LOCUS_29550 85957 84428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 86152 87831 gene locus_tag LOCUS_29560 gene aceB 86152 87831 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706619.1 protein_id gnl|my_center|LOCUS_29560 87918 89192 gene locus_tag LOCUS_29570 87918 89192 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_29570 89436 89657 gene locus_tag LOCUS_29580 89436 89657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 90100 94797 gene locus_tag LOCUS_29590 90100 94797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 95352 95666 gene locus_tag LOCUS_29600 95352 95666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 95785 96885 gene locus_tag LOCUS_29610 95785 96885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 97024 98025 gene locus_tag LOCUS_29620 97024 98025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 98292 100742 gene locus_tag LOCUS_29630 98292 100742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_29630 102108 100825 gene locus_tag LOCUS_29640 102108 100825 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_29640 105910 102296 gene locus_tag LOCUS_29650 105910 102296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 107393 106248 gene locus_tag LOCUS_29660 gene metK 107393 106248 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE2 protein_id gnl|my_center|LOCUS_29660 107739 108527 gene locus_tag LOCUS_29670 107739 108527 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_29670 109407 108505 gene locus_tag LOCUS_29680 109407 108505 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013910.1 protein_id gnl|my_center|LOCUS_29680 111496 109526 gene locus_tag LOCUS_29690 111496 109526 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_29690 114148 111569 gene locus_tag LOCUS_29700 114148 111569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_29700 114373 116181 gene locus_tag LOCUS_29710 114373 116181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 116976 116224 gene locus_tag LOCUS_29720 116976 116224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 119767 117065 gene locus_tag LOCUS_29730 119767 117065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 119912 119724 gene locus_tag LOCUS_29740 119912 119724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 123066 120058 gene locus_tag LOCUS_29750 123066 120058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_29750 124013 123177 gene locus_tag LOCUS_29760 124013 123177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 124615 124010 gene locus_tag LOCUS_29770 124615 124010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 125384 124647 gene locus_tag LOCUS_29780 125384 124647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 126888 125389 gene locus_tag LOCUS_29790 126888 125389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 131182 126917 gene locus_tag LOCUS_29800 131182 126917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 133020 131185 gene locus_tag LOCUS_29810 133020 131185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 133127 134764 gene locus_tag LOCUS_29820 133127 134764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 134870 137674 gene locus_tag LOCUS_29830 134870 137674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 138406 137684 gene locus_tag LOCUS_29840 138406 137684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 138755 139813 gene locus_tag LOCUS_29850 gene hemE 138755 139813 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_29850 140540 139821 gene locus_tag LOCUS_29860 140540 139821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 142411 140537 gene locus_tag LOCUS_29870 142411 140537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 142583 142798 gene locus_tag LOCUS_29880 142583 142798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 142826 143341 gene locus_tag LOCUS_29890 142826 143341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 143432 143680 gene locus_tag LOCUS_29900 143432 143680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 144344 143670 gene locus_tag LOCUS_29910 144344 143670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 145874 144603 gene locus_tag LOCUS_29920 145874 144603 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_29920 147198 145927 gene locus_tag LOCUS_29930 147198 145927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 147556 148512 gene locus_tag LOCUS_29940 147556 148512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 148628 149671 gene locus_tag LOCUS_29950 148628 149671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 149668 150492 gene locus_tag LOCUS_29960 149668 150492 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_29960 152749 150500 gene locus_tag LOCUS_29970 152749 150500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence017 2271 58 gene locus_tag LOCUS_29980 2271 58 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_29980 4469 2271 gene locus_tag LOCUS_29990 4469 2271 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_29990 4679 5875 gene locus_tag LOCUS_30000 gene menC 4679 5875 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q838J7 protein_id gnl|my_center|LOCUS_30000 5923 7509 gene locus_tag LOCUS_30010 5923 7509 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_30010 7671 8222 gene locus_tag LOCUS_30020 7671 8222 CDS product L-amino acid N-acyltransferase MnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 protein_id gnl|my_center|LOCUS_30020 8337 9338 gene locus_tag LOCUS_30030 8337 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 9367 10344 gene locus_tag LOCUS_30040 9367 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 11778 10348 gene locus_tag LOCUS_30050 11778 10348 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_30050 12743 11778 gene locus_tag LOCUS_30060 12743 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 13090 13533 gene locus_tag LOCUS_30070 13090 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 13835 14929 gene locus_tag LOCUS_30080 13835 14929 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_30080 15126 19151 gene locus_tag LOCUS_30090 15126 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 19318 20619 gene locus_tag LOCUS_30100 19318 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 21592 20822 gene locus_tag LOCUS_30110 21592 20822 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_30110 24876 21727 gene locus_tag LOCUS_30120 24876 21727 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_30120 25099 25572 gene locus_tag LOCUS_30130 25099 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 25684 26232 gene locus_tag LOCUS_30140 25684 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 26366 28807 gene locus_tag LOCUS_30150 26366 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 29318 29413 gene locus_tag LOCUS_t00240 29318 29413 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32614 29534 gene locus_tag LOCUS_30160 32614 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 32653 32826 gene locus_tag LOCUS_30170 32653 32826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 34114 32804 gene locus_tag LOCUS_30180 34114 32804 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_30180 34283 34921 gene locus_tag LOCUS_30190 34283 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 34939 36099 gene locus_tag LOCUS_30200 34939 36099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 36396 39500 gene locus_tag LOCUS_30210 36396 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 40703 39507 gene locus_tag LOCUS_30220 40703 39507 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228406.1 protein_id gnl|my_center|LOCUS_30220 41247 40870 gene locus_tag LOCUS_30230 41247 40870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 42071 41244 gene locus_tag LOCUS_30240 42071 41244 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_30240 44119 42068 gene locus_tag LOCUS_30250 44119 42068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 45128 44226 gene locus_tag LOCUS_30260 45128 44226 CDS product molecular chaperone Hsp33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_30260 45894 45217 gene locus_tag LOCUS_30270 45894 45217 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAJ7 protein_id gnl|my_center|LOCUS_30270 46072 47019 gene locus_tag LOCUS_30280 46072 47019 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_30280 47051 48745 gene locus_tag LOCUS_30290 47051 48745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 48764 50593 gene locus_tag LOCUS_30300 48764 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 50901 50590 gene locus_tag LOCUS_30310 50901 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 52603 50921 gene locus_tag LOCUS_30320 52603 50921 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_30320 52958 54841 gene locus_tag LOCUS_30330 52958 54841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 54925 57249 gene locus_tag LOCUS_30340 54925 57249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 58194 57292 gene locus_tag LOCUS_30350 58194 57292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 58351 60777 gene locus_tag LOCUS_30360 58351 60777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 60914 61894 gene locus_tag LOCUS_30370 60914 61894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_30370 61995 63482 gene locus_tag LOCUS_30380 61995 63482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_30380 63589 64326 gene locus_tag LOCUS_30390 gene natA 63589 64326 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_30390 64326 65501 gene locus_tag LOCUS_30400 64326 65501 CDS product Na+ ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_30400 65588 66154 gene locus_tag LOCUS_30410 65588 66154 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121023.1 protein_id gnl|my_center|LOCUS_30410 66352 66825 gene locus_tag LOCUS_30420 66352 66825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 66822 67643 gene locus_tag LOCUS_30430 gene yqjF 66822 67643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_30430 68201 67614 gene locus_tag LOCUS_30440 68201 67614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 68991 68317 gene locus_tag LOCUS_30450 68991 68317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 71389 69008 gene locus_tag LOCUS_30460 71389 69008 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_30460 72238 71393 gene locus_tag LOCUS_30470 72238 71393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 72954 72235 gene locus_tag LOCUS_30480 72954 72235 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_30480 73934 72951 gene locus_tag LOCUS_30490 73934 72951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 74928 75809 gene locus_tag LOCUS_30500 74928 75809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 77823 76018 gene locus_tag LOCUS_30510 gene ilvB 77823 76018 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_30510 78115 80103 gene locus_tag LOCUS_30520 78115 80103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 81342 80161 gene locus_tag LOCUS_30530 81342 80161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 81659 82396 gene locus_tag LOCUS_30540 81659 82396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 82972 82412 gene locus_tag LOCUS_30550 82972 82412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 83508 82969 gene locus_tag LOCUS_30560 83508 82969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 85108 83519 gene locus_tag LOCUS_30570 85108 83519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 85358 86056 gene locus_tag LOCUS_30580 gene drrA 85358 86056 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_30580 86065 88173 gene locus_tag LOCUS_30590 86065 88173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 88226 88702 gene locus_tag LOCUS_30600 gene tspO 88226 88702 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_30600 90392 88746 gene locus_tag LOCUS_30610 90392 88746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205701.1 protein_id gnl|my_center|LOCUS_30610 90774 95033 gene locus_tag LOCUS_30620 90774 95033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 95077 97188 gene locus_tag LOCUS_30630 95077 97188 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_30630 97189 97932 gene locus_tag LOCUS_30640 gene fabG 97189 97932 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_30640 97999 99234 gene locus_tag LOCUS_30650 gene fabF 97999 99234 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UP39 protein_id gnl|my_center|LOCUS_30650 99295 99546 gene locus_tag LOCUS_30660 gene acpP 99295 99546 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZD0 protein_id gnl|my_center|LOCUS_30660 99548 100306 gene locus_tag LOCUS_30670 99548 100306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 100504 102264 gene locus_tag LOCUS_30680 100504 102264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 102373 102798 gene locus_tag LOCUS_30690 102373 102798 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118054.1 protein_id gnl|my_center|LOCUS_30690 102779 105604 gene locus_tag LOCUS_30700 102779 105604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 106345 105632 gene locus_tag LOCUS_30710 106345 105632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 107356 106418 gene locus_tag LOCUS_30720 107356 106418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 108729 107353 gene locus_tag LOCUS_30730 108729 107353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 109747 108767 gene locus_tag LOCUS_30740 109747 108767 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_30740 110431 110063 gene locus_tag LOCUS_30750 110431 110063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 112271 110418 gene locus_tag LOCUS_30760 112271 110418 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_30760 113278 112268 gene locus_tag LOCUS_30770 113278 112268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 114472 113369 gene locus_tag LOCUS_30780 114472 113369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 115837 114524 gene locus_tag LOCUS_30790 115837 114524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 115951 116310 gene locus_tag LOCUS_30800 115951 116310 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_30800 116349 116951 gene locus_tag LOCUS_30810 116349 116951 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085670.1 protein_id gnl|my_center|LOCUS_30810 117949 117404 gene locus_tag LOCUS_30820 117949 117404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 118270 118043 gene locus_tag LOCUS_30830 118270 118043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 119389 118292 gene locus_tag LOCUS_30840 119389 118292 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_30840 120632 119400 gene locus_tag LOCUS_30850 gene nqrF 120632 119400 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP55 protein_id gnl|my_center|LOCUS_30850 121275 120658 gene locus_tag LOCUS_30860 gene nqrE 121275 120658 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_30860 121895 121275 gene locus_tag LOCUS_30870 gene nqrD 121895 121275 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_30870 122680 121895 gene locus_tag LOCUS_30880 gene nqrC 122680 121895 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBZ2 protein_id gnl|my_center|LOCUS_30880 123893 122670 gene locus_tag LOCUS_30890 gene nqrB 123893 122670 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRK7 protein_id gnl|my_center|LOCUS_30890 125263 123893 gene locus_tag LOCUS_30900 gene nqrA 125263 123893 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_30900 125594 126256 gene locus_tag LOCUS_30910 gene trmH 125594 126256 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2I1 protein_id gnl|my_center|LOCUS_30910 128006 126270 gene locus_tag LOCUS_30920 128006 126270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 128420 128650 gene locus_tag LOCUS_30930 128420 128650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 128672 129097 gene locus_tag LOCUS_30940 gene vapC 128672 129097 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI02 protein_id gnl|my_center|LOCUS_30940 130630 129134 gene locus_tag LOCUS_30950 130630 129134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 132678 131068 gene locus_tag LOCUS_30960 132678 131068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 133668 133075 gene locus_tag LOCUS_30970 133668 133075 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_30970 135464 133686 gene locus_tag LOCUS_30980 135464 133686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 137077 135461 gene locus_tag LOCUS_30990 137077 135461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 137314 137739 gene locus_tag LOCUS_31000 137314 137739 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_31000 137736 138638 gene locus_tag LOCUS_31010 137736 138638 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_31010 138622 139311 gene locus_tag LOCUS_31020 138622 139311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 139345 140034 gene locus_tag LOCUS_31030 139345 140034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 140962 140060 gene locus_tag LOCUS_31040 140962 140060 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870293.1 protein_id gnl|my_center|LOCUS_31040 141749 141003 gene locus_tag LOCUS_31050 141749 141003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 141793 142758 gene locus_tag LOCUS_31060 141793 142758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 142782 144755 gene locus_tag LOCUS_31070 142782 144755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 144929 146782 gene locus_tag LOCUS_31080 144929 146782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 147128 146802 gene locus_tag LOCUS_31090 147128 146802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 148381 147188 gene locus_tag LOCUS_31100 148381 147188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 148767 151217 gene locus_tag LOCUS_31110 148767 151217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence018 593 1246 gene locus_tag LOCUS_31120 593 1246 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_31120 1255 2661 gene locus_tag LOCUS_31130 1255 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3924 2668 gene locus_tag LOCUS_31140 3924 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 5749 4052 gene locus_tag LOCUS_31150 5749 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 6741 5845 gene locus_tag LOCUS_31160 6741 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 9687 6763 gene locus_tag LOCUS_31170 9687 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 10211 9684 gene locus_tag LOCUS_31180 10211 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 10098 10361 gene locus_tag LOCUS_31190 10098 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 11599 10412 gene locus_tag LOCUS_31200 11599 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 12603 11773 gene locus_tag LOCUS_31210 12603 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 13152 12646 gene locus_tag LOCUS_31220 13152 12646 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085826.1 protein_id gnl|my_center|LOCUS_31220 13508 14992 gene locus_tag LOCUS_31230 13508 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 15172 16158 gene locus_tag LOCUS_31240 15172 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 16234 17223 gene locus_tag LOCUS_31250 16234 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 17340 17753 gene locus_tag LOCUS_31260 17340 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 18629 17862 gene locus_tag LOCUS_31270 18629 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 19379 20041 gene locus_tag LOCUS_31280 19379 20041 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_31280 20532 20095 gene locus_tag LOCUS_31290 20532 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 20771 20538 gene locus_tag LOCUS_31300 20771 20538 CDS product antibiotic synthesis protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304661.1 protein_id gnl|my_center|LOCUS_31300 21112 22266 gene locus_tag LOCUS_31310 21112 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_31310 22263 24005 gene locus_tag LOCUS_31320 22263 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 24052 25032 gene locus_tag LOCUS_31330 24052 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 25198 25788 gene locus_tag LOCUS_31340 25198 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 25796 26473 gene locus_tag LOCUS_31350 25796 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 27022 26642 gene locus_tag LOCUS_31360 27022 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 28242 27019 gene locus_tag LOCUS_31370 28242 27019 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_31370 29563 28313 gene locus_tag LOCUS_31380 29563 28313 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_31380 30929 29574 gene locus_tag LOCUS_31390 30929 29574 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_31390 31957 31016 gene locus_tag LOCUS_31400 31957 31016 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_31400 33949 32570 gene locus_tag LOCUS_31410 33949 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_31410 35531 33966 gene locus_tag LOCUS_31420 35531 33966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_31420 37885 36656 gene locus_tag LOCUS_31430 37885 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 38532 37900 gene locus_tag LOCUS_31440 38532 37900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 40542 38701 gene locus_tag LOCUS_31450 40542 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 40708 41958 gene locus_tag LOCUS_31460 40708 41958 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_31460 41981 44335 gene locus_tag LOCUS_31470 41981 44335 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSP4 protein_id gnl|my_center|LOCUS_31470 46780 44339 gene locus_tag LOCUS_31480 46780 44339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_31480 47396 46797 gene locus_tag LOCUS_31490 47396 46797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_31490 47560 48078 gene locus_tag LOCUS_31500 47560 48078 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807810.1 protein_id gnl|my_center|LOCUS_31500 48635 49126 gene locus_tag LOCUS_31510 48635 49126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 51500 49242 gene locus_tag LOCUS_31520 51500 49242 CDS product bifunctional hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_31520 52365 51565 gene locus_tag LOCUS_31530 52365 51565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 54711 52534 gene locus_tag LOCUS_31540 gene mrcB 54711 52534 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNZ9 protein_id gnl|my_center|LOCUS_31540 56005 54875 gene locus_tag LOCUS_31550 56005 54875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 56367 57380 gene locus_tag LOCUS_31560 56367 57380 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_31560 58830 57406 gene locus_tag LOCUS_31570 58830 57406 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035924.1 protein_id gnl|my_center|LOCUS_31570 59248 58832 gene locus_tag LOCUS_31580 59248 58832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 59634 60692 gene locus_tag LOCUS_31590 59634 60692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 61649 60870 gene locus_tag LOCUS_31600 61649 60870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 64014 62005 gene locus_tag LOCUS_31610 64014 62005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 65585 64020 gene locus_tag LOCUS_31620 65585 64020 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261373.1 protein_id gnl|my_center|LOCUS_31620 68374 65861 gene locus_tag LOCUS_31630 68374 65861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 70702 68444 gene locus_tag LOCUS_31640 70702 68444 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_31640 71338 70739 gene locus_tag LOCUS_31650 71338 70739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 71456 71665 gene locus_tag LOCUS_31660 71456 71665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 71650 71982 gene locus_tag LOCUS_31670 71650 71982 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_31670 72550 72023 gene locus_tag LOCUS_31680 72550 72023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 73617 72721 gene locus_tag LOCUS_31690 73617 72721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 73799 74281 gene locus_tag LOCUS_31700 gene smpB 73799 74281 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59630 protein_id gnl|my_center|LOCUS_31700 75627 74278 gene locus_tag LOCUS_31710 75627 74278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_31710 76767 75658 gene locus_tag LOCUS_31720 76767 75658 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_31720 76871 77239 gene locus_tag LOCUS_31730 76871 77239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 77793 77236 gene locus_tag LOCUS_31740 77793 77236 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU27 protein_id gnl|my_center|LOCUS_31740 80108 77796 gene locus_tag LOCUS_31750 80108 77796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 81646 80249 gene locus_tag LOCUS_31760 81646 80249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 84933 81643 gene locus_tag LOCUS_31770 84933 81643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 87458 85152 gene locus_tag LOCUS_31780 87458 85152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 87727 88119 gene locus_tag LOCUS_31790 87727 88119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 88112 88687 gene locus_tag LOCUS_31800 88112 88687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 88857 89240 gene locus_tag LOCUS_31810 88857 89240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 89500 90471 gene locus_tag LOCUS_31820 89500 90471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 91462 90545 gene locus_tag LOCUS_31830 91462 90545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 93498 92323 gene locus_tag LOCUS_31840 93498 92323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 94881 93688 gene locus_tag LOCUS_31850 94881 93688 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_31850 96038 94884 gene locus_tag LOCUS_31860 96038 94884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_31860 96754 96035 gene locus_tag LOCUS_31870 gene tptC 96754 96035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_31870 98039 96810 gene locus_tag LOCUS_31880 gene acrE 98039 96810 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_31880 99557 98196 gene locus_tag LOCUS_31890 99557 98196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 102063 99598 gene locus_tag LOCUS_31900 102063 99598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 101761 101668 gene locus_tag LOCUS_t00250 101761 101668 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 102291 103853 gene locus_tag LOCUS_31910 102291 103853 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_31910 104236 106662 gene locus_tag LOCUS_31920 104236 106662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_31920 106752 106976 gene locus_tag LOCUS_31930 106752 106976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 106986 107426 gene locus_tag LOCUS_31940 106986 107426 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_31940 108800 107475 gene locus_tag LOCUS_31950 108800 107475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268797.1 protein_id gnl|my_center|LOCUS_31950 109793 108804 gene locus_tag LOCUS_31960 109793 108804 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_31960 111012 109870 gene locus_tag LOCUS_31970 111012 109870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 111635 111009 gene locus_tag LOCUS_31980 111635 111009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 112528 111632 gene locus_tag LOCUS_31990 112528 111632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 113543 112521 gene locus_tag LOCUS_32000 113543 112521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_32000 114564 113548 gene locus_tag LOCUS_32010 114564 113548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 114739 115398 gene locus_tag LOCUS_32020 114739 115398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 115429 116364 gene locus_tag LOCUS_32030 115429 116364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 116385 119228 gene locus_tag LOCUS_32040 116385 119228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 119578 119156 gene locus_tag LOCUS_32050 119578 119156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 121877 119571 gene locus_tag LOCUS_32060 121877 119571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 124749 121909 gene locus_tag LOCUS_32070 124749 121909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 125789 124749 gene locus_tag LOCUS_32080 125789 124749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 125962 126540 gene locus_tag LOCUS_32090 gene algU 125962 126540 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_32090 126555 127424 gene locus_tag LOCUS_32100 126555 127424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 127435 130428 gene locus_tag LOCUS_32110 127435 130428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_32110 130478 131959 gene locus_tag LOCUS_32120 130478 131959 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_32120 132342 133607 gene locus_tag LOCUS_32130 gene proB 132342 133607 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X86 protein_id gnl|my_center|LOCUS_32130 133659 134984 gene locus_tag LOCUS_32140 gene proA 133659 134984 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_32140 135598 135218 gene locus_tag LOCUS_32150 gene rplQ 135598 135218 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_32150 136615 135623 gene locus_tag LOCUS_32160 gene rpoA 136615 135623 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_32160 137307 136678 gene locus_tag LOCUS_32170 137307 136678 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_32170 137989 137588 gene locus_tag LOCUS_32180 gene rpsK 137989 137588 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B1 protein_id gnl|my_center|LOCUS_32180 138512 138129 gene locus_tag LOCUS_32190 gene rpsM 138512 138129 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80377 protein_id gnl|my_center|LOCUS_32190 139503 138709 gene locus_tag LOCUS_32200 139503 138709 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_32200 140103 139534 gene locus_tag LOCUS_32210 gene adk 140103 139534 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD4 protein_id gnl|my_center|LOCUS_32210 141472 140090 gene locus_tag LOCUS_32220 gene secY 141472 140090 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_32220 141906 141472 gene locus_tag LOCUS_32230 gene rplO 141906 141472 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19946 protein_id gnl|my_center|LOCUS_32230 142100 141903 gene locus_tag LOCUS_32240 gene rpmD 142100 141903 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA2 protein_id gnl|my_center|LOCUS_32240 142648 142145 gene locus_tag LOCUS_32250 gene rpsE 142648 142145 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_32250 143150 142764 gene locus_tag LOCUS_32260 gene rplR 143150 142764 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E9 protein_id gnl|my_center|LOCUS_32260 143700 143179 gene locus_tag LOCUS_32270 gene rplF 143700 143179 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_32270 144161 143763 gene locus_tag LOCUS_32280 gene rpsH 144161 143763 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A1 protein_id gnl|my_center|LOCUS_32280 144360 144175 gene locus_tag LOCUS_32290 gene rpsZ 144360 144175 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E6 protein_id gnl|my_center|LOCUS_32290 145001 144417 gene locus_tag LOCUS_32300 gene rplE 145001 144417 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG8 protein_id gnl|my_center|LOCUS_32300 145360 145034 gene locus_tag LOCUS_32310 gene rplX 145360 145034 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_32310 145753 145385 gene locus_tag LOCUS_32320 gene rplN 145753 145385 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z8 protein_id gnl|my_center|LOCUS_32320 146037 145765 gene locus_tag LOCUS_32330 146037 145765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 146314 146108 gene locus_tag LOCUS_32340 gene rpmC 146314 146108 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E1 protein_id gnl|my_center|LOCUS_32340 146759 146340 gene locus_tag LOCUS_32350 gene rplP 146759 146340 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_32350 147425 146775 gene locus_tag LOCUS_32360 gene rpsC 147425 146775 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E0 protein_id gnl|my_center|LOCUS_32360 147795 147430 gene locus_tag LOCUS_32370 gene rplV 147795 147430 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PY5 protein_id gnl|my_center|LOCUS_32370 148094 147813 gene locus_tag LOCUS_32380 gene rpsS 148094 147813 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG43 protein_id gnl|my_center|LOCUS_32380 148943 148110 gene locus_tag LOCUS_32390 gene rplB 148943 148110 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_32390 149267 148977 gene locus_tag LOCUS_32400 gene rplW 149267 148977 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_32400 149887 149264 gene locus_tag LOCUS_32410 149887 149264 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_32410 150527 149898 gene locus_tag LOCUS_32420 gene rplC 150527 149898 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60454 protein_id gnl|my_center|LOCUS_32420 150875 150567 gene locus_tag LOCUS_32430 gene rpsJ 150875 150567 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J83 protein_id gnl|my_center|LOCUS_32430 >Feature sequence019 1005 31 gene locus_tag LOCUS_32440 1005 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2130 1015 gene locus_tag LOCUS_32450 2130 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3259 2942 gene locus_tag LOCUS_32460 3259 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3583 3290 gene locus_tag LOCUS_32470 3583 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3814 7821 gene locus_tag LOCUS_32480 3814 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 8309 8680 gene locus_tag LOCUS_32490 8309 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 8634 9524 gene locus_tag LOCUS_32500 8634 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 9566 9970 gene locus_tag LOCUS_32510 9566 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 10292 11923 gene locus_tag LOCUS_32520 10292 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227462.1 protein_id gnl|my_center|LOCUS_32520 13288 11954 gene locus_tag LOCUS_32530 13288 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 13506 13865 gene locus_tag LOCUS_32540 13506 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 15172 13835 gene locus_tag LOCUS_32550 15172 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 15385 15786 gene locus_tag LOCUS_32560 15385 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 15783 16337 gene locus_tag LOCUS_32570 15783 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 16728 16913 gene locus_tag LOCUS_32580 16728 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 16935 17630 gene locus_tag LOCUS_32590 16935 17630 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT41 protein_id gnl|my_center|LOCUS_32590 18044 18283 gene locus_tag LOCUS_32600 18044 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 18292 19191 gene locus_tag LOCUS_32610 18292 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 19587 19195 gene locus_tag LOCUS_32620 19587 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 20349 20116 gene locus_tag LOCUS_32630 20349 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 21743 20538 gene locus_tag LOCUS_32640 21743 20538 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074378.1 protein_id gnl|my_center|LOCUS_32640 22283 23545 gene locus_tag LOCUS_32650 22283 23545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 25069 23552 gene locus_tag LOCUS_32660 25069 23552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_32660 25671 25066 gene locus_tag LOCUS_32670 25671 25066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 27586 25949 gene locus_tag LOCUS_32680 27586 25949 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533077.1 protein_id gnl|my_center|LOCUS_32680 29039 27810 gene locus_tag LOCUS_32690 29039 27810 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_32690 30599 29163 gene locus_tag LOCUS_32700 30599 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 31282 30596 gene locus_tag LOCUS_32710 31282 30596 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_32710 31549 33717 gene locus_tag LOCUS_32720 31549 33717 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_32720 33737 34666 gene locus_tag LOCUS_32730 33737 34666 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728989.1 protein_id gnl|my_center|LOCUS_32730 35478 34759 gene locus_tag LOCUS_32740 35478 34759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 35798 37222 gene locus_tag LOCUS_32750 35798 37222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_32750 37306 38322 gene locus_tag LOCUS_32760 37306 38322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 38576 39823 gene locus_tag LOCUS_32770 38576 39823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 39925 40317 gene locus_tag LOCUS_32780 39925 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 42249 40519 gene locus_tag LOCUS_32790 42249 40519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 42472 43554 gene locus_tag LOCUS_32800 42472 43554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 43704 44879 gene locus_tag LOCUS_32810 43704 44879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 44876 45871 gene locus_tag LOCUS_32820 gene fabH 44876 45871 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHA3 protein_id gnl|my_center|LOCUS_32820 46049 46204 gene locus_tag LOCUS_32830 46049 46204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 46366 47874 gene locus_tag LOCUS_32840 46366 47874 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_32840 48550 48281 gene locus_tag LOCUS_32850 48550 48281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 51027 48580 gene locus_tag LOCUS_32860 51027 48580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_32860 51149 53032 gene locus_tag LOCUS_32870 51149 53032 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223844.1 protein_id gnl|my_center|LOCUS_32870 53029 53487 gene locus_tag LOCUS_32880 53029 53487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 53922 53500 gene locus_tag LOCUS_32890 53922 53500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 53988 54209 gene locus_tag LOCUS_32900 53988 54209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 54270 55664 gene locus_tag LOCUS_32910 54270 55664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_32910 56837 55683 gene locus_tag LOCUS_32920 56837 55683 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_32920 58026 56929 gene locus_tag LOCUS_32930 gene gcvT 58026 56929 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDT6 protein_id gnl|my_center|LOCUS_32930 59880 59002 gene locus_tag LOCUS_32940 59880 59002 CDS product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_32940 60158 60784 gene locus_tag LOCUS_32950 60158 60784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 60781 61194 gene locus_tag LOCUS_32960 60781 61194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 61239 64298 gene locus_tag LOCUS_32970 61239 64298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 64306 65721 gene locus_tag LOCUS_32980 64306 65721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 65714 67033 gene locus_tag LOCUS_32990 65714 67033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142886.1 protein_id gnl|my_center|LOCUS_32990 67115 68224 gene locus_tag LOCUS_33000 gene aspC-2 67115 68224 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCN2 protein_id gnl|my_center|LOCUS_33000 70280 68304 gene locus_tag LOCUS_33010 70280 68304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 70729 74679 gene locus_tag LOCUS_33020 gene dnaE 70729 74679 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUS6 protein_id gnl|my_center|LOCUS_33020 74819 76030 gene locus_tag LOCUS_33030 74819 76030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 76231 77292 gene locus_tag LOCUS_33040 76231 77292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 77289 78533 gene locus_tag LOCUS_33050 77289 78533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 78551 79168 gene locus_tag LOCUS_33060 78551 79168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 79171 80565 gene locus_tag LOCUS_33070 79171 80565 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_33070 80562 81275 gene locus_tag LOCUS_33080 80562 81275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 81284 81745 gene locus_tag LOCUS_33090 81284 81745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 81749 82825 gene locus_tag LOCUS_33100 81749 82825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 82822 84660 gene locus_tag LOCUS_33110 82822 84660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 85030 84701 gene locus_tag LOCUS_33120 85030 84701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 88177 85388 gene locus_tag LOCUS_33130 88177 85388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 89655 88306 gene locus_tag LOCUS_33140 89655 88306 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_33140 90994 89681 gene locus_tag LOCUS_33150 90994 89681 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_33150 92419 91070 gene locus_tag LOCUS_33160 gene hemN 92419 91070 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_33160 93605 92469 gene locus_tag LOCUS_33170 93605 92469 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_33170 94825 93644 gene locus_tag LOCUS_33180 94825 93644 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_33180 96478 95033 gene locus_tag LOCUS_33190 96478 95033 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_33190 96835 97245 gene locus_tag LOCUS_33200 96835 97245 CDS product glyoxalase/bleomycin resistance protein/dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529778.1 protein_id gnl|my_center|LOCUS_33200 97395 99995 gene locus_tag LOCUS_33210 97395 99995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 100404 99940 gene locus_tag LOCUS_33220 100404 99940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 100607 100401 gene locus_tag LOCUS_33230 100607 100401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 102494 100767 gene locus_tag LOCUS_33240 102494 100767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 103440 102577 gene locus_tag LOCUS_33250 103440 102577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 103818 105281 gene locus_tag LOCUS_33260 103818 105281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 105312 107162 gene locus_tag LOCUS_33270 105312 107162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 107521 107192 gene locus_tag LOCUS_33280 107521 107192 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227522.1 protein_id gnl|my_center|LOCUS_33280 107748 109898 gene locus_tag LOCUS_33290 107748 109898 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067382.1 protein_id gnl|my_center|LOCUS_33290 112201 110405 gene locus_tag LOCUS_33300 112201 110405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 112508 115231 gene locus_tag LOCUS_33310 112508 115231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 117568 115265 gene locus_tag LOCUS_33320 117568 115265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 117877 118266 gene locus_tag LOCUS_33330 gene pilH 117877 118266 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_33330 118263 118862 gene locus_tag LOCUS_33340 gene cheC 118263 118862 CDS product CheY-P-specific phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 protein_id gnl|my_center|LOCUS_33340 118866 120539 gene locus_tag LOCUS_33350 118866 120539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 120828 121451 gene locus_tag LOCUS_33360 120828 121451 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039381.1 protein_id gnl|my_center|LOCUS_33360 121451 123004 gene locus_tag LOCUS_33370 121451 123004 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_33370 123004 124191 gene locus_tag LOCUS_33380 123004 124191 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_33380 124188 127391 gene locus_tag LOCUS_33390 124188 127391 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_33390 128275 127466 gene locus_tag LOCUS_33400 128275 127466 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086143.1 protein_id gnl|my_center|LOCUS_33400 128420 128728 gene locus_tag LOCUS_33410 128420 128728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_33410 128725 128943 gene locus_tag LOCUS_33420 128725 128943 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_33420 129008 129952 gene locus_tag LOCUS_33430 129008 129952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 129949 130737 gene locus_tag LOCUS_33440 129949 130737 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_33440 130890 133058 gene locus_tag LOCUS_33450 130890 133058 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072692.1 protein_id gnl|my_center|LOCUS_33450 133088 136243 gene locus_tag LOCUS_33460 133088 136243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 136655 138916 gene locus_tag LOCUS_33470 gene phuR 136655 138916 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_33470 138922 141240 gene locus_tag LOCUS_33480 138922 141240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 142898 141339 gene locus_tag LOCUS_33490 gene badA 142898 141339 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_33490 144461 142926 gene locus_tag LOCUS_33500 144461 142926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_33500 145032 144484 gene locus_tag LOCUS_33510 gene rfbC 145032 144484 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_33510 146138 145029 gene locus_tag LOCUS_33520 gene rfbB-2 146138 145029 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UA9 protein_id gnl|my_center|LOCUS_33520 147348 146296 gene locus_tag LOCUS_33530 147348 146296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 147446 148201 gene locus_tag LOCUS_33540 147446 148201 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707589.1 protein_id gnl|my_center|LOCUS_33540 149060 148245 gene locus_tag LOCUS_33550 149060 148245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence020 2228 738 gene locus_tag LOCUS_33560 2228 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 4276 2429 gene locus_tag LOCUS_33570 4276 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 5198 4623 gene locus_tag LOCUS_33580 5198 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 5388 6905 gene locus_tag LOCUS_33590 5388 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 7180 8472 gene locus_tag LOCUS_33600 7180 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 10288 8570 gene locus_tag LOCUS_33610 10288 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 10532 10909 gene locus_tag LOCUS_33620 10532 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_33620 11651 11112 gene locus_tag LOCUS_33630 11651 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 12753 11950 gene locus_tag LOCUS_33640 12753 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 13800 12907 gene locus_tag LOCUS_33650 13800 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 14380 13865 gene locus_tag LOCUS_33660 14380 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 protein_id gnl|my_center|LOCUS_33660 14764 14435 gene locus_tag LOCUS_33670 14764 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 15618 14818 gene locus_tag LOCUS_33680 15618 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 16043 15711 gene locus_tag LOCUS_33690 16043 15711 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205685.1 protein_id gnl|my_center|LOCUS_33690 16503 16030 gene locus_tag LOCUS_33700 16503 16030 CDS product vanillate O-demethylase oxidoreductase VanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710014.1 protein_id gnl|my_center|LOCUS_33700 17261 16593 gene locus_tag LOCUS_33710 17261 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 17731 17336 gene locus_tag LOCUS_33720 17731 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 18269 17742 gene locus_tag LOCUS_33730 18269 17742 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_33730 18841 18266 gene locus_tag LOCUS_33740 18841 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 19486 18845 gene locus_tag LOCUS_33750 19486 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700774.1 protein_id gnl|my_center|LOCUS_33750 19628 19476 gene locus_tag LOCUS_33760 19628 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33760 20417 19752 gene locus_tag LOCUS_33770 20417 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33770 21336 20449 gene locus_tag LOCUS_33780 21336 20449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266248.1 protein_id gnl|my_center|LOCUS_33780 21522 22463 gene locus_tag LOCUS_33790 21522 22463 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_33790 23254 22535 gene locus_tag LOCUS_33800 23254 22535 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406252.1 protein_id gnl|my_center|LOCUS_33800 24362 23478 gene locus_tag LOCUS_33810 24362 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_33810 25453 24434 gene locus_tag LOCUS_33820 25453 24434 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_33820 25943 25515 gene locus_tag LOCUS_33830 25943 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 26887 26042 gene locus_tag LOCUS_33840 26887 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 27365 26922 gene locus_tag LOCUS_33850 27365 26922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 28312 27416 gene locus_tag LOCUS_33860 28312 27416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 29223 28312 gene locus_tag LOCUS_33870 29223 28312 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_33870 30995 29244 gene locus_tag LOCUS_33880 30995 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 32096 31230 gene locus_tag LOCUS_33890 32096 31230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 33805 32204 gene locus_tag LOCUS_33900 33805 32204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 34887 33802 gene locus_tag LOCUS_33910 34887 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33910 35819 34887 gene locus_tag LOCUS_33920 35819 34887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 37655 35919 gene locus_tag LOCUS_33930 37655 35919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 38655 37924 gene locus_tag LOCUS_33940 38655 37924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 38814 39998 gene locus_tag LOCUS_33950 38814 39998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 40066 41373 gene locus_tag LOCUS_33960 40066 41373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 41488 41979 gene locus_tag LOCUS_33970 41488 41979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 42675 43775 gene locus_tag LOCUS_33980 42675 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 44335 44216 gene locus_tag LOCUS_33990 44335 44216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 44471 44349 gene locus_tag LOCUS_34000 44471 44349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 44826 45533 gene locus_tag LOCUS_34010 44826 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 46587 45547 gene locus_tag LOCUS_34020 46587 45547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 46969 46580 gene locus_tag LOCUS_34030 46969 46580 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_34030 48165 46966 gene locus_tag LOCUS_34040 gene hsdM-1 48165 46966 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_34040 51462 48730 gene locus_tag LOCUS_34050 51462 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 51682 52749 gene locus_tag LOCUS_34060 51682 52749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 53391 52753 gene locus_tag LOCUS_34070 53391 52753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 54704 53559 gene locus_tag LOCUS_34080 54704 53559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 55295 54819 gene locus_tag LOCUS_34090 55295 54819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 55500 56753 gene locus_tag LOCUS_34100 55500 56753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 56756 57040 gene locus_tag LOCUS_34110 56756 57040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085458.1 protein_id gnl|my_center|LOCUS_34110 57051 58025 gene locus_tag LOCUS_34120 57051 58025 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_34120 58155 58730 gene locus_tag LOCUS_34130 58155 58730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 58796 59626 gene locus_tag LOCUS_34140 58796 59626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 62488 59846 gene locus_tag LOCUS_34150 62488 59846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 63116 62502 gene locus_tag LOCUS_34160 63116 62502 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_34160 64031 63231 gene locus_tag LOCUS_34170 64031 63231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 64465 64031 gene locus_tag LOCUS_34180 64465 64031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 65384 64632 gene locus_tag LOCUS_34190 65384 64632 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_34190 67363 65405 gene locus_tag LOCUS_34200 67363 65405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 68128 67370 gene locus_tag LOCUS_34210 gene cutC 68128 67370 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJF2 protein_id gnl|my_center|LOCUS_34210 68829 68125 gene locus_tag LOCUS_34220 68829 68125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 69387 75674 gene locus_tag LOCUS_34230 69387 75674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 75758 76090 gene locus_tag LOCUS_34240 75758 76090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 76232 81151 gene locus_tag LOCUS_34250 76232 81151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 81184 81723 gene locus_tag LOCUS_34260 81184 81723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 81900 82448 gene locus_tag LOCUS_34270 81900 82448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 82594 83892 gene locus_tag LOCUS_34280 82594 83892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 84606 84010 gene locus_tag LOCUS_34290 84606 84010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 86364 84964 gene locus_tag LOCUS_34300 86364 84964 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067008.1 protein_id gnl|my_center|LOCUS_34300 88428 86434 gene locus_tag LOCUS_34310 88428 86434 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_34310 89502 88579 gene locus_tag LOCUS_34320 89502 88579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 89658 90467 gene locus_tag LOCUS_34330 89658 90467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 90997 90563 gene locus_tag LOCUS_34340 90997 90563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 95427 91090 gene locus_tag LOCUS_34350 95427 91090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 96226 95699 gene locus_tag LOCUS_34360 96226 95699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 96489 97100 gene locus_tag LOCUS_34370 96489 97100 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_34370 97100 99820 gene locus_tag LOCUS_34380 97100 99820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 100008 102395 gene locus_tag LOCUS_34390 100008 102395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_34390 102494 103051 gene locus_tag LOCUS_34400 102494 103051 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_34400 103065 105350 gene locus_tag LOCUS_34410 103065 105350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 105560 106759 gene locus_tag LOCUS_34420 105560 106759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 108069 106741 gene locus_tag LOCUS_34430 108069 106741 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_34430 108533 108192 gene locus_tag LOCUS_34440 108533 108192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_34440 111629 108777 gene locus_tag LOCUS_34450 111629 108777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 111864 116978 gene locus_tag LOCUS_34460 111864 116978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 117209 118318 gene locus_tag LOCUS_34470 117209 118318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 118315 119109 gene locus_tag LOCUS_34480 118315 119109 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_34480 120777 119161 gene locus_tag LOCUS_34490 120777 119161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 120883 121641 gene locus_tag LOCUS_34500 120883 121641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 121756 122130 gene locus_tag LOCUS_34510 121756 122130 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_34510 122127 124775 gene locus_tag LOCUS_34520 122127 124775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_34520 126233 124791 gene locus_tag LOCUS_34530 126233 124791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 126391 127119 gene locus_tag LOCUS_34540 126391 127119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_34540 127116 127916 gene locus_tag LOCUS_34550 127116 127916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_34550 128007 129500 gene locus_tag LOCUS_34560 128007 129500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 129654 132155 gene locus_tag LOCUS_34570 129654 132155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 133000 132320 gene locus_tag LOCUS_34580 133000 132320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 133248 133592 gene locus_tag LOCUS_34590 133248 133592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 133597 136338 gene locus_tag LOCUS_34600 133597 136338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_34600 138327 136900 gene locus_tag LOCUS_34610 138327 136900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 138635 138324 gene locus_tag LOCUS_34620 138635 138324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 139589 139209 gene locus_tag LOCUS_34630 139589 139209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence021 10187 2799 gene locus_tag LOCUS_34640 10187 2799 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267241.1 protein_id gnl|my_center|LOCUS_34640 21306 10312 gene locus_tag LOCUS_34650 21306 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 23038 21944 gene locus_tag LOCUS_34660 23038 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_34660 25962 23035 gene locus_tag LOCUS_34670 25962 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34670 27632 25884 gene locus_tag LOCUS_34680 27632 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34680 30937 27629 gene locus_tag LOCUS_34690 30937 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34690 47442 30934 gene locus_tag LOCUS_34700 47442 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 47820 48266 gene locus_tag LOCUS_34710 47820 48266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_34710 48587 48294 gene locus_tag LOCUS_34720 48587 48294 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_34720 48859 48587 gene locus_tag LOCUS_34730 48859 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 48933 50345 gene locus_tag LOCUS_34740 48933 50345 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_34740 51360 50395 gene locus_tag LOCUS_34750 51360 50395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 51577 52188 gene locus_tag LOCUS_34760 51577 52188 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_34760 52185 53813 gene locus_tag LOCUS_34770 52185 53813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 53810 56383 gene locus_tag LOCUS_34780 53810 56383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 56530 57456 gene locus_tag LOCUS_34790 56530 57456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 57571 57804 gene locus_tag LOCUS_34800 57571 57804 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WE6 protein_id gnl|my_center|LOCUS_34800 59220 57988 gene locus_tag LOCUS_34810 59220 57988 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_34810 59464 59718 gene locus_tag LOCUS_34820 59464 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 59883 67352 gene locus_tag LOCUS_34830 59883 67352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 67535 68650 gene locus_tag LOCUS_34840 67535 68650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 70022 68871 gene locus_tag LOCUS_34850 70022 68871 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_34850 72663 70192 gene locus_tag LOCUS_34860 72663 70192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_34860 72948 74648 gene locus_tag LOCUS_34870 72948 74648 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_34870 74672 75871 gene locus_tag LOCUS_34880 74672 75871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 76096 78204 gene locus_tag LOCUS_34890 76096 78204 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_34890 78376 79341 gene locus_tag LOCUS_34900 78376 79341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_34900 79402 80739 gene locus_tag LOCUS_34910 79402 80739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 80927 81547 gene locus_tag LOCUS_34920 80927 81547 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_34920 81549 84551 gene locus_tag LOCUS_34930 81549 84551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 85585 84554 gene locus_tag LOCUS_34940 85585 84554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 85803 86771 gene locus_tag LOCUS_34950 85803 86771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 89498 86775 gene locus_tag LOCUS_34960 89498 86775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 90081 89503 gene locus_tag LOCUS_34970 90081 89503 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_34970 90277 91074 gene locus_tag LOCUS_34980 90277 91074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 91872 91096 gene locus_tag LOCUS_34990 91872 91096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 92230 94206 gene locus_tag LOCUS_35000 92230 94206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 95149 94298 gene locus_tag LOCUS_35010 95149 94298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 96878 95190 gene locus_tag LOCUS_35020 96878 95190 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_35020 97893 97081 gene locus_tag LOCUS_35030 97893 97081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390023.1 protein_id gnl|my_center|LOCUS_35030 98960 97890 gene locus_tag LOCUS_35040 98960 97890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087314.1 protein_id gnl|my_center|LOCUS_35040 99249 98974 gene locus_tag LOCUS_35050 99249 98974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 99209 101227 gene locus_tag LOCUS_35060 99209 101227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 101328 102233 gene locus_tag LOCUS_35070 gene purC 101328 102233 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_35070 106467 102283 gene locus_tag LOCUS_35080 106467 102283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 108908 106464 gene locus_tag LOCUS_35090 108908 106464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 109686 109165 gene locus_tag LOCUS_35100 109686 109165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 112266 109777 gene locus_tag LOCUS_35110 112266 109777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 112564 114069 gene locus_tag LOCUS_35120 112564 114069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 115325 114285 gene locus_tag LOCUS_35130 gene gluQ 115325 114285 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_35130 115720 118137 gene locus_tag LOCUS_35140 115720 118137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 119164 118184 gene locus_tag LOCUS_35150 119164 118184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 119333 119968 gene locus_tag LOCUS_35160 119333 119968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 120735 119908 gene locus_tag LOCUS_35170 120735 119908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 120804 121667 gene locus_tag LOCUS_35180 gene tesB 120804 121667 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_35180 123410 121671 gene locus_tag LOCUS_35190 123410 121671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 123660 124220 gene locus_tag LOCUS_35200 123660 124220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 124255 126000 gene locus_tag LOCUS_35210 124255 126000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 128366 125997 gene locus_tag LOCUS_35220 128366 125997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142385.1 protein_id gnl|my_center|LOCUS_35220 128864 130645 gene locus_tag LOCUS_35230 128864 130645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_35230 132069 130642 gene locus_tag LOCUS_35240 gene menE 132069 130642 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE3 protein_id gnl|my_center|LOCUS_35240 133007 132066 gene locus_tag LOCUS_35250 gene menA 133007 132066 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_35250 134026 133004 gene locus_tag LOCUS_35260 134026 133004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 135864 134023 gene locus_tag LOCUS_35270 135864 134023 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_35270 137377 135884 gene locus_tag LOCUS_35280 137377 135884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 138129 137374 gene locus_tag LOCUS_35290 gene ubiE 138129 137374 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_35290 139264 138140 gene locus_tag LOCUS_35300 139264 138140 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047347.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence022 165 704 gene locus_tag LOCUS_35310 165 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 701 1462 gene locus_tag LOCUS_35320 701 1462 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_35320 2592 1927 gene locus_tag LOCUS_35330 2592 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3824 2856 gene locus_tag LOCUS_35340 3824 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 5458 3830 gene locus_tag LOCUS_35350 5458 3830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_35350 8028 5455 gene locus_tag LOCUS_35360 8028 5455 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_35360 11733 8167 gene locus_tag LOCUS_35370 11733 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 13242 11857 gene locus_tag LOCUS_35380 gene kmo 13242 11857 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_35380 14714 13239 gene locus_tag LOCUS_35390 14714 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 15452 14721 gene locus_tag LOCUS_35400 15452 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 17264 15639 gene locus_tag LOCUS_35410 17264 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 17459 19906 gene locus_tag LOCUS_35420 17459 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_35420 25180 20264 gene locus_tag LOCUS_35430 25180 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35430 33256 25214 gene locus_tag LOCUS_35440 33256 25214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35440 46224 33253 gene locus_tag LOCUS_35450 46224 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 55085 46224 gene locus_tag LOCUS_35460 55085 46224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 64612 55082 gene locus_tag LOCUS_35470 64612 55082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35470 78597 64609 gene locus_tag LOCUS_35480 78597 64609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35480 79057 79710 gene locus_tag LOCUS_35490 79057 79710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 80344 81945 gene locus_tag LOCUS_35500 80344 81945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 82262 82855 gene locus_tag LOCUS_35510 82262 82855 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_35510 85644 82804 gene locus_tag LOCUS_35520 85644 82804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 87362 85923 gene locus_tag LOCUS_35530 87362 85923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 88090 87359 gene locus_tag LOCUS_35540 88090 87359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 89080 88172 gene locus_tag LOCUS_35550 89080 88172 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_35550 92802 89077 gene locus_tag LOCUS_35560 92802 89077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_35560 93142 93681 gene locus_tag LOCUS_35570 93142 93681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 94624 93821 gene locus_tag LOCUS_35580 94624 93821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 96804 94636 gene locus_tag LOCUS_35590 96804 94636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 97022 98374 gene locus_tag LOCUS_35600 97022 98374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 98589 98365 gene locus_tag LOCUS_35610 98589 98365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 100439 98709 gene locus_tag LOCUS_35620 gene sopT 100439 98709 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_35620 103878 100699 gene locus_tag LOCUS_35630 103878 100699 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223591.1 protein_id gnl|my_center|LOCUS_35630 104946 104125 gene locus_tag LOCUS_35640 gene mutM 104946 104125 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E4 protein_id gnl|my_center|LOCUS_35640 105090 105692 gene locus_tag LOCUS_35650 105090 105692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 105780 106424 gene locus_tag LOCUS_35660 gene udk 105780 106424 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_35660 106855 106460 gene locus_tag LOCUS_35670 gene panD 106855 106460 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBZ3 protein_id gnl|my_center|LOCUS_35670 107857 106910 gene locus_tag LOCUS_35680 gene panC 107857 106910 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_35680 108770 107850 gene locus_tag LOCUS_35690 gene panB 108770 107850 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729A6 protein_id gnl|my_center|LOCUS_35690 109721 109071 gene locus_tag LOCUS_35700 gene dck 109721 109071 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_35700 110314 111552 gene locus_tag LOCUS_35710 110314 111552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 111745 112605 gene locus_tag LOCUS_35720 111745 112605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 113176 112673 gene locus_tag LOCUS_35730 113176 112673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 113479 115140 gene locus_tag LOCUS_35740 113479 115140 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_35740 115156 116175 gene locus_tag LOCUS_35750 115156 116175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 116141 117034 gene locus_tag LOCUS_35760 116141 117034 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 protein_id gnl|my_center|LOCUS_35760 120352 117251 gene locus_tag LOCUS_35770 120352 117251 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_35770 121413 120349 gene locus_tag LOCUS_35780 121413 120349 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_35780 122597 121692 gene locus_tag LOCUS_35790 122597 121692 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_35790 122676 123416 gene locus_tag LOCUS_35800 122676 123416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 124970 123498 gene locus_tag LOCUS_35810 gene argH 124970 123498 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34858 protein_id gnl|my_center|LOCUS_35810 126169 124967 gene locus_tag LOCUS_35820 gene argG 126169 124967 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59846 protein_id gnl|my_center|LOCUS_35820 126697 126320 gene locus_tag LOCUS_35830 126697 126320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 126581 127996 gene locus_tag LOCUS_35840 126581 127996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 127993 128700 gene locus_tag LOCUS_35850 127993 128700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 128697 129977 gene locus_tag LOCUS_35860 128697 129977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 129967 131364 gene locus_tag LOCUS_35870 129967 131364 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_35870 131560 133230 gene locus_tag LOCUS_35880 gene glpA 131560 133230 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZR9 protein_id gnl|my_center|LOCUS_35880 133251 134159 gene locus_tag LOCUS_35890 133251 134159 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence023 2333 1293 gene locus_tag LOCUS_35900 2333 1293 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_35900 4105 2330 gene locus_tag LOCUS_35910 4105 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_35910 4303 5292 gene locus_tag LOCUS_35920 4303 5292 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_35920 6889 5300 gene locus_tag LOCUS_35930 6889 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 7884 6895 gene locus_tag LOCUS_35940 7884 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 9450 7957 gene locus_tag LOCUS_35950 9450 7957 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_35950 10922 9573 gene locus_tag LOCUS_35960 10922 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 13045 11213 gene locus_tag LOCUS_35970 13045 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 14799 13042 gene locus_tag LOCUS_35980 14799 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 15094 15648 gene locus_tag LOCUS_35990 15094 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 15803 18112 gene locus_tag LOCUS_36000 15803 18112 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_36000 19134 18337 gene locus_tag LOCUS_36010 19134 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 19407 20474 gene locus_tag LOCUS_36020 19407 20474 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_36020 22863 20572 gene locus_tag LOCUS_36030 22863 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 23539 23144 gene locus_tag LOCUS_36040 23539 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 25223 25819 gene locus_tag LOCUS_36050 25223 25819 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_36050 25937 26707 gene locus_tag LOCUS_36060 25937 26707 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_36060 27217 26804 gene locus_tag LOCUS_36070 27217 26804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 27440 27195 gene locus_tag LOCUS_36080 27440 27195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 27723 28901 gene locus_tag LOCUS_36090 27723 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 28898 29311 gene locus_tag LOCUS_36100 28898 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 30531 29308 gene locus_tag LOCUS_36110 30531 29308 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_36110 32795 30528 gene locus_tag LOCUS_36120 32795 30528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 33783 32977 gene locus_tag LOCUS_36130 33783 32977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 34047 33802 gene locus_tag LOCUS_36140 34047 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 34238 34044 gene locus_tag LOCUS_36150 34238 34044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 34540 34241 gene locus_tag LOCUS_36160 34540 34241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 35150 34551 gene locus_tag LOCUS_36170 35150 34551 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_36170 36937 35174 gene locus_tag LOCUS_36180 gene ctaD 36937 35174 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_36180 37772 37077 gene locus_tag LOCUS_36190 37772 37077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 38045 38869 gene locus_tag LOCUS_36200 38045 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 39733 39095 gene locus_tag LOCUS_36210 39733 39095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 40568 39717 gene locus_tag LOCUS_36220 40568 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 41230 40562 gene locus_tag LOCUS_36230 41230 40562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 41467 42009 gene locus_tag LOCUS_36240 41467 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 42035 42427 gene locus_tag LOCUS_36250 42035 42427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 42567 43721 gene locus_tag LOCUS_36260 42567 43721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 44336 43776 gene locus_tag LOCUS_36270 44336 43776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 44790 44398 gene locus_tag LOCUS_36280 44790 44398 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_36280 47418 45091 gene locus_tag LOCUS_36290 47418 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 49342 47495 gene locus_tag LOCUS_36300 49342 47495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 50153 49344 gene locus_tag LOCUS_36310 50153 49344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 50929 50186 gene locus_tag LOCUS_36320 50929 50186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 52830 50926 gene locus_tag LOCUS_36330 52830 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 53355 52849 gene locus_tag LOCUS_36340 53355 52849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 56497 53477 gene locus_tag LOCUS_36350 56497 53477 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_36350 57291 56644 gene locus_tag LOCUS_36360 57291 56644 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_36360 57583 59247 gene locus_tag LOCUS_36370 57583 59247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 59298 59750 gene locus_tag LOCUS_36380 59298 59750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 59777 60277 gene locus_tag LOCUS_36390 59777 60277 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_36390 60490 62184 gene locus_tag LOCUS_36400 60490 62184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 62333 63640 gene locus_tag LOCUS_36410 gene murA 62333 63640 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q84 protein_id gnl|my_center|LOCUS_36410 63777 66110 gene locus_tag LOCUS_36420 63777 66110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 66894 66160 gene locus_tag LOCUS_36430 66894 66160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 67703 66882 gene locus_tag LOCUS_36440 67703 66882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 68038 68592 gene locus_tag LOCUS_36450 68038 68592 CDS product macrodomain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_36450 69106 68660 gene locus_tag LOCUS_36460 69106 68660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 70426 69188 gene locus_tag LOCUS_36470 gene apgM 70426 69188 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X295 protein_id gnl|my_center|LOCUS_36470 70947 70528 gene locus_tag LOCUS_36480 70947 70528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 71845 71033 gene locus_tag LOCUS_36490 71845 71033 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259399.1 protein_id gnl|my_center|LOCUS_36490 72018 72326 gene locus_tag LOCUS_36500 72018 72326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 72405 73784 gene locus_tag LOCUS_36510 72405 73784 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_36510 74041 73781 gene locus_tag LOCUS_36520 74041 73781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 74287 75633 gene locus_tag LOCUS_36530 74287 75633 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_36530 75656 76936 gene locus_tag LOCUS_36540 75656 76936 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338730.1 protein_id gnl|my_center|LOCUS_36540 76933 79107 gene locus_tag LOCUS_36550 76933 79107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 79262 79189 gene locus_tag LOCUS_t00260 79262 79189 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 80832 79372 gene locus_tag LOCUS_36560 gene gltX 80832 79372 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_36560 81004 81095 gene locus_tag LOCUS_t00270 81004 81095 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81338 83350 gene locus_tag LOCUS_36570 gene tkt 81338 83350 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_36570 83385 85805 gene locus_tag LOCUS_36580 83385 85805 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_36580 85938 86339 gene locus_tag LOCUS_36590 85938 86339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 87756 86389 gene locus_tag LOCUS_36600 87756 86389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085153.1 protein_id gnl|my_center|LOCUS_36600 88017 89261 gene locus_tag LOCUS_36610 88017 89261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 89483 90319 gene locus_tag LOCUS_36620 89483 90319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 90319 92622 gene locus_tag LOCUS_36630 90319 92622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_36630 92631 93437 gene locus_tag LOCUS_36640 92631 93437 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_36640 93550 94500 gene locus_tag LOCUS_36650 93550 94500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 94837 95757 gene locus_tag LOCUS_36660 94837 95757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 96099 98066 gene locus_tag LOCUS_36670 96099 98066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 98035 99981 gene locus_tag LOCUS_36680 98035 99981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 99984 100352 gene locus_tag LOCUS_36690 99984 100352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023556.1 protein_id gnl|my_center|LOCUS_36690 100528 101751 gene locus_tag LOCUS_36700 100528 101751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 101882 103315 gene locus_tag LOCUS_36710 101882 103315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 103312 105573 gene locus_tag LOCUS_36720 103312 105573 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_36720 105593 108514 gene locus_tag LOCUS_36730 105593 108514 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_36730 108551 109099 gene locus_tag LOCUS_36740 108551 109099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 109291 110523 gene locus_tag LOCUS_36750 109291 110523 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887434.1 protein_id gnl|my_center|LOCUS_36750 113500 110567 gene locus_tag LOCUS_36760 113500 110567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 115428 113497 gene locus_tag LOCUS_36770 115428 113497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 118844 115425 gene locus_tag LOCUS_36780 118844 115425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 123388 118841 gene locus_tag LOCUS_36790 123388 118841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 124132 123467 gene locus_tag LOCUS_36800 124132 123467 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_36800 124450 125370 gene locus_tag LOCUS_36810 124450 125370 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404720.1 protein_id gnl|my_center|LOCUS_36810 126412 125342 gene locus_tag LOCUS_36820 gene rkpO 126412 125342 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887053.1 protein_id gnl|my_center|LOCUS_36820 127158 126412 gene locus_tag LOCUS_36830 127158 126412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 128387 127161 gene locus_tag LOCUS_36840 128387 127161 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_36840 129372 128398 gene locus_tag LOCUS_36850 129372 128398 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_36850 130603 129479 gene locus_tag LOCUS_36860 gene dinB 130603 129479 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_36860 <131837 130736 gene locus_tag LOCUS_36870 <131837 130736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter >Feature sequence024 1334 729 gene locus_tag LOCUS_36880 gene clpP 1334 729 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R80 protein_id gnl|my_center|LOCUS_36880 2683 1340 gene locus_tag LOCUS_36890 gene tig 2683 1340 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI37 protein_id gnl|my_center|LOCUS_36890 2938 2852 gene locus_tag LOCUS_t00280 2938 2852 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3313 3238 gene locus_tag LOCUS_t00290 3313 3238 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3740 3516 gene locus_tag LOCUS_36900 gene thiS 3740 3516 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_36900 4507 3818 gene locus_tag LOCUS_36910 4507 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 5546 4644 gene locus_tag LOCUS_36920 5546 4644 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36920 7340 5550 gene locus_tag LOCUS_36930 7340 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 8589 7465 gene locus_tag LOCUS_36940 gene pheA 8589 7465 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 protein_id gnl|my_center|LOCUS_36940 9071 10252 gene locus_tag LOCUS_36950 9071 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 11225 10269 gene locus_tag LOCUS_36960 gene galE1 11225 10269 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN67 protein_id gnl|my_center|LOCUS_36960 12327 11254 gene locus_tag LOCUS_36970 gene fabH2 12327 11254 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_36970 12978 12412 gene locus_tag LOCUS_36980 12978 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 13681 13037 gene locus_tag LOCUS_36990 gene folE 13681 13037 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJV0 protein_id gnl|my_center|LOCUS_36990 14130 14291 gene locus_tag LOCUS_37000 14130 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 15192 14356 gene locus_tag LOCUS_37010 15192 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 15349 16479 gene locus_tag LOCUS_37020 gene carA 15349 16479 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_37020 16510 17793 gene locus_tag LOCUS_37030 gene lolE 16510 17793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_37030 18239 21463 gene locus_tag LOCUS_37040 18239 21463 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCJ8 protein_id gnl|my_center|LOCUS_37040 22482 21460 gene locus_tag LOCUS_37050 gene nadR 22482 21460 CDS product transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_37050 23075 22479 gene locus_tag LOCUS_37060 23075 22479 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_37060 23281 23484 gene locus_tag LOCUS_37070 23281 23484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_37070 24029 24307 gene locus_tag LOCUS_37080 24029 24307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 24316 25197 gene locus_tag LOCUS_37090 24316 25197 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_37090 25266 26234 gene locus_tag LOCUS_37100 25266 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 27507 26269 gene locus_tag LOCUS_37110 27507 26269 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_37110 28235 27435 gene locus_tag LOCUS_37120 28235 27435 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_37120 28843 28232 gene locus_tag LOCUS_37130 28843 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 29672 28872 gene locus_tag LOCUS_37140 29672 28872 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_37140 30021 29683 gene locus_tag LOCUS_37150 30021 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 30598 30164 gene locus_tag LOCUS_37160 30598 30164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 31580 30612 gene locus_tag LOCUS_37170 31580 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 31860 31591 gene locus_tag LOCUS_37180 31860 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 32140 33372 gene locus_tag LOCUS_37190 32140 33372 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_37190 33372 34355 gene locus_tag LOCUS_37200 33372 34355 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC8 protein_id gnl|my_center|LOCUS_37200 34454 34945 gene locus_tag LOCUS_37210 gene dcd 34454 34945 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MG72 protein_id gnl|my_center|LOCUS_37210 35095 36495 gene locus_tag LOCUS_37220 35095 36495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 36512 38068 gene locus_tag LOCUS_37230 gene gltB2 36512 38068 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_37230 38082 38948 gene locus_tag LOCUS_37240 38082 38948 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_37240 38945 39640 gene locus_tag LOCUS_37250 gene phoP 38945 39640 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_37250 39908 39657 gene locus_tag LOCUS_37260 39908 39657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 40406 42856 gene locus_tag LOCUS_37270 40406 42856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 43146 46538 gene locus_tag LOCUS_37280 43146 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 49614 46663 gene locus_tag LOCUS_37290 49614 46663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 50093 51241 gene locus_tag LOCUS_37300 50093 51241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 51382 53544 gene locus_tag LOCUS_37310 51382 53544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 53865 54269 gene locus_tag LOCUS_37320 53865 54269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 54394 58242 gene locus_tag LOCUS_37330 54394 58242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 59268 58270 gene locus_tag LOCUS_37340 59268 58270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 61672 59591 gene locus_tag LOCUS_37350 61672 59591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 61862 62053 gene locus_tag LOCUS_37360 61862 62053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 63005 62226 gene locus_tag LOCUS_37370 63005 62226 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_37370 63876 63049 gene locus_tag LOCUS_37380 63876 63049 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_37380 65145 63913 gene locus_tag LOCUS_37390 65145 63913 CDS product putative acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268525.1 protein_id gnl|my_center|LOCUS_37390 66179 65379 gene locus_tag LOCUS_37400 66179 65379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 66579 67589 gene locus_tag LOCUS_37410 gene fbp 66579 67589 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AZ9 protein_id gnl|my_center|LOCUS_37410 67730 68776 gene locus_tag LOCUS_37420 67730 68776 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_37420 68783 69034 gene locus_tag LOCUS_37430 68783 69034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_37430 69039 69524 gene locus_tag LOCUS_37440 69039 69524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 70533 69526 gene locus_tag LOCUS_37450 70533 69526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 70727 72364 gene locus_tag LOCUS_37460 70727 72364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 72633 72968 gene locus_tag LOCUS_37470 72633 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 72965 73696 gene locus_tag LOCUS_37480 72965 73696 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_37480 73735 74715 gene locus_tag LOCUS_37490 73735 74715 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870293.1 protein_id gnl|my_center|LOCUS_37490 75523 74699 gene locus_tag LOCUS_37500 75523 74699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 75748 77118 gene locus_tag LOCUS_37510 75748 77118 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_37510 77088 77948 gene locus_tag LOCUS_37520 77088 77948 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888458.1 protein_id gnl|my_center|LOCUS_37520 78170 79576 gene locus_tag LOCUS_37530 78170 79576 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_37530 79654 81033 gene locus_tag LOCUS_37540 79654 81033 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB01 protein_id gnl|my_center|LOCUS_37540 81242 81042 gene locus_tag LOCUS_37550 81242 81042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 83305 81242 gene locus_tag LOCUS_37560 gene feoB 83305 81242 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_37560 83571 83305 gene locus_tag LOCUS_37570 83571 83305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 86011 83723 gene locus_tag LOCUS_37580 86011 83723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 87430 86108 gene locus_tag LOCUS_37590 87430 86108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 87805 87572 gene locus_tag LOCUS_37600 87805 87572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 87711 89570 gene locus_tag LOCUS_37610 87711 89570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 89654 91438 gene locus_tag LOCUS_37620 89654 91438 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 protein_id gnl|my_center|LOCUS_37620 92858 91440 gene locus_tag LOCUS_37630 92858 91440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 93089 94033 gene locus_tag LOCUS_37640 93089 94033 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_37640 94560 94135 gene locus_tag LOCUS_37650 94560 94135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 94820 94560 gene locus_tag LOCUS_37660 94820 94560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 94951 96534 gene locus_tag LOCUS_37670 94951 96534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 97802 96531 gene locus_tag LOCUS_37680 97802 96531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 98019 100523 gene locus_tag LOCUS_37690 98019 100523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_37690 101015 100569 gene locus_tag LOCUS_37700 101015 100569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_37700 102397 101012 gene locus_tag LOCUS_37710 102397 101012 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_37710 103052 102432 gene locus_tag LOCUS_37720 gene ppiB 103052 102432 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VX98 protein_id gnl|my_center|LOCUS_37720 107720 103095 gene locus_tag LOCUS_37730 107720 103095 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_37730 108036 109157 gene locus_tag LOCUS_37740 gene ydjI 108036 109157 CDS product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_37740 109231 110322 gene locus_tag LOCUS_37750 109231 110322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_37750 110365 112467 gene locus_tag LOCUS_37760 110365 112467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 112464 113543 gene locus_tag LOCUS_37770 gene mnmA 112464 113543 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51625 protein_id gnl|my_center|LOCUS_37770 115150 113540 gene locus_tag LOCUS_37780 115150 113540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 115279 116751 gene locus_tag LOCUS_37790 115279 116751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 117374 116778 gene locus_tag LOCUS_37800 117374 116778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 117588 118211 gene locus_tag LOCUS_37810 117588 118211 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_37810 118315 118857 gene locus_tag LOCUS_37820 118315 118857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 118844 120805 gene locus_tag LOCUS_37830 118844 120805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 121242 121679 gene locus_tag LOCUS_37840 121242 121679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 121851 122015 gene locus_tag LOCUS_37850 121851 122015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 122050 122331 gene locus_tag LOCUS_37860 122050 122331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 122468 123250 gene locus_tag LOCUS_37870 122468 123250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 123247 124464 gene locus_tag LOCUS_37880 123247 124464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 124537 125196 gene locus_tag LOCUS_37890 124537 125196 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_37890 125205 125885 gene locus_tag LOCUS_37900 125205 125885 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_37900 125898 126632 gene locus_tag LOCUS_37910 125898 126632 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_37910 127150 128736 gene locus_tag LOCUS_37920 127150 128736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 128878 130830 gene locus_tag LOCUS_37930 128878 130830 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence025 <1 1359 gene locus_tag LOCUS_37940 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:acriflavin resistance protein 1523 3499 gene locus_tag LOCUS_37950 1523 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 3672 4199 gene locus_tag LOCUS_37960 3672 4199 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_37960 4196 4948 gene locus_tag LOCUS_37970 4196 4948 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804262.1 protein_id gnl|my_center|LOCUS_37970 4981 7443 gene locus_tag LOCUS_37980 4981 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 7440 8966 gene locus_tag LOCUS_37990 7440 8966 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_37990 10486 8963 gene locus_tag LOCUS_38000 10486 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 13405 10691 gene locus_tag LOCUS_38010 13405 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 13542 14507 gene locus_tag LOCUS_38020 gene mmuM 13542 14507 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258939.1 protein_id gnl|my_center|LOCUS_38020 14923 14513 gene locus_tag LOCUS_38030 14923 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 15183 14920 gene locus_tag LOCUS_38040 15183 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 16275 15319 gene locus_tag LOCUS_38050 16275 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 17621 16290 gene locus_tag LOCUS_38060 gene aceF 17621 16290 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45118 protein_id gnl|my_center|LOCUS_38060 20323 17651 gene locus_tag LOCUS_38070 gene aceE 20323 17651 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_38070 20609 21199 gene locus_tag LOCUS_38080 20609 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 22106 21237 gene locus_tag LOCUS_38090 22106 21237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 22494 22913 gene locus_tag LOCUS_38100 gene yphP 22494 22913 CDS product UPF0403 protein YphP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54170 protein_id gnl|my_center|LOCUS_38100 23047 23325 gene locus_tag LOCUS_38110 23047 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 23327 23707 gene locus_tag LOCUS_38120 23327 23707 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_38120 23742 25373 gene locus_tag LOCUS_38130 gene pruA 23742 25373 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_38130 25394 27127 gene locus_tag LOCUS_38140 25394 27127 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_38140 27383 28429 gene locus_tag LOCUS_38150 27383 28429 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG7 protein_id gnl|my_center|LOCUS_38150 29717 28587 gene locus_tag LOCUS_38160 29717 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 29903 32050 gene locus_tag LOCUS_38170 29903 32050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 32047 33096 gene locus_tag LOCUS_38180 32047 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 36587 33093 gene locus_tag LOCUS_38190 36587 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 40129 36872 gene locus_tag LOCUS_38200 40129 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 41703 40126 gene locus_tag LOCUS_38210 41703 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 42554 41700 gene locus_tag LOCUS_38220 42554 41700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 43191 42547 gene locus_tag LOCUS_38230 43191 42547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 44864 43470 gene locus_tag LOCUS_38240 gene cca 44864 43470 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D4 protein_id gnl|my_center|LOCUS_38240 46688 44895 gene locus_tag LOCUS_38250 46688 44895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 47866 46685 gene locus_tag LOCUS_38260 47866 46685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 49086 47863 gene locus_tag LOCUS_38270 49086 47863 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_38270 49508 50440 gene locus_tag LOCUS_38280 49508 50440 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_38280 51495 50452 gene locus_tag LOCUS_38290 51495 50452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 52883 51582 gene locus_tag LOCUS_38300 52883 51582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 54694 52847 gene locus_tag LOCUS_38310 54694 52847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_38310 55594 58374 gene locus_tag LOCUS_38320 55594 58374 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031100.1 protein_id gnl|my_center|LOCUS_38320 58385 60220 gene locus_tag LOCUS_38330 58385 60220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_38330 60217 62646 gene locus_tag LOCUS_38340 60217 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_38340 63188 62700 gene locus_tag LOCUS_38350 63188 62700 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_38350 63699 63193 gene locus_tag LOCUS_38360 gene hcp1 63699 63193 CDS product protein hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I747 protein_id gnl|my_center|LOCUS_38360 65278 63764 gene locus_tag LOCUS_38370 65278 63764 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_38370 65976 65278 gene locus_tag LOCUS_38380 65976 65278 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_38380 67390 66302 gene locus_tag LOCUS_38390 67390 66302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_38390 71721 67414 gene locus_tag LOCUS_38400 71721 67414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 72593 71718 gene locus_tag LOCUS_38410 72593 71718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 73941 72604 gene locus_tag LOCUS_38420 73941 72604 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_38420 74605 74009 gene locus_tag LOCUS_38430 74605 74009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 75815 74862 gene locus_tag LOCUS_38440 75815 74862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 76599 75817 gene locus_tag LOCUS_38450 76599 75817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 78316 76808 gene locus_tag LOCUS_38460 78316 76808 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530233.1 protein_id gnl|my_center|LOCUS_38460 79043 79588 gene locus_tag LOCUS_38470 79043 79588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 80280 79594 gene locus_tag LOCUS_38480 80280 79594 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_38480 84220 80327 gene locus_tag LOCUS_38490 84220 80327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 84400 84774 gene locus_tag LOCUS_38500 84400 84774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 84843 85328 gene locus_tag LOCUS_38510 84843 85328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 85325 85756 gene locus_tag LOCUS_38520 85325 85756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 85991 87124 gene locus_tag LOCUS_38530 85991 87124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 87196 88425 gene locus_tag LOCUS_38540 87196 88425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 88520 89560 gene locus_tag LOCUS_38550 88520 89560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 89557 90648 gene locus_tag LOCUS_38560 89557 90648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 90939 90661 gene locus_tag LOCUS_38570 90939 90661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 93099 91051 gene locus_tag LOCUS_38580 93099 91051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_38580 93244 94251 gene locus_tag LOCUS_38590 gene lipA 93244 94251 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_38590 94523 94993 gene locus_tag LOCUS_38600 94523 94993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 95045 96391 gene locus_tag LOCUS_38610 95045 96391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 96501 97406 gene locus_tag LOCUS_38620 96501 97406 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW55 protein_id gnl|my_center|LOCUS_38620 97406 98227 gene locus_tag LOCUS_38630 gene proC 97406 98227 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_38630 98220 98993 gene locus_tag LOCUS_38640 98220 98993 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403528.1 protein_id gnl|my_center|LOCUS_38640 99217 100221 gene locus_tag LOCUS_38650 99217 100221 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_38650 100410 102137 gene locus_tag LOCUS_38660 gene recN 100410 102137 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_38660 102148 102834 gene locus_tag LOCUS_38670 102148 102834 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_38670 102866 104866 gene locus_tag LOCUS_38680 102866 104866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_38680 104964 107276 gene locus_tag LOCUS_38690 104964 107276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 107400 107897 gene locus_tag LOCUS_38700 gene coaD 107400 107897 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IB2 protein_id gnl|my_center|LOCUS_38700 108005 110596 gene locus_tag LOCUS_38710 108005 110596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 112416 110653 gene locus_tag LOCUS_38720 112416 110653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 115761 112522 gene locus_tag LOCUS_38730 115761 112522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 116106 115819 gene locus_tag LOCUS_38740 116106 115819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 117872 116103 gene locus_tag LOCUS_38750 117872 116103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 118429 118986 gene locus_tag LOCUS_38760 118429 118986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 118983 121904 gene locus_tag LOCUS_38770 118983 121904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 121914 124271 gene locus_tag LOCUS_38780 121914 124271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 124451 125062 gene locus_tag LOCUS_38790 124451 125062 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence026 1686 271 gene locus_tag LOCUS_38800 1686 271 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_38800 2813 1683 gene locus_tag LOCUS_38810 2813 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2904 4163 gene locus_tag LOCUS_38820 gene cinA 2904 4163 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKI6 protein_id gnl|my_center|LOCUS_38820 4160 4795 gene locus_tag LOCUS_38830 4160 4795 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN52 protein_id gnl|my_center|LOCUS_38830 4795 5436 gene locus_tag LOCUS_38840 gene plsY1 4795 5436 CDS product glycerol-3-phosphate acyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSV1 protein_id gnl|my_center|LOCUS_38840 5436 6449 gene locus_tag LOCUS_38850 gene gpsA 5436 6449 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_38850 6915 8459 gene locus_tag LOCUS_38860 gene guaA 6915 8459 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_38860 8671 9504 gene locus_tag LOCUS_38870 gene lgt 8671 9504 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60970 protein_id gnl|my_center|LOCUS_38870 9501 10364 gene locus_tag LOCUS_38880 9501 10364 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_38880 10366 11376 gene locus_tag LOCUS_38890 10366 11376 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228521.1 protein_id gnl|my_center|LOCUS_38890 11532 13235 gene locus_tag LOCUS_38900 11532 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 13239 13682 gene locus_tag LOCUS_38910 13239 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 13666 13854 gene locus_tag LOCUS_38920 13666 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 14126 13938 gene locus_tag LOCUS_38930 14126 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 14262 14918 gene locus_tag LOCUS_38940 14262 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404594.1 protein_id gnl|my_center|LOCUS_38940 14923 16467 gene locus_tag LOCUS_38950 gene nnr 14923 16467 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_38950 16669 17526 gene locus_tag LOCUS_38960 16669 17526 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_38960 17523 18581 gene locus_tag LOCUS_38970 17523 18581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_38970 18670 21120 gene locus_tag LOCUS_38980 18670 21120 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_38980 21204 21767 gene locus_tag LOCUS_38990 21204 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 21760 23046 gene locus_tag LOCUS_39000 21760 23046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_39000 23043 24035 gene locus_tag LOCUS_39010 23043 24035 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_39010 24292 25194 gene locus_tag LOCUS_39020 24292 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 25212 26633 gene locus_tag LOCUS_39030 25212 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 26765 27685 gene locus_tag LOCUS_39040 26765 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 27682 29067 gene locus_tag LOCUS_39050 27682 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 32181 29161 gene locus_tag LOCUS_39060 32181 29161 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5W6 protein_id gnl|my_center|LOCUS_39060 32354 32872 gene locus_tag LOCUS_39070 32354 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_39070 33133 35739 gene locus_tag LOCUS_39080 33133 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 36188 35736 gene locus_tag LOCUS_39090 36188 35736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 36346 37881 gene locus_tag LOCUS_39100 36346 37881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 37914 38447 gene locus_tag LOCUS_39110 37914 38447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 39609 38461 gene locus_tag LOCUS_39120 39609 38461 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_39120 40930 39620 gene locus_tag LOCUS_39130 40930 39620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 41610 41245 gene locus_tag LOCUS_39140 41610 41245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 42068 41928 gene locus_tag LOCUS_39150 42068 41928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 45307 42320 gene locus_tag LOCUS_39160 45307 42320 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_39160 47596 45326 gene locus_tag LOCUS_39170 47596 45326 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_39170 48838 47600 gene locus_tag LOCUS_39180 48838 47600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 48955 50130 gene locus_tag LOCUS_39190 48955 50130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 50544 50131 gene locus_tag LOCUS_39200 50544 50131 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_39200 50897 50541 gene locus_tag LOCUS_39210 50897 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 50997 52376 gene locus_tag LOCUS_39220 gene sdaA 50997 52376 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_39220 53656 52493 gene locus_tag LOCUS_39230 53656 52493 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_39230 53847 55946 gene locus_tag LOCUS_39240 53847 55946 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_39240 56038 57981 gene locus_tag LOCUS_39250 56038 57981 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_39250 58064 61249 gene locus_tag LOCUS_39260 58064 61249 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037971.1 protein_id gnl|my_center|LOCUS_39260 62135 61380 gene locus_tag LOCUS_39270 62135 61380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 62411 64801 gene locus_tag LOCUS_39280 62411 64801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 66889 64967 gene locus_tag LOCUS_39290 66889 64967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 68796 66886 gene locus_tag LOCUS_39300 68796 66886 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_39300 70469 68793 gene locus_tag LOCUS_39310 70469 68793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 71416 70505 gene locus_tag LOCUS_39320 71416 70505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 72254 72805 gene locus_tag LOCUS_39330 72254 72805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 72810 73742 gene locus_tag LOCUS_39340 72810 73742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 73749 74378 gene locus_tag LOCUS_39350 73749 74378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 74375 75346 gene locus_tag LOCUS_39360 74375 75346 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_39360 75570 77972 gene locus_tag LOCUS_39370 75570 77972 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403170.1 protein_id gnl|my_center|LOCUS_39370 78055 78813 gene locus_tag LOCUS_39380 78055 78813 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_39380 79148 78828 gene locus_tag LOCUS_39390 79148 78828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 79583 80668 gene locus_tag LOCUS_39400 79583 80668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 80721 81011 gene locus_tag LOCUS_39410 80721 81011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_39410 81008 81298 gene locus_tag LOCUS_39420 81008 81298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 81830 81348 gene locus_tag LOCUS_39430 81830 81348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 82145 81852 gene locus_tag LOCUS_39440 82145 81852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 82381 83619 gene locus_tag LOCUS_39450 82381 83619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 83656 84834 gene locus_tag LOCUS_39460 gene solA 83656 84834 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_39460 90516 84877 gene locus_tag LOCUS_39470 90516 84877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 90403 90771 gene locus_tag LOCUS_39480 90403 90771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 92172 90667 gene locus_tag LOCUS_39490 92172 90667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 92627 93301 gene locus_tag LOCUS_39500 92627 93301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 93424 94521 gene locus_tag LOCUS_39510 93424 94521 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266337.1 protein_id gnl|my_center|LOCUS_39510 94518 98909 gene locus_tag LOCUS_39520 94518 98909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 99467 99210 gene locus_tag LOCUS_39530 99467 99210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 99975 99580 gene locus_tag LOCUS_39540 99975 99580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 100893 100108 gene locus_tag LOCUS_39550 100893 100108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 101555 102043 gene locus_tag LOCUS_39560 101555 102043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 102040 104013 gene locus_tag LOCUS_39570 102040 104013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 104191 106500 gene locus_tag LOCUS_39580 104191 106500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_39580 106511 107428 gene locus_tag LOCUS_39590 gene miaA 106511 107428 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_39590 107467 107670 gene locus_tag LOCUS_39600 107467 107670 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_39600 107757 109094 gene locus_tag LOCUS_39610 107757 109094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 109100 109822 gene locus_tag LOCUS_39620 109100 109822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 109912 110409 gene locus_tag LOCUS_39630 109912 110409 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_39630 110412 112205 gene locus_tag LOCUS_39640 110412 112205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 114025 112202 gene locus_tag LOCUS_39650 114025 112202 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_39650 115941 114022 gene locus_tag LOCUS_39660 115941 114022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 117001 116093 gene locus_tag LOCUS_39670 117001 116093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 118855 117122 gene locus_tag LOCUS_39680 118855 117122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 119676 121202 gene locus_tag LOCUS_39690 119676 121202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_39690 121468 123057 gene locus_tag LOCUS_39700 121468 123057 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222804.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence027 1895 1209 gene locus_tag LOCUS_39710 1895 1209 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 protein_id gnl|my_center|LOCUS_39710 2110 3021 gene locus_tag LOCUS_39720 2110 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39720 2921 3538 gene locus_tag LOCUS_39730 2921 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39730 5725 3620 gene locus_tag LOCUS_39740 5725 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 10102 6305 gene locus_tag LOCUS_39750 10102 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 10417 11478 gene locus_tag LOCUS_39760 10417 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 11539 13656 gene locus_tag LOCUS_39770 11539 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 13687 14322 gene locus_tag LOCUS_39780 13687 14322 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_39780 14319 16979 gene locus_tag LOCUS_39790 14319 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 17239 19923 gene locus_tag LOCUS_39800 17239 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 19961 22252 gene locus_tag LOCUS_39810 19961 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 23993 22299 gene locus_tag LOCUS_39820 23993 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 24879 24253 gene locus_tag LOCUS_39830 24879 24253 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_39830 28094 24954 gene locus_tag LOCUS_39840 28094 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 28909 28331 gene locus_tag LOCUS_39850 28909 28331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 29709 28927 gene locus_tag LOCUS_39860 29709 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 30247 29720 gene locus_tag LOCUS_39870 30247 29720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 30736 30269 gene locus_tag LOCUS_39880 gene infC 30736 30269 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHN0 protein_id gnl|my_center|LOCUS_39880 33596 31059 gene locus_tag LOCUS_39890 33596 31059 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039087.1 protein_id gnl|my_center|LOCUS_39890 34400 33681 gene locus_tag LOCUS_39900 34400 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 34673 35011 gene locus_tag LOCUS_39910 gene ytxJ 34673 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181889.1 protein_id gnl|my_center|LOCUS_39910 36079 35024 gene locus_tag LOCUS_39920 36079 35024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 37422 36076 gene locus_tag LOCUS_39930 37422 36076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 39534 37456 gene locus_tag LOCUS_39940 39534 37456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 40079 39531 gene locus_tag LOCUS_39950 40079 39531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 41378 40236 gene locus_tag LOCUS_39960 41378 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 41990 41418 gene locus_tag LOCUS_39970 41990 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 43202 42105 gene locus_tag LOCUS_39980 gene cheB 43202 42105 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX8 protein_id gnl|my_center|LOCUS_39980 44035 43199 gene locus_tag LOCUS_39990 gene cheR40H 44035 43199 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AY4 protein_id gnl|my_center|LOCUS_39990 45948 44053 gene locus_tag LOCUS_40000 45948 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 48181 46013 gene locus_tag LOCUS_40010 48181 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 48811 48272 gene locus_tag LOCUS_40020 48811 48272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 49690 48812 gene locus_tag LOCUS_40030 49690 48812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 51321 49687 gene locus_tag LOCUS_40040 gene cheA 51321 49687 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405314.1 protein_id gnl|my_center|LOCUS_40040 51500 51979 gene locus_tag LOCUS_40050 51500 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 51993 52724 gene locus_tag LOCUS_40060 51993 52724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942853.1 protein_id gnl|my_center|LOCUS_40060 52909 54471 gene locus_tag LOCUS_40070 52909 54471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 54483 55385 gene locus_tag LOCUS_40080 54483 55385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 55388 56374 gene locus_tag LOCUS_40090 55388 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 57171 56356 gene locus_tag LOCUS_40100 57171 56356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 57932 57306 gene locus_tag LOCUS_40110 57932 57306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 58498 58037 gene locus_tag LOCUS_40120 58498 58037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40120 59604 58429 gene locus_tag LOCUS_40130 59604 58429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40130 59787 62336 gene locus_tag LOCUS_40140 59787 62336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 63782 62394 gene locus_tag LOCUS_40150 63782 62394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 64248 63871 gene locus_tag LOCUS_40160 64248 63871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 71267 64245 gene locus_tag LOCUS_40170 71267 64245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 71564 72010 gene locus_tag LOCUS_40180 71564 72010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 72225 76331 gene locus_tag LOCUS_40190 72225 76331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 77230 76535 gene locus_tag LOCUS_40200 77230 76535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 78430 77462 gene locus_tag LOCUS_40210 78430 77462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 78604 79524 gene locus_tag LOCUS_40220 78604 79524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 80225 79647 gene locus_tag LOCUS_40230 80225 79647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 80497 83280 gene locus_tag LOCUS_40240 80497 83280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 83417 84604 gene locus_tag LOCUS_40250 83417 84604 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_40250 86720 84627 gene locus_tag LOCUS_40260 86720 84627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 86842 87432 gene locus_tag LOCUS_40270 86842 87432 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_40270 89899 87446 gene locus_tag LOCUS_40280 89899 87446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 90084 93359 gene locus_tag LOCUS_40290 90084 93359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 95533 93425 gene locus_tag LOCUS_40300 95533 93425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 98909 95793 gene locus_tag LOCUS_40310 98909 95793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 101666 99180 gene locus_tag LOCUS_40320 101666 99180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 101577 101999 gene locus_tag LOCUS_40330 101577 101999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 102571 102008 gene locus_tag LOCUS_40340 102571 102008 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_40340 103806 102682 gene locus_tag LOCUS_40350 103806 102682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 104711 104046 gene locus_tag LOCUS_40360 104711 104046 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729800.1 protein_id gnl|my_center|LOCUS_40360 105091 104717 gene locus_tag LOCUS_40370 105091 104717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 105605 105108 gene locus_tag LOCUS_40380 105605 105108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 107172 105739 gene locus_tag LOCUS_40390 107172 105739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 107676 107248 gene locus_tag LOCUS_40400 107676 107248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 108436 107789 gene locus_tag LOCUS_40410 108436 107789 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_40410 109712 108459 gene locus_tag LOCUS_40420 109712 108459 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206548.1 protein_id gnl|my_center|LOCUS_40420 110866 109871 gene locus_tag LOCUS_40430 110866 109871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 111764 110895 gene locus_tag LOCUS_40440 111764 110895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 112405 111776 gene locus_tag LOCUS_40450 112405 111776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 >Feature sequence028 2850 3245 gene locus_tag LOCUS_40460 2850 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 3437 4417 gene locus_tag LOCUS_40470 3437 4417 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_40470 4646 5968 gene locus_tag LOCUS_40480 4646 5968 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_40480 6003 6944 gene locus_tag LOCUS_40490 6003 6944 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_40490 6991 7233 gene locus_tag LOCUS_40500 6991 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 7292 8044 gene locus_tag LOCUS_40510 7292 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 8172 10073 gene locus_tag LOCUS_40520 8172 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 10073 15019 gene locus_tag LOCUS_40530 10073 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 15016 16590 gene locus_tag LOCUS_40540 15016 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 16633 17445 gene locus_tag LOCUS_40550 16633 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 19369 17513 gene locus_tag LOCUS_40560 19369 17513 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_40560 21885 19516 gene locus_tag LOCUS_40570 21885 19516 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_40570 22384 21974 gene locus_tag LOCUS_40580 22384 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256827.1 protein_id gnl|my_center|LOCUS_40580 23329 22655 gene locus_tag LOCUS_40590 23329 22655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 24123 23425 gene locus_tag LOCUS_40600 24123 23425 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_40600 24745 24092 gene locus_tag LOCUS_40610 24745 24092 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_40610 25109 24837 gene locus_tag LOCUS_40620 25109 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 25006 27006 gene locus_tag LOCUS_40630 25006 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 27068 27640 gene locus_tag LOCUS_40640 27068 27640 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_40640 27763 28350 gene locus_tag LOCUS_40650 27763 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 28495 29442 gene locus_tag LOCUS_40660 28495 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 29593 30450 gene locus_tag LOCUS_40670 gene hbd 29593 30450 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_40670 30462 32291 gene locus_tag LOCUS_40680 30462 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 32409 34118 gene locus_tag LOCUS_40690 gene proS 32409 34118 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_40690 35624 34206 gene locus_tag LOCUS_40700 35624 34206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 36379 35621 gene locus_tag LOCUS_40710 36379 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 37446 36661 gene locus_tag LOCUS_40720 gene paaG 37446 36661 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_40720 37787 41620 gene locus_tag LOCUS_40730 37787 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 42603 41824 gene locus_tag LOCUS_40740 42603 41824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 43157 42600 gene locus_tag LOCUS_40750 43157 42600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 44497 43244 gene locus_tag LOCUS_40760 44497 43244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_40760 46362 44656 gene locus_tag LOCUS_40770 46362 44656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 47677 46409 gene locus_tag LOCUS_40780 47677 46409 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040769.1 protein_id gnl|my_center|LOCUS_40780 50114 47667 gene locus_tag LOCUS_40790 50114 47667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 50421 51329 gene locus_tag LOCUS_40800 50421 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 51396 53006 gene locus_tag LOCUS_40810 51396 53006 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_40810 53808 53008 gene locus_tag LOCUS_40820 53808 53008 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531023.1 protein_id gnl|my_center|LOCUS_40820 55069 53843 gene locus_tag LOCUS_40830 55069 53843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_40830 55199 57454 gene locus_tag LOCUS_40840 55199 57454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 57663 60974 gene locus_tag LOCUS_40850 57663 60974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_40850 61187 62080 gene locus_tag LOCUS_40860 61187 62080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 62167 63093 gene locus_tag LOCUS_40870 62167 63093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_40870 65732 63090 gene locus_tag LOCUS_40880 65732 63090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 66118 65798 gene locus_tag LOCUS_40890 66118 65798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 66303 67979 gene locus_tag LOCUS_40900 66303 67979 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_40900 68001 68843 gene locus_tag LOCUS_40910 gene prmC 68001 68843 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727D9 protein_id gnl|my_center|LOCUS_40910 69125 72766 gene locus_tag LOCUS_40920 69125 72766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 72820 73053 gene locus_tag LOCUS_40930 72820 73053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 73805 73167 gene locus_tag LOCUS_40940 73805 73167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404717.1 protein_id gnl|my_center|LOCUS_40940 74493 73894 gene locus_tag LOCUS_40950 74493 73894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 77011 74516 gene locus_tag LOCUS_40960 77011 74516 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_40960 77451 77011 gene locus_tag LOCUS_40970 77451 77011 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_40970 77646 78629 gene locus_tag LOCUS_40980 77646 78629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_40980 80395 78794 gene locus_tag LOCUS_40990 80395 78794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 82204 80603 gene locus_tag LOCUS_41000 82204 80603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 84350 82731 gene locus_tag LOCUS_41010 84350 82731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 87244 84551 gene locus_tag LOCUS_41020 87244 84551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 87430 87897 gene locus_tag LOCUS_41030 87430 87897 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709522.1 protein_id gnl|my_center|LOCUS_41030 87900 88271 gene locus_tag LOCUS_41040 87900 88271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 88352 88897 gene locus_tag LOCUS_41050 gene yceJ 88352 88897 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_41050 91961 89178 gene locus_tag LOCUS_41060 91961 89178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 92549 92121 gene locus_tag LOCUS_41070 92549 92121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_41070 92809 93153 gene locus_tag LOCUS_41080 92809 93153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 96418 93647 gene locus_tag LOCUS_41090 96418 93647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 99577 96809 gene locus_tag LOCUS_41100 99577 96809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 99940 100632 gene locus_tag LOCUS_41110 99940 100632 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868622.1 protein_id gnl|my_center|LOCUS_41110 100717 101709 gene locus_tag LOCUS_41120 100717 101709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 101714 102688 gene locus_tag LOCUS_41130 101714 102688 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810439.1 protein_id gnl|my_center|LOCUS_41130 103600 102821 gene locus_tag LOCUS_41140 103600 102821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 103775 105391 gene locus_tag LOCUS_41150 103775 105391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 105388 106062 gene locus_tag LOCUS_41160 105388 106062 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_41160 106363 106938 gene locus_tag LOCUS_41170 106363 106938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 108211 106964 gene locus_tag LOCUS_41180 108211 106964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence029 2632 854 gene locus_tag LOCUS_41190 2632 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 3307 2825 gene locus_tag LOCUS_41200 3307 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 5135 3381 gene locus_tag LOCUS_41210 5135 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 5758 5156 gene locus_tag LOCUS_41220 5758 5156 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_41220 8124 5755 gene locus_tag LOCUS_41230 8124 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 10182 8224 gene locus_tag LOCUS_41240 10182 8224 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_41240 10870 10172 gene locus_tag LOCUS_41250 10870 10172 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_41250 11293 11565 gene locus_tag LOCUS_41260 11293 11565 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_41260 12819 11728 gene locus_tag LOCUS_41270 12819 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226588.1 protein_id gnl|my_center|LOCUS_41270 14194 13046 gene locus_tag LOCUS_41280 14194 13046 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_41280 14438 14202 gene locus_tag LOCUS_41290 14438 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 15337 14480 gene locus_tag LOCUS_41300 gene paaH 15337 14480 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_41300 17474 15339 gene locus_tag LOCUS_41310 gene htpG 17474 15339 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64412 protein_id gnl|my_center|LOCUS_41310 17944 19860 gene locus_tag LOCUS_41320 17944 19860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 20297 21508 gene locus_tag LOCUS_41330 20297 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_41330 21519 23435 gene locus_tag LOCUS_41340 gene uup 21519 23435 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_41340 24422 23622 gene locus_tag LOCUS_41350 24422 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 25702 24548 gene locus_tag LOCUS_41360 25702 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 26135 26211 gene locus_tag LOCUS_t00300 26135 26211 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26534 28054 gene locus_tag LOCUS_41370 gene yclF 26534 28054 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_41370 30559 28136 gene locus_tag LOCUS_41380 30559 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_41380 61703 30621 gene locus_tag LOCUS_41390 61703 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 67650 62017 gene locus_tag LOCUS_41400 67650 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 68030 67689 gene locus_tag LOCUS_41410 68030 67689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 78711 68455 gene locus_tag LOCUS_41420 78711 68455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 83504 78708 gene locus_tag LOCUS_41430 83504 78708 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973246.1 protein_id gnl|my_center|LOCUS_41430 97016 83637 gene locus_tag LOCUS_41440 97016 83637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 100001 97029 gene locus_tag LOCUS_41450 100001 97029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 <107743 99919 gene locus_tag LOCUS_41460 <107743 99919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267817.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted >Feature sequence030 2659 998 gene locus_tag LOCUS_41470 2659 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 4600 2981 gene locus_tag LOCUS_41480 4600 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 6582 4837 gene locus_tag LOCUS_41490 6582 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 8592 6976 gene locus_tag LOCUS_41500 8592 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 10094 9144 gene locus_tag LOCUS_41510 10094 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 13008 10228 gene locus_tag LOCUS_41520 13008 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 15008 13089 gene locus_tag LOCUS_41530 gene speA 15008 13089 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_41530 15214 16191 gene locus_tag LOCUS_41540 15214 16191 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_41540 16225 16854 gene locus_tag LOCUS_41550 16225 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 17435 16869 gene locus_tag LOCUS_41560 17435 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 17599 18984 gene locus_tag LOCUS_41570 17599 18984 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861820.1 protein_id gnl|my_center|LOCUS_41570 19116 21479 gene locus_tag LOCUS_41580 19116 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_41580 21518 23872 gene locus_tag LOCUS_41590 21518 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_41590 24587 24904 gene locus_tag LOCUS_41600 24587 24904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 30652 24968 gene locus_tag LOCUS_41610 30652 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_41610 31315 30776 gene locus_tag LOCUS_41620 31315 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 32117 31368 gene locus_tag LOCUS_41630 32117 31368 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_41630 32399 34810 gene locus_tag LOCUS_41640 32399 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 35057 35971 gene locus_tag LOCUS_41650 35057 35971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 35978 36868 gene locus_tag LOCUS_41660 35978 36868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 37386 36880 gene locus_tag LOCUS_41670 37386 36880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 37635 37402 gene locus_tag LOCUS_41680 37635 37402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 37923 38780 gene locus_tag LOCUS_41690 37923 38780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 38777 39277 gene locus_tag LOCUS_41700 38777 39277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 40723 39443 gene locus_tag LOCUS_41710 40723 39443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 42050 40773 gene locus_tag LOCUS_41720 42050 40773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 43544 42165 gene locus_tag LOCUS_41730 gene pilR 43544 42165 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_41730 46424 43662 gene locus_tag LOCUS_41740 46424 43662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41740 48706 46700 gene locus_tag LOCUS_41750 48706 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 49882 49091 gene locus_tag LOCUS_41760 49882 49091 CDS product competence protein ComF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704303.1 protein_id gnl|my_center|LOCUS_41760 50114 50671 gene locus_tag LOCUS_41770 50114 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 51261 50683 gene locus_tag LOCUS_41780 51261 50683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 51453 51528 gene locus_tag LOCUS_t00310 51453 51528 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 52387 52157 gene locus_tag LOCUS_41790 52387 52157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 52726 53934 gene locus_tag LOCUS_41800 52726 53934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 55077 54016 gene locus_tag LOCUS_41810 55077 54016 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_41810 57411 55162 gene locus_tag LOCUS_41820 57411 55162 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123688.1 protein_id gnl|my_center|LOCUS_41820 57588 59459 gene locus_tag LOCUS_41830 57588 59459 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969331.1 protein_id gnl|my_center|LOCUS_41830 59788 63627 gene locus_tag LOCUS_41840 59788 63627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 65162 63654 gene locus_tag LOCUS_41850 65162 63654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 66537 65248 gene locus_tag LOCUS_41860 66537 65248 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_41860 67260 66541 gene locus_tag LOCUS_41870 67260 66541 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_41870 68282 67257 gene locus_tag LOCUS_41880 68282 67257 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 protein_id gnl|my_center|LOCUS_41880 68368 68967 gene locus_tag LOCUS_41890 68368 68967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_41890 70264 68972 gene locus_tag LOCUS_41900 gene dctM 70264 68972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103397.1 protein_id gnl|my_center|LOCUS_41900 70836 70261 gene locus_tag LOCUS_41910 70836 70261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 70858 72093 gene locus_tag LOCUS_41920 gene galK 70858 72093 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB97 protein_id gnl|my_center|LOCUS_41920 72510 72172 gene locus_tag LOCUS_41930 72510 72172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 72828 75218 gene locus_tag LOCUS_41940 72828 75218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 75309 75530 gene locus_tag LOCUS_41950 75309 75530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 75527 75982 gene locus_tag LOCUS_41960 75527 75982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41960 77266 76064 gene locus_tag LOCUS_41970 77266 76064 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_41970 80114 77625 gene locus_tag LOCUS_41980 80114 77625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_41980 80362 81279 gene locus_tag LOCUS_41990 80362 81279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101696.1 protein_id gnl|my_center|LOCUS_41990 82431 81385 gene locus_tag LOCUS_42000 82431 81385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 83370 82591 gene locus_tag LOCUS_42010 83370 82591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 83512 84339 gene locus_tag LOCUS_42020 83512 84339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 84471 86879 gene locus_tag LOCUS_42030 84471 86879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_42030 88447 87050 gene locus_tag LOCUS_42040 88447 87050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_42040 90237 88495 gene locus_tag LOCUS_42050 90237 88495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_42050 90638 92896 gene locus_tag LOCUS_42060 90638 92896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 93208 95832 gene locus_tag LOCUS_42070 93208 95832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 97265 95901 gene locus_tag LOCUS_42080 97265 95901 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_42080 98857 97265 gene locus_tag LOCUS_42090 98857 97265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 100587 98854 gene locus_tag LOCUS_42100 100587 98854 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_42100 100926 100591 gene locus_tag LOCUS_42110 100926 100591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 100853 102613 gene locus_tag LOCUS_42120 100853 102613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 102635 103738 gene locus_tag LOCUS_42130 102635 103738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence031 626 264 gene locus_tag LOCUS_42140 626 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 1321 689 gene locus_tag LOCUS_42150 1321 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 1537 3360 gene locus_tag LOCUS_42160 1537 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 3357 5618 gene locus_tag LOCUS_42170 3357 5618 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_42170 6060 5659 gene locus_tag LOCUS_42180 6060 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 6301 6020 gene locus_tag LOCUS_42190 6301 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6372 9488 gene locus_tag LOCUS_42200 6372 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 9485 9676 gene locus_tag LOCUS_42210 9485 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 9725 10120 gene locus_tag LOCUS_42220 9725 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 10644 10138 gene locus_tag LOCUS_42230 10644 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 11952 10714 gene locus_tag LOCUS_42240 gene gdhA 11952 10714 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_42240 12330 14642 gene locus_tag LOCUS_42250 12330 14642 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 protein_id gnl|my_center|LOCUS_42250 16669 14861 gene locus_tag LOCUS_42260 16669 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 18675 16696 gene locus_tag LOCUS_42270 18675 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 18930 19586 gene locus_tag LOCUS_42280 18930 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 19808 21685 gene locus_tag LOCUS_42290 19808 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 21682 23364 gene locus_tag LOCUS_42300 21682 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 25414 23369 gene locus_tag LOCUS_42310 gene shc 25414 23369 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_42310 26277 25411 gene locus_tag LOCUS_42320 26277 25411 CDS product beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_42320 27955 26237 gene locus_tag LOCUS_42330 27955 26237 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_42330 28893 27952 gene locus_tag LOCUS_42340 28893 27952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 29399 28890 gene locus_tag LOCUS_42350 29399 28890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 30558 29428 gene locus_tag LOCUS_42360 30558 29428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_42360 30794 30555 gene locus_tag LOCUS_42370 30794 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 31270 30794 gene locus_tag LOCUS_42380 gene gcvH 31270 30794 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B07 protein_id gnl|my_center|LOCUS_42380 32565 31285 gene locus_tag LOCUS_42390 gene iscS 32565 31285 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_42390 33845 32565 gene locus_tag LOCUS_42400 33845 32565 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_42400 34184 37180 gene locus_tag LOCUS_42410 34184 37180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 37429 38031 gene locus_tag LOCUS_42420 37429 38031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 38092 39075 gene locus_tag LOCUS_42430 38092 39075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 39068 40336 gene locus_tag LOCUS_42440 39068 40336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 40750 40511 gene locus_tag LOCUS_42450 40750 40511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 41130 40876 gene locus_tag LOCUS_42460 41130 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 41493 42755 gene locus_tag LOCUS_42470 41493 42755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 43638 42784 gene locus_tag LOCUS_42480 43638 42784 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_42480 44789 43635 gene locus_tag LOCUS_42490 44789 43635 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405558.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42490 45180 47189 gene locus_tag LOCUS_42500 45180 47189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 47661 47254 gene locus_tag LOCUS_42510 47661 47254 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309882.1 protein_id gnl|my_center|LOCUS_42510 47904 50612 gene locus_tag LOCUS_42520 47904 50612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 50642 51118 gene locus_tag LOCUS_42530 50642 51118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 52509 51241 gene locus_tag LOCUS_42540 52509 51241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 52771 53361 gene locus_tag LOCUS_42550 52771 53361 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_42550 53370 55904 gene locus_tag LOCUS_42560 53370 55904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 56180 56376 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgacgttgccgtcgggctcgatctc 57128 58537 gene locus_tag LOCUS_42570 57128 58537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 58693 61878 gene locus_tag LOCUS_42580 58693 61878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 62627 62007 gene locus_tag LOCUS_42590 62627 62007 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_42590 62866 65244 gene locus_tag LOCUS_42600 62866 65244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 65255 65782 gene locus_tag LOCUS_42610 65255 65782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 67219 65864 gene locus_tag LOCUS_42620 67219 65864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 67806 67216 gene locus_tag LOCUS_42630 67806 67216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 69157 67967 gene locus_tag LOCUS_42640 69157 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870119.1 protein_id gnl|my_center|LOCUS_42640 70827 69358 gene locus_tag LOCUS_42650 70827 69358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 71621 70881 gene locus_tag LOCUS_42660 71621 70881 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_42660 71838 73088 gene locus_tag LOCUS_42670 71838 73088 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_42670 73149 73224 gene locus_tag LOCUS_t00320 73149 73224 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 73828 73376 gene locus_tag LOCUS_42680 73828 73376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 74941 73901 gene locus_tag LOCUS_42690 74941 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 75119 76537 gene locus_tag LOCUS_42700 75119 76537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 78417 76534 gene locus_tag LOCUS_42710 78417 76534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 79828 78428 gene locus_tag LOCUS_42720 79828 78428 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531150.1 protein_id gnl|my_center|LOCUS_42720 80028 80660 gene locus_tag LOCUS_42730 80028 80660 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_42730 81431 80688 gene locus_tag LOCUS_42740 81431 80688 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_42740 81624 81968 gene locus_tag LOCUS_42750 81624 81968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_42750 84122 82041 gene locus_tag LOCUS_42760 84122 82041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_42760 84608 90013 gene locus_tag LOCUS_42770 84608 90013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 92234 90195 gene locus_tag LOCUS_42780 92234 90195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 92419 92982 gene locus_tag LOCUS_42790 92419 92982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 93003 93557 gene locus_tag LOCUS_42800 93003 93557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 93578 95308 gene locus_tag LOCUS_42810 93578 95308 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_42810 95317 95844 gene locus_tag LOCUS_42820 95317 95844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 95860 96765 gene locus_tag LOCUS_42830 95860 96765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 96868 98130 gene locus_tag LOCUS_42840 96868 98130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 99695 98115 gene locus_tag LOCUS_42850 99695 98115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 101497 99692 gene locus_tag LOCUS_42860 101497 99692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 102674 101616 gene locus_tag LOCUS_42870 102674 101616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 <104015 102855 gene locus_tag LOCUS_42880 <104015 102855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038579.1:aminopeptidase >Feature sequence032 5597 10954 gene locus_tag LOCUS_42890 5597 10954 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228023.1 protein_id gnl|my_center|LOCUS_42890 11481 11203 gene locus_tag LOCUS_42900 11481 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 11587 11805 gene locus_tag LOCUS_42910 11587 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 12387 11809 gene locus_tag LOCUS_42920 12387 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700774.1 protein_id gnl|my_center|LOCUS_42920 13349 12384 gene locus_tag LOCUS_42930 13349 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 14188 13346 gene locus_tag LOCUS_42940 14188 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 14727 14185 gene locus_tag LOCUS_42950 14727 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 15478 14834 gene locus_tag LOCUS_42960 15478 14834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484031.1 protein_id gnl|my_center|LOCUS_42960 15681 16946 gene locus_tag LOCUS_42970 15681 16946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962613.1 protein_id gnl|my_center|LOCUS_42970 17164 18513 gene locus_tag LOCUS_42980 gene gdhA 17164 18513 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_42980 18660 21677 gene locus_tag LOCUS_42990 18660 21677 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_42990 21927 22853 gene locus_tag LOCUS_43000 21927 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_43000 23720 22875 gene locus_tag LOCUS_43010 23720 22875 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 protein_id gnl|my_center|LOCUS_43010 23972 27322 gene locus_tag LOCUS_43020 23972 27322 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_43020 27552 28859 gene locus_tag LOCUS_43030 27552 28859 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_43030 28950 29345 gene locus_tag LOCUS_43040 28950 29345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 29555 31987 gene locus_tag LOCUS_43050 29555 31987 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 protein_id gnl|my_center|LOCUS_43050 32027 33778 gene locus_tag LOCUS_43060 32027 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 35163 33814 gene locus_tag LOCUS_43070 35163 33814 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088318.1 protein_id gnl|my_center|LOCUS_43070 35625 35191 gene locus_tag LOCUS_43080 gene vapC39 35625 35191 CDS product ribonuclease VapC39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF63 protein_id gnl|my_center|LOCUS_43080 35861 35622 gene locus_tag LOCUS_43090 35861 35622 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412749.1 protein_id gnl|my_center|LOCUS_43090 37239 35935 gene locus_tag LOCUS_43100 37239 35935 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 protein_id gnl|my_center|LOCUS_43100 38765 37305 gene locus_tag LOCUS_43110 38765 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 40244 39060 gene locus_tag LOCUS_43120 40244 39060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 41209 40451 gene locus_tag LOCUS_43130 41209 40451 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_43130 42393 41221 gene locus_tag LOCUS_43140 42393 41221 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_43140 42953 42408 gene locus_tag LOCUS_43150 42953 42408 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_43150 45077 43023 gene locus_tag LOCUS_43160 45077 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 46330 45155 gene locus_tag LOCUS_43170 gene degP 46330 45155 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_43170 49604 46434 gene locus_tag LOCUS_43180 49604 46434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 49929 49678 gene locus_tag LOCUS_43190 49929 49678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 50702 49926 gene locus_tag LOCUS_43200 50702 49926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_43200 51276 50845 gene locus_tag LOCUS_43210 51276 50845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 53442 51382 gene locus_tag LOCUS_43220 53442 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_43220 54192 53473 gene locus_tag LOCUS_43230 54192 53473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 56794 54326 gene locus_tag LOCUS_43240 56794 54326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 58357 57011 gene locus_tag LOCUS_43250 58357 57011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 58768 59913 gene locus_tag LOCUS_43260 58768 59913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 59977 60918 gene locus_tag LOCUS_43270 59977 60918 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_43270 64226 61035 gene locus_tag LOCUS_43280 64226 61035 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_43280 67865 64239 gene locus_tag LOCUS_43290 67865 64239 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_43290 69142 67862 gene locus_tag LOCUS_43300 gene czcB 69142 67862 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_43300 70652 69477 gene locus_tag LOCUS_43310 70652 69477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 71478 70633 gene locus_tag LOCUS_43320 71478 70633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 75041 71565 gene locus_tag LOCUS_43330 gene mfd 75041 71565 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_43330 75423 75076 gene locus_tag LOCUS_43340 75423 75076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 76721 75420 gene locus_tag LOCUS_43350 gene eno 76721 75420 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEL5 protein_id gnl|my_center|LOCUS_43350 77030 77106 gene locus_tag LOCUS_t00330 77030 77106 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77220 77888 gene locus_tag LOCUS_43360 gene bplG 77220 77888 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_43360 78242 80191 gene locus_tag LOCUS_43370 78242 80191 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510922.1 protein_id gnl|my_center|LOCUS_43370 80281 81276 gene locus_tag LOCUS_43380 80281 81276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 81294 84308 gene locus_tag LOCUS_43390 81294 84308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 84305 85465 gene locus_tag LOCUS_43400 84305 85465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 85739 87451 gene locus_tag LOCUS_43410 85739 87451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 87448 89655 gene locus_tag LOCUS_43420 87448 89655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 89652 90848 gene locus_tag LOCUS_43430 89652 90848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 91274 90873 gene locus_tag LOCUS_43440 91274 90873 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143787.1 protein_id gnl|my_center|LOCUS_43440 91498 91271 gene locus_tag LOCUS_43450 91498 91271 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NES9 protein_id gnl|my_center|LOCUS_43450 97610 91566 gene locus_tag LOCUS_43460 97610 91566 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_43460 98278 99144 gene locus_tag LOCUS_43470 98278 99144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 100944 99151 gene locus_tag LOCUS_43480 100944 99151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 102554 101079 gene locus_tag LOCUS_43490 102554 101079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 102498 102809 gene locus_tag LOCUS_43500 102498 102809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 >Feature sequence033 2199 2645 gene locus_tag LOCUS_43510 2199 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_43510 4913 2586 gene locus_tag LOCUS_43520 4913 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 7065 5107 gene locus_tag LOCUS_43530 7065 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 7701 7129 gene locus_tag LOCUS_43540 7701 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 8240 7698 gene locus_tag LOCUS_43550 8240 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 9871 9470 gene locus_tag LOCUS_43560 9871 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 13210 9902 gene locus_tag LOCUS_43570 13210 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 13781 13203 gene locus_tag LOCUS_43580 13781 13203 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_43580 14078 14677 gene locus_tag LOCUS_43590 14078 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 14757 18839 gene locus_tag LOCUS_43600 14757 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 21501 18865 gene locus_tag LOCUS_43610 21501 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204961.1 protein_id gnl|my_center|LOCUS_43610 22289 21498 gene locus_tag LOCUS_43620 22289 21498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_43620 23605 22436 gene locus_tag LOCUS_43630 23605 22436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 23793 24584 gene locus_tag LOCUS_43640 23793 24584 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088800.1 protein_id gnl|my_center|LOCUS_43640 24625 25452 gene locus_tag LOCUS_43650 24625 25452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 26247 25540 gene locus_tag LOCUS_43660 26247 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 26562 29651 gene locus_tag LOCUS_43670 26562 29651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 29726 30658 gene locus_tag LOCUS_43680 29726 30658 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_43680 31000 31755 gene locus_tag LOCUS_43690 31000 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 31914 32267 gene locus_tag LOCUS_43700 31914 32267 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_43700 32301 32696 gene locus_tag LOCUS_43710 32301 32696 CDS product protein PhaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405395.1 protein_id gnl|my_center|LOCUS_43710 32707 34089 gene locus_tag LOCUS_43720 32707 34089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 34667 35902 gene locus_tag LOCUS_43730 34667 35902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 35939 36433 gene locus_tag LOCUS_43740 35939 36433 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_43740 36642 36481 gene locus_tag LOCUS_43750 36642 36481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 36846 37526 gene locus_tag LOCUS_43760 36846 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 37545 38414 gene locus_tag LOCUS_43770 37545 38414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 38459 41212 gene locus_tag LOCUS_43780 38459 41212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 45591 41536 gene locus_tag LOCUS_43790 45591 41536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 45836 47464 gene locus_tag LOCUS_43800 45836 47464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 47505 50408 gene locus_tag LOCUS_43810 47505 50408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 50421 51749 gene locus_tag LOCUS_43820 50421 51749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 52230 51808 gene locus_tag LOCUS_43830 52230 51808 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_43830 52484 52227 gene locus_tag LOCUS_43840 52484 52227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 54874 52577 gene locus_tag LOCUS_43850 54874 52577 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_43850 55279 57129 gene locus_tag LOCUS_43860 55279 57129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118523.1 protein_id gnl|my_center|LOCUS_43860 57369 57731 gene locus_tag LOCUS_43870 57369 57731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 57817 58662 gene locus_tag LOCUS_43880 57817 58662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 58731 59612 gene locus_tag LOCUS_43890 58731 59612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 59609 60463 gene locus_tag LOCUS_43900 59609 60463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 63313 60494 gene locus_tag LOCUS_43910 63313 60494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 63717 65480 gene locus_tag LOCUS_43920 63717 65480 CDS product putative protease IV SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704518.1 protein_id gnl|my_center|LOCUS_43920 65763 66233 gene locus_tag LOCUS_43930 65763 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 66658 67599 gene locus_tag LOCUS_43940 gene prsA 66658 67599 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_43940 67734 68384 gene locus_tag LOCUS_43950 gene rplY 67734 68384 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1W2 protein_id gnl|my_center|LOCUS_43950 68391 68999 gene locus_tag LOCUS_43960 gene pth 68391 68999 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181A2 protein_id gnl|my_center|LOCUS_43960 69126 71183 gene locus_tag LOCUS_43970 69126 71183 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_43970 71483 71866 gene locus_tag LOCUS_43980 gene rpsF 71483 71866 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG2 protein_id gnl|my_center|LOCUS_43980 71871 72101 gene locus_tag LOCUS_43990 gene rpsR 71871 72101 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQP6 protein_id gnl|my_center|LOCUS_43990 72118 72582 gene locus_tag LOCUS_44000 gene rplI 72118 72582 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGF0 protein_id gnl|my_center|LOCUS_44000 72719 73987 gene locus_tag LOCUS_44010 72719 73987 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877560.1 protein_id gnl|my_center|LOCUS_44010 74041 75027 gene locus_tag LOCUS_44020 74041 75027 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_44020 75252 76091 gene locus_tag LOCUS_44030 75252 76091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 77004 76102 gene locus_tag LOCUS_44040 77004 76102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_44040 78065 77001 gene locus_tag LOCUS_44050 78065 77001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_44050 79091 78105 gene locus_tag LOCUS_44060 79091 78105 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_44060 80845 79088 gene locus_tag LOCUS_44070 80845 79088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 81873 80842 gene locus_tag LOCUS_44080 81873 80842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_44080 82236 83477 gene locus_tag LOCUS_44090 82236 83477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 83878 84170 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgccgccaccggaggtctcggc 85525 84788 gene locus_tag LOCUS_44100 85525 84788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 86877 85624 gene locus_tag LOCUS_44110 86877 85624 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090664.1 protein_id gnl|my_center|LOCUS_44110 87930 86980 gene locus_tag LOCUS_44120 87930 86980 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_44120 88149 89084 gene locus_tag LOCUS_44130 88149 89084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 91376 89433 gene locus_tag LOCUS_44140 91376 89433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 91646 92104 gene locus_tag LOCUS_44150 91646 92104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 92443 95010 gene locus_tag LOCUS_44160 92443 95010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 >Feature sequence034 224 1813 gene locus_tag LOCUS_44170 224 1813 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_44170 2052 2711 gene locus_tag LOCUS_44180 gene phoU 2052 2711 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_44180 2737 3489 gene locus_tag LOCUS_44190 gene phoB 2737 3489 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_44190 3615 5495 gene locus_tag LOCUS_44200 gene phoR 3615 5495 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_44200 6021 6707 gene locus_tag LOCUS_44210 gene oprG 6021 6707 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_44210 7090 7449 gene locus_tag LOCUS_44220 7090 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44220 7542 9410 gene locus_tag LOCUS_44230 gene ccoI 7542 9410 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44230 9407 9568 gene locus_tag LOCUS_44240 9407 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 9616 11802 gene locus_tag LOCUS_44250 gene ccoN/ccoO 9616 11802 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_44250 11799 11996 gene locus_tag LOCUS_44260 11799 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 11989 12636 gene locus_tag LOCUS_44270 11989 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 12658 14127 gene locus_tag LOCUS_44280 gene ccoG 12658 14127 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_44280 14124 14588 gene locus_tag LOCUS_44290 gene ccoH 14124 14588 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_44290 14730 15428 gene locus_tag LOCUS_44300 14730 15428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_44300 17316 15439 gene locus_tag LOCUS_44310 17316 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 18018 17455 gene locus_tag LOCUS_44320 18018 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 18822 18034 gene locus_tag LOCUS_44330 18822 18034 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_44330 19447 18965 gene locus_tag LOCUS_44340 19447 18965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 20081 19527 gene locus_tag LOCUS_44350 20081 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 21016 20219 gene locus_tag LOCUS_44360 21016 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 22161 21016 gene locus_tag LOCUS_44370 22161 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 22384 24546 gene locus_tag LOCUS_44380 22384 24546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 protein_id gnl|my_center|LOCUS_44380 25814 24960 gene locus_tag LOCUS_44390 25814 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 protein_id gnl|my_center|LOCUS_44390 28210 25811 gene locus_tag LOCUS_44400 28210 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 28875 28207 gene locus_tag LOCUS_44410 28875 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 30911 28956 gene locus_tag LOCUS_44420 30911 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_44420 31861 31454 gene locus_tag LOCUS_44430 31861 31454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 33911 32145 gene locus_tag LOCUS_44440 33911 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 35997 34252 gene locus_tag LOCUS_44450 35997 34252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 36438 38285 gene locus_tag LOCUS_44460 gene fadD 36438 38285 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_44460 38577 38888 gene locus_tag LOCUS_44470 38577 38888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 40212 38911 gene locus_tag LOCUS_44480 40212 38911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 41527 40346 gene locus_tag LOCUS_44490 41527 40346 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_44490 41703 42620 gene locus_tag LOCUS_44500 41703 42620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 42611 44539 gene locus_tag LOCUS_44510 42611 44539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 44595 45497 gene locus_tag LOCUS_44520 44595 45497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 45651 46931 gene locus_tag LOCUS_44530 45651 46931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 47832 46960 gene locus_tag LOCUS_44540 47832 46960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 49109 47829 gene locus_tag LOCUS_44550 49109 47829 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_44550 50252 49242 gene locus_tag LOCUS_44560 gene icd 50252 49242 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_44560 51501 50398 gene locus_tag LOCUS_44570 51501 50398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 54567 51523 gene locus_tag LOCUS_44580 54567 51523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 55333 54572 gene locus_tag LOCUS_44590 gene rnhB 55333 54572 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIH1 protein_id gnl|my_center|LOCUS_44590 55795 55448 gene locus_tag LOCUS_44600 gene rplS 55795 55448 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 protein_id gnl|my_center|LOCUS_44600 56741 55977 gene locus_tag LOCUS_44610 gene trmD 56741 55977 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG3 protein_id gnl|my_center|LOCUS_44610 57307 56723 gene locus_tag LOCUS_44620 gene rimM 57307 56723 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV5 protein_id gnl|my_center|LOCUS_44620 57509 57282 gene locus_tag LOCUS_44630 57509 57282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 58021 57608 gene locus_tag LOCUS_44640 58021 57608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 59574 58171 gene locus_tag LOCUS_44650 gene ffh 59574 58171 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV8 protein_id gnl|my_center|LOCUS_44650 59869 61350 gene locus_tag LOCUS_44660 59869 61350 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_44660 61675 62571 gene locus_tag LOCUS_44670 61675 62571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 63384 62743 gene locus_tag LOCUS_44680 63384 62743 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_44680 64183 63395 gene locus_tag LOCUS_44690 64183 63395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 66932 64269 gene locus_tag LOCUS_44700 gene alaS 66932 64269 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0B3 protein_id gnl|my_center|LOCUS_44700 67658 67188 gene locus_tag LOCUS_44710 gene recX 67658 67188 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_44710 68887 67700 gene locus_tag LOCUS_44720 gene pilT-1 68887 67700 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_44720 70359 69193 gene locus_tag LOCUS_44730 70359 69193 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_44730 71396 70668 gene locus_tag LOCUS_44740 71396 70668 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR8 protein_id gnl|my_center|LOCUS_44740 72340 71393 gene locus_tag LOCUS_44750 72340 71393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 73458 72340 gene locus_tag LOCUS_44760 gene dnaJ 73458 72340 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_44760 75387 73624 gene locus_tag LOCUS_44770 gene dnaK 75387 73624 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_44770 76286 75507 gene locus_tag LOCUS_44780 76286 75507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 77458 76382 gene locus_tag LOCUS_44790 gene hrcA 77458 76382 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_44790 77784 78674 gene locus_tag LOCUS_44800 77784 78674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 78730 80058 gene locus_tag LOCUS_44810 78730 80058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 80219 80731 gene locus_tag LOCUS_44820 gene nrdR 80219 80731 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6W9 protein_id gnl|my_center|LOCUS_44820 80742 83195 gene locus_tag LOCUS_44830 gene lon 80742 83195 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_44830 83232 84281 gene locus_tag LOCUS_44840 gene thiL 83232 84281 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHG6 protein_id gnl|my_center|LOCUS_44840 84978 84337 gene locus_tag LOCUS_44850 84978 84337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 88719 85408 gene locus_tag LOCUS_44860 88719 85408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 90032 88704 gene locus_tag LOCUS_44870 gene aroA 90032 88704 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB0 protein_id gnl|my_center|LOCUS_44870 92054 90090 gene locus_tag LOCUS_44880 92054 90090 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_44880 93052 92177 gene locus_tag LOCUS_44890 93052 92177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 93283 94518 gene locus_tag LOCUS_44900 93283 94518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 94598 95404 gene locus_tag LOCUS_44910 gene thiG 94598 95404 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_44910 95495 95571 gene locus_tag LOCUS_t00340 95495 95571 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 4065 2914 gene locus_tag LOCUS_44920 4065 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 4666 4190 gene locus_tag LOCUS_44930 4666 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 5187 4666 gene locus_tag LOCUS_44940 5187 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5475 6155 gene locus_tag LOCUS_44950 5475 6155 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_44950 6187 6399 gene locus_tag LOCUS_44960 6187 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 6403 6807 gene locus_tag LOCUS_44970 gene vapC 6403 6807 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCS9 protein_id gnl|my_center|LOCUS_44970 6798 7739 gene locus_tag LOCUS_44980 6798 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44980 7736 8827 gene locus_tag LOCUS_44990 7736 8827 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_44990 8918 10519 gene locus_tag LOCUS_45000 8918 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 10539 11342 gene locus_tag LOCUS_45010 10539 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45010 11339 12190 gene locus_tag LOCUS_45020 11339 12190 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031752.1 protein_id gnl|my_center|LOCUS_45020 12187 13224 gene locus_tag LOCUS_45030 12187 13224 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_45030 13221 14243 gene locus_tag LOCUS_45040 gene oppC 13221 14243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880981.1 protein_id gnl|my_center|LOCUS_45040 14301 16142 gene locus_tag LOCUS_45050 gene oppA 14301 16142 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_45050 16157 16738 gene locus_tag LOCUS_45060 16157 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 16879 19758 gene locus_tag LOCUS_45070 16879 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 19887 20555 gene locus_tag LOCUS_45080 19887 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 20618 22048 gene locus_tag LOCUS_45090 20618 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 22522 24024 gene locus_tag LOCUS_45100 22522 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 31157 24039 gene locus_tag LOCUS_45110 31157 24039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 31304 32872 gene locus_tag LOCUS_45120 31304 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 32882 38506 gene locus_tag LOCUS_45130 32882 38506 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141952.1 protein_id gnl|my_center|LOCUS_45130 38769 39953 gene locus_tag LOCUS_45140 38769 39953 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229252.1 protein_id gnl|my_center|LOCUS_45140 39995 40963 gene locus_tag LOCUS_45150 39995 40963 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_45150 41194 41604 gene locus_tag LOCUS_45160 41194 41604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 41604 43130 gene locus_tag LOCUS_45170 41604 43130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 44739 43270 gene locus_tag LOCUS_45180 44739 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 44955 45509 gene locus_tag LOCUS_45190 44955 45509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 45506 49525 gene locus_tag LOCUS_45200 45506 49525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 49803 50891 gene locus_tag LOCUS_45210 49803 50891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 50891 54136 gene locus_tag LOCUS_45220 50891 54136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 56334 54277 gene locus_tag LOCUS_45230 56334 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 57168 56440 gene locus_tag LOCUS_45240 57168 56440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 57317 58246 gene locus_tag LOCUS_45250 57317 58246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 58243 59298 gene locus_tag LOCUS_45260 58243 59298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 59379 61934 gene locus_tag LOCUS_45270 59379 61934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 63280 61931 gene locus_tag LOCUS_45280 63280 61931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 63974 63312 gene locus_tag LOCUS_45290 63974 63312 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_45290 64230 66233 gene locus_tag LOCUS_45300 64230 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 69965 66330 gene locus_tag LOCUS_45310 69965 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 70574 69972 gene locus_tag LOCUS_45320 70574 69972 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_45320 70820 71716 gene locus_tag LOCUS_45330 70820 71716 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_45330 71729 75373 gene locus_tag LOCUS_45340 71729 75373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_45340 76269 75385 gene locus_tag LOCUS_45350 76269 75385 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_45350 76656 79988 gene locus_tag LOCUS_45360 76656 79988 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_45360 80905 80060 gene locus_tag LOCUS_45370 80905 80060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 83777 80943 gene locus_tag LOCUS_45380 83777 80943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 84494 83808 gene locus_tag LOCUS_45390 84494 83808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 84607 85419 gene locus_tag LOCUS_45400 84607 85419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 86181 85432 gene locus_tag LOCUS_45410 86181 85432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 86123 86362 gene locus_tag LOCUS_45420 86123 86362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 88671 86488 gene locus_tag LOCUS_45430 88671 86488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 89772 88708 gene locus_tag LOCUS_45440 gene rfbG 89772 88708 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_45440 89889 91364 gene locus_tag LOCUS_45450 89889 91364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_45450 91361 92161 gene locus_tag LOCUS_45460 91361 92161 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH1 protein_id gnl|my_center|LOCUS_45460 >Feature sequence036 4074 4988 gene locus_tag LOCUS_45470 4074 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 4994 6493 gene locus_tag LOCUS_45480 4994 6493 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_45480 7525 6674 gene locus_tag LOCUS_45490 7525 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 7812 7615 gene locus_tag LOCUS_45500 7812 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 9863 7863 gene locus_tag LOCUS_45510 9863 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 12123 9868 gene locus_tag LOCUS_45520 12123 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 12448 13062 gene locus_tag LOCUS_45530 12448 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 15207 13072 gene locus_tag LOCUS_45540 15207 13072 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706924.1 protein_id gnl|my_center|LOCUS_45540 16282 15221 gene locus_tag LOCUS_45550 16282 15221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122798.1 protein_id gnl|my_center|LOCUS_45550 17262 16282 gene locus_tag LOCUS_45560 gene moxR 17262 16282 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123485.1 protein_id gnl|my_center|LOCUS_45560 18005 17379 gene locus_tag LOCUS_45570 18005 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 20323 18176 gene locus_tag LOCUS_45580 20323 18176 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037547.1 protein_id gnl|my_center|LOCUS_45580 21612 20392 gene locus_tag LOCUS_45590 21612 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 22949 21609 gene locus_tag LOCUS_45600 22949 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 23890 22949 gene locus_tag LOCUS_45610 23890 22949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_45610 24274 24047 gene locus_tag LOCUS_45620 24274 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 24724 24281 gene locus_tag LOCUS_45630 24724 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45630 26845 24728 gene locus_tag LOCUS_45640 26845 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 27059 28240 gene locus_tag LOCUS_45650 27059 28240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 28227 29702 gene locus_tag LOCUS_45660 28227 29702 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_45660 30032 30511 gene locus_tag LOCUS_45670 30032 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 30630 31442 gene locus_tag LOCUS_45680 30630 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 31978 31451 gene locus_tag LOCUS_45690 31978 31451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 32436 31975 gene locus_tag LOCUS_45700 32436 31975 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_45700 32696 34438 gene locus_tag LOCUS_45710 32696 34438 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_45710 36386 34446 gene locus_tag LOCUS_45720 36386 34446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 38152 36386 gene locus_tag LOCUS_45730 38152 36386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 40132 38384 gene locus_tag LOCUS_45740 40132 38384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 40860 40129 gene locus_tag LOCUS_45750 40860 40129 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_45750 44533 40970 gene locus_tag LOCUS_45760 44533 40970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 44714 46093 gene locus_tag LOCUS_45770 44714 46093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 47330 46044 gene locus_tag LOCUS_45780 47330 46044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 48671 47478 gene locus_tag LOCUS_45790 48671 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 49534 48668 gene locus_tag LOCUS_45800 49534 48668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 50701 49691 gene locus_tag LOCUS_45810 50701 49691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_45810 51137 51808 gene locus_tag LOCUS_45820 51137 51808 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_45820 51801 53090 gene locus_tag LOCUS_45830 51801 53090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 53354 54676 gene locus_tag LOCUS_45840 53354 54676 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_45840 54736 56364 gene locus_tag LOCUS_45850 54736 56364 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_45850 57007 56914 gene locus_tag LOCUS_t00350 57007 56914 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 57350 58486 gene locus_tag LOCUS_45860 gene menC 57350 58486 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34514 protein_id gnl|my_center|LOCUS_45860 58498 60420 gene locus_tag LOCUS_45870 58498 60420 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_45870 62028 60592 gene locus_tag LOCUS_45880 gene cls 62028 60592 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_45880 62483 62052 gene locus_tag LOCUS_45890 62483 62052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 63517 62480 gene locus_tag LOCUS_45900 63517 62480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 65776 64133 gene locus_tag LOCUS_45910 gene groL 65776 64133 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_45910 66145 65858 gene locus_tag LOCUS_45920 gene groES1 66145 65858 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1D4 protein_id gnl|my_center|LOCUS_45920 67663 66428 gene locus_tag LOCUS_45930 gene ribA 67663 66428 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_45930 68709 67792 gene locus_tag LOCUS_45940 68709 67792 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_45940 69005 68706 gene locus_tag LOCUS_45950 69005 68706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 70689 69235 gene locus_tag LOCUS_45960 gene hemN 70689 69235 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67886 protein_id gnl|my_center|LOCUS_45960 71839 70760 gene locus_tag LOCUS_45970 71839 70760 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_45970 72272 71871 gene locus_tag LOCUS_45980 gene erpA 72272 71871 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45344 protein_id gnl|my_center|LOCUS_45980 72300 73103 gene locus_tag LOCUS_45990 72300 73103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_45990 73532 73855 gene locus_tag LOCUS_46000 73532 73855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 73970 74046 gene locus_tag LOCUS_t00360 73970 74046 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 74053 74129 gene locus_tag LOCUS_t00370 74053 74129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 74351 76285 gene locus_tag LOCUS_46010 gene thrS 74351 76285 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L8 protein_id gnl|my_center|LOCUS_46010 76379 76570 gene locus_tag LOCUS_46020 76379 76570 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_46020 76688 77053 gene locus_tag LOCUS_46030 gene rplT 76688 77053 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_46030 77071 78120 gene locus_tag LOCUS_46040 gene pheS 77071 78120 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D00 protein_id gnl|my_center|LOCUS_46040 78124 80187 gene locus_tag LOCUS_46050 gene pheT 78124 80187 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817I7 protein_id gnl|my_center|LOCUS_46050 80193 80471 gene locus_tag LOCUS_46060 80193 80471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 80783 81088 gene locus_tag LOCUS_46070 80783 81088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 81463 83028 gene locus_tag LOCUS_46080 81463 83028 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_46080 83028 83834 gene locus_tag LOCUS_46090 83028 83834 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_46090 84057 85169 gene locus_tag LOCUS_46100 84057 85169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 85314 86570 gene locus_tag LOCUS_46110 85314 86570 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_46110 86617 86934 gene locus_tag LOCUS_46120 86617 86934 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_46120 86985 87536 gene locus_tag LOCUS_46130 86985 87536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_46130 87675 89003 gene locus_tag LOCUS_46140 87675 89003 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_46140 89034 89486 gene locus_tag LOCUS_46150 89034 89486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 89918 89595 gene locus_tag LOCUS_46160 89918 89595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 92323 90236 gene locus_tag LOCUS_46170 92323 90236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 93242 92844 gene locus_tag LOCUS_46180 93242 92844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 >Feature sequence037 10252 8651 gene locus_tag LOCUS_46190 gene hutH 10252 8651 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA45 protein_id gnl|my_center|LOCUS_46190 15754 10487 gene locus_tag LOCUS_46200 15754 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 21003 16030 gene locus_tag LOCUS_46210 21003 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 33320 21000 gene locus_tag LOCUS_46220 33320 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 36098 33675 gene locus_tag LOCUS_46230 36098 33675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_46230 36386 38215 gene locus_tag LOCUS_46240 36386 38215 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_46240 38566 38321 gene locus_tag LOCUS_46250 38566 38321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 38513 39214 gene locus_tag LOCUS_46260 38513 39214 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_46260 39322 39633 gene locus_tag LOCUS_46270 39322 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 39630 42374 gene locus_tag LOCUS_46280 39630 42374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_46280 44089 42416 gene locus_tag LOCUS_46290 44089 42416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 45543 44161 gene locus_tag LOCUS_46300 45543 44161 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705408.1 protein_id gnl|my_center|LOCUS_46300 48411 45721 gene locus_tag LOCUS_46310 48411 45721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 49010 48408 gene locus_tag LOCUS_46320 49010 48408 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_46320 49160 49510 gene locus_tag LOCUS_46330 49160 49510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 49536 50801 gene locus_tag LOCUS_46340 49536 50801 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_46340 50794 51324 gene locus_tag LOCUS_46350 50794 51324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 52505 51327 gene locus_tag LOCUS_46360 52505 51327 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_46360 57368 52518 gene locus_tag LOCUS_46370 gene lhr 57368 52518 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224210.1 protein_id gnl|my_center|LOCUS_46370 57651 60185 gene locus_tag LOCUS_46380 57651 60185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 60947 60258 gene locus_tag LOCUS_46390 60947 60258 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_46390 62258 60984 gene locus_tag LOCUS_46400 gene adh 62258 60984 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_46400 62711 64807 gene locus_tag LOCUS_46410 62711 64807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 64818 65948 gene locus_tag LOCUS_46420 64818 65948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 65852 66658 gene locus_tag LOCUS_46430 65852 66658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 66736 67710 gene locus_tag LOCUS_46440 66736 67710 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_46440 68648 67725 gene locus_tag LOCUS_46450 68648 67725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 70538 68688 gene locus_tag LOCUS_46460 70538 68688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_46460 70861 72582 gene locus_tag LOCUS_46470 70861 72582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 72582 74042 gene locus_tag LOCUS_46480 72582 74042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 74039 75499 gene locus_tag LOCUS_46490 74039 75499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 75512 76846 gene locus_tag LOCUS_46500 75512 76846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 77015 77206 gene locus_tag LOCUS_46510 77015 77206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 77355 77546 gene locus_tag LOCUS_46520 77355 77546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 77637 79799 gene locus_tag LOCUS_46530 77637 79799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 79846 82275 gene locus_tag LOCUS_46540 79846 82275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_46540 82289 83518 gene locus_tag LOCUS_46550 82289 83518 CDS product cytochrome P-450 like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_46550 83515 84303 gene locus_tag LOCUS_46560 83515 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 85394 84363 gene locus_tag LOCUS_46570 85394 84363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 85499 86836 gene locus_tag LOCUS_46580 85499 86836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 88399 87077 gene locus_tag LOCUS_46590 88399 87077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 88609 91494 gene locus_tag LOCUS_46600 88609 91494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence038 2342 2980 gene locus_tag LOCUS_46610 2342 2980 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 protein_id gnl|my_center|LOCUS_46610 3098 4027 gene locus_tag LOCUS_46620 gene hemB 3098 4027 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV9 protein_id gnl|my_center|LOCUS_46620 4024 5295 gene locus_tag LOCUS_46630 gene hemL 4024 5295 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ31 protein_id gnl|my_center|LOCUS_46630 5440 5697 gene locus_tag LOCUS_46640 5440 5697 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03942 protein_id gnl|my_center|LOCUS_46640 7896 5779 gene locus_tag LOCUS_46650 7896 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 8131 9669 gene locus_tag LOCUS_46660 8131 9669 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_46660 10952 10245 gene locus_tag LOCUS_46670 10952 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 11291 10974 gene locus_tag LOCUS_46680 11291 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 14270 11346 gene locus_tag LOCUS_46690 14270 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 17140 14267 gene locus_tag LOCUS_46700 17140 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 17540 19219 gene locus_tag LOCUS_46710 17540 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 19281 23450 gene locus_tag LOCUS_46720 19281 23450 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_46720 23447 24598 gene locus_tag LOCUS_46730 gene metB 23447 24598 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_46730 25325 24612 gene locus_tag LOCUS_46740 25325 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 25696 25475 gene locus_tag LOCUS_46750 25696 25475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 25640 26272 gene locus_tag LOCUS_46760 25640 26272 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_46760 28789 26312 gene locus_tag LOCUS_46770 28789 26312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 29356 28967 gene locus_tag LOCUS_46780 29356 28967 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195236.1 protein_id gnl|my_center|LOCUS_46780 29608 30714 gene locus_tag LOCUS_46790 29608 30714 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_46790 30792 31631 gene locus_tag LOCUS_46800 30792 31631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 31643 32023 gene locus_tag LOCUS_46810 31643 32023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 33409 32024 gene locus_tag LOCUS_46820 gene zraR 33409 32024 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_46820 33679 34971 gene locus_tag LOCUS_46830 33679 34971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46830 36244 34994 gene locus_tag LOCUS_46840 36244 34994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 36481 37818 gene locus_tag LOCUS_46850 gene purA 36481 37818 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG93 protein_id gnl|my_center|LOCUS_46850 38817 37822 gene locus_tag LOCUS_46860 gene prfB 38817 37822 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28367 protein_id gnl|my_center|LOCUS_46860 40476 38950 gene locus_tag LOCUS_46870 gene lnt 40476 38950 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32IR5 protein_id gnl|my_center|LOCUS_46870 40733 42703 gene locus_tag LOCUS_46880 40733 42703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 43906 42761 gene locus_tag LOCUS_46890 43906 42761 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_46890 44677 44009 gene locus_tag LOCUS_46900 44677 44009 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_46900 46444 44969 gene locus_tag LOCUS_46910 46444 44969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 48834 46441 gene locus_tag LOCUS_46920 48834 46441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 49652 48933 gene locus_tag LOCUS_46930 49652 48933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 50773 49649 gene locus_tag LOCUS_46940 gene arcT 50773 49649 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_46940 50988 52010 gene locus_tag LOCUS_46950 50988 52010 CDS product putative cyclodeaminase y4tK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55665 protein_id gnl|my_center|LOCUS_46950 52716 52066 gene locus_tag LOCUS_46960 gene dauR 52716 52066 CDS product transcriptional regulator DauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE2 protein_id gnl|my_center|LOCUS_46960 53825 52767 gene locus_tag LOCUS_46970 53825 52767 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_46970 54081 54662 gene locus_tag LOCUS_46980 gene rpoE 54081 54662 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_46980 54691 55419 gene locus_tag LOCUS_46990 54691 55419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 55441 55977 gene locus_tag LOCUS_47000 55441 55977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 56111 57895 gene locus_tag LOCUS_47010 56111 57895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_47010 57948 59444 gene locus_tag LOCUS_47020 57948 59444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_47020 61934 59475 gene locus_tag LOCUS_47030 gene phr 61934 59475 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122223.1 protein_id gnl|my_center|LOCUS_47030 62155 62448 gene locus_tag LOCUS_47040 62155 62448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 62445 62876 gene locus_tag LOCUS_47050 gene vapC35 62445 62876 CDS product ribonuclease VapC35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF67 protein_id gnl|my_center|LOCUS_47050 66185 62997 gene locus_tag LOCUS_47060 66185 62997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 66990 66205 gene locus_tag LOCUS_47070 66990 66205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 68199 67219 gene locus_tag LOCUS_47080 68199 67219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_47080 69038 68244 gene locus_tag LOCUS_47090 69038 68244 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_47090 70619 69156 gene locus_tag LOCUS_47100 70619 69156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 74447 70782 gene locus_tag LOCUS_47110 74447 70782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 74361 74627 gene locus_tag LOCUS_47120 74361 74627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 75445 75867 gene locus_tag LOCUS_47130 75445 75867 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_47130 78370 75842 gene locus_tag LOCUS_47140 78370 75842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 79904 78597 gene locus_tag LOCUS_47150 gene ftsA 79904 78597 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122747.1 protein_id gnl|my_center|LOCUS_47150 80842 79901 gene locus_tag LOCUS_47160 80842 79901 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_47160 81057 81788 gene locus_tag LOCUS_47170 gene pyrE 81057 81788 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF81 protein_id gnl|my_center|LOCUS_47170 81902 83131 gene locus_tag LOCUS_47180 81902 83131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 83143 84774 gene locus_tag LOCUS_47190 83143 84774 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_47190 85187 84777 gene locus_tag LOCUS_47200 85187 84777 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_47200 87095 85206 gene locus_tag LOCUS_47210 gene selB 87095 85206 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_47210 >Feature sequence039 1042 215 gene locus_tag LOCUS_47220 1042 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 3158 1329 gene locus_tag LOCUS_47230 3158 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 3841 3155 gene locus_tag LOCUS_47240 3841 3155 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_47240 6497 4095 gene locus_tag LOCUS_47250 6497 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 6682 7680 gene locus_tag LOCUS_47260 6682 7680 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_47260 7769 8167 gene locus_tag LOCUS_47270 7769 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_47270 8335 10641 gene locus_tag LOCUS_47280 8335 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 11453 10662 gene locus_tag LOCUS_47290 11453 10662 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_47290 14136 11479 gene locus_tag LOCUS_47300 14136 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 14879 14133 gene locus_tag LOCUS_47310 14879 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 16431 14950 gene locus_tag LOCUS_47320 16431 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 16633 16511 gene locus_tag LOCUS_47330 16633 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 18813 16735 gene locus_tag LOCUS_47340 18813 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 19168 18839 gene locus_tag LOCUS_47350 19168 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 20398 19205 gene locus_tag LOCUS_47360 20398 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 21790 20399 gene locus_tag LOCUS_47370 21790 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 21943 23646 gene locus_tag LOCUS_47380 21943 23646 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_47380 23773 27528 gene locus_tag LOCUS_47390 23773 27528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 27580 28821 gene locus_tag LOCUS_47400 27580 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 28966 30084 gene locus_tag LOCUS_47410 28966 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_47410 30344 30081 gene locus_tag LOCUS_47420 30344 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 30619 30350 gene locus_tag LOCUS_47430 30619 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 31297 30683 gene locus_tag LOCUS_47440 31297 30683 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_47440 31597 31460 gene locus_tag LOCUS_47450 31597 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 32100 31669 gene locus_tag LOCUS_47460 32100 31669 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_47460 32438 32097 gene locus_tag LOCUS_47470 32438 32097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 42171 32698 gene locus_tag LOCUS_47480 42171 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 42463 42194 gene locus_tag LOCUS_47490 42463 42194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 42552 44459 gene locus_tag LOCUS_47500 gene ggt 42552 44459 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_47500 44443 46083 gene locus_tag LOCUS_47510 44443 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 46243 49329 gene locus_tag LOCUS_47520 46243 49329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 50120 49404 gene locus_tag LOCUS_47530 50120 49404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 52210 50120 gene locus_tag LOCUS_47540 gene fusA 52210 50120 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F983 protein_id gnl|my_center|LOCUS_47540 53349 52378 gene locus_tag LOCUS_47550 53349 52378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 53843 53346 gene locus_tag LOCUS_47560 53843 53346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 53951 54397 gene locus_tag LOCUS_47570 53951 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 54394 54807 gene locus_tag LOCUS_47580 54394 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875943.1 protein_id gnl|my_center|LOCUS_47580 57238 54824 gene locus_tag LOCUS_47590 57238 54824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 59267 57501 gene locus_tag LOCUS_47600 59267 57501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 61165 59390 gene locus_tag LOCUS_47610 61165 59390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 61595 62221 gene locus_tag LOCUS_47620 61595 62221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 62343 64190 gene locus_tag LOCUS_47630 62343 64190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_47630 65377 64202 gene locus_tag LOCUS_47640 65377 64202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 66001 65402 gene locus_tag LOCUS_47650 66001 65402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 66303 66028 gene locus_tag LOCUS_47660 66303 66028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 67358 66357 gene locus_tag LOCUS_47670 67358 66357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 68375 67362 gene locus_tag LOCUS_47680 68375 67362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 68884 68381 gene locus_tag LOCUS_47690 68884 68381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 70301 68901 gene locus_tag LOCUS_47700 70301 68901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 71397 70471 gene locus_tag LOCUS_47710 71397 70471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 71733 71572 gene locus_tag LOCUS_47720 71733 71572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 72139 73422 gene locus_tag LOCUS_47730 72139 73422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 74476 73445 gene locus_tag LOCUS_47740 74476 73445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 74881 76521 gene locus_tag LOCUS_47750 74881 76521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_47750 77578 76904 gene locus_tag LOCUS_47760 77578 76904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 78688 77780 gene locus_tag LOCUS_47770 78688 77780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 78973 79779 gene locus_tag LOCUS_47780 gene mscS 78973 79779 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_47780 80145 83096 gene locus_tag LOCUS_47790 80145 83096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 83093 84496 gene locus_tag LOCUS_47800 83093 84496 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_47800 84632 85954 gene locus_tag LOCUS_47810 84632 85954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 85951 87081 gene locus_tag LOCUS_47820 85951 87081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_47820 87264 88601 gene locus_tag LOCUS_47830 87264 88601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 >Feature sequence040 563 1018 gene locus_tag LOCUS_47840 gene dtd 563 1018 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE39 protein_id gnl|my_center|LOCUS_47840 2002 1022 gene locus_tag LOCUS_47850 2002 1022 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_47850 2084 2347 gene locus_tag LOCUS_47860 2084 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 3169 2369 gene locus_tag LOCUS_47870 3169 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 3374 6796 gene locus_tag LOCUS_47880 3374 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 8587 6803 gene locus_tag LOCUS_47890 8587 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 9645 8611 gene locus_tag LOCUS_47900 9645 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 9816 10643 gene locus_tag LOCUS_47910 9816 10643 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_47910 10687 12714 gene locus_tag LOCUS_47920 gene nadE 10687 12714 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_47920 12711 13520 gene locus_tag LOCUS_47930 12711 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 14369 13500 gene locus_tag LOCUS_47940 14369 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 14872 14381 gene locus_tag LOCUS_47950 gene tpx 14872 14381 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 protein_id gnl|my_center|LOCUS_47950 15192 15106 gene locus_tag LOCUS_t00380 15192 15106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15670 16254 gene locus_tag LOCUS_47960 15670 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 16486 17094 gene locus_tag LOCUS_47970 16486 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 17110 17403 gene locus_tag LOCUS_47980 17110 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 17406 19865 gene locus_tag LOCUS_47990 gene priA 17406 19865 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94461 protein_id gnl|my_center|LOCUS_47990 19967 20917 gene locus_tag LOCUS_48000 gene accA 19967 20917 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIK7 protein_id gnl|my_center|LOCUS_48000 20901 22616 gene locus_tag LOCUS_48010 gene recJ 20901 22616 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_48010 22609 24777 gene locus_tag LOCUS_48020 22609 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 24780 25502 gene locus_tag LOCUS_48030 24780 25502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_48030 25643 27436 gene locus_tag LOCUS_48040 25643 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 27585 28130 gene locus_tag LOCUS_48050 27585 28130 CDS product ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_48050 28142 28603 gene locus_tag LOCUS_48060 28142 28603 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_48060 28600 29574 gene locus_tag LOCUS_48070 gene hprK 28600 29574 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_48070 29594 30439 gene locus_tag LOCUS_48080 29594 30439 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0W8 protein_id gnl|my_center|LOCUS_48080 30600 31061 gene locus_tag LOCUS_48090 30600 31061 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_48090 31186 31461 gene locus_tag LOCUS_48100 gene ptsH 31186 31461 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_48100 31458 33209 gene locus_tag LOCUS_48110 gene ptsI 31458 33209 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_48110 33280 34194 gene locus_tag LOCUS_48120 33280 34194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 34191 35537 gene locus_tag LOCUS_48130 gene miaB 34191 35537 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV6 protein_id gnl|my_center|LOCUS_48130 35691 36194 gene locus_tag LOCUS_48140 35691 36194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_48140 36820 37578 gene locus_tag LOCUS_48150 36820 37578 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_48150 37571 38431 gene locus_tag LOCUS_48160 37571 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 38783 41149 gene locus_tag LOCUS_48170 38783 41149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 42722 41331 gene locus_tag LOCUS_48180 gene dnaC 42722 41331 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Q8 protein_id gnl|my_center|LOCUS_48180 43598 42843 gene locus_tag LOCUS_48190 43598 42843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 45925 43625 gene locus_tag LOCUS_48200 45925 43625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 46356 46673 gene locus_tag LOCUS_48210 gene hup 46356 46673 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720260.1 protein_id gnl|my_center|LOCUS_48210 46756 47613 gene locus_tag LOCUS_48220 46756 47613 CDS product putative dTDP-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704341.1 protein_id gnl|my_center|LOCUS_48220 48112 48411 gene locus_tag LOCUS_48230 48112 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 48442 49611 gene locus_tag LOCUS_48240 48442 49611 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_48240 49658 52267 gene locus_tag LOCUS_48250 49658 52267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 52390 52584 gene locus_tag LOCUS_48260 52390 52584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 52577 52747 gene locus_tag LOCUS_48270 52577 52747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 52967 53743 gene locus_tag LOCUS_48280 52967 53743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 54472 53753 gene locus_tag LOCUS_48290 54472 53753 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_48290 55482 54469 gene locus_tag LOCUS_48300 55482 54469 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392828.1 protein_id gnl|my_center|LOCUS_48300 55613 56230 gene locus_tag LOCUS_48310 55613 56230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 56240 57520 gene locus_tag LOCUS_48320 56240 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 57733 59361 gene locus_tag LOCUS_48330 57733 59361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 59831 59391 gene locus_tag LOCUS_48340 59831 59391 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_48340 59905 60492 gene locus_tag LOCUS_48350 59905 60492 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_48350 60935 61927 gene locus_tag LOCUS_48360 60935 61927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 61974 62150 gene locus_tag LOCUS_48370 61974 62150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 64939 63260 gene locus_tag LOCUS_48380 64939 63260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 65241 65056 gene locus_tag LOCUS_48390 65241 65056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 65415 65708 gene locus_tag LOCUS_48400 65415 65708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 65712 66368 gene locus_tag LOCUS_48410 65712 66368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48410 66935 68485 gene locus_tag LOCUS_48420 66935 68485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 68522 68445 gene locus_tag LOCUS_t00390 68522 68445 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 70474 68627 gene locus_tag LOCUS_48430 70474 68627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 70764 71750 gene locus_tag LOCUS_48440 70764 71750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 71899 72378 gene locus_tag LOCUS_48450 71899 72378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 72405 73835 gene locus_tag LOCUS_48460 72405 73835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 73822 75579 gene locus_tag LOCUS_48470 73822 75579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 75572 76675 gene locus_tag LOCUS_48480 75572 76675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 76768 81312 gene locus_tag LOCUS_48490 76768 81312 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_48490 82662 81343 gene locus_tag LOCUS_48500 82662 81343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 85069 82754 gene locus_tag LOCUS_48510 85069 82754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 87654 85165 gene locus_tag LOCUS_48520 87654 85165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 88534 87818 gene locus_tag LOCUS_48530 88534 87818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 >Feature sequence041 1224 1151 gene locus_tag LOCUS_t00400 1224 1151 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3744 1303 gene locus_tag LOCUS_48540 gene rne 3744 1303 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EP1 protein_id gnl|my_center|LOCUS_48540 6246 3781 gene locus_tag LOCUS_48550 6246 3781 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_48550 6852 8126 gene locus_tag LOCUS_48560 gene add 6852 8126 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CCL9 protein_id gnl|my_center|LOCUS_48560 9727 8111 gene locus_tag LOCUS_48570 9727 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 11459 9762 gene locus_tag LOCUS_48580 11459 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 12725 14212 gene locus_tag LOCUS_48590 12725 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 14436 16613 gene locus_tag LOCUS_48600 14436 16613 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_48600 16908 18548 gene locus_tag LOCUS_48610 16908 18548 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039149.1 protein_id gnl|my_center|LOCUS_48610 18552 20276 gene locus_tag LOCUS_48620 18552 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 20273 21175 gene locus_tag LOCUS_48630 20273 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 21253 22215 gene locus_tag LOCUS_48640 21253 22215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140179.1 protein_id gnl|my_center|LOCUS_48640 22349 23317 gene locus_tag LOCUS_48650 gene mauG 22349 23317 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_48650 23345 23983 gene locus_tag LOCUS_48660 23345 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 24036 24866 gene locus_tag LOCUS_48670 24036 24866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 26488 25100 gene locus_tag LOCUS_48680 26488 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 26661 27470 gene locus_tag LOCUS_48690 26661 27470 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 protein_id gnl|my_center|LOCUS_48690 27508 27966 gene locus_tag LOCUS_48700 27508 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 28029 30338 gene locus_tag LOCUS_48710 28029 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 30422 31516 gene locus_tag LOCUS_48720 30422 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 33733 31541 gene locus_tag LOCUS_48730 33733 31541 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 protein_id gnl|my_center|LOCUS_48730 34644 33730 gene locus_tag LOCUS_48740 34644 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 35303 34641 gene locus_tag LOCUS_48750 35303 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 35463 36773 gene locus_tag LOCUS_48760 35463 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806979.1 protein_id gnl|my_center|LOCUS_48760 36956 38434 gene locus_tag LOCUS_48770 36956 38434 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_48770 38427 39668 gene locus_tag LOCUS_48780 38427 39668 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089883.1 protein_id gnl|my_center|LOCUS_48780 40297 39665 gene locus_tag LOCUS_48790 40297 39665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 41984 40308 gene locus_tag LOCUS_48800 41984 40308 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_48800 42569 43867 gene locus_tag LOCUS_48810 42569 43867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 43864 45312 gene locus_tag LOCUS_48820 gene leuC 43864 45312 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_48820 45312 46073 gene locus_tag LOCUS_48830 gene leuD 45312 46073 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_48830 46070 47167 gene locus_tag LOCUS_48840 gene leuB 46070 47167 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIE1 protein_id gnl|my_center|LOCUS_48840 47779 47183 gene locus_tag LOCUS_48850 47779 47183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 48479 47799 gene locus_tag LOCUS_48860 48479 47799 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_48860 50743 48485 gene locus_tag LOCUS_48870 gene fadE 50743 48485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_48870 51241 50777 gene locus_tag LOCUS_48880 51241 50777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 51440 52684 gene locus_tag LOCUS_48890 51440 52684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 52754 53965 gene locus_tag LOCUS_48900 52754 53965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 54008 54961 gene locus_tag LOCUS_48910 gene yibQ 54008 54961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_48910 57514 54980 gene locus_tag LOCUS_48920 57514 54980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 59023 57521 gene locus_tag LOCUS_48930 59023 57521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 59236 60741 gene locus_tag LOCUS_48940 59236 60741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 60760 61197 gene locus_tag LOCUS_48950 60760 61197 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_48950 61286 63862 gene locus_tag LOCUS_48960 61286 63862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 63926 64960 gene locus_tag LOCUS_48970 63926 64960 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_48970 65427 70577 gene locus_tag LOCUS_48980 65427 70577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 70592 76636 gene locus_tag LOCUS_48990 70592 76636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 77270 76851 gene locus_tag LOCUS_49000 77270 76851 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_49000 77407 78243 gene locus_tag LOCUS_49010 77407 78243 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_49010 78499 81417 gene locus_tag LOCUS_49020 78499 81417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 81635 83146 gene locus_tag LOCUS_49030 81635 83146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 83897 83316 gene locus_tag LOCUS_49040 83897 83316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 84989 85969 gene locus_tag LOCUS_49050 84989 85969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 86112 86426 gene locus_tag LOCUS_49060 86112 86426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 86410 86775 gene locus_tag LOCUS_49070 86410 86775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 86865 87968 gene locus_tag LOCUS_49080 86865 87968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 >Feature sequence042 59 874 gene locus_tag LOCUS_49090 59 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 874 1632 gene locus_tag LOCUS_49100 874 1632 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_49100 1690 2160 gene locus_tag LOCUS_49110 1690 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 2432 3901 gene locus_tag LOCUS_49120 2432 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 3920 4825 gene locus_tag LOCUS_49130 3920 4825 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_49130 6149 4833 gene locus_tag LOCUS_49140 6149 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 8665 6233 gene locus_tag LOCUS_49150 8665 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_49150 8848 9681 gene locus_tag LOCUS_49160 8848 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 9653 12883 gene locus_tag LOCUS_49170 9653 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 13000 13509 gene locus_tag LOCUS_49180 13000 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 14728 13511 gene locus_tag LOCUS_49190 14728 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 17292 14731 gene locus_tag LOCUS_49200 17292 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 18119 17412 gene locus_tag LOCUS_49210 18119 17412 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337631.1 protein_id gnl|my_center|LOCUS_49210 20896 18398 gene locus_tag LOCUS_49220 20896 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 23262 21217 gene locus_tag LOCUS_49230 23262 21217 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_49230 24595 23390 gene locus_tag LOCUS_49240 24595 23390 CDS product putative mannose-6-phosphate isomerase ManA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704330.1 protein_id gnl|my_center|LOCUS_49240 25455 24592 gene locus_tag LOCUS_49250 25455 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 28351 25535 gene locus_tag LOCUS_49260 28351 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 28579 29964 gene locus_tag LOCUS_49270 gene creD 28579 29964 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_49270 30092 31348 gene locus_tag LOCUS_49280 30092 31348 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_49280 31436 31933 gene locus_tag LOCUS_49290 31436 31933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 31930 32364 gene locus_tag LOCUS_49300 31930 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 32361 33947 gene locus_tag LOCUS_49310 32361 33947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 34522 37386 gene locus_tag LOCUS_49320 gene nrdA 34522 37386 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D561 protein_id gnl|my_center|LOCUS_49320 37528 38523 gene locus_tag LOCUS_49330 37528 38523 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_49330 38557 39696 gene locus_tag LOCUS_49340 38557 39696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_49340 39709 40296 gene locus_tag LOCUS_49350 39709 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 41391 40321 gene locus_tag LOCUS_49360 41391 40321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 42545 41403 gene locus_tag LOCUS_49370 42545 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 44439 42601 gene locus_tag LOCUS_49380 44439 42601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 44603 46339 gene locus_tag LOCUS_49390 44603 46339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 46886 46554 gene locus_tag LOCUS_49400 46886 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 47158 48075 gene locus_tag LOCUS_49410 47158 48075 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_49410 48525 49742 gene locus_tag LOCUS_49420 48525 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 49739 50236 gene locus_tag LOCUS_49430 49739 50236 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259680.1 protein_id gnl|my_center|LOCUS_49430 50347 51075 gene locus_tag LOCUS_49440 gene drrA 50347 51075 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_49440 51072 52562 gene locus_tag LOCUS_49450 51072 52562 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_49450 52630 53061 gene locus_tag LOCUS_49460 52630 53061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 53073 53996 gene locus_tag LOCUS_49470 53073 53996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 54004 56334 gene locus_tag LOCUS_49480 54004 56334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 57663 56410 gene locus_tag LOCUS_49490 57663 56410 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_49490 59530 57728 gene locus_tag LOCUS_49500 59530 57728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 59529 60206 gene locus_tag LOCUS_49510 59529 60206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 60239 61096 gene locus_tag LOCUS_49520 60239 61096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 61083 61709 gene locus_tag LOCUS_49530 61083 61709 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_49530 61791 62087 gene locus_tag LOCUS_49540 gene ccmK2 61791 62087 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_49540 62087 62401 gene locus_tag LOCUS_49550 gene eutN 62087 62401 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_49550 62389 63891 gene locus_tag LOCUS_49560 62389 63891 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_49560 63891 64493 gene locus_tag LOCUS_49570 63891 64493 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_49570 64493 64780 gene locus_tag LOCUS_49580 64493 64780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 64804 65049 gene locus_tag LOCUS_49590 64804 65049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 66124 65282 gene locus_tag LOCUS_49600 66124 65282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 66624 66031 gene locus_tag LOCUS_49610 66624 66031 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_49610 67238 66747 gene locus_tag LOCUS_49620 67238 66747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 69585 67228 gene locus_tag LOCUS_49630 69585 67228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 69860 71323 gene locus_tag LOCUS_49640 69860 71323 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_49640 71320 72723 gene locus_tag LOCUS_49650 71320 72723 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867911.1 protein_id gnl|my_center|LOCUS_49650 73139 72720 gene locus_tag LOCUS_49660 73139 72720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 74023 73364 gene locus_tag LOCUS_49670 74023 73364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 74941 74153 gene locus_tag LOCUS_49680 74941 74153 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_49680 75875 75006 gene locus_tag LOCUS_49690 75875 75006 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707175.1 protein_id gnl|my_center|LOCUS_49690 78211 75872 gene locus_tag LOCUS_49700 78211 75872 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_49700 78702 78211 gene locus_tag LOCUS_49710 78702 78211 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707174.1 protein_id gnl|my_center|LOCUS_49710 79565 78699 gene locus_tag LOCUS_49720 gene pnp 79565 78699 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5V2 protein_id gnl|my_center|LOCUS_49720 80881 79562 gene locus_tag LOCUS_49730 gene pyn 80881 79562 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403917.1 protein_id gnl|my_center|LOCUS_49730 82048 80888 gene locus_tag LOCUS_49740 gene deoB 82048 80888 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_49740 82295 83440 gene locus_tag LOCUS_49750 82295 83440 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_49750 83465 83872 gene locus_tag LOCUS_49760 83465 83872 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_49760 83914 84222 gene locus_tag LOCUS_49770 83914 84222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 85227 84226 gene locus_tag LOCUS_49780 85227 84226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 85411 86070 gene locus_tag LOCUS_49790 85411 86070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 >Feature sequence043 550 260 gene locus_tag LOCUS_49800 550 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 1391 606 gene locus_tag LOCUS_49810 gene gmk 1391 606 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60551 protein_id gnl|my_center|LOCUS_49810 2272 1391 gene locus_tag LOCUS_49820 2272 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 protein_id gnl|my_center|LOCUS_49820 4231 2288 gene locus_tag LOCUS_49830 4231 2288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_49830 5418 4225 gene locus_tag LOCUS_49840 gene lpxB 5418 4225 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_49840 5621 5430 gene locus_tag LOCUS_49850 5621 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 5997 5632 gene locus_tag LOCUS_49860 5997 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 6419 6126 gene locus_tag LOCUS_49870 gene ihfB-2 6419 6126 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_49870 6719 6953 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctcctcggtcgcttcggc 10266 8977 gene locus_tag LOCUS_49880 gene queG 10266 8977 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYQ7 protein_id gnl|my_center|LOCUS_49880 10969 10259 gene locus_tag LOCUS_49890 gene cmk 10969 10259 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU5 protein_id gnl|my_center|LOCUS_49890 12089 10971 gene locus_tag LOCUS_49900 12089 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 12996 12082 gene locus_tag LOCUS_49910 12996 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 13790 12993 gene locus_tag LOCUS_49920 gene scpA 13790 12993 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_49920 14638 13853 gene locus_tag LOCUS_49930 14638 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 15656 14691 gene locus_tag LOCUS_49940 15656 14691 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404175.1 protein_id gnl|my_center|LOCUS_49940 17992 16283 gene locus_tag LOCUS_49950 17992 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 18764 18252 gene locus_tag LOCUS_49960 18764 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 21504 19069 gene locus_tag LOCUS_49970 21504 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_49970 21815 23323 gene locus_tag LOCUS_49980 21815 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 28794 23572 gene locus_tag LOCUS_49990 28794 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 29376 32543 gene locus_tag LOCUS_50000 29376 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 32819 33895 gene locus_tag LOCUS_50010 32819 33895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 36494 33900 gene locus_tag LOCUS_50020 36494 33900 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528647.1 protein_id gnl|my_center|LOCUS_50020 36567 37400 gene locus_tag LOCUS_50030 gene ku 36567 37400 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34859 protein_id gnl|my_center|LOCUS_50030 37422 38285 gene locus_tag LOCUS_50040 37422 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 39810 38359 gene locus_tag LOCUS_50050 39810 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 41736 39898 gene locus_tag LOCUS_50060 gene uvrC 41736 39898 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_50060 43807 41741 gene locus_tag LOCUS_50070 gene uvrB 43807 41741 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_50070 43956 46511 gene locus_tag LOCUS_50080 43956 46511 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_50080 47029 46553 gene locus_tag LOCUS_50090 47029 46553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 47268 49223 gene locus_tag LOCUS_50100 47268 49223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 49291 50607 gene locus_tag LOCUS_50110 49291 50607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 51276 50782 gene locus_tag LOCUS_50120 51276 50782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 51206 51547 gene locus_tag LOCUS_50130 51206 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 53454 51469 gene locus_tag LOCUS_50140 53454 51469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 54034 53468 gene locus_tag LOCUS_50150 54034 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 55303 54332 gene locus_tag LOCUS_50160 55303 54332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 56373 55300 gene locus_tag LOCUS_50170 56373 55300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 57214 56381 gene locus_tag LOCUS_50180 gene phnC1 57214 56381 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK8 protein_id gnl|my_center|LOCUS_50180 58135 57245 gene locus_tag LOCUS_50190 gene phnD 58135 57245 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 protein_id gnl|my_center|LOCUS_50190 58310 59956 gene locus_tag LOCUS_50200 58310 59956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 60593 60030 gene locus_tag LOCUS_50210 60593 60030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 61993 60914 gene locus_tag LOCUS_50220 61993 60914 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_50220 63272 62256 gene locus_tag LOCUS_50230 63272 62256 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_50230 64225 63266 gene locus_tag LOCUS_50240 64225 63266 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_50240 64856 64335 gene locus_tag LOCUS_50250 64856 64335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 65166 66686 gene locus_tag LOCUS_50260 65166 66686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 67471 66722 gene locus_tag LOCUS_50270 67471 66722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 68246 67476 gene locus_tag LOCUS_50280 68246 67476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_50280 69797 68280 gene locus_tag LOCUS_50290 gene nfeD 69797 68280 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_50290 70163 71230 gene locus_tag LOCUS_50300 70163 71230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 71232 71870 gene locus_tag LOCUS_50310 71232 71870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 72775 71948 gene locus_tag LOCUS_50320 72775 71948 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_50320 73213 74997 gene locus_tag LOCUS_50330 73213 74997 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_50330 74994 76745 gene locus_tag LOCUS_50340 74994 76745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 79146 76978 gene locus_tag LOCUS_50350 79146 76978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 >Feature sequence044 3126 1738 gene locus_tag LOCUS_50360 3126 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 3319 4260 gene locus_tag LOCUS_50370 3319 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121848.1 protein_id gnl|my_center|LOCUS_50370 4557 20720 gene locus_tag LOCUS_50380 4557 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 20859 24401 gene locus_tag LOCUS_50390 20859 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 24572 25858 gene locus_tag LOCUS_50400 24572 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 25858 27264 gene locus_tag LOCUS_50410 25858 27264 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_50410 27941 27222 gene locus_tag LOCUS_50420 27941 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 31024 27938 gene locus_tag LOCUS_50430 31024 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 31438 32937 gene locus_tag LOCUS_50440 31438 32937 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_50440 33238 33786 gene locus_tag LOCUS_50450 33238 33786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 33783 33980 gene locus_tag LOCUS_50460 33783 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 34862 34065 gene locus_tag LOCUS_50470 34862 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 35320 37476 gene locus_tag LOCUS_50480 35320 37476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 37686 38324 gene locus_tag LOCUS_50490 37686 38324 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_50490 38369 40933 gene locus_tag LOCUS_50500 38369 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 41845 41144 gene locus_tag LOCUS_50510 41845 41144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 42638 41997 gene locus_tag LOCUS_50520 42638 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 42891 43874 gene locus_tag LOCUS_50530 42891 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_50530 43877 44788 gene locus_tag LOCUS_50540 43877 44788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121246.1 protein_id gnl|my_center|LOCUS_50540 45789 44827 gene locus_tag LOCUS_50550 45789 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 46636 45818 gene locus_tag LOCUS_50560 46636 45818 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_50560 47667 46660 gene locus_tag LOCUS_50570 47667 46660 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_50570 49559 47670 gene locus_tag LOCUS_50580 gene korA 49559 47670 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_50580 49982 51892 gene locus_tag LOCUS_50590 49982 51892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 53082 51913 gene locus_tag LOCUS_50600 53082 51913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 53416 53180 gene locus_tag LOCUS_50610 53416 53180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_50610 53875 53450 gene locus_tag LOCUS_50620 53875 53450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 54049 54510 gene locus_tag LOCUS_50630 54049 54510 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889501.1 protein_id gnl|my_center|LOCUS_50630 54722 55309 gene locus_tag LOCUS_50640 54722 55309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 55573 57174 gene locus_tag LOCUS_50650 55573 57174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 57297 58484 gene locus_tag LOCUS_50660 57297 58484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 58367 58460 gene locus_tag LOCUS_t00410 58367 58460 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 58749 58570 gene locus_tag LOCUS_50670 58749 58570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 59366 58746 gene locus_tag LOCUS_50680 59366 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 59825 59379 gene locus_tag LOCUS_50690 59825 59379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 60070 61011 gene locus_tag LOCUS_50700 gene mtrA 60070 61011 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_50700 61025 63346 gene locus_tag LOCUS_50710 61025 63346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 63551 65767 gene locus_tag LOCUS_50720 63551 65767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 66156 65821 gene locus_tag LOCUS_50730 66156 65821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 66137 67369 gene locus_tag LOCUS_50740 66137 67369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 67444 68994 gene locus_tag LOCUS_50750 67444 68994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 69711 69010 gene locus_tag LOCUS_50760 69711 69010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 71836 70118 gene locus_tag LOCUS_50770 71836 70118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142452.1 protein_id gnl|my_center|LOCUS_50770 74087 72024 gene locus_tag LOCUS_50780 74087 72024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 74361 74708 gene locus_tag LOCUS_50790 74361 74708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 74701 77406 gene locus_tag LOCUS_50800 74701 77406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_50800 77503 78327 gene locus_tag LOCUS_50810 77503 78327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 <78980 78312 gene locus_tag LOCUS_50820 <78980 78312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545133.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence045 474 857 gene locus_tag LOCUS_50830 474 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 860 1783 gene locus_tag LOCUS_50840 860 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 1785 3371 gene locus_tag LOCUS_50850 1785 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 3368 4993 gene locus_tag LOCUS_50860 3368 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 5003 6745 gene locus_tag LOCUS_50870 5003 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 7102 8184 gene locus_tag LOCUS_50880 7102 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 10680 8323 gene locus_tag LOCUS_50890 10680 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 11246 10689 gene locus_tag LOCUS_50900 11246 10689 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_50900 11609 12805 gene locus_tag LOCUS_50910 11609 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 14145 12850 gene locus_tag LOCUS_50920 14145 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 15547 14120 gene locus_tag LOCUS_50930 15547 14120 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_50930 15734 17404 gene locus_tag LOCUS_50940 15734 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 18990 17431 gene locus_tag LOCUS_50950 18990 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 19294 19974 gene locus_tag LOCUS_50960 19294 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 22758 19993 gene locus_tag LOCUS_50970 22758 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 23378 22755 gene locus_tag LOCUS_50980 23378 22755 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_50980 25865 23466 gene locus_tag LOCUS_50990 25865 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_50990 26203 27942 gene locus_tag LOCUS_51000 26203 27942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 28826 27963 gene locus_tag LOCUS_51010 28826 27963 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_51010 29205 28816 gene locus_tag LOCUS_51020 29205 28816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 29262 29666 gene locus_tag LOCUS_51030 29262 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 29866 30687 gene locus_tag LOCUS_51040 29866 30687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 30672 31658 gene locus_tag LOCUS_51050 30672 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 31718 32161 gene locus_tag LOCUS_51060 31718 32161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 32164 32484 gene locus_tag LOCUS_51070 32164 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 32481 33020 gene locus_tag LOCUS_51080 32481 33020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_51080 33109 33621 gene locus_tag LOCUS_51090 33109 33621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 33627 34649 gene locus_tag LOCUS_51100 33627 34649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 35032 34664 gene locus_tag LOCUS_51110 35032 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 35545 35036 gene locus_tag LOCUS_51120 35545 35036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 36431 36823 gene locus_tag LOCUS_51130 36431 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 39125 36732 gene locus_tag LOCUS_51140 39125 36732 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_51140 39705 39127 gene locus_tag LOCUS_51150 39705 39127 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_51150 41406 39763 gene locus_tag LOCUS_51160 41406 39763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 41986 42513 gene locus_tag LOCUS_51170 41986 42513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 42525 44528 gene locus_tag LOCUS_51180 42525 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 46282 44609 gene locus_tag LOCUS_51190 46282 44609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 47085 46456 gene locus_tag LOCUS_51200 47085 46456 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_51200 47310 47987 gene locus_tag LOCUS_51210 47310 47987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 51090 48178 gene locus_tag LOCUS_51220 51090 48178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 53033 51150 gene locus_tag LOCUS_51230 53033 51150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 53218 54186 gene locus_tag LOCUS_51240 53218 54186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 54260 56173 gene locus_tag LOCUS_51250 54260 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 56667 56164 gene locus_tag LOCUS_51260 56667 56164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 57570 56680 gene locus_tag LOCUS_51270 57570 56680 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_51270 58467 57610 gene locus_tag LOCUS_51280 58467 57610 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227569.1 protein_id gnl|my_center|LOCUS_51280 58816 58472 gene locus_tag LOCUS_51290 58816 58472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 59008 60546 gene locus_tag LOCUS_51300 59008 60546 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_51300 60875 60618 gene locus_tag LOCUS_51310 60875 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 61024 62103 gene locus_tag LOCUS_51320 61024 62103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 62818 62117 gene locus_tag LOCUS_51330 gene fabG 62818 62117 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_51330 63500 62883 gene locus_tag LOCUS_51340 63500 62883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51340 63829 63455 gene locus_tag LOCUS_51350 63829 63455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51350 64013 64933 gene locus_tag LOCUS_51360 64013 64933 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_51360 66311 65271 gene locus_tag LOCUS_51370 66311 65271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 66691 67740 gene locus_tag LOCUS_51380 66691 67740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 69140 67737 gene locus_tag LOCUS_51390 69140 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 69715 69278 gene locus_tag LOCUS_51400 69715 69278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 70332 69712 gene locus_tag LOCUS_51410 70332 69712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 70531 72114 gene locus_tag LOCUS_51420 70531 72114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 73582 72317 gene locus_tag LOCUS_51430 73582 72317 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_51430 75681 73585 gene locus_tag LOCUS_51440 75681 73585 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405118.1 protein_id gnl|my_center|LOCUS_51440 >Feature sequence046 149 781 gene locus_tag LOCUS_51450 149 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 1300 8466 gene locus_tag LOCUS_51460 1300 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 8564 10255 gene locus_tag LOCUS_51470 8564 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 10658 13600 gene locus_tag LOCUS_51480 gene btuB 10658 13600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_51480 13833 14417 gene locus_tag LOCUS_51490 13833 14417 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_51490 14658 15011 gene locus_tag LOCUS_51500 14658 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 15076 16515 gene locus_tag LOCUS_51510 15076 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 16985 20008 gene locus_tag LOCUS_51520 16985 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 21469 20423 gene locus_tag LOCUS_51530 21469 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 23007 21661 gene locus_tag LOCUS_51540 23007 21661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 23829 23092 gene locus_tag LOCUS_51550 23829 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 24247 27861 gene locus_tag LOCUS_51560 24247 27861 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_51560 28088 29206 gene locus_tag LOCUS_51570 28088 29206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 29287 30138 gene locus_tag LOCUS_51580 29287 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 30835 30185 gene locus_tag LOCUS_51590 30835 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 31229 32332 gene locus_tag LOCUS_51600 31229 32332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_51600 32506 32694 gene locus_tag LOCUS_51610 32506 32694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 32713 33891 gene locus_tag LOCUS_51620 32713 33891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 34043 34879 gene locus_tag LOCUS_51630 34043 34879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 34991 35440 gene locus_tag LOCUS_51640 34991 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 35649 37184 gene locus_tag LOCUS_51650 35649 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 40209 37282 gene locus_tag LOCUS_51660 40209 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 40357 41847 gene locus_tag LOCUS_51670 40357 41847 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I133 protein_id gnl|my_center|LOCUS_51670 43109 42063 gene locus_tag LOCUS_51680 43109 42063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 43936 45444 gene locus_tag LOCUS_51690 43936 45444 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_51690 45572 47110 gene locus_tag LOCUS_51700 45572 47110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 47286 47594 gene locus_tag LOCUS_51710 47286 47594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 47963 49906 gene locus_tag LOCUS_51720 47963 49906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339070.1 protein_id gnl|my_center|LOCUS_51720 49936 51975 gene locus_tag LOCUS_51730 49936 51975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 52005 55181 gene locus_tag LOCUS_51740 52005 55181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 55251 57176 gene locus_tag LOCUS_51750 55251 57176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 57194 58639 gene locus_tag LOCUS_51760 57194 58639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 58722 62942 gene locus_tag LOCUS_51770 58722 62942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 65856 62923 gene locus_tag LOCUS_51780 65856 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_51780 66811 66014 gene locus_tag LOCUS_51790 66811 66014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 67415 66795 gene locus_tag LOCUS_51800 67415 66795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 67686 71084 gene locus_tag LOCUS_51810 67686 71084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 71081 72196 gene locus_tag LOCUS_51820 71081 72196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 72266 74161 gene locus_tag LOCUS_51830 72266 74161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 74379 74933 gene locus_tag LOCUS_51840 74379 74933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 74937 76211 gene locus_tag LOCUS_51850 74937 76211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence047 2522 2950 gene locus_tag LOCUS_51860 2522 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 3789 3310 gene locus_tag LOCUS_51870 3789 3310 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_51870 4018 4638 gene locus_tag LOCUS_51880 4018 4638 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_51880 4635 6086 gene locus_tag LOCUS_51890 4635 6086 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_51890 6191 8746 gene locus_tag LOCUS_51900 6191 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 8817 9596 gene locus_tag LOCUS_51910 8817 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 11971 9590 gene locus_tag LOCUS_51920 11971 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 12162 12449 gene locus_tag LOCUS_51930 12162 12449 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FU4 protein_id gnl|my_center|LOCUS_51930 13218 12454 gene locus_tag LOCUS_51940 13218 12454 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 protein_id gnl|my_center|LOCUS_51940 13916 13215 gene locus_tag LOCUS_51950 13916 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 15545 13971 gene locus_tag LOCUS_51960 15545 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 15773 16696 gene locus_tag LOCUS_51970 15773 16696 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_51970 16713 17834 gene locus_tag LOCUS_51980 16713 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_51980 20351 17838 gene locus_tag LOCUS_51990 20351 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 21858 20428 gene locus_tag LOCUS_52000 21858 20428 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141146.1 protein_id gnl|my_center|LOCUS_52000 21983 24967 gene locus_tag LOCUS_52010 21983 24967 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_52010 26378 25023 gene locus_tag LOCUS_52020 26378 25023 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_52020 26583 27368 gene locus_tag LOCUS_52030 26583 27368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 27425 28045 gene locus_tag LOCUS_52040 27425 28045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_52040 28816 28163 gene locus_tag LOCUS_52050 28816 28163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 29608 28892 gene locus_tag LOCUS_52060 29608 28892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 31008 29710 gene locus_tag LOCUS_52070 31008 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 31230 34121 gene locus_tag LOCUS_52080 31230 34121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 34211 35527 gene locus_tag LOCUS_52090 34211 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 37316 35994 gene locus_tag LOCUS_52100 37316 35994 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_52100 37924 37316 gene locus_tag LOCUS_52110 37924 37316 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_52110 38228 38827 gene locus_tag LOCUS_52120 38228 38827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_52120 40500 39007 gene locus_tag LOCUS_52130 40500 39007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 43265 40497 gene locus_tag LOCUS_52140 43265 40497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 43876 43262 gene locus_tag LOCUS_52150 43876 43262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 43764 44024 gene locus_tag LOCUS_52160 43764 44024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 44059 45306 gene locus_tag LOCUS_52170 gene gltP 44059 45306 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_52170 45303 46205 gene locus_tag LOCUS_52180 45303 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 46232 47530 gene locus_tag LOCUS_52190 46232 47530 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_52190 47673 48896 gene locus_tag LOCUS_52200 gene aspC 47673 48896 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM8 protein_id gnl|my_center|LOCUS_52200 49937 48921 gene locus_tag LOCUS_52210 49937 48921 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_52210 52964 50181 gene locus_tag LOCUS_52220 52964 50181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 54016 53033 gene locus_tag LOCUS_52230 54016 53033 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BAB3 protein_id gnl|my_center|LOCUS_52230 54660 54013 gene locus_tag LOCUS_52240 54660 54013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 55067 54657 gene locus_tag LOCUS_52250 gene acpS 55067 54657 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AT2 protein_id gnl|my_center|LOCUS_52250 55756 55064 gene locus_tag LOCUS_52260 55756 55064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 56078 55719 gene locus_tag LOCUS_52270 56078 55719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 56290 57174 gene locus_tag LOCUS_52280 56290 57174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 57174 57689 gene locus_tag LOCUS_52290 gene def 57174 57689 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_52290 57735 59162 gene locus_tag LOCUS_52300 gene cysS 57735 59162 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F525 protein_id gnl|my_center|LOCUS_52300 59180 59578 gene locus_tag LOCUS_52310 59180 59578 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_52310 59684 59758 gene locus_tag LOCUS_t00420 59684 59758 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 59956 60030 gene locus_tag LOCUS_t00430 59956 60030 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 60223 60735 gene locus_tag LOCUS_52320 60223 60735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_52320 61894 60743 gene locus_tag LOCUS_52330 gene murB 61894 60743 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUJ2 protein_id gnl|my_center|LOCUS_52330 62624 61881 gene locus_tag LOCUS_52340 62624 61881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 64396 62636 gene locus_tag LOCUS_52350 64396 62636 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_52350 64905 64393 gene locus_tag LOCUS_52360 64905 64393 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_52360 65056 65556 gene locus_tag LOCUS_52370 65056 65556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 65869 67689 gene locus_tag LOCUS_52380 65869 67689 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_52380 67950 68267 gene locus_tag LOCUS_52390 67950 68267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 68345 69259 gene locus_tag LOCUS_52400 68345 69259 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232471.2 protein_id gnl|my_center|LOCUS_52400 69237 70148 gene locus_tag LOCUS_52410 69237 70148 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_52410 70141 71019 gene locus_tag LOCUS_52420 gene pstA2 70141 71019 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_52420 71016 71849 gene locus_tag LOCUS_52430 gene pstB 71016 71849 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9M8 protein_id gnl|my_center|LOCUS_52430 72219 71851 gene locus_tag LOCUS_52440 72219 71851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 72452 72219 gene locus_tag LOCUS_52450 72452 72219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 72828 72511 gene locus_tag LOCUS_52460 72828 72511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 73084 73989 gene locus_tag LOCUS_52470 73084 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 >Feature sequence048 <1 715 gene locus_tag LOCUS_52480 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRE8:peptide chain release factor 3 721 2397 gene locus_tag LOCUS_52490 721 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_52490 2563 2958 gene locus_tag LOCUS_52500 2563 2958 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_52500 3011 3919 gene locus_tag LOCUS_52510 3011 3919 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_52510 3916 4593 gene locus_tag LOCUS_52520 3916 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 5259 5492 gene locus_tag LOCUS_52530 5259 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 5527 6453 gene locus_tag LOCUS_52540 5527 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 6785 6420 gene locus_tag LOCUS_52550 6785 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 7092 8417 gene locus_tag LOCUS_52560 7092 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 8892 8608 gene locus_tag LOCUS_52570 8892 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 8795 9004 gene locus_tag LOCUS_52580 8795 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 9428 9039 gene locus_tag LOCUS_52590 9428 9039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_52590 9684 10541 gene locus_tag LOCUS_52600 9684 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 10698 12530 gene locus_tag LOCUS_52610 gene typA 10698 12530 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403243.1 protein_id gnl|my_center|LOCUS_52610 14170 12629 gene locus_tag LOCUS_52620 14170 12629 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_52620 14356 15060 gene locus_tag LOCUS_52630 14356 15060 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_52630 15878 15231 gene locus_tag LOCUS_52640 gene msrA 15878 15231 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_52640 16107 16880 gene locus_tag LOCUS_52650 16107 16880 CDS product 2-hydroxymuconic semialdehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067680.1 protein_id gnl|my_center|LOCUS_52650 16877 17650 gene locus_tag LOCUS_52660 gene lipB 16877 17650 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_52660 17647 18618 gene locus_tag LOCUS_52670 17647 18618 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085337.1 protein_id gnl|my_center|LOCUS_52670 19950 18604 gene locus_tag LOCUS_52680 19950 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 23578 20129 gene locus_tag LOCUS_52690 gene cyaI3 23578 20129 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967832.1 protein_id gnl|my_center|LOCUS_52690 24637 23747 gene locus_tag LOCUS_52700 24637 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 24950 28969 gene locus_tag LOCUS_52710 24950 28969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 29190 30281 gene locus_tag LOCUS_52720 29190 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 30380 31864 gene locus_tag LOCUS_52730 30380 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 33703 31886 gene locus_tag LOCUS_52740 33703 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 34123 34986 gene locus_tag LOCUS_52750 34123 34986 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_52750 35024 35473 gene locus_tag LOCUS_52760 35024 35473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 35503 36255 gene locus_tag LOCUS_52770 gene fabG 35503 36255 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_52770 36275 37288 gene locus_tag LOCUS_52780 36275 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 37562 39049 gene locus_tag LOCUS_52790 37562 39049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 39317 40243 gene locus_tag LOCUS_52800 39317 40243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 40523 42985 gene locus_tag LOCUS_52810 40523 42985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 43308 43069 gene locus_tag LOCUS_52820 43308 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 43277 43891 gene locus_tag LOCUS_52830 43277 43891 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_52830 43905 46760 gene locus_tag LOCUS_52840 43905 46760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 47217 46828 gene locus_tag LOCUS_52850 47217 46828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 47957 47214 gene locus_tag LOCUS_52860 47957 47214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_52860 48371 47970 gene locus_tag LOCUS_52870 48371 47970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_52870 49648 48368 gene locus_tag LOCUS_52880 49648 48368 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_52880 50054 49713 gene locus_tag LOCUS_52890 50054 49713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 50497 50054 gene locus_tag LOCUS_52900 50497 50054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 51066 50596 gene locus_tag LOCUS_52910 51066 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 51346 52302 gene locus_tag LOCUS_52920 51346 52302 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_52920 53318 52317 gene locus_tag LOCUS_52930 53318 52317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 53627 55213 gene locus_tag LOCUS_52940 53627 55213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 55276 57696 gene locus_tag LOCUS_52950 55276 57696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 57798 60287 gene locus_tag LOCUS_52960 57798 60287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141418.1 protein_id gnl|my_center|LOCUS_52960 60398 61993 gene locus_tag LOCUS_52970 60398 61993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 62037 62618 gene locus_tag LOCUS_52980 62037 62618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 63161 63997 gene locus_tag LOCUS_52990 63161 63997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 64008 64931 gene locus_tag LOCUS_53000 64008 64931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 65105 66397 gene locus_tag LOCUS_53010 65105 66397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 66940 67308 gene locus_tag LOCUS_53020 66940 67308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 67431 67802 gene locus_tag LOCUS_53030 67431 67802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 67992 68405 gene locus_tag LOCUS_53040 67992 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 68683 68369 gene locus_tag LOCUS_53050 68683 68369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 69525 68713 gene locus_tag LOCUS_53060 69525 68713 CDS product D-xylose reductase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 protein_id gnl|my_center|LOCUS_53060 69800 70237 gene locus_tag LOCUS_53070 69800 70237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 70703 71170 gene locus_tag LOCUS_53080 70703 71170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 71182 71466 gene locus_tag LOCUS_53090 71182 71466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 71506 72348 gene locus_tag LOCUS_53100 gene cpdA 71506 72348 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_53100 >Feature sequence049 <1 1064 gene locus_tag LOCUS_53110 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941785.1:peptidase ClpP 1033 1944 gene locus_tag LOCUS_53120 1033 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 1956 3689 gene locus_tag LOCUS_53130 1956 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 3769 4779 gene locus_tag LOCUS_53140 3769 4779 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_53140 5357 4974 gene locus_tag LOCUS_53150 5357 4974 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_53150 5596 5354 gene locus_tag LOCUS_53160 5596 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 5987 5655 gene locus_tag LOCUS_53170 5987 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 6700 5987 gene locus_tag LOCUS_53180 6700 5987 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_53180 6585 6815 gene locus_tag LOCUS_53190 6585 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 7917 6835 gene locus_tag LOCUS_53200 7917 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 8678 7914 gene locus_tag LOCUS_53210 8678 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 9598 8678 gene locus_tag LOCUS_53220 9598 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 10468 9692 gene locus_tag LOCUS_53230 10468 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 11432 10767 gene locus_tag LOCUS_53240 11432 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 14353 11522 gene locus_tag LOCUS_53250 14353 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 16476 14815 gene locus_tag LOCUS_53260 16476 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 16963 19191 gene locus_tag LOCUS_53270 16963 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 20693 19185 gene locus_tag LOCUS_53280 20693 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 21550 20858 gene locus_tag LOCUS_53290 21550 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 22209 21550 gene locus_tag LOCUS_53300 22209 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 25871 22518 gene locus_tag LOCUS_53310 25871 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 26337 26062 gene locus_tag LOCUS_53320 26337 26062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 26221 28800 gene locus_tag LOCUS_53330 26221 28800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 29024 31195 gene locus_tag LOCUS_53340 29024 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 31862 31275 gene locus_tag LOCUS_53350 31862 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 32020 32961 gene locus_tag LOCUS_53360 32020 32961 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708509.1 protein_id gnl|my_center|LOCUS_53360 33137 34339 gene locus_tag LOCUS_53370 33137 34339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 34478 34999 gene locus_tag LOCUS_53380 34478 34999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 35018 35716 gene locus_tag LOCUS_53390 35018 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53390 36086 37147 gene locus_tag LOCUS_53400 36086 37147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 38122 37406 gene locus_tag LOCUS_53410 38122 37406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 38518 38943 gene locus_tag LOCUS_53420 38518 38943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_53420 40269 38974 gene locus_tag LOCUS_53430 40269 38974 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_53430 40465 41229 gene locus_tag LOCUS_53440 40465 41229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 42451 41465 gene locus_tag LOCUS_53450 42451 41465 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_53450 42696 44333 gene locus_tag LOCUS_53460 42696 44333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 44532 45092 gene locus_tag LOCUS_53470 44532 45092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 45236 46861 gene locus_tag LOCUS_53480 45236 46861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 46974 47594 gene locus_tag LOCUS_53490 46974 47594 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977395.1 protein_id gnl|my_center|LOCUS_53490 47591 48463 gene locus_tag LOCUS_53500 47591 48463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 48530 49495 gene locus_tag LOCUS_53510 48530 49495 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_53510 49669 50307 gene locus_tag LOCUS_53520 49669 50307 CDS product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_53520 50881 50372 gene locus_tag LOCUS_53530 50881 50372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 51117 51716 gene locus_tag LOCUS_53540 51117 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 53093 51849 gene locus_tag LOCUS_53550 gene rocD 53093 51849 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9P3 protein_id gnl|my_center|LOCUS_53550 53330 54160 gene locus_tag LOCUS_53560 53330 54160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_53560 54183 55430 gene locus_tag LOCUS_53570 54183 55430 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_53570 55427 56305 gene locus_tag LOCUS_53580 55427 56305 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_53580 56338 57645 gene locus_tag LOCUS_53590 gene cfa 56338 57645 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_53590 57642 58028 gene locus_tag LOCUS_53600 57642 58028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 58025 59059 gene locus_tag LOCUS_53610 58025 59059 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_53610 59135 59410 gene locus_tag LOCUS_53620 59135 59410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 72455 59760 gene locus_tag LOCUS_53630 72455 59760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 <73528 72662 gene locus_tag LOCUS_53640 <73528 72662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948729.1:cell surface protein >Feature sequence050 1128 364 gene locus_tag LOCUS_53650 gene ate 1128 364 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_53650 3224 1125 gene locus_tag LOCUS_53660 gene glgX 3224 1125 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDC6 protein_id gnl|my_center|LOCUS_53660 4456 3239 gene locus_tag LOCUS_53670 4456 3239 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_53670 4703 6298 gene locus_tag LOCUS_53680 4703 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 6488 6949 gene locus_tag LOCUS_53690 6488 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_53690 7232 8668 gene locus_tag LOCUS_53700 7232 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 8675 8986 gene locus_tag LOCUS_53710 8675 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 9079 10545 gene locus_tag LOCUS_53720 gene gatA 9079 10545 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_53720 10526 12271 gene locus_tag LOCUS_53730 10526 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 12320 12892 gene locus_tag LOCUS_53740 12320 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 12889 13740 gene locus_tag LOCUS_53750 12889 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 13828 14145 gene locus_tag LOCUS_53760 13828 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 14216 16939 gene locus_tag LOCUS_53770 14216 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 17431 18135 gene locus_tag LOCUS_53780 17431 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 19170 18139 gene locus_tag LOCUS_53790 19170 18139 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_53790 19825 19412 gene locus_tag LOCUS_53800 19825 19412 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_53800 20264 19818 gene locus_tag LOCUS_53810 20264 19818 CDS product DNA polymerase beta-like region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393832.1 protein_id gnl|my_center|LOCUS_53810 21683 20313 gene locus_tag LOCUS_53820 21683 20313 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405165.1 protein_id gnl|my_center|LOCUS_53820 24754 21779 gene locus_tag LOCUS_53830 24754 21779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 27190 25148 gene locus_tag LOCUS_53840 27190 25148 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_53840 28360 27323 gene locus_tag LOCUS_53850 gene recA 28360 27323 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_53850 28617 29318 gene locus_tag LOCUS_53860 28617 29318 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_53860 30090 29500 gene locus_tag LOCUS_53870 30090 29500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 30594 31256 gene locus_tag LOCUS_53880 gene sigG 30594 31256 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_53880 31249 31863 gene locus_tag LOCUS_53890 31249 31863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 32010 32990 gene locus_tag LOCUS_53900 32010 32990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 33165 34301 gene locus_tag LOCUS_53910 33165 34301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_53910 35615 34302 gene locus_tag LOCUS_53920 35615 34302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 36586 35663 gene locus_tag LOCUS_53930 36586 35663 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_53930 36901 36620 gene locus_tag LOCUS_53940 36901 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 38002 36920 gene locus_tag LOCUS_53950 gene spsE 38002 36920 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_53950 38766 37999 gene locus_tag LOCUS_53960 38766 37999 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544386.1 protein_id gnl|my_center|LOCUS_53960 41653 38816 gene locus_tag LOCUS_53970 41653 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 44582 41766 gene locus_tag LOCUS_53980 44582 41766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 47456 44601 gene locus_tag LOCUS_53990 47456 44601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 50434 47621 gene locus_tag LOCUS_54000 50434 47621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 50610 53066 gene locus_tag LOCUS_54010 gene glgB 50610 53066 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDR4 protein_id gnl|my_center|LOCUS_54010 54465 53047 gene locus_tag LOCUS_54020 54465 53047 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_54020 54748 55956 gene locus_tag LOCUS_54030 54748 55956 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_54030 56923 55976 gene locus_tag LOCUS_54040 56923 55976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 57333 56980 gene locus_tag LOCUS_54050 57333 56980 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_54050 57590 57366 gene locus_tag LOCUS_54060 57590 57366 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THY7 protein_id gnl|my_center|LOCUS_54060 57734 58384 gene locus_tag LOCUS_54070 gene tpm 57734 58384 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_54070 59564 60556 gene locus_tag LOCUS_54080 59564 60556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 60608 61750 gene locus_tag LOCUS_54090 60608 61750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 62041 63198 gene locus_tag LOCUS_54100 62041 63198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_54100 63195 63968 gene locus_tag LOCUS_54110 63195 63968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_54110 63979 66024 gene locus_tag LOCUS_54120 63979 66024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 66024 67106 gene locus_tag LOCUS_54130 66024 67106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 68712 67264 gene locus_tag LOCUS_54140 68712 67264 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_54140 70099 68747 gene locus_tag LOCUS_54150 70099 68747 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_54150 70336 70409 gene locus_tag LOCUS_t00440 70336 70409 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 70442 70518 gene locus_tag LOCUS_t00450 70442 70518 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 1051 4680 gene locus_tag LOCUS_54160 1051 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 5025 5588 gene locus_tag LOCUS_54170 5025 5588 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY9 protein_id gnl|my_center|LOCUS_54170 5585 8059 gene locus_tag LOCUS_54180 5585 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 8195 9439 gene locus_tag LOCUS_54190 8195 9439 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259425.1 protein_id gnl|my_center|LOCUS_54190 9436 11157 gene locus_tag LOCUS_54200 9436 11157 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259426.1 protein_id gnl|my_center|LOCUS_54200 11171 11551 gene locus_tag LOCUS_54210 11171 11551 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259427.1 protein_id gnl|my_center|LOCUS_54210 11725 14184 gene locus_tag LOCUS_54220 11725 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_54220 16647 14218 gene locus_tag LOCUS_54230 16647 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 18722 16644 gene locus_tag LOCUS_54240 gene fusA1 18722 16644 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_54240 18971 20923 gene locus_tag LOCUS_54250 18971 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 21036 23876 gene locus_tag LOCUS_54260 21036 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 23873 25846 gene locus_tag LOCUS_54270 23873 25846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 25965 29306 gene locus_tag LOCUS_54280 25965 29306 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_54280 29639 29385 gene locus_tag LOCUS_54290 29639 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_54290 29836 29636 gene locus_tag LOCUS_54300 29836 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 30013 32442 gene locus_tag LOCUS_54310 30013 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_54310 32552 33577 gene locus_tag LOCUS_54320 32552 33577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 33791 36229 gene locus_tag LOCUS_54330 33791 36229 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338477.1 protein_id gnl|my_center|LOCUS_54330 36345 37910 gene locus_tag LOCUS_54340 36345 37910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 39931 37904 gene locus_tag LOCUS_54350 39931 37904 CDS product O-linked GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124155.1 protein_id gnl|my_center|LOCUS_54350 40420 40989 gene locus_tag LOCUS_54360 40420 40989 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_54360 40989 43682 gene locus_tag LOCUS_54370 40989 43682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 43864 44457 gene locus_tag LOCUS_54380 gene rpoE 43864 44457 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_54380 44454 45152 gene locus_tag LOCUS_54390 44454 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 47680 45266 gene locus_tag LOCUS_54400 47680 45266 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_54400 47958 50066 gene locus_tag LOCUS_54410 47958 50066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 51124 50063 gene locus_tag LOCUS_54420 51124 50063 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_54420 54067 51194 gene locus_tag LOCUS_54430 54067 51194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 54492 55967 gene locus_tag LOCUS_54440 54492 55967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 55972 56841 gene locus_tag LOCUS_54450 55972 56841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 56933 58171 gene locus_tag LOCUS_54460 gene paaJ 56933 58171 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_54460 58179 59501 gene locus_tag LOCUS_54470 58179 59501 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_54470 61764 59515 gene locus_tag LOCUS_54480 61764 59515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 62223 63128 gene locus_tag LOCUS_54490 62223 63128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_54490 64293 63154 gene locus_tag LOCUS_54500 64293 63154 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_54500 65310 64447 gene locus_tag LOCUS_54510 gene exo 65310 64447 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_54510 65907 65323 gene locus_tag LOCUS_54520 gene pdxH 65907 65323 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_54520 67199 65904 gene locus_tag LOCUS_54530 gene hemY 67199 65904 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_54530 68869 67316 gene locus_tag LOCUS_54540 68869 67316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 >Feature sequence052 2153 4084 gene locus_tag LOCUS_54550 2153 4084 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_54550 4112 4960 gene locus_tag LOCUS_54560 4112 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_54560 5781 5029 gene locus_tag LOCUS_54570 5781 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 6412 5969 gene locus_tag LOCUS_54580 6412 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 7253 6459 gene locus_tag LOCUS_54590 7253 6459 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_54590 7147 7467 gene locus_tag LOCUS_54600 7147 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 8552 7449 gene locus_tag LOCUS_54610 8552 7449 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_54610 9711 8941 gene locus_tag LOCUS_54620 9711 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 9830 10609 gene locus_tag LOCUS_54630 9830 10609 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_54630 10611 11336 gene locus_tag LOCUS_54640 10611 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 12244 11333 gene locus_tag LOCUS_54650 12244 11333 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_54650 12717 12349 gene locus_tag LOCUS_54660 12717 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 13160 12768 gene locus_tag LOCUS_54670 13160 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 14762 13275 gene locus_tag LOCUS_54680 14762 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 16326 14968 gene locus_tag LOCUS_54690 16326 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 17875 16421 gene locus_tag LOCUS_54700 17875 16421 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_54700 18788 17982 gene locus_tag LOCUS_54710 18788 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 18855 20273 gene locus_tag LOCUS_54720 18855 20273 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_54720 20561 21244 gene locus_tag LOCUS_54730 20561 21244 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_54730 21436 22050 gene locus_tag LOCUS_54740 21436 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 22869 22081 gene locus_tag LOCUS_54750 22869 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 23964 23047 gene locus_tag LOCUS_54760 23964 23047 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706261.1 protein_id gnl|my_center|LOCUS_54760 24132 24548 gene locus_tag LOCUS_54770 24132 24548 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225123.1 protein_id gnl|my_center|LOCUS_54770 25325 24567 gene locus_tag LOCUS_54780 25325 24567 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_54780 26365 25322 gene locus_tag LOCUS_54790 26365 25322 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_54790 26624 28213 gene locus_tag LOCUS_54800 26624 28213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_54800 28385 29362 gene locus_tag LOCUS_54810 28385 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 29624 33673 gene locus_tag LOCUS_54820 29624 33673 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_54820 34906 33692 gene locus_tag LOCUS_54830 34906 33692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_54830 36285 34924 gene locus_tag LOCUS_54840 36285 34924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_54840 37220 36381 gene locus_tag LOCUS_54850 37220 36381 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_54850 37971 37318 gene locus_tag LOCUS_54860 37971 37318 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_54860 38279 39526 gene locus_tag LOCUS_54870 38279 39526 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_54870 39523 40917 gene locus_tag LOCUS_54880 39523 40917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 41252 42514 gene locus_tag LOCUS_54890 gene glgC 41252 42514 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_54890 42520 44079 gene locus_tag LOCUS_54900 gene glgA 42520 44079 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSN1 protein_id gnl|my_center|LOCUS_54900 44232 45062 gene locus_tag LOCUS_54910 44232 45062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54910 45964 45188 gene locus_tag LOCUS_54920 45964 45188 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_54920 46298 46062 gene locus_tag LOCUS_54930 46298 46062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 46316 46900 gene locus_tag LOCUS_54940 46316 46900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 47307 48080 gene locus_tag LOCUS_54950 gene trmJ 47307 48080 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_54950 49503 48097 gene locus_tag LOCUS_54960 49503 48097 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_54960 51629 49518 gene locus_tag LOCUS_54970 51629 49518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 51967 52956 gene locus_tag LOCUS_54980 51967 52956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 52978 53748 gene locus_tag LOCUS_54990 52978 53748 CDS product TatD family deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_54990 54187 53729 gene locus_tag LOCUS_55000 54187 53729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_55000 55191 54340 gene locus_tag LOCUS_55010 55191 54340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 56870 55260 gene locus_tag LOCUS_55020 56870 55260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_55020 56955 58001 gene locus_tag LOCUS_55030 56955 58001 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_55030 58815 58027 gene locus_tag LOCUS_55040 58815 58027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 59122 60021 gene locus_tag LOCUS_55050 59122 60021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 59970 60701 gene locus_tag LOCUS_55060 59970 60701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706297.1 protein_id gnl|my_center|LOCUS_55060 60767 61438 gene locus_tag LOCUS_55070 60767 61438 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_55070 61465 61884 gene locus_tag LOCUS_55080 gene rimI 61465 61884 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431730.1 protein_id gnl|my_center|LOCUS_55080 61977 63320 gene locus_tag LOCUS_55090 61977 63320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 63389 64243 gene locus_tag LOCUS_55100 63389 64243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 >Feature sequence053 <1 2817 gene locus_tag LOCUS_55110 <1 2817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine protein kinase 3748 2849 gene locus_tag LOCUS_55120 3748 2849 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403636.1 protein_id gnl|my_center|LOCUS_55120 4267 3761 gene locus_tag LOCUS_55130 4267 3761 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_55130 5907 4324 gene locus_tag LOCUS_55140 5907 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 6705 5908 gene locus_tag LOCUS_55150 6705 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 7127 6753 gene locus_tag LOCUS_55160 7127 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 10910 7761 gene locus_tag LOCUS_55170 10910 7761 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_55170 12058 10907 gene locus_tag LOCUS_55180 12058 10907 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_55180 12355 12855 gene locus_tag LOCUS_55190 gene rimI 12355 12855 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVZ8 protein_id gnl|my_center|LOCUS_55190 13095 15530 gene locus_tag LOCUS_55200 13095 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_55200 15579 16085 gene locus_tag LOCUS_55210 15579 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 17448 16108 gene locus_tag LOCUS_55220 17448 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 18225 17506 gene locus_tag LOCUS_55230 18225 17506 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_55230 19045 18506 gene locus_tag LOCUS_55240 19045 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 21348 19186 gene locus_tag LOCUS_55250 21348 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 21583 22818 gene locus_tag LOCUS_55260 gene ampG 21583 22818 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098442.1 protein_id gnl|my_center|LOCUS_55260 23065 25230 gene locus_tag LOCUS_55270 23065 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 25903 25334 gene locus_tag LOCUS_55280 25903 25334 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886835.1 protein_id gnl|my_center|LOCUS_55280 26091 27365 gene locus_tag LOCUS_55290 26091 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 27585 27373 gene locus_tag LOCUS_55300 27585 27373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 29019 27610 gene locus_tag LOCUS_55310 29019 27610 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_55310 31326 29032 gene locus_tag LOCUS_55320 31326 29032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 32477 31323 gene locus_tag LOCUS_55330 32477 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 32875 34020 gene locus_tag LOCUS_55340 32875 34020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 35803 34073 gene locus_tag LOCUS_55350 gene mviN 35803 34073 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_55350 36047 36940 gene locus_tag LOCUS_55360 gene dhaA 36047 36940 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_55360 36981 37229 gene locus_tag LOCUS_55370 36981 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 37219 37665 gene locus_tag LOCUS_55380 37219 37665 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_55380 39702 37684 gene locus_tag LOCUS_55390 39702 37684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z840 protein_id gnl|my_center|LOCUS_55390 40507 39770 gene locus_tag LOCUS_55400 40507 39770 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_55400 41346 40537 gene locus_tag LOCUS_55410 41346 40537 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_55410 42735 41542 gene locus_tag LOCUS_55420 42735 41542 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390855.1 protein_id gnl|my_center|LOCUS_55420 43886 42735 gene locus_tag LOCUS_55430 43886 42735 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257254.1 protein_id gnl|my_center|LOCUS_55430 46014 43927 gene locus_tag LOCUS_55440 46014 43927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 48554 46041 gene locus_tag LOCUS_55450 48554 46041 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_55450 49148 48624 gene locus_tag LOCUS_55460 49148 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 51346 49136 gene locus_tag LOCUS_55470 51346 49136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_55470 51258 51467 gene locus_tag LOCUS_55480 51258 51467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 51551 52399 gene locus_tag LOCUS_55490 51551 52399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 53165 52362 gene locus_tag LOCUS_55500 53165 52362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 54079 53162 gene locus_tag LOCUS_55510 gene hemC 54079 53162 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1Q9 protein_id gnl|my_center|LOCUS_55510 54363 54968 gene locus_tag LOCUS_55520 54363 54968 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090904.1 protein_id gnl|my_center|LOCUS_55520 55029 55418 gene locus_tag LOCUS_55530 55029 55418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 55424 56917 gene locus_tag LOCUS_55540 55424 56917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 57590 56955 gene locus_tag LOCUS_55550 57590 56955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 57823 58236 gene locus_tag LOCUS_55560 57823 58236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 59512 58250 gene locus_tag LOCUS_55570 59512 58250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 59856 59509 gene locus_tag LOCUS_55580 gene trxA 59856 59509 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ35 protein_id gnl|my_center|LOCUS_55580 60983 59997 gene locus_tag LOCUS_55590 60983 59997 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD65 protein_id gnl|my_center|LOCUS_55590 62442 61045 gene locus_tag LOCUS_55600 gene rimO 62442 61045 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_55600 >Feature sequence054 1886 843 gene locus_tag LOCUS_55610 gene rbsR 1886 843 CDS product ribose operon repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_55610 3356 2031 gene locus_tag LOCUS_55620 3356 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_55620 5004 3379 gene locus_tag LOCUS_55630 5004 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_55630 6092 5016 gene locus_tag LOCUS_55640 6092 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 6303 7076 gene locus_tag LOCUS_55650 6303 7076 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706661.1 protein_id gnl|my_center|LOCUS_55650 7300 7136 gene locus_tag LOCUS_55660 7300 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 7721 7230 gene locus_tag LOCUS_55670 7721 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 9750 7843 gene locus_tag LOCUS_55680 gene cmfA 9750 7843 CDS product conditioned medium factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035568.1 protein_id gnl|my_center|LOCUS_55680 10054 9872 gene locus_tag LOCUS_55690 10054 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 10026 10736 gene locus_tag LOCUS_55700 10026 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 12906 10744 gene locus_tag LOCUS_55710 12906 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 13251 14162 gene locus_tag LOCUS_55720 13251 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 14159 14806 gene locus_tag LOCUS_55730 14159 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 15048 15899 gene locus_tag LOCUS_55740 15048 15899 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_55740 17492 15957 gene locus_tag LOCUS_55750 17492 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 17666 18508 gene locus_tag LOCUS_55760 17666 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 18505 19557 gene locus_tag LOCUS_55770 18505 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 25088 19578 gene locus_tag LOCUS_55780 25088 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 25961 25146 gene locus_tag LOCUS_55790 25961 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 37335 26002 gene locus_tag LOCUS_55800 37335 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 37391 37777 gene locus_tag LOCUS_55810 37391 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 37777 43470 gene locus_tag LOCUS_55820 37777 43470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 46785 43870 gene locus_tag LOCUS_55830 46785 43870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_55830 48513 47407 gene locus_tag LOCUS_55840 gene srkA 48513 47407 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F359 protein_id gnl|my_center|LOCUS_55840 50005 48551 gene locus_tag LOCUS_55850 gene asnS 50005 48551 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58697 protein_id gnl|my_center|LOCUS_55850 50191 51027 gene locus_tag LOCUS_55860 50191 51027 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_55860 51085 51648 gene locus_tag LOCUS_55870 51085 51648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 51636 52361 gene locus_tag LOCUS_55880 51636 52361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_55880 52348 54999 gene locus_tag LOCUS_55890 52348 54999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 55586 55005 gene locus_tag LOCUS_55900 55586 55005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_55900 57332 55623 gene locus_tag LOCUS_55910 57332 55623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 57816 57343 gene locus_tag LOCUS_55920 57816 57343 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 protein_id gnl|my_center|LOCUS_55920 59006 57813 gene locus_tag LOCUS_55930 59006 57813 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_55930 59181 59648 gene locus_tag LOCUS_55940 59181 59648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 59648 61177 gene locus_tag LOCUS_55950 59648 61177 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_55950 61234 62646 gene locus_tag LOCUS_55960 61234 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 >Feature sequence055 <1 1538 gene locus_tag LOCUS_55970 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029617.1:exopolyphosphatase 2091 1570 gene locus_tag LOCUS_55980 2091 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 3848 2211 gene locus_tag LOCUS_55990 3848 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 9394 3974 gene locus_tag LOCUS_56000 9394 3974 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_56000 9696 11633 gene locus_tag LOCUS_56010 9696 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 12633 11797 gene locus_tag LOCUS_56020 12633 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 13333 12668 gene locus_tag LOCUS_56030 13333 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 14232 13321 gene locus_tag LOCUS_56040 14232 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 15019 14297 gene locus_tag LOCUS_56050 15019 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 15109 17772 gene locus_tag LOCUS_56060 15109 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 18331 17894 gene locus_tag LOCUS_56070 18331 17894 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_56070 18352 19392 gene locus_tag LOCUS_56080 18352 19392 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_56080 21521 19389 gene locus_tag LOCUS_56090 21521 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 21788 23824 gene locus_tag LOCUS_56100 21788 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 23910 24566 gene locus_tag LOCUS_56110 23910 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 25151 24573 gene locus_tag LOCUS_56120 25151 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 26681 25269 gene locus_tag LOCUS_56130 26681 25269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 27410 26937 gene locus_tag LOCUS_56140 27410 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 33740 27558 gene locus_tag LOCUS_56150 33740 27558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 34362 35591 gene locus_tag LOCUS_56160 34362 35591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 37016 35814 gene locus_tag LOCUS_56170 37016 35814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 37224 40154 gene locus_tag LOCUS_56180 37224 40154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 40341 40096 gene locus_tag LOCUS_56190 40341 40096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 40448 41677 gene locus_tag LOCUS_56200 40448 41677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 43588 41720 gene locus_tag LOCUS_56210 43588 41720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 44540 43779 gene locus_tag LOCUS_56220 44540 43779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 46806 44809 gene locus_tag LOCUS_56230 46806 44809 CDS product potassium transporter KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939577.1 protein_id gnl|my_center|LOCUS_56230 48154 46820 gene locus_tag LOCUS_56240 48154 46820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 48553 51558 gene locus_tag LOCUS_56250 48553 51558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 51728 53359 gene locus_tag LOCUS_56260 51728 53359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 54292 53468 gene locus_tag LOCUS_56270 54292 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 55122 54319 gene locus_tag LOCUS_56280 55122 54319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 57333 55252 gene locus_tag LOCUS_56290 57333 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 61405 57821 gene locus_tag LOCUS_56300 61405 57821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 >Feature sequence056 210 605 gene locus_tag LOCUS_56310 210 605 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_56310 602 1069 gene locus_tag LOCUS_56320 602 1069 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 protein_id gnl|my_center|LOCUS_56320 1167 1523 gene locus_tag LOCUS_56330 1167 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 2969 1908 gene locus_tag LOCUS_56340 2969 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 3207 4034 gene locus_tag LOCUS_56350 3207 4034 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 protein_id gnl|my_center|LOCUS_56350 4031 4312 gene locus_tag LOCUS_56360 4031 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 4482 5405 gene locus_tag LOCUS_56370 4482 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 6045 5416 gene locus_tag LOCUS_56380 6045 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 7347 6157 gene locus_tag LOCUS_56390 7347 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 7396 8121 gene locus_tag LOCUS_56400 7396 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 8114 9151 gene locus_tag LOCUS_56410 8114 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 9436 10305 gene locus_tag LOCUS_56420 9436 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022015.1 protein_id gnl|my_center|LOCUS_56420 11676 10360 gene locus_tag LOCUS_56430 11676 10360 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_56430 11820 13850 gene locus_tag LOCUS_56440 11820 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 13950 14471 gene locus_tag LOCUS_56450 13950 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 14680 14865 gene locus_tag LOCUS_56460 gene rpmF 14680 14865 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_56460 14889 15905 gene locus_tag LOCUS_56470 gene plsX 14889 15905 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_56470 16023 16766 gene locus_tag LOCUS_56480 16023 16766 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_56480 16897 17181 gene locus_tag LOCUS_56490 gene acpP 16897 17181 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E38 protein_id gnl|my_center|LOCUS_56490 17201 18454 gene locus_tag LOCUS_56500 17201 18454 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_56500 18658 19617 gene locus_tag LOCUS_56510 18658 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 22822 19724 gene locus_tag LOCUS_56520 22822 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 23234 23995 gene locus_tag LOCUS_56530 23234 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 24167 25921 gene locus_tag LOCUS_56540 24167 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 26023 28158 gene locus_tag LOCUS_56550 26023 28158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 28257 29945 gene locus_tag LOCUS_56560 28257 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 29942 31318 gene locus_tag LOCUS_56570 29942 31318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 32107 35160 gene locus_tag LOCUS_56580 32107 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 35222 35416 gene locus_tag LOCUS_56590 35222 35416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 35392 35706 gene locus_tag LOCUS_56600 35392 35706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 35781 37358 gene locus_tag LOCUS_56610 35781 37358 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_56610 37402 38616 gene locus_tag LOCUS_56620 gene glgC 37402 38616 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2E1 protein_id gnl|my_center|LOCUS_56620 38694 38987 gene locus_tag LOCUS_56630 38694 38987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 38981 39421 gene locus_tag LOCUS_56640 38981 39421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 39454 40269 gene locus_tag LOCUS_56650 gene cobB 39454 40269 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFN0 protein_id gnl|my_center|LOCUS_56650 40687 40271 gene locus_tag LOCUS_56660 40687 40271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 41927 40716 gene locus_tag LOCUS_56670 41927 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 42935 42072 gene locus_tag LOCUS_56680 42935 42072 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_56680 44345 43113 gene locus_tag LOCUS_56690 44345 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 46238 44433 gene locus_tag LOCUS_56700 46238 44433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 47113 46643 gene locus_tag LOCUS_56710 47113 46643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 47998 47228 gene locus_tag LOCUS_56720 47998 47228 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_56720 48383 53674 gene locus_tag LOCUS_56730 48383 53674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 53711 58729 gene locus_tag LOCUS_56740 53711 58729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 >Feature sequence057 3096 1564 gene locus_tag LOCUS_56750 3096 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 3711 3130 gene locus_tag LOCUS_56760 3711 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 4381 5886 gene locus_tag LOCUS_56770 4381 5886 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 protein_id gnl|my_center|LOCUS_56770 6085 7452 gene locus_tag LOCUS_56780 gene dctD 6085 7452 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_56780 7681 8826 gene locus_tag LOCUS_56790 7681 8826 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_56790 8846 9994 gene locus_tag LOCUS_56800 gene mmgC 8846 9994 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_56800 10195 13581 gene locus_tag LOCUS_56810 gene icmF 10195 13581 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_56810 13765 14745 gene locus_tag LOCUS_56820 13765 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 14865 15665 gene locus_tag LOCUS_56830 14865 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 15658 16476 gene locus_tag LOCUS_56840 15658 16476 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_56840 16451 17227 gene locus_tag LOCUS_56850 16451 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 17237 17635 gene locus_tag LOCUS_56860 17237 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 17669 18466 gene locus_tag LOCUS_56870 17669 18466 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_56870 19670 18486 gene locus_tag LOCUS_56880 19670 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 19919 20164 gene locus_tag LOCUS_56890 19919 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 20291 20497 gene locus_tag LOCUS_56900 20291 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 20720 20517 gene locus_tag LOCUS_56910 20720 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 21239 22540 gene locus_tag LOCUS_56920 21239 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 23286 22726 gene locus_tag LOCUS_56930 23286 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_56930 23673 24374 gene locus_tag LOCUS_56940 23673 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 26876 24417 gene locus_tag LOCUS_56950 26876 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 27154 27516 gene locus_tag LOCUS_56960 27154 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 27578 29986 gene locus_tag LOCUS_56970 27578 29986 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_56970 30335 32749 gene locus_tag LOCUS_56980 30335 32749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_56980 32806 36147 gene locus_tag LOCUS_56990 32806 36147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 36841 36128 gene locus_tag LOCUS_57000 36841 36128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 37580 36897 gene locus_tag LOCUS_57010 37580 36897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 39499 37862 gene locus_tag LOCUS_57020 39499 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 39657 40253 gene locus_tag LOCUS_57030 39657 40253 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_57030 40284 42632 gene locus_tag LOCUS_57040 40284 42632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 43900 42770 gene locus_tag LOCUS_57050 43900 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 46264 44411 gene locus_tag LOCUS_57060 46264 44411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 46574 47275 gene locus_tag LOCUS_57070 gene truC 46574 47275 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_57070 48999 47272 gene locus_tag LOCUS_57080 48999 47272 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_57080 50275 49163 gene locus_tag LOCUS_57090 50275 49163 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_57090 50611 51531 gene locus_tag LOCUS_57100 gene uppS 50611 51531 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_57100 51534 52382 gene locus_tag LOCUS_57110 51534 52382 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_57110 53533 52346 gene locus_tag LOCUS_57120 53533 52346 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_57120 54087 53560 gene locus_tag LOCUS_57130 54087 53560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 54313 56916 gene locus_tag LOCUS_57140 gene mutS 54313 56916 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_57140 >Feature sequence058 1549 302 gene locus_tag LOCUS_57150 1549 302 CDS product D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637768.2 protein_id gnl|my_center|LOCUS_57150 2484 1546 gene locus_tag LOCUS_57160 2484 1546 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_57160 2907 3464 gene locus_tag LOCUS_57170 2907 3464 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_57170 3646 5511 gene locus_tag LOCUS_57180 3646 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 5646 6134 gene locus_tag LOCUS_57190 5646 6134 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_57190 6134 7879 gene locus_tag LOCUS_57200 6134 7879 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_57200 8937 7918 gene locus_tag LOCUS_57210 8937 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 11811 9031 gene locus_tag LOCUS_57220 11811 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 12509 11808 gene locus_tag LOCUS_57230 12509 11808 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_57230 13164 12493 gene locus_tag LOCUS_57240 13164 12493 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_57240 16939 13664 gene locus_tag LOCUS_57250 16939 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_57250 16929 17228 gene locus_tag LOCUS_57260 16929 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 17460 19229 gene locus_tag LOCUS_57270 17460 19229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 20456 19482 gene locus_tag LOCUS_57280 20456 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 21799 20528 gene locus_tag LOCUS_57290 21799 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 22830 21796 gene locus_tag LOCUS_57300 22830 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 23396 22827 gene locus_tag LOCUS_57310 23396 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 24834 23398 gene locus_tag LOCUS_57320 gene hldE 24834 23398 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7C7 protein_id gnl|my_center|LOCUS_57320 25439 24831 gene locus_tag LOCUS_57330 gene gmhA 25439 24831 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB00 protein_id gnl|my_center|LOCUS_57330 26531 25443 gene locus_tag LOCUS_57340 26531 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 27124 26534 gene locus_tag LOCUS_57350 27124 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 28296 27121 gene locus_tag LOCUS_57360 28296 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 30185 28293 gene locus_tag LOCUS_57370 30185 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 31803 30280 gene locus_tag LOCUS_57380 31803 30280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 32228 33343 gene locus_tag LOCUS_57390 32228 33343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 34833 33346 gene locus_tag LOCUS_57400 34833 33346 CDS product LPS biosynthesis RfbU related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875812.1 protein_id gnl|my_center|LOCUS_57400 35734 34847 gene locus_tag LOCUS_57410 35734 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 35733 36695 gene locus_tag LOCUS_57420 35733 36695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 38116 36701 gene locus_tag LOCUS_57430 38116 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 39444 38095 gene locus_tag LOCUS_57440 39444 38095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 40187 39642 gene locus_tag LOCUS_57450 40187 39642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 41488 40184 gene locus_tag LOCUS_57460 41488 40184 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S410 protein_id gnl|my_center|LOCUS_57460 41734 43356 gene locus_tag LOCUS_57470 41734 43356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 44215 43373 gene locus_tag LOCUS_57480 44215 43373 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978272.1 protein_id gnl|my_center|LOCUS_57480 44879 44223 gene locus_tag LOCUS_57490 44879 44223 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_57490 44975 45994 gene locus_tag LOCUS_57500 44975 45994 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898118.1 protein_id gnl|my_center|LOCUS_57500 46887 46015 gene locus_tag LOCUS_57510 gene petH 46887 46015 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_57510 47483 46899 gene locus_tag LOCUS_57520 gene rnfA 47483 46899 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B02 protein_id gnl|my_center|LOCUS_57520 48112 47480 gene locus_tag LOCUS_57530 48112 47480 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIJ8 protein_id gnl|my_center|LOCUS_57530 48849 48109 gene locus_tag LOCUS_57540 48849 48109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 49910 48846 gene locus_tag LOCUS_57550 49910 48846 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_57550 51283 49907 gene locus_tag LOCUS_57560 51283 49907 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY86 protein_id gnl|my_center|LOCUS_57560 <56228 51294 gene locus_tag LOCUS_57570 <56228 51294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q832R1:pyruvate-flavodoxin oxidoreductase >Feature sequence059 <1 1392 gene locus_tag LOCUS_57580 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT3:translation initiation factor IF-2 1513 1812 gene locus_tag LOCUS_57590 1513 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411038.1 protein_id gnl|my_center|LOCUS_57590 1809 2207 gene locus_tag LOCUS_57600 gene rbfA 1809 2207 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_57600 2200 3174 gene locus_tag LOCUS_57610 2200 3174 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_57610 3171 4091 gene locus_tag LOCUS_57620 gene truB 3171 4091 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66922 protein_id gnl|my_center|LOCUS_57620 4189 4458 gene locus_tag LOCUS_57630 gene rpsO 4189 4458 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G448 protein_id gnl|my_center|LOCUS_57630 4760 7078 gene locus_tag LOCUS_57640 gene pnp 4760 7078 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_57640 7353 8456 gene locus_tag LOCUS_57650 7353 8456 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870467.1 protein_id gnl|my_center|LOCUS_57650 8508 9314 gene locus_tag LOCUS_57660 8508 9314 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_57660 9508 9338 gene locus_tag LOCUS_57670 9508 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 10032 10973 gene locus_tag LOCUS_57680 gene trxB1 10032 10973 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W175 protein_id gnl|my_center|LOCUS_57680 10970 12493 gene locus_tag LOCUS_57690 10970 12493 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_57690 12509 13597 gene locus_tag LOCUS_57700 12509 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_57700 13753 14451 gene locus_tag LOCUS_57710 13753 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 14481 15830 gene locus_tag LOCUS_57720 14481 15830 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_57720 15827 16321 gene locus_tag LOCUS_57730 15827 16321 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_57730 16968 18260 gene locus_tag LOCUS_57740 16968 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 18384 20528 gene locus_tag LOCUS_57750 gene ptrB 18384 20528 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_57750 21690 20458 gene locus_tag LOCUS_57760 21690 20458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 23009 21687 gene locus_tag LOCUS_57770 23009 21687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 24508 23024 gene locus_tag LOCUS_57780 24508 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 24423 24516 gene locus_tag LOCUS_t00460 24423 24516 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30674 25071 gene locus_tag LOCUS_57790 30674 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 31277 30954 gene locus_tag LOCUS_57800 31277 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 32825 31479 gene locus_tag LOCUS_57810 32825 31479 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_57810 34956 32818 gene locus_tag LOCUS_57820 34956 32818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 35888 35028 gene locus_tag LOCUS_57830 35888 35028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 37113 36019 gene locus_tag LOCUS_57840 37113 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 38202 37321 gene locus_tag LOCUS_57850 gene suhB 38202 37321 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_57850 39535 38195 gene locus_tag LOCUS_57860 gene pyrC 39535 38195 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 protein_id gnl|my_center|LOCUS_57860 40496 39537 gene locus_tag LOCUS_57870 gene pyrB 40496 39537 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_57870 41107 40493 gene locus_tag LOCUS_57880 gene pyrR 41107 40493 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK65 protein_id gnl|my_center|LOCUS_57880 41368 41997 gene locus_tag LOCUS_57890 41368 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 42553 42302 gene locus_tag LOCUS_57900 42553 42302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 42446 43690 gene locus_tag LOCUS_57910 gene iucD 42446 43690 CDS product L-lysine 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103033.1 protein_id gnl|my_center|LOCUS_57910 43687 44940 gene locus_tag LOCUS_57920 gene avtA 43687 44940 CDS product 2-aminoadipate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037008.1 protein_id gnl|my_center|LOCUS_57920 45192 45755 gene locus_tag LOCUS_57930 45192 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 45827 47839 gene locus_tag LOCUS_57940 45827 47839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 49073 48279 gene locus_tag LOCUS_57950 49073 48279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 <54424 49242 gene locus_tag LOCUS_57960 <54424 49242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence060 1178 306 gene locus_tag LOCUS_57970 1178 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 7810 1175 gene locus_tag LOCUS_57980 7810 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 22168 7904 gene locus_tag LOCUS_57990 22168 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 23511 24185 gene locus_tag LOCUS_58000 23511 24185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 24314 26764 gene locus_tag LOCUS_58010 24314 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 29520 26833 gene locus_tag LOCUS_58020 29520 26833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_58020 29855 29517 gene locus_tag LOCUS_58030 29855 29517 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888710.1 protein_id gnl|my_center|LOCUS_58030 30123 30371 gene locus_tag LOCUS_58040 30123 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 30411 30773 gene locus_tag LOCUS_58050 30411 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 30846 34148 gene locus_tag LOCUS_58060 30846 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_58060 37518 34219 gene locus_tag LOCUS_58070 37518 34219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_58070 37864 38664 gene locus_tag LOCUS_58080 37864 38664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 39178 40239 gene locus_tag LOCUS_58090 39178 40239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 40465 43977 gene locus_tag LOCUS_58100 40465 43977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 44240 45115 gene locus_tag LOCUS_58110 gene bla 44240 45115 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RB4 protein_id gnl|my_center|LOCUS_58110 45282 50702 gene locus_tag LOCUS_58120 45282 50702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 50782 52704 gene locus_tag LOCUS_58130 gene spdH 50782 52704 CDS product spermidine dehydrogenase SpdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_58130 >Feature sequence061 1294 1854 gene locus_tag LOCUS_58140 1294 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 2292 2981 gene locus_tag LOCUS_58150 2292 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 3565 3218 gene locus_tag LOCUS_58160 3565 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 3608 3982 gene locus_tag LOCUS_58170 3608 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 3979 4929 gene locus_tag LOCUS_58180 3979 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 5097 6071 gene locus_tag LOCUS_58190 5097 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 6097 7092 gene locus_tag LOCUS_58200 6097 7092 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_58200 7104 8015 gene locus_tag LOCUS_58210 7104 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 8012 8908 gene locus_tag LOCUS_58220 8012 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 8905 9843 gene locus_tag LOCUS_58230 8905 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 10104 11024 gene locus_tag LOCUS_58240 10104 11024 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_58240 11035 12294 gene locus_tag LOCUS_58250 11035 12294 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_58250 12291 13349 gene locus_tag LOCUS_58260 12291 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 13346 14161 gene locus_tag LOCUS_58270 13346 14161 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_58270 14158 15921 gene locus_tag LOCUS_58280 14158 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 16170 16967 gene locus_tag LOCUS_58290 16170 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 17324 19255 gene locus_tag LOCUS_58300 17324 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 19605 19405 gene locus_tag LOCUS_58310 19605 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 19534 20361 gene locus_tag LOCUS_58320 19534 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 20465 21430 gene locus_tag LOCUS_58330 20465 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 21945 21727 gene locus_tag LOCUS_58340 21945 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 22150 23580 gene locus_tag LOCUS_58350 22150 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 25056 23566 gene locus_tag LOCUS_58360 25056 23566 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 protein_id gnl|my_center|LOCUS_58360 25859 26953 gene locus_tag LOCUS_58370 25859 26953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 27112 27513 gene locus_tag LOCUS_58380 27112 27513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 27589 29064 gene locus_tag LOCUS_58390 27589 29064 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_58390 29424 30734 gene locus_tag LOCUS_58400 29424 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 30747 34007 gene locus_tag LOCUS_58410 30747 34007 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_58410 34000 34518 gene locus_tag LOCUS_58420 34000 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 35373 34582 gene locus_tag LOCUS_58430 35373 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 35577 35383 gene locus_tag LOCUS_58440 35577 35383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 35488 35676 gene locus_tag LOCUS_58450 35488 35676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 35732 36184 gene locus_tag LOCUS_58460 35732 36184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 36181 37497 gene locus_tag LOCUS_58470 36181 37497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_58470 37560 37997 gene locus_tag LOCUS_58480 37560 37997 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_58480 38000 40465 gene locus_tag LOCUS_58490 38000 40465 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_58490 41749 40481 gene locus_tag LOCUS_58500 41749 40481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 42037 44121 gene locus_tag LOCUS_58510 42037 44121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 44481 44251 gene locus_tag LOCUS_58520 44481 44251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 44896 44546 gene locus_tag LOCUS_58530 44896 44546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 45919 45476 gene locus_tag LOCUS_58540 45919 45476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 46607 46134 gene locus_tag LOCUS_58550 46607 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 46885 47262 gene locus_tag LOCUS_58560 46885 47262 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_58560 47299 47670 gene locus_tag LOCUS_58570 47299 47670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 48047 47742 gene locus_tag LOCUS_58580 48047 47742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 51688 48050 gene locus_tag LOCUS_58590 51688 48050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 >Feature sequence062 1096 2769 gene locus_tag LOCUS_58600 1096 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 3146 2814 gene locus_tag LOCUS_58610 3146 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 4385 3159 gene locus_tag LOCUS_58620 4385 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 8045 4566 gene locus_tag LOCUS_58630 8045 4566 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602654.1 protein_id gnl|my_center|LOCUS_58630 9381 8218 gene locus_tag LOCUS_58640 9381 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLM9 protein_id gnl|my_center|LOCUS_58640 9649 12675 gene locus_tag LOCUS_58650 9649 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 12872 14026 gene locus_tag LOCUS_58660 12872 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 14038 15753 gene locus_tag LOCUS_58670 14038 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 16016 17683 gene locus_tag LOCUS_58680 16016 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 19859 17652 gene locus_tag LOCUS_58690 19859 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 21655 19856 gene locus_tag LOCUS_58700 21655 19856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 23463 21652 gene locus_tag LOCUS_58710 23463 21652 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_58710 23572 24396 gene locus_tag LOCUS_58720 23572 24396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 28093 24419 gene locus_tag LOCUS_58730 28093 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 28220 29029 gene locus_tag LOCUS_58740 28220 29029 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974254.1 protein_id gnl|my_center|LOCUS_58740 29502 29032 gene locus_tag LOCUS_58750 29502 29032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 29844 31412 gene locus_tag LOCUS_58760 29844 31412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 31412 34105 gene locus_tag LOCUS_58770 31412 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 34348 35502 gene locus_tag LOCUS_58780 34348 35502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 37226 35592 gene locus_tag LOCUS_58790 37226 35592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 38932 37625 gene locus_tag LOCUS_58800 38932 37625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 39011 39217 gene locus_tag LOCUS_58810 39011 39217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 39224 39487 gene locus_tag LOCUS_58820 39224 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 40616 39513 gene locus_tag LOCUS_58830 40616 39513 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_58830 40808 42679 gene locus_tag LOCUS_58840 gene asnB 40808 42679 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_58840 42741 43292 gene locus_tag LOCUS_58850 42741 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 <49089 43261 gene locus_tag LOCUS_58860 <49089 43261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence063 1301 561 gene locus_tag LOCUS_58870 1301 561 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_58870 2952 1318 gene locus_tag LOCUS_58880 2952 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 4804 2957 gene locus_tag LOCUS_58890 4804 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 5846 4815 gene locus_tag LOCUS_58900 5846 4815 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930605.1 protein_id gnl|my_center|LOCUS_58900 6827 5904 gene locus_tag LOCUS_58910 6827 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 8292 6985 gene locus_tag LOCUS_58920 8292 6985 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_58920 9716 8289 gene locus_tag LOCUS_58930 gene fadI 9716 8289 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD46 protein_id gnl|my_center|LOCUS_58930 10021 11367 gene locus_tag LOCUS_58940 10021 11367 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728393.1 protein_id gnl|my_center|LOCUS_58940 12967 11330 gene locus_tag LOCUS_58950 12967 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 13183 16830 gene locus_tag LOCUS_58960 13183 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 34208 16917 gene locus_tag LOCUS_58970 34208 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 36465 34231 gene locus_tag LOCUS_58980 36465 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 38333 36585 gene locus_tag LOCUS_58990 gene aspS 38333 36585 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_58990 38942 38415 gene locus_tag LOCUS_59000 38942 38415 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889777.1 protein_id gnl|my_center|LOCUS_59000 39113 39895 gene locus_tag LOCUS_59010 39113 39895 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_59010 39952 40515 gene locus_tag LOCUS_59020 39952 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_59020 41259 40552 gene locus_tag LOCUS_59030 41259 40552 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391618.1 protein_id gnl|my_center|LOCUS_59030 41747 42880 gene locus_tag LOCUS_59040 41747 42880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 >Feature sequence064 10231 638 gene locus_tag LOCUS_59050 10231 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 14598 10519 gene locus_tag LOCUS_59060 14598 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 14827 18768 gene locus_tag LOCUS_59070 14827 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 19171 18785 gene locus_tag LOCUS_59080 19171 18785 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_59080 19407 19168 gene locus_tag LOCUS_59090 19407 19168 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRZ3 protein_id gnl|my_center|LOCUS_59090 20378 19536 gene locus_tag LOCUS_59100 20378 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 21427 20555 gene locus_tag LOCUS_59110 21427 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 21642 23435 gene locus_tag LOCUS_59120 21642 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 31576 23543 gene locus_tag LOCUS_59130 31576 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 37371 31729 gene locus_tag LOCUS_59140 37371 31729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 37670 39613 gene locus_tag LOCUS_59150 37670 39613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 >Feature sequence065 1790 495 gene locus_tag LOCUS_59160 1790 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_59160 4411 1916 gene locus_tag LOCUS_59170 4411 1916 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_59170 5744 4452 gene locus_tag LOCUS_59180 gene hadHB 5744 4452 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_59180 6917 5754 gene locus_tag LOCUS_59190 gene tyrA 6917 5754 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK89 protein_id gnl|my_center|LOCUS_59190 7976 6951 gene locus_tag LOCUS_59200 7976 6951 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_59200 9106 8102 gene locus_tag LOCUS_59210 9106 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 9349 10395 gene locus_tag LOCUS_59220 9349 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 10442 11866 gene locus_tag LOCUS_59230 10442 11866 CDS product metallo-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_59230 14171 11883 gene locus_tag LOCUS_59240 14171 11883 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_59240 15248 14223 gene locus_tag LOCUS_59250 15248 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 16462 15353 gene locus_tag LOCUS_59260 16462 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 17471 16725 gene locus_tag LOCUS_59270 17471 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 17543 18139 gene locus_tag LOCUS_59280 17543 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 18162 19700 gene locus_tag LOCUS_59290 18162 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 19697 21217 gene locus_tag LOCUS_59300 gene pepD 19697 21217 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_59300 21314 21631 gene locus_tag LOCUS_59310 gene hcaC 21314 21631 CDS product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ2 protein_id gnl|my_center|LOCUS_59310 21631 22245 gene locus_tag LOCUS_59320 21631 22245 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_59320 22242 22490 gene locus_tag LOCUS_59330 22242 22490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 22622 24031 gene locus_tag LOCUS_59340 22622 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 25745 24072 gene locus_tag LOCUS_59350 25745 24072 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_59350 26583 25843 gene locus_tag LOCUS_59360 26583 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258569.1 protein_id gnl|my_center|LOCUS_59360 27338 26580 gene locus_tag LOCUS_59370 27338 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 28216 27335 gene locus_tag LOCUS_59380 28216 27335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258571.1 protein_id gnl|my_center|LOCUS_59380 28509 30116 gene locus_tag LOCUS_59390 28509 30116 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_59390 30116 31720 gene locus_tag LOCUS_59400 30116 31720 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_59400 31908 33173 gene locus_tag LOCUS_59410 31908 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 33448 34776 gene locus_tag LOCUS_59420 33448 34776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 35534 35241 gene locus_tag LOCUS_59430 35534 35241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 36479 35937 gene locus_tag LOCUS_59440 36479 35937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 37777 36476 gene locus_tag LOCUS_59450 37777 36476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 39003 37774 gene locus_tag LOCUS_59460 39003 37774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 39482 39727 gene locus_tag LOCUS_59470 39482 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 39893 41023 gene locus_tag LOCUS_59480 39893 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 41292 41041 gene locus_tag LOCUS_59490 41292 41041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 >Feature sequence066 782 3193 gene locus_tag LOCUS_59500 782 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 5571 3178 gene locus_tag LOCUS_59510 5571 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 6527 5568 gene locus_tag LOCUS_59520 6527 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 6995 6609 gene locus_tag LOCUS_59530 6995 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 7036 8406 gene locus_tag LOCUS_59540 7036 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 8449 8658 gene locus_tag LOCUS_59550 8449 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 8655 8894 gene locus_tag LOCUS_59560 8655 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 9758 8898 gene locus_tag LOCUS_59570 gene nadC 9758 8898 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_59570 9973 11640 gene locus_tag LOCUS_59580 9973 11640 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205594.1 protein_id gnl|my_center|LOCUS_59580 12597 11644 gene locus_tag LOCUS_59590 12597 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 13654 12668 gene locus_tag LOCUS_59600 13654 12668 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390774.1 protein_id gnl|my_center|LOCUS_59600 13982 13830 gene locus_tag LOCUS_59610 13982 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 15868 13979 gene locus_tag LOCUS_59620 15868 13979 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389237.1 protein_id gnl|my_center|LOCUS_59620 16344 15865 gene locus_tag LOCUS_59630 16344 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 16627 16337 gene locus_tag LOCUS_59640 16627 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 17928 16690 gene locus_tag LOCUS_59650 17928 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 20735 17925 gene locus_tag LOCUS_59660 20735 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 24939 20806 gene locus_tag LOCUS_59670 24939 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 25225 25782 gene locus_tag LOCUS_59680 25225 25782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 27397 25802 gene locus_tag LOCUS_59690 27397 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 27767 31528 gene locus_tag LOCUS_59700 gene metH 27767 31528 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_59700 31911 31570 gene locus_tag LOCUS_59710 31911 31570 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C35 protein_id gnl|my_center|LOCUS_59710 32313 34016 gene locus_tag LOCUS_59720 32313 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 34441 34043 gene locus_tag LOCUS_59730 34441 34043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 35383 34550 gene locus_tag LOCUS_59740 35383 34550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 36044 35376 gene locus_tag LOCUS_59750 36044 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence067 1737 2306 gene locus_tag LOCUS_59760 1737 2306 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_59760 3631 2324 gene locus_tag LOCUS_59770 3631 2324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_59770 5828 3741 gene locus_tag LOCUS_59780 5828 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 5983 8457 gene locus_tag LOCUS_59790 5983 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 10345 8471 gene locus_tag LOCUS_59800 10345 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 11555 10587 gene locus_tag LOCUS_59810 11555 10587 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958609.1 protein_id gnl|my_center|LOCUS_59810 14490 11641 gene locus_tag LOCUS_59820 14490 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 15918 14719 gene locus_tag LOCUS_59830 gene thrC 15918 14719 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_59830 16338 18011 gene locus_tag LOCUS_59840 16338 18011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 18032 18796 gene locus_tag LOCUS_59850 18032 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_59850 19481 18861 gene locus_tag LOCUS_59860 19481 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 20458 19478 gene locus_tag LOCUS_59870 20458 19478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229585.1 protein_id gnl|my_center|LOCUS_59870 21290 20448 gene locus_tag LOCUS_59880 21290 20448 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_59880 21463 22917 gene locus_tag LOCUS_59890 21463 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 22932 24836 gene locus_tag LOCUS_59900 22932 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 24833 28084 gene locus_tag LOCUS_59910 24833 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 28072 31029 gene locus_tag LOCUS_59920 28072 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 31296 33554 gene locus_tag LOCUS_59930 31296 33554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 33704 34063 gene locus_tag LOCUS_59940 33704 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 34662 34381 gene locus_tag LOCUS_59950 34662 34381 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_59950 36353 35079 gene locus_tag LOCUS_59960 36353 35079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 37855 36332 gene locus_tag LOCUS_59970 37855 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 >Feature sequence068 1552 650 gene locus_tag LOCUS_59980 1552 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 2669 1542 gene locus_tag LOCUS_59990 2669 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 3138 2686 gene locus_tag LOCUS_60000 gene capC 3138 2686 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329558.1 protein_id gnl|my_center|LOCUS_60000 4324 3131 gene locus_tag LOCUS_60010 gene capB 4324 3131 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_60010 4921 6153 gene locus_tag LOCUS_60020 4921 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 6251 6709 gene locus_tag LOCUS_60030 6251 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 6806 7144 gene locus_tag LOCUS_60040 6806 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 7168 9819 gene locus_tag LOCUS_60050 7168 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_60050 11022 9994 gene locus_tag LOCUS_60060 11022 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_60060 11420 12349 gene locus_tag LOCUS_60070 11420 12349 CDS product putative transcriptional regulator, MarR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701880.1 protein_id gnl|my_center|LOCUS_60070 12353 13990 gene locus_tag LOCUS_60080 12353 13990 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_60080 13987 14724 gene locus_tag LOCUS_60090 gene natA 13987 14724 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_60090 14721 15887 gene locus_tag LOCUS_60100 gene natB 14721 15887 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 protein_id gnl|my_center|LOCUS_60100 16139 18388 gene locus_tag LOCUS_60110 16139 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 18443 19276 gene locus_tag LOCUS_60120 18443 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 19484 20830 gene locus_tag LOCUS_60130 19484 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 21167 22855 gene locus_tag LOCUS_60140 21167 22855 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_60140 23230 22958 gene locus_tag LOCUS_60150 23230 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 23123 23683 gene locus_tag LOCUS_60160 23123 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 24007 23765 gene locus_tag LOCUS_60170 24007 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 24636 24313 gene locus_tag LOCUS_60180 24636 24313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 24866 25294 gene locus_tag LOCUS_60190 24866 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 25443 27932 gene locus_tag LOCUS_60200 25443 27932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_60200 28242 28721 gene locus_tag LOCUS_60210 28242 28721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 29978 28812 gene locus_tag LOCUS_60220 29978 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 30866 30006 gene locus_tag LOCUS_60230 30866 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 31442 33049 gene locus_tag LOCUS_60240 31442 33049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 35574 33166 gene locus_tag LOCUS_60250 35574 33166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 <36977 35772 gene locus_tag LOCUS_60260 <36977 35772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937687.1:sulfatase >Feature sequence069 413 1627 gene locus_tag LOCUS_60270 413 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 2848 1718 gene locus_tag LOCUS_60280 2848 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 2987 3361 gene locus_tag LOCUS_60290 2987 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 3797 3384 gene locus_tag LOCUS_60300 3797 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60300 4872 4324 gene locus_tag LOCUS_60310 4872 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 5000 6823 gene locus_tag LOCUS_60320 5000 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 8855 6834 gene locus_tag LOCUS_60330 8855 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 9011 9550 gene locus_tag LOCUS_60340 9011 9550 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 protein_id gnl|my_center|LOCUS_60340 9547 10665 gene locus_tag LOCUS_60350 9547 10665 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_60350 10829 11305 gene locus_tag LOCUS_60360 10829 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 12118 11336 gene locus_tag LOCUS_60370 12118 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 13431 12124 gene locus_tag LOCUS_60380 gene adh 13431 12124 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_60380 14861 13524 gene locus_tag LOCUS_60390 gene pfkA 14861 13524 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AD6 protein_id gnl|my_center|LOCUS_60390 15898 14858 gene locus_tag LOCUS_60400 gene gapA 15898 14858 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_60400 16193 16690 gene locus_tag LOCUS_60410 16193 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 17844 16687 gene locus_tag LOCUS_60420 17844 16687 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_60420 18093 18695 gene locus_tag LOCUS_60430 18093 18695 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_60430 18734 19687 gene locus_tag LOCUS_60440 18734 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 19684 20823 gene locus_tag LOCUS_60450 19684 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 21171 22424 gene locus_tag LOCUS_60460 21171 22424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 22850 22428 gene locus_tag LOCUS_60470 22850 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704230.1 protein_id gnl|my_center|LOCUS_60470 22934 23587 gene locus_tag LOCUS_60480 gene tmk 22934 23587 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_60480 23584 24438 gene locus_tag LOCUS_60490 23584 24438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 24704 25570 gene locus_tag LOCUS_60500 24704 25570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_60500 26665 25601 gene locus_tag LOCUS_60510 26665 25601 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_60510 26986 28287 gene locus_tag LOCUS_60520 26986 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 28284 29759 gene locus_tag LOCUS_60530 gene hemY 28284 29759 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_60530 29859 31244 gene locus_tag LOCUS_60540 29859 31244 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_60540 31299 31868 gene locus_tag LOCUS_60550 31299 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_60550 31882 33087 gene locus_tag LOCUS_60560 31882 33087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_60560 >Feature sequence070 215 1537 gene locus_tag LOCUS_60570 215 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 4283 1605 gene locus_tag LOCUS_60580 4283 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 4720 7113 gene locus_tag LOCUS_60590 4720 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 7383 8480 gene locus_tag LOCUS_60600 7383 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 8641 9762 gene locus_tag LOCUS_60610 8641 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 10997 9759 gene locus_tag LOCUS_60620 10997 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 11317 11964 gene locus_tag LOCUS_60630 11317 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_60630 12282 14120 gene locus_tag LOCUS_60640 12282 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 14156 15469 gene locus_tag LOCUS_60650 14156 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 16824 15709 gene locus_tag LOCUS_60660 16824 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 17414 16905 gene locus_tag LOCUS_60670 17414 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 18354 17509 gene locus_tag LOCUS_60680 18354 17509 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_60680 19138 18497 gene locus_tag LOCUS_60690 19138 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 21084 19240 gene locus_tag LOCUS_60700 21084 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 21395 22312 gene locus_tag LOCUS_60710 21395 22312 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_60710 <29597 22331 gene locus_tag LOCUS_60720 <29597 22331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase >Feature sequence071 780 1031 gene locus_tag LOCUS_60730 780 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_60730 1024 1509 gene locus_tag LOCUS_60740 1024 1509 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248955.1 protein_id gnl|my_center|LOCUS_60740 1604 2830 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgaaggggcggcgcctgatttcgac 3086 3268 gene locus_tag LOCUS_60750 3086 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 5368 3350 gene locus_tag LOCUS_60760 5368 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 5600 7222 gene locus_tag LOCUS_60770 5600 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_60770 7219 8982 gene locus_tag LOCUS_60780 7219 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 8979 9473 gene locus_tag LOCUS_60790 8979 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 9473 10675 gene locus_tag LOCUS_60800 9473 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 10675 11646 gene locus_tag LOCUS_60810 10675 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 11634 12071 gene locus_tag LOCUS_60820 11634 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 12064 13215 gene locus_tag LOCUS_60830 12064 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 13217 13549 gene locus_tag LOCUS_60840 13217 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 13546 14454 gene locus_tag LOCUS_60850 13546 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 17675 14415 gene locus_tag LOCUS_60860 17675 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_60860 18566 17727 gene locus_tag LOCUS_60870 18566 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 19228 18563 gene locus_tag LOCUS_60880 19228 18563 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_60880 19300 22875 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtctcaatcccccgaaggggcggc 23892 22885 gene locus_tag LOCUS_60890 23892 22885 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405476.1 protein_id gnl|my_center|LOCUS_60890 24328 25434 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtctcaatcccccgaaggggcggcg 26538 25522 gene locus_tag LOCUS_60900 26538 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 26980 27549 gene locus_tag LOCUS_60910 26980 27549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 27772 28245 gene locus_tag LOCUS_60920 27772 28245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 28544 28453 gene locus_tag LOCUS_t00470 28544 28453 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 5544 580 gene locus_tag LOCUS_60930 5544 580 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267397.1 protein_id gnl|my_center|LOCUS_60930 6654 5725 gene locus_tag LOCUS_60940 6654 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 7632 6718 gene locus_tag LOCUS_60950 7632 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 8033 8653 gene locus_tag LOCUS_60960 8033 8653 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_60960 8643 11186 gene locus_tag LOCUS_60970 8643 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 11866 12753 gene locus_tag LOCUS_60980 11866 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 12970 13722 gene locus_tag LOCUS_60990 12970 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 14028 15581 gene locus_tag LOCUS_61000 14028 15581 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104986.1 protein_id gnl|my_center|LOCUS_61000 15757 17151 gene locus_tag LOCUS_61010 15757 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 17916 17158 gene locus_tag LOCUS_61020 17916 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 18342 18046 gene locus_tag LOCUS_61030 18342 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 19166 18339 gene locus_tag LOCUS_61040 19166 18339 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_61040 20194 19265 gene locus_tag LOCUS_61050 20194 19265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 20665 22932 gene locus_tag LOCUS_61060 20665 22932 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_61060 >Feature sequence073 1347 2294 gene locus_tag LOCUS_61070 1347 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 2366 3205 gene locus_tag LOCUS_61080 2366 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 3281 4666 gene locus_tag LOCUS_61090 3281 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 4683 5672 gene locus_tag LOCUS_61100 4683 5672 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030232.1 protein_id gnl|my_center|LOCUS_61100 8638 5675 gene locus_tag LOCUS_61110 8638 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 9057 8860 gene locus_tag LOCUS_61120 9057 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 9049 9483 gene locus_tag LOCUS_61130 9049 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 9627 11027 gene locus_tag LOCUS_61140 gene aspA 9627 11027 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_61140 12488 11043 gene locus_tag LOCUS_61150 12488 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 13301 12648 gene locus_tag LOCUS_61160 13301 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 15365 13416 gene locus_tag LOCUS_61170 15365 13416 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_61170 16528 15392 gene locus_tag LOCUS_61180 16528 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_61180 16776 17387 gene locus_tag LOCUS_61190 16776 17387 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_61190 17525 18328 gene locus_tag LOCUS_61200 17525 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_61200 20650 18338 gene locus_tag LOCUS_61210 20650 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 20774 21232 gene locus_tag LOCUS_61220 gene furR2 20774 21232 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880915.1 protein_id gnl|my_center|LOCUS_61220 21414 23609 gene locus_tag LOCUS_61230 gene fadJ 21414 23609 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_61230 23690 24085 gene locus_tag LOCUS_61240 gene crcB 23690 24085 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE9 protein_id gnl|my_center|LOCUS_61240 24105 25889 gene locus_tag LOCUS_61250 24105 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_61250 >Feature sequence074 <1 1177 gene locus_tag LOCUS_61260 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:tetratricopeptide repeat domain protein 1273 2025 gene locus_tag LOCUS_61270 1273 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 2486 2118 gene locus_tag LOCUS_61280 2486 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 3507 2791 gene locus_tag LOCUS_61290 3507 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 4133 3507 gene locus_tag LOCUS_61300 4133 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 4379 16390 gene locus_tag LOCUS_61310 4379 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 16507 17349 gene locus_tag LOCUS_61320 16507 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 17697 20933 gene locus_tag LOCUS_61330 17697 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 22579 21014 gene locus_tag LOCUS_61340 22579 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 23176 22862 gene locus_tag LOCUS_61350 23176 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 23438 23160 gene locus_tag LOCUS_61360 23438 23160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_61360 23638 25542 gene locus_tag LOCUS_61370 23638 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 <26288 25549 gene locus_tag LOCUS_61380 <26288 25549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104858.1:AraC family transcriptional regulator >Feature sequence075 1646 450 gene locus_tag LOCUS_61390 1646 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 3268 1694 gene locus_tag LOCUS_61400 gene secD 3268 1694 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_61400 3587 3270 gene locus_tag LOCUS_61410 3587 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 3514 3801 gene locus_tag LOCUS_61420 3514 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 5005 3878 gene locus_tag LOCUS_61430 gene tgt 5005 3878 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_61430 5841 5002 gene locus_tag LOCUS_61440 5841 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 6023 7879 gene locus_tag LOCUS_61450 gene argS 6023 7879 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_61450 8005 8982 gene locus_tag LOCUS_61460 8005 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_61460 11295 8986 gene locus_tag LOCUS_61470 11295 8986 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037547.1 protein_id gnl|my_center|LOCUS_61470 15031 11387 gene locus_tag LOCUS_61480 15031 11387 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_61480 17430 15259 gene locus_tag LOCUS_61490 17430 15259 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG52 protein_id gnl|my_center|LOCUS_61490 17949 17476 gene locus_tag LOCUS_61500 17949 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 19085 18006 gene locus_tag LOCUS_61510 19085 18006 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_61510 19202 20488 gene locus_tag LOCUS_61520 gene serS 19202 20488 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H55 protein_id gnl|my_center|LOCUS_61520 20501 20588 gene locus_tag LOCUS_t00480 20501 20588 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20882 22507 gene locus_tag LOCUS_61530 20882 22507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 23514 22546 gene locus_tag LOCUS_61540 23514 22546 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 protein_id gnl|my_center|LOCUS_61540 23622 23921 gene locus_tag LOCUS_61550 23622 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 <24735 24043 gene locus_tag LOCUS_61560 <24735 24043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958515.1:peptidase >Feature sequence076 1276 542 gene locus_tag LOCUS_61570 1276 542 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_61570 1548 1273 gene locus_tag LOCUS_61580 1548 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 2886 1654 gene locus_tag LOCUS_61590 2886 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 3390 5168 gene locus_tag LOCUS_61600 3390 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 5185 7560 gene locus_tag LOCUS_61610 5185 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 9073 7565 gene locus_tag LOCUS_61620 9073 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 9381 10667 gene locus_tag LOCUS_61630 9381 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 10677 11696 gene locus_tag LOCUS_61640 10677 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 11693 14173 gene locus_tag LOCUS_61650 11693 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 14280 15215 gene locus_tag LOCUS_61660 14280 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 15229 16161 gene locus_tag LOCUS_61670 15229 16161 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 protein_id gnl|my_center|LOCUS_61670 16158 16832 gene locus_tag LOCUS_61680 gene modB 16158 16832 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038307.1 protein_id gnl|my_center|LOCUS_61680 16835 17977 gene locus_tag LOCUS_61690 gene modC 16835 17977 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_61690 19023 17986 gene locus_tag LOCUS_61700 19023 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 19250 19038 gene locus_tag LOCUS_61710 19250 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 19597 19247 gene locus_tag LOCUS_61720 19597 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 20109 19594 gene locus_tag LOCUS_61730 20109 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 <24040 20157 gene locus_tag LOCUS_61740 <24040 20157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs >Feature sequence077 661 1746 gene locus_tag LOCUS_61750 661 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 1752 2420 gene locus_tag LOCUS_61760 1752 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_61760 2599 2417 gene locus_tag LOCUS_61770 2599 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 4355 2826 gene locus_tag LOCUS_61780 4355 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 5695 4355 gene locus_tag LOCUS_61790 5695 4355 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_61790 5884 10089 gene locus_tag LOCUS_61800 5884 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 10105 15867 gene locus_tag LOCUS_61810 10105 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 16178 18049 gene locus_tag LOCUS_61820 16178 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 18108 19886 gene locus_tag LOCUS_61830 gene aceK 18108 19886 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_61830 19896 21407 gene locus_tag LOCUS_61840 19896 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 21677 22855 gene locus_tag LOCUS_61850 21677 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 >Feature sequence078 686 1240 gene locus_tag LOCUS_61860 686 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_61860 1605 1417 gene locus_tag LOCUS_61870 1605 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61870 2839 1901 gene locus_tag LOCUS_61880 2839 1901 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 protein_id gnl|my_center|LOCUS_61880 3536 3168 gene locus_tag LOCUS_61890 3536 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 4169 6475 gene locus_tag LOCUS_61900 4169 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 6478 7593 gene locus_tag LOCUS_61910 6478 7593 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_61910 7646 10702 gene locus_tag LOCUS_61920 7646 10702 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815495.1 protein_id gnl|my_center|LOCUS_61920 10699 11190 gene locus_tag LOCUS_61930 10699 11190 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_61930 13188 12286 gene locus_tag LOCUS_61940 13188 12286 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_61940 13471 13217 gene locus_tag LOCUS_61950 13471 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 13941 14423 gene locus_tag LOCUS_61960 13941 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 14455 14883 gene locus_tag LOCUS_61970 14455 14883 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_61970 15344 14874 gene locus_tag LOCUS_61980 15344 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 15953 15504 gene locus_tag LOCUS_61990 15953 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 16753 16085 gene locus_tag LOCUS_62000 16753 16085 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZX7 protein_id gnl|my_center|LOCUS_62000 17088 16750 gene locus_tag LOCUS_62010 17088 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 18885 17377 gene locus_tag LOCUS_62020 18885 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62020 19866 18886 gene locus_tag LOCUS_62030 19866 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62030 20889 19876 gene locus_tag LOCUS_62040 20889 19876 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974801.1 protein_id gnl|my_center|LOCUS_62040 21357 21557 gene locus_tag LOCUS_62050 21357 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 >Feature sequence079 1344 541 gene locus_tag LOCUS_62060 gene paaG 1344 541 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_62060 3410 1341 gene locus_tag LOCUS_62070 3410 1341 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_62070 5020 3425 gene locus_tag LOCUS_62080 5020 3425 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_62080 7064 5175 gene locus_tag LOCUS_62090 7064 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 7280 7633 gene locus_tag LOCUS_62100 7280 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 7689 8432 gene locus_tag LOCUS_62110 7689 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 8478 12557 gene locus_tag LOCUS_62120 8478 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 13433 12714 gene locus_tag LOCUS_62130 13433 12714 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV18 protein_id gnl|my_center|LOCUS_62130 17374 13430 gene locus_tag LOCUS_62140 17374 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 19075 17489 gene locus_tag LOCUS_62150 19075 17489 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_62150 20016 19087 gene locus_tag LOCUS_62160 gene dapA 20016 19087 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_62160 21384 20080 gene locus_tag LOCUS_62170 21384 20080 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_62170 >Feature sequence080 1805 465 gene locus_tag LOCUS_62180 1805 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 3162 1936 gene locus_tag LOCUS_62190 3162 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 3832 4089 gene locus_tag LOCUS_62200 3832 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 4086 5039 gene locus_tag LOCUS_62210 4086 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 6995 6303 gene locus_tag LOCUS_62220 6995 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 7356 6985 gene locus_tag LOCUS_62230 7356 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 7936 8832 gene locus_tag LOCUS_62240 7936 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 9029 9973 gene locus_tag LOCUS_62250 9029 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 10554 9895 gene locus_tag LOCUS_62260 10554 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 15021 10663 gene locus_tag LOCUS_62270 15021 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256978.1 protein_id gnl|my_center|LOCUS_62270 15776 15156 gene locus_tag LOCUS_62280 15776 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62280 15967 16506 gene locus_tag LOCUS_62290 15967 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 16525 17220 gene locus_tag LOCUS_62300 16525 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 17681 17124 gene locus_tag LOCUS_62310 gene traF 17681 17124 CDS product putative conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55417 protein_id gnl|my_center|LOCUS_62310 19111 17678 gene locus_tag LOCUS_62320 19111 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 19647 19123 gene locus_tag LOCUS_62330 19647 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 19955 19644 gene locus_tag LOCUS_62340 19955 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 20730 20176 gene locus_tag LOCUS_62350 20730 20176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 21257 20883 gene locus_tag LOCUS_62360 21257 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 >Feature sequence081 3281 1545 gene locus_tag LOCUS_62370 3281 1545 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_62370 3966 3394 gene locus_tag LOCUS_62380 gene yfiT 3966 3394 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_62380 4300 5634 gene locus_tag LOCUS_62390 4300 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 5631 7838 gene locus_tag LOCUS_62400 5631 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 7922 10183 gene locus_tag LOCUS_62410 7922 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 10195 11712 gene locus_tag LOCUS_62420 10195 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 11712 13760 gene locus_tag LOCUS_62430 11712 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 13908 14348 gene locus_tag LOCUS_62440 13908 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 14467 15984 gene locus_tag LOCUS_62450 gene phr 14467 15984 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_62450 16119 16529 gene locus_tag LOCUS_62460 16119 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708780.1 protein_id gnl|my_center|LOCUS_62460 17767 16526 gene locus_tag LOCUS_62470 17767 16526 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_62470 19101 17767 gene locus_tag LOCUS_62480 19101 17767 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_62480 19739 19098 gene locus_tag LOCUS_62490 19739 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 >Feature sequence082 2815 3075 gene locus_tag LOCUS_62500 2815 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 4361 3072 gene locus_tag LOCUS_62510 4361 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 4838 6247 gene locus_tag LOCUS_62520 4838 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 6244 7545 gene locus_tag LOCUS_62530 6244 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 7542 8096 gene locus_tag LOCUS_62540 7542 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 9555 8140 gene locus_tag LOCUS_62550 9555 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 9875 9564 gene locus_tag LOCUS_62560 9875 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 10591 11904 gene locus_tag LOCUS_62570 10591 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 11917 12990 gene locus_tag LOCUS_62580 11917 12990 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_62580 14829 17147 gene locus_tag LOCUS_62590 14829 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 17605 17342 gene locus_tag LOCUS_62600 17605 17342 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305108.1 protein_id gnl|my_center|LOCUS_62600 17859 17602 gene locus_tag LOCUS_62610 17859 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 18211 17981 gene locus_tag LOCUS_62620 18211 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 >Feature sequence083 640 2304 gene locus_tag LOCUS_62630 640 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 2378 3709 gene locus_tag LOCUS_62640 2378 3709 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_62640 5111 3699 gene locus_tag LOCUS_62650 5111 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 5192 5392 gene locus_tag LOCUS_62660 5192 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 5400 7703 gene locus_tag LOCUS_62670 5400 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 7700 8671 gene locus_tag LOCUS_62680 7700 8671 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_62680 8668 9888 gene locus_tag LOCUS_62690 8668 9888 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_62690 9997 11421 gene locus_tag LOCUS_62700 9997 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 11418 13061 gene locus_tag LOCUS_62710 11418 13061 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122542.1 protein_id gnl|my_center|LOCUS_62710 13058 13789 gene locus_tag LOCUS_62720 13058 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 13795 16608 gene locus_tag LOCUS_62730 13795 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 >Feature sequence084 2579 819 gene locus_tag LOCUS_62740 2579 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 2593 2766 gene locus_tag LOCUS_62750 2593 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 5149 2921 gene locus_tag LOCUS_62760 5149 2921 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_62760 6183 5146 gene locus_tag LOCUS_62770 6183 5146 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_62770 7513 6257 gene locus_tag LOCUS_62780 7513 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974563.1 protein_id gnl|my_center|LOCUS_62780 7702 8940 gene locus_tag LOCUS_62790 7702 8940 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921469.1 protein_id gnl|my_center|LOCUS_62790 9111 10388 gene locus_tag LOCUS_62800 9111 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 10385 11833 gene locus_tag LOCUS_62810 10385 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 12980 11835 gene locus_tag LOCUS_62820 12980 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 13385 14707 gene locus_tag LOCUS_62830 13385 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 15619 14714 gene locus_tag LOCUS_62840 15619 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 15569 15937 gene locus_tag LOCUS_62850 15569 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 16444 16368 gene locus_tag LOCUS_t00490 16444 16368 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16680 16604 gene locus_tag LOCUS_t00500 16680 16604 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 843 2174 gene locus_tag LOCUS_62860 843 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 2319 2786 gene locus_tag LOCUS_62870 gene nrfC 2319 2786 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_62870 2834 4531 gene locus_tag LOCUS_62880 gene nrfA 2834 4531 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_62880 6071 4593 gene locus_tag LOCUS_62890 6071 4593 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_62890 6337 6068 gene locus_tag LOCUS_62900 6337 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 10523 6330 gene locus_tag LOCUS_62910 10523 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117982.1 protein_id gnl|my_center|LOCUS_62910 14806 10520 gene locus_tag LOCUS_62920 14806 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117982.1 protein_id gnl|my_center|LOCUS_62920 >Feature sequence086 2000 489 gene locus_tag LOCUS_62930 gene atpA 2000 489 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S3 protein_id gnl|my_center|LOCUS_62930 2631 2041 gene locus_tag LOCUS_62940 gene atpH 2631 2041 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB8 protein_id gnl|my_center|LOCUS_62940 3283 2642 gene locus_tag LOCUS_62950 3283 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 3784 3467 gene locus_tag LOCUS_62960 gene atpE 3784 3467 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC0 protein_id gnl|my_center|LOCUS_62960 4858 3989 gene locus_tag LOCUS_62970 gene atpB 4858 3989 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_62970 5335 4904 gene locus_tag LOCUS_62980 5335 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 5858 6580 gene locus_tag LOCUS_62990 5858 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 6802 7059 gene locus_tag LOCUS_63000 6802 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 7134 7610 gene locus_tag LOCUS_63010 7134 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 8420 7635 gene locus_tag LOCUS_63020 8420 7635 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_63020 9494 8442 gene locus_tag LOCUS_63030 9494 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 10232 9495 gene locus_tag LOCUS_63040 10232 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 10398 12938 gene locus_tag LOCUS_63050 gene hrpB 10398 12938 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_63050 13267 13590 gene locus_tag LOCUS_63060 13267 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 13694 14041 gene locus_tag LOCUS_63070 13694 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 >Feature sequence087 1625 738 gene locus_tag LOCUS_63080 1625 738 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_63080 3037 1802 gene locus_tag LOCUS_63090 3037 1802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_63090 3982 3110 gene locus_tag LOCUS_63100 3982 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 5523 4015 gene locus_tag LOCUS_63110 gene speE1 5523 4015 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_63110 5780 5562 gene locus_tag LOCUS_63120 5780 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 5961 5782 gene locus_tag LOCUS_63130 5961 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 7237 5978 gene locus_tag LOCUS_63140 7237 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63140 7875 7237 gene locus_tag LOCUS_63150 7875 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63150 8161 10812 gene locus_tag LOCUS_63160 8161 10812 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_63160 11508 10933 gene locus_tag LOCUS_63170 11508 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 11800 12651 gene locus_tag LOCUS_63180 gene cobB 11800 12651 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIH7 protein_id gnl|my_center|LOCUS_63180 12735 13637 gene locus_tag LOCUS_63190 12735 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 13682 14005 gene locus_tag LOCUS_63200 13682 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 >Feature sequence088 231 596 gene locus_tag LOCUS_63210 231 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 662 892 gene locus_tag LOCUS_63220 662 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 1084 7935 gene locus_tag LOCUS_63230 1084 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 7928 8596 gene locus_tag LOCUS_63240 7928 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 9288 8707 gene locus_tag LOCUS_63250 9288 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 9704 9285 gene locus_tag LOCUS_63260 9704 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 10252 9773 gene locus_tag LOCUS_63270 10252 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 10489 10839 gene locus_tag LOCUS_63280 10489 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 10839 11786 gene locus_tag LOCUS_63290 10839 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 11980 11813 gene locus_tag LOCUS_63300 11980 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 12373 12753 gene locus_tag LOCUS_63310 12373 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 13327 13638 gene locus_tag LOCUS_63320 13327 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 >Feature sequence089 793 1080 gene locus_tag LOCUS_63330 793 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 1083 2030 gene locus_tag LOCUS_63340 1083 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 2638 2057 gene locus_tag LOCUS_63350 2638 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 2534 3007 gene locus_tag LOCUS_63360 2534 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 3397 3035 gene locus_tag LOCUS_63370 3397 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 3583 5040 gene locus_tag LOCUS_63380 3583 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 5048 7030 gene locus_tag LOCUS_63390 5048 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 7030 7713 gene locus_tag LOCUS_63400 7030 7713 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_63400 8779 7733 gene locus_tag LOCUS_63410 8779 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 9773 8934 gene locus_tag LOCUS_63420 9773 8934 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63420 10831 9770 gene locus_tag LOCUS_63430 10831 9770 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405558.1 protein_id gnl|my_center|LOCUS_63430 11626 10991 gene locus_tag LOCUS_63440 11626 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 12428 11844 gene locus_tag LOCUS_63450 12428 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 12837 12439 gene locus_tag LOCUS_63460 12837 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 13193 12882 gene locus_tag LOCUS_63470 13193 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 >Feature sequence090 <1 1458 gene locus_tag LOCUS_63480 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205558.1:non-ribosomal peptide synthase 1619 3106 gene locus_tag LOCUS_63490 1619 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 3099 5555 gene locus_tag LOCUS_63500 3099 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_63500 5552 7144 gene locus_tag LOCUS_63510 5552 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 7195 9801 gene locus_tag LOCUS_63520 7195 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 12323 9897 gene locus_tag LOCUS_63530 12323 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 >Feature sequence091 <1 662 gene locus_tag LOCUS_63540 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCH5:adenosylhomocysteinase 800 1492 gene locus_tag LOCUS_63550 800 1492 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_63550 1657 3108 gene locus_tag LOCUS_63560 1657 3108 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_63560 3293 3703 gene locus_tag LOCUS_63570 3293 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_63570 3716 4147 gene locus_tag LOCUS_63580 3716 4147 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_63580 4855 4163 gene locus_tag LOCUS_63590 4855 4163 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_63590 5104 6105 gene locus_tag LOCUS_63600 5104 6105 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_63600 6402 8618 gene locus_tag LOCUS_63610 6402 8618 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121437.1 protein_id gnl|my_center|LOCUS_63610 8618 10108 gene locus_tag LOCUS_63620 8618 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 10321 11397 gene locus_tag LOCUS_63630 10321 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_63630 11695 >12052 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccctccgcgtgagggcgtgga >Feature sequence092 604 3417 gene locus_tag LOCUS_63640 604 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 3425 5440 gene locus_tag LOCUS_63650 gene pstA 3425 5440 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_63650 5718 6599 gene locus_tag LOCUS_63660 gene pstB 5718 6599 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_63660 6678 7370 gene locus_tag LOCUS_63670 gene phoU 6678 7370 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_63670 7450 8238 gene locus_tag LOCUS_63680 7450 8238 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_63680 8228 8692 gene locus_tag LOCUS_63690 8228 8692 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_63690 >Feature sequence093 1805 465 gene locus_tag LOCUS_63700 1805 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 3168 1936 gene locus_tag LOCUS_63710 3168 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 4181 4351 gene locus_tag LOCUS_63720 4181 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 5656 4370 gene locus_tag LOCUS_63730 5656 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 10378 5834 gene locus_tag LOCUS_63740 10378 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 <11462 10514 gene locus_tag LOCUS_63750 <11462 10514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533272.1:conjugal transfer protein TraG >Feature sequence094 263 2149 gene locus_tag LOCUS_63760 263 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 2146 2715 gene locus_tag LOCUS_63770 2146 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 2712 4394 gene locus_tag LOCUS_63780 2712 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 4391 4909 gene locus_tag LOCUS_63790 4391 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 4906 7278 gene locus_tag LOCUS_63800 4906 7278 CDS product CRISPR-associated RAMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387942.1 protein_id gnl|my_center|LOCUS_63800 7305 7583 gene locus_tag LOCUS_63810 7305 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 7931 8932 gene locus_tag LOCUS_63820 7931 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 9400 9652 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgaaaccaggcgccgccccttcgggggattgagac >Feature sequence095 110 451 gene locus_tag LOCUS_63830 110 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 1418 789 gene locus_tag LOCUS_63840 1418 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 2170 1403 gene locus_tag LOCUS_63850 2170 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 4696 3698 gene locus_tag LOCUS_63860 4696 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 5427 4771 gene locus_tag LOCUS_63870 5427 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 6101 5424 gene locus_tag LOCUS_63880 6101 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 6824 6126 gene locus_tag LOCUS_63890 6824 6126 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD1 protein_id gnl|my_center|LOCUS_63890 7210 6827 gene locus_tag LOCUS_63900 7210 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 8068 7322 gene locus_tag LOCUS_63910 8068 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 >Feature sequence096 <1 1239 gene locus_tag LOCUS_63920 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035372.1:transcriptional regulator 1366 1728 gene locus_tag LOCUS_63930 1366 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 1854 5069 gene locus_tag LOCUS_63940 1854 5069 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_63940 5378 6664 gene locus_tag LOCUS_63950 5378 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 >Feature sequence097 <1 1338 gene locus_tag LOCUS_63960 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074377.1:integrase 2454 4736 gene locus_tag LOCUS_63970 2454 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 5569 7065 gene locus_tag LOCUS_63980 5569 7065 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084718.1 protein_id gnl|my_center|LOCUS_63980 7712 7458 gene locus_tag LOCUS_63990 7712 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 7999 7709 gene locus_tag LOCUS_64000 7999 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 >Feature sequence098 2322 1699 gene locus_tag LOCUS_64010 2322 1699 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_64010 3544 2351 gene locus_tag LOCUS_64020 3544 2351 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_64020 6168 3799 gene locus_tag LOCUS_64030 6168 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 6437 6144 gene locus_tag LOCUS_64040 6437 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 7539 6550 gene locus_tag LOCUS_64050 7539 6550 CDS product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPZ1 protein_id gnl|my_center|LOCUS_64050 >Feature sequence099 <1 718 gene locus_tag LOCUS_64060 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074377.1:integrase note possible pseudo, frameshifted 676 1131 gene locus_tag LOCUS_64070 676 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64070 1171 1431 gene locus_tag LOCUS_64080 1171 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 1431 1712 gene locus_tag LOCUS_64090 1431 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 2135 3292 gene locus_tag LOCUS_64100 2135 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 3271 4500 gene locus_tag LOCUS_64110 3271 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 4638 4859 gene locus_tag LOCUS_64120 4638 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 5217 5035 gene locus_tag LOCUS_64130 5217 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 5263 7206 gene locus_tag LOCUS_64140 5263 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 >Feature sequence100 685 1431 gene locus_tag LOCUS_64150 685 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 1543 1926 gene locus_tag LOCUS_64160 1543 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 1929 2627 gene locus_tag LOCUS_64170 1929 2627 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD1 protein_id gnl|my_center|LOCUS_64170 2749 3330 gene locus_tag LOCUS_64180 2749 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 3327 4010 gene locus_tag LOCUS_64190 3327 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 4072 5604 gene locus_tag LOCUS_64200 4072 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 6191 5718 gene locus_tag LOCUS_64210 6191 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 7402 6557 gene locus_tag LOCUS_64220 7402 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 >Feature sequence101 69 1181 gene locus_tag LOCUS_64230 69 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 1193 1567 gene locus_tag LOCUS_64240 1193 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 2270 1683 gene locus_tag LOCUS_64250 2270 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 3558 2386 gene locus_tag LOCUS_64260 3558 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 4267 3863 gene locus_tag LOCUS_64270 4267 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 4606 5379 gene locus_tag LOCUS_64280 gene wzm 4606 5379 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTB8 protein_id gnl|my_center|LOCUS_64280 5495 7204 gene locus_tag LOCUS_64290 5495 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 >Feature sequence102 932 489 gene locus_tag LOCUS_64300 932 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 1620 1147 gene locus_tag LOCUS_64310 1620 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 1921 2463 gene locus_tag LOCUS_64320 1921 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 2785 2444 gene locus_tag LOCUS_64330 2785 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 6438 2788 gene locus_tag LOCUS_64340 6438 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64340 >Feature sequence103 5470 98 gene locus_tag LOCUS_64350 5470 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 5884 5651 gene locus_tag LOCUS_64360 5884 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 6365 5952 gene locus_tag LOCUS_64370 6365 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 >Feature sequence104 2119 1106 gene locus_tag LOCUS_64380 2119 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64380 2786 2058 gene locus_tag LOCUS_64390 2786 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 3239 4126 gene locus_tag LOCUS_64400 3239 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 >Feature sequence105 1430 1122 gene locus_tag LOCUS_64410 1430 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 3097 1676 gene locus_tag LOCUS_64420 3097 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 3455 3144 gene locus_tag LOCUS_64430 3455 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 4239 3676 gene locus_tag LOCUS_64440 4239 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 4704 4381 gene locus_tag LOCUS_64450 4704 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 >Feature sequence106 <1 2816 gene locus_tag LOCUS_64460 <1 2816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026867.1:polyketide synthase >Feature sequence107 2300 882 gene locus_tag LOCUS_64470 2300 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 3286 4170 gene locus_tag LOCUS_64480 3286 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 4427 4167 gene locus_tag LOCUS_64490 4427 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 >Feature sequence108 35 289 gene locus_tag LOCUS_64500 35 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 948 301 gene locus_tag LOCUS_64510 948 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 2136 3554 gene locus_tag LOCUS_64520 2136 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 >Feature sequence109 317 75 gene locus_tag LOCUS_64530 317 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 655 1434 gene locus_tag LOCUS_64540 655 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 2479 2237 gene locus_tag LOCUS_64550 2479 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 >Feature sequence110 113 280 gene locus_tag LOCUS_64560 113 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 1598 1245 gene locus_tag LOCUS_64570 1598 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 1834 2313 gene locus_tag LOCUS_64580 1834 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 2394 2813 gene locus_tag LOCUS_64590 2394 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 2810 3391 gene locus_tag LOCUS_64600 2810 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 3689 3459 gene locus_tag LOCUS_64610 3689 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 >Feature sequence111 <1 2599 gene locus_tag LOCUS_64620 <1 2599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267036.1:DEAD/DEAH box helicase 2602 2907 gene locus_tag LOCUS_64630 2602 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 3423 3046 gene locus_tag LOCUS_64640 3423 3046 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_64640 >Feature sequence112 >Feature sequence113 >Feature sequence114 1079 282 gene locus_tag LOCUS_64650 1079 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 1885 1109 gene locus_tag LOCUS_64660 1885 1109 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_64660 2038 2997 gene locus_tag LOCUS_64670 gene hemF 2038 2997 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XXN3 protein_id gnl|my_center|LOCUS_64670 >Feature sequence115 >Feature sequence116 108 1313 gene locus_tag LOCUS_64680 108 1313 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084954.1 protein_id gnl|my_center|LOCUS_64680 2875 1625 gene locus_tag LOCUS_64690 2875 1625 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084588.1 protein_id gnl|my_center|LOCUS_64690 >Feature sequence117 >Feature sequence118 <2682 132 gene locus_tag LOCUS_64700 <2682 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs >Feature sequence119 1684 8 gene locus_tag LOCUS_64710 1684 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 2301 1669 gene locus_tag LOCUS_64720 2301 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 >Feature sequence120 >Feature sequence121 678 85 gene locus_tag LOCUS_64730 678 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 1296 865 gene locus_tag LOCUS_64740 1296 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 1391 1316 gene locus_tag LOCUS_t00510 1391 1316 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 275 601 gene locus_tag LOCUS_64750 275 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 598 927 gene locus_tag LOCUS_64760 598 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 >Feature sequence123 >Feature sequence124 >Feature sequence125 44 748 gene locus_tag LOCUS_64770 44 748 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_64770