>Feature sequence0001 471 100 gene locus_tag LOCUS_00010 471 100 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_00010 3086 681 gene locus_tag LOCUS_00020 3086 681 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_00020 3664 3191 gene locus_tag LOCUS_00030 3664 3191 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_00030 5632 3875 gene locus_tag LOCUS_00040 gene fadD 5632 3875 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_00040 7813 6083 gene locus_tag LOCUS_00050 7813 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_00050 8709 7810 gene locus_tag LOCUS_00060 8709 7810 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_00060 10574 8709 gene locus_tag LOCUS_00070 gene mnmG 10574 8709 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_00070 11073 10651 gene locus_tag LOCUS_00080 gene ybeY 11073 10651 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_00080 11514 11074 gene locus_tag LOCUS_00090 11514 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12275 11511 gene locus_tag LOCUS_00100 gene xth 12275 11511 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_00100 12673 12311 gene locus_tag LOCUS_00110 12673 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_00110 13022 12666 gene locus_tag LOCUS_00120 13022 12666 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_00120 13303 13794 gene locus_tag LOCUS_00130 13303 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13939 15099 gene locus_tag LOCUS_00140 13939 15099 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_00140 15941 15102 gene locus_tag LOCUS_00150 15941 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16356 15922 gene locus_tag LOCUS_00160 16356 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_00160 16952 16362 gene locus_tag LOCUS_00170 16952 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_00170 20336 17034 gene locus_tag LOCUS_00180 20336 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21648 20476 gene locus_tag LOCUS_00190 21648 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22108 22578 gene locus_tag LOCUS_00200 22108 22578 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_00200 23016 22579 gene locus_tag LOCUS_00210 23016 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24101 23163 gene locus_tag LOCUS_00220 24101 23163 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYG1 protein_id gnl|my_center|LOCUS_00220 25075 24098 gene locus_tag LOCUS_00230 25075 24098 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence0002 1663 641 gene locus_tag LOCUS_00240 1663 641 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882917.1 protein_id gnl|my_center|LOCUS_00240 1883 2311 gene locus_tag LOCUS_00250 gene haaO 1883 2311 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_00250 2647 2402 gene locus_tag LOCUS_00260 2647 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 3111 2644 gene locus_tag LOCUS_00270 3111 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 3222 3803 gene locus_tag LOCUS_00280 3222 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_00280 4077 6404 gene locus_tag LOCUS_00290 gene pepN 4077 6404 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_00290 7124 6735 gene locus_tag LOCUS_00300 7124 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8490 7222 gene locus_tag LOCUS_00310 8490 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 11002 8501 gene locus_tag LOCUS_00320 11002 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 13508 11292 gene locus_tag LOCUS_00330 gene katG 13508 11292 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_00330 13726 13995 gene locus_tag LOCUS_00340 13726 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 14082 14900 gene locus_tag LOCUS_00350 14082 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 16739 15435 gene locus_tag LOCUS_00360 16739 15435 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_00360 16907 17701 gene locus_tag LOCUS_00370 16907 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 18927 17773 gene locus_tag LOCUS_00380 gene alr 18927 17773 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_00380 >Feature sequence0003 1399 959 gene locus_tag LOCUS_00390 1399 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 2264 1614 gene locus_tag LOCUS_00400 gene rpe 2264 1614 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_00400 3958 2318 gene locus_tag LOCUS_00410 3958 2318 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_00410 4586 3945 gene locus_tag LOCUS_00420 4586 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 4716 5342 gene locus_tag LOCUS_00430 4716 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5382 6287 gene locus_tag LOCUS_00440 gene hemF 5382 6287 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_00440 6318 6896 gene locus_tag LOCUS_00450 6318 6896 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_00450 7935 7345 gene locus_tag LOCUS_00460 gene ribE 7935 7345 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_00460 8064 8720 gene locus_tag LOCUS_00470 gene pcm 8064 8720 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_00470 8910 9443 gene locus_tag LOCUS_00480 8910 9443 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_00480 9489 10046 gene locus_tag LOCUS_00490 9489 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10043 10366 gene locus_tag LOCUS_00500 10043 10366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_00500 10380 11402 gene locus_tag LOCUS_00510 10380 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 14037 11584 gene locus_tag LOCUS_00520 14037 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 14863 14024 gene locus_tag LOCUS_00530 14863 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 15438 14860 gene locus_tag LOCUS_00540 15438 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 15935 15462 gene locus_tag LOCUS_00550 15935 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 17325 16210 gene locus_tag LOCUS_00560 17325 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 18911 17451 gene locus_tag LOCUS_00570 gene gatB 18911 17451 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_00570 <20392 18989 gene locus_tag LOCUS_00580 <20392 18989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YB4:alanine--tRNA ligase >Feature sequence0004 1689 973 gene locus_tag LOCUS_00590 1689 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2812 1682 gene locus_tag LOCUS_00600 2812 1682 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_00600 4124 2799 gene locus_tag LOCUS_00610 4124 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 5095 4193 gene locus_tag LOCUS_00620 5095 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 6018 5092 gene locus_tag LOCUS_00630 6018 5092 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_00630 7136 7384 gene locus_tag LOCUS_00640 7136 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 8505 7435 gene locus_tag LOCUS_00650 8505 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 11144 8511 gene locus_tag LOCUS_00660 11144 8511 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_00660 12039 11290 gene locus_tag LOCUS_00670 12039 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12562 13533 gene locus_tag LOCUS_00680 gene gldB 12562 13533 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_00680 14695 13502 gene locus_tag LOCUS_00690 14695 13502 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_00690 16675 14888 gene locus_tag LOCUS_00700 gene asnB 16675 14888 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964098.1 protein_id gnl|my_center|LOCUS_00700 17363 16677 gene locus_tag LOCUS_00710 gene nth 17363 16677 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_00710 17676 18545 gene locus_tag LOCUS_00720 17676 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18613 19410 gene locus_tag LOCUS_00730 18613 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0005 <1 606 gene locus_tag LOCUS_00740 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030607.1:phytanoyl-CoA dioxygenase 611 835 gene locus_tag LOCUS_00750 611 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00750 1208 2053 gene locus_tag LOCUS_00760 1208 2053 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_00760 3613 2162 gene locus_tag LOCUS_00770 3613 2162 CDS product PhoPQ-regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_00770 4066 3716 gene locus_tag LOCUS_00780 4066 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4507 4079 gene locus_tag LOCUS_00790 4507 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 7421 4710 gene locus_tag LOCUS_00800 7421 4710 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_00800 7669 8532 gene locus_tag LOCUS_00810 7669 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 12419 8757 gene locus_tag LOCUS_00820 12419 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14718 13159 gene locus_tag LOCUS_00830 14718 13159 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_00830 16140 14743 gene locus_tag LOCUS_00840 16140 14743 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_00840 17279 16149 gene locus_tag LOCUS_00850 17279 16149 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_00850 18969 17299 gene locus_tag LOCUS_00860 18969 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 <19503 18962 gene locus_tag LOCUS_00870 <19503 18962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119589.1:aryl-sulfate sulfohydrolase >Feature sequence0006 2441 1374 gene locus_tag LOCUS_00880 2441 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5287 2534 gene locus_tag LOCUS_00890 5287 2534 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_00890 5934 5284 gene locus_tag LOCUS_00900 5934 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6190 7110 gene locus_tag LOCUS_00910 gene lolI 6190 7110 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_00910 8221 7136 gene locus_tag LOCUS_00920 8221 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8493 8810 gene locus_tag LOCUS_00930 8493 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8946 10208 gene locus_tag LOCUS_00940 8946 10208 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_00940 10995 10264 gene locus_tag LOCUS_00950 10995 10264 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_00950 11097 12584 gene locus_tag LOCUS_00960 11097 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12581 13276 gene locus_tag LOCUS_00970 12581 13276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_00970 13587 13796 gene locus_tag LOCUS_00980 13587 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13966 15201 gene locus_tag LOCUS_00990 13966 15201 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_00990 15203 15664 gene locus_tag LOCUS_01000 15203 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 15922 16683 gene locus_tag LOCUS_01010 15922 16683 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_01010 18680 17319 gene locus_tag LOCUS_01020 18680 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence0007 1897 215 gene locus_tag LOCUS_01030 1897 215 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_01030 3256 2099 gene locus_tag LOCUS_01040 3256 2099 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_01040 4975 3503 gene locus_tag LOCUS_01050 4975 3503 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_01050 5278 5511 gene locus_tag LOCUS_01060 5278 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5508 6029 gene locus_tag LOCUS_01070 5508 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 6095 6253 gene locus_tag LOCUS_01080 6095 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 6882 6295 gene locus_tag LOCUS_01090 6882 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7777 7262 gene locus_tag LOCUS_01100 7777 7262 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_01100 7825 8754 gene locus_tag LOCUS_01110 7825 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8757 9449 gene locus_tag LOCUS_01120 8757 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9460 10332 gene locus_tag LOCUS_01130 9460 10332 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 protein_id gnl|my_center|LOCUS_01130 11081 12595 gene locus_tag LOCUS_01140 11081 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_01140 13920 13093 gene locus_tag LOCUS_01150 13920 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 14238 13939 gene locus_tag LOCUS_01160 14238 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 15217 14306 gene locus_tag LOCUS_01170 15217 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 16165 15296 gene locus_tag LOCUS_01180 16165 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_01180 16748 16200 gene locus_tag LOCUS_01190 16748 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_01190 17254 16748 gene locus_tag LOCUS_01200 17254 16748 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226054.1 protein_id gnl|my_center|LOCUS_01200 17966 17418 gene locus_tag LOCUS_01210 17966 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence0008 <1 1968 gene locus_tag LOCUS_01220 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931958.1:outer membrane protein assembly factor BamA 1968 2504 gene locus_tag LOCUS_01230 1968 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_01230 2522 3067 gene locus_tag LOCUS_01240 2522 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3257 3565 gene locus_tag LOCUS_01250 3257 3565 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_01250 4035 3664 gene locus_tag LOCUS_01260 4035 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7686 4123 gene locus_tag LOCUS_01270 7686 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8120 8659 gene locus_tag LOCUS_01280 8120 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9090 8779 gene locus_tag LOCUS_01290 9090 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9334 12150 gene locus_tag LOCUS_01300 gene polA 9334 12150 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_01300 12600 13985 gene locus_tag LOCUS_01310 gene radA 12600 13985 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_01310 14190 15515 gene locus_tag LOCUS_01320 14190 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15481 15765 gene locus_tag LOCUS_01330 15481 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 16787 15792 gene locus_tag LOCUS_01340 gene ddl 16787 15792 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_01340 16982 17575 gene locus_tag LOCUS_01350 16982 17575 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795958.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence0009 164 1537 gene locus_tag LOCUS_01360 164 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1572 2153 gene locus_tag LOCUS_01370 1572 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4883 2172 gene locus_tag LOCUS_01380 4883 2172 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_01380 5425 7158 gene locus_tag LOCUS_01390 5425 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7160 7936 gene locus_tag LOCUS_01400 7160 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8104 9348 gene locus_tag LOCUS_01410 gene selA 8104 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_01410 9368 10621 gene locus_tag LOCUS_01420 9368 10621 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_01420 11535 11083 gene locus_tag LOCUS_01430 11535 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 12180 11731 gene locus_tag LOCUS_01440 12180 11731 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974893.1 protein_id gnl|my_center|LOCUS_01440 12551 12177 gene locus_tag LOCUS_01450 12551 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 protein_id gnl|my_center|LOCUS_01450 14400 12694 gene locus_tag LOCUS_01460 14400 12694 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_01460 15131 15382 gene locus_tag LOCUS_01470 15131 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 15360 15797 gene locus_tag LOCUS_01480 15360 15797 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_01480 17374 15944 gene locus_tag LOCUS_01490 17374 15944 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence0010 351 2069 gene locus_tag LOCUS_01500 351 2069 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_01500 4722 2251 gene locus_tag LOCUS_01510 4722 2251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_01510 5564 4926 gene locus_tag LOCUS_01520 5564 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6148 5651 gene locus_tag LOCUS_01530 6148 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6425 6790 gene locus_tag LOCUS_01540 6425 6790 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_01540 6841 7239 gene locus_tag LOCUS_01550 6841 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 7318 7863 gene locus_tag LOCUS_01560 7318 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01560 8000 8335 gene locus_tag LOCUS_01570 8000 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8781 8362 gene locus_tag LOCUS_01580 8781 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 8932 9459 gene locus_tag LOCUS_01590 8932 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10208 9483 gene locus_tag LOCUS_01600 10208 9483 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_01600 10491 10763 gene locus_tag LOCUS_01610 10491 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 10744 11169 gene locus_tag LOCUS_01620 10744 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 11925 14327 gene locus_tag LOCUS_01630 11925 14327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence0011 1927 38 gene locus_tag LOCUS_01640 1927 38 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_01640 2459 2214 gene locus_tag LOCUS_01650 2459 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2566 2805 gene locus_tag LOCUS_01660 2566 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2802 3122 gene locus_tag LOCUS_01670 2802 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_01670 4247 3285 gene locus_tag LOCUS_01680 4247 3285 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_01680 5059 4274 gene locus_tag LOCUS_01690 5059 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_01690 6423 5308 gene locus_tag LOCUS_01700 6423 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 7908 6430 gene locus_tag LOCUS_01710 7908 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 8967 7930 gene locus_tag LOCUS_01720 8967 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9138 9347 gene locus_tag LOCUS_01730 9138 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 9316 9636 gene locus_tag LOCUS_01740 9316 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9636 11648 gene locus_tag LOCUS_01750 9636 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 12950 11757 gene locus_tag LOCUS_01760 12950 11757 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_01760 14264 13131 gene locus_tag LOCUS_01770 14264 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15800 14391 gene locus_tag LOCUS_01780 15800 14391 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_01780 16624 15833 gene locus_tag LOCUS_01790 16624 15833 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence0012 2711 1530 gene locus_tag LOCUS_01800 2711 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_01800 3921 2920 gene locus_tag LOCUS_01810 3921 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4718 4086 gene locus_tag LOCUS_01820 4718 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 6979 4865 gene locus_tag LOCUS_01830 6979 4865 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_01830 7925 7035 gene locus_tag LOCUS_01840 7925 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_01840 8493 8092 gene locus_tag LOCUS_01850 8493 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 8928 8515 gene locus_tag LOCUS_01860 8928 8515 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_01860 9505 8990 gene locus_tag LOCUS_01870 9505 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9874 9608 gene locus_tag LOCUS_01880 9874 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 11385 10051 gene locus_tag LOCUS_01890 11385 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_01890 12530 11763 gene locus_tag LOCUS_01900 12530 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12705 14648 gene locus_tag LOCUS_01910 12705 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14645 15379 gene locus_tag LOCUS_01920 14645 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 16144 15380 gene locus_tag LOCUS_01930 16144 15380 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0013 3600 2557 gene locus_tag LOCUS_01940 3600 2557 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_01940 4483 3878 gene locus_tag LOCUS_01950 4483 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4818 5678 gene locus_tag LOCUS_01960 gene hisG 4818 5678 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_01960 5882 7174 gene locus_tag LOCUS_01970 gene hisD 5882 7174 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_01970 7174 8232 gene locus_tag LOCUS_01980 gene hisC 7174 8232 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 protein_id gnl|my_center|LOCUS_01980 8305 9399 gene locus_tag LOCUS_01990 gene hisB 8305 9399 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_01990 10567 9497 gene locus_tag LOCUS_02000 10567 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11014 10589 gene locus_tag LOCUS_02010 11014 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 11169 11954 gene locus_tag LOCUS_02020 11169 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12895 12014 gene locus_tag LOCUS_02030 12895 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_02030 13002 13754 gene locus_tag LOCUS_02040 13002 13754 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_02040 15000 13732 gene locus_tag LOCUS_02050 15000 13732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_02050 14949 16190 gene locus_tag LOCUS_02060 14949 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence0014 1027 122 gene locus_tag LOCUS_02070 gene atpB 1027 122 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_02070 1552 1166 gene locus_tag LOCUS_02080 1552 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 2231 1791 gene locus_tag LOCUS_02090 2231 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 3097 2234 gene locus_tag LOCUS_02100 3097 2234 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_02100 3292 5793 gene locus_tag LOCUS_02110 3292 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 5880 8156 gene locus_tag LOCUS_02120 gene mrcA 5880 8156 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_02120 8282 10087 gene locus_tag LOCUS_02130 gene uvrC 8282 10087 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_02130 10918 10106 gene locus_tag LOCUS_02140 10918 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 12567 10960 gene locus_tag LOCUS_02150 gene gldM 12567 10960 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_02150 13408 12608 gene locus_tag LOCUS_02160 13408 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 14553 13459 gene locus_tag LOCUS_02170 14553 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15644 14673 gene locus_tag LOCUS_02180 15644 14673 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence0015 2094 400 gene locus_tag LOCUS_02190 2094 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 2770 2102 gene locus_tag LOCUS_02200 2770 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2949 3428 gene locus_tag LOCUS_02210 2949 3428 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043733.1 protein_id gnl|my_center|LOCUS_02210 3526 4581 gene locus_tag LOCUS_02220 gene kbl 3526 4581 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L232 protein_id gnl|my_center|LOCUS_02220 4696 5934 gene locus_tag LOCUS_02230 4696 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7769 5940 gene locus_tag LOCUS_02240 7769 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8102 7788 gene locus_tag LOCUS_02250 8102 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 8161 8985 gene locus_tag LOCUS_02260 8161 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9923 9186 gene locus_tag LOCUS_02270 gene hisA 9923 9186 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_02270 11169 10105 gene locus_tag LOCUS_02280 11169 10105 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118968.1 protein_id gnl|my_center|LOCUS_02280 12627 11512 gene locus_tag LOCUS_02290 12627 11512 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_02290 13828 12953 gene locus_tag LOCUS_02300 13828 12953 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_02300 <15906 13841 gene locus_tag LOCUS_02310 <15906 13841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117959.1:glycosyl hydrolase >Feature sequence0016 422 2440 gene locus_tag LOCUS_02320 422 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02320 2746 4950 gene locus_tag LOCUS_02330 2746 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4957 8697 gene locus_tag LOCUS_02340 4957 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8694 9836 gene locus_tag LOCUS_02350 8694 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_02350 9861 11006 gene locus_tag LOCUS_02360 9861 11006 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_02360 11007 12167 gene locus_tag LOCUS_02370 11007 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12170 12520 gene locus_tag LOCUS_02380 12170 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12611 13042 gene locus_tag LOCUS_02390 12611 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence0017 1992 2519 gene locus_tag LOCUS_02400 1992 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2568 2966 gene locus_tag LOCUS_02410 2568 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2920 3081 gene locus_tag LOCUS_02420 2920 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3190 3564 gene locus_tag LOCUS_02430 3190 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4253 5563 gene locus_tag LOCUS_02440 4253 5563 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860655.1 protein_id gnl|my_center|LOCUS_02440 5959 7518 gene locus_tag LOCUS_02450 gene atsA 5959 7518 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_02450 7499 8833 gene locus_tag LOCUS_02460 7499 8833 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_02460 8961 10994 gene locus_tag LOCUS_02470 8961 10994 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_02470 10991 11437 gene locus_tag LOCUS_02480 10991 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 11475 12671 gene locus_tag LOCUS_02490 11475 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 12680 13570 gene locus_tag LOCUS_02500 12680 13570 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_02500 13612 14376 gene locus_tag LOCUS_02510 13612 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence0018 4083 4805 gene locus_tag LOCUS_02520 4083 4805 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_02520 4819 6360 gene locus_tag LOCUS_02530 4819 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6505 7110 gene locus_tag LOCUS_02540 6505 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7262 7930 gene locus_tag LOCUS_02550 7262 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7951 8502 gene locus_tag LOCUS_02560 7951 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8733 9344 gene locus_tag LOCUS_02570 8733 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 9355 10083 gene locus_tag LOCUS_02580 9355 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence0019 816 2780 gene locus_tag LOCUS_02590 gene glgB 816 2780 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L3 protein_id gnl|my_center|LOCUS_02590 3695 2817 gene locus_tag LOCUS_02600 3695 2817 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_02600 4075 5172 gene locus_tag LOCUS_02610 4075 5172 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_02610 5162 5863 gene locus_tag LOCUS_02620 5162 5863 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_02620 7048 5867 gene locus_tag LOCUS_02630 gene uxuA 7048 5867 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_02630 8084 7272 gene locus_tag LOCUS_02640 8084 7272 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_02640 9590 8157 gene locus_tag LOCUS_02650 gene uxaC 9590 8157 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_02650 9777 10799 gene locus_tag LOCUS_02660 9777 10799 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_02660 12524 10848 gene locus_tag LOCUS_02670 12524 10848 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_02670 <14741 12543 gene locus_tag LOCUS_02680 <14741 12543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0020 759 523 gene locus_tag LOCUS_02690 759 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 1335 958 gene locus_tag LOCUS_02700 1335 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2871 4283 gene locus_tag LOCUS_02710 2871 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4294 7494 gene locus_tag LOCUS_02720 4294 7494 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202647.1 protein_id gnl|my_center|LOCUS_02720 7714 9051 gene locus_tag LOCUS_02730 7714 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 9355 9083 gene locus_tag LOCUS_02740 9355 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 9983 9513 gene locus_tag LOCUS_02750 9983 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 10287 10078 gene locus_tag LOCUS_02760 10287 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10313 10963 gene locus_tag LOCUS_02770 10313 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12085 11312 gene locus_tag LOCUS_02780 12085 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12767 13957 gene locus_tag LOCUS_02790 12767 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence0021 315 1538 gene locus_tag LOCUS_02800 gene ribBA 315 1538 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_02800 1647 2282 gene locus_tag LOCUS_02810 1647 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2288 3070 gene locus_tag LOCUS_02820 gene surE 2288 3070 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_02820 3970 3137 gene locus_tag LOCUS_02830 3970 3137 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_02830 4217 5032 gene locus_tag LOCUS_02840 4217 5032 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_02840 5045 5998 gene locus_tag LOCUS_02850 5045 5998 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_02850 5995 6360 gene locus_tag LOCUS_02860 5995 6360 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_02860 7229 6357 gene locus_tag LOCUS_02870 7229 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_02870 8367 7216 gene locus_tag LOCUS_02880 gene crtY 8367 7216 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_02880 9184 8432 gene locus_tag LOCUS_02890 9184 8432 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_02890 9565 11523 gene locus_tag LOCUS_02900 gene gyrB 9565 11523 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 protein_id gnl|my_center|LOCUS_02900 11642 13762 gene locus_tag LOCUS_02910 11642 13762 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_02910 14049 13840 gene locus_tag LOCUS_02920 14049 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence0022 1554 1345 gene locus_tag LOCUS_02930 1554 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_02930 2610 1585 gene locus_tag LOCUS_02940 gene pdxA 2610 1585 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_02940 2810 3592 gene locus_tag LOCUS_02950 gene rsmA 2810 3592 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_02950 3580 4947 gene locus_tag LOCUS_02960 gene mgtE 3580 4947 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_02960 5430 6038 gene locus_tag LOCUS_02970 5430 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6659 6309 gene locus_tag LOCUS_02980 6659 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8496 6769 gene locus_tag LOCUS_02990 gene aceK 8496 6769 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_02990 8985 9653 gene locus_tag LOCUS_03000 8985 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9653 10291 gene locus_tag LOCUS_03010 9653 10291 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_03010 10339 11592 gene locus_tag LOCUS_03020 10339 11592 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_03020 11621 11935 gene locus_tag LOCUS_03030 11621 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 13140 12061 gene locus_tag LOCUS_03040 13140 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 13877 13155 gene locus_tag LOCUS_03050 gene dapB 13877 13155 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence0023 1352 501 gene locus_tag LOCUS_03060 gene tktA 1352 501 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_03060 1822 1373 gene locus_tag LOCUS_03070 1822 1373 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_03070 3773 1848 gene locus_tag LOCUS_03080 3773 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4485 3760 gene locus_tag LOCUS_03090 4485 3760 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_03090 5170 4490 gene locus_tag LOCUS_03100 5170 4490 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_03100 6618 5167 gene locus_tag LOCUS_03110 6618 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 6747 7490 gene locus_tag LOCUS_03120 6747 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 7852 10662 gene locus_tag LOCUS_03130 7852 10662 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_03130 10948 11409 gene locus_tag LOCUS_03140 10948 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 11419 11874 gene locus_tag LOCUS_03150 11419 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_03150 <13889 12116 gene locus_tag LOCUS_03160 <13889 12116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001151639.1:D-3-phosphoglycerate dehydrogenase >Feature sequence0024 966 1208 gene locus_tag LOCUS_03170 966 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1599 3251 gene locus_tag LOCUS_03180 1599 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5212 3614 gene locus_tag LOCUS_03190 gene rny 5212 3614 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_03190 5530 5246 gene locus_tag LOCUS_03200 5530 5246 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_03200 5816 5532 gene locus_tag LOCUS_03210 5816 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8230 5819 gene locus_tag LOCUS_03220 gene pheT 8230 5819 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_03220 9609 9388 gene locus_tag LOCUS_03230 9609 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10289 9606 gene locus_tag LOCUS_03240 10289 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10470 10279 gene locus_tag LOCUS_03250 10470 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 11156 10470 gene locus_tag LOCUS_03260 11156 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 13065 11146 gene locus_tag LOCUS_03270 13065 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence0025 424 101 gene locus_tag LOCUS_03280 424 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 858 1586 gene locus_tag LOCUS_03290 858 1586 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361993.1 protein_id gnl|my_center|LOCUS_03290 1793 1587 gene locus_tag LOCUS_03300 1793 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2107 3057 gene locus_tag LOCUS_03310 2107 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03310 3112 3678 gene locus_tag LOCUS_03320 3112 3678 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970854.1 protein_id gnl|my_center|LOCUS_03320 3681 4403 gene locus_tag LOCUS_03330 3681 4403 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708757.1 protein_id gnl|my_center|LOCUS_03330 5164 4907 gene locus_tag LOCUS_03340 5164 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6500 7993 gene locus_tag LOCUS_03350 6500 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8019 11216 gene locus_tag LOCUS_03360 8019 11216 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_03360 11579 12901 gene locus_tag LOCUS_03370 11579 12901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_03370 13150 12932 gene locus_tag LOCUS_03380 13150 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0026 991 527 gene locus_tag LOCUS_03390 991 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 1430 1954 gene locus_tag LOCUS_03400 1430 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3948 2257 gene locus_tag LOCUS_03410 3948 2257 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_03410 5165 4026 gene locus_tag LOCUS_03420 5165 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 5325 5714 gene locus_tag LOCUS_03430 5325 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6310 5729 gene locus_tag LOCUS_03440 6310 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6551 7876 gene locus_tag LOCUS_03450 gene dbpA 6551 7876 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_03450 8659 7892 gene locus_tag LOCUS_03460 8659 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 9395 8652 gene locus_tag LOCUS_03470 9395 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10575 9370 gene locus_tag LOCUS_03480 10575 9370 CDS product copper-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_03480 11271 10942 gene locus_tag LOCUS_03490 11271 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 12191 11625 gene locus_tag LOCUS_03500 12191 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_03500 <13723 12294 gene locus_tag LOCUS_03510 <13723 12294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403087.1:nitrous-oxide reductase >Feature sequence0027 2184 61 gene locus_tag LOCUS_03520 2184 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2279 3577 gene locus_tag LOCUS_03530 gene murF 2279 3577 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_03530 3650 4345 gene locus_tag LOCUS_03540 3650 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4486 5082 gene locus_tag LOCUS_03550 4486 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5275 5736 gene locus_tag LOCUS_03560 5275 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5733 6173 gene locus_tag LOCUS_03570 5733 6173 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979180.1 protein_id gnl|my_center|LOCUS_03570 6308 6937 gene locus_tag LOCUS_03580 gene queE 6308 6937 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_03580 6942 8870 gene locus_tag LOCUS_03590 6942 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 9403 12426 gene locus_tag LOCUS_03600 9403 12426 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence0028 2507 1107 gene locus_tag LOCUS_03610 2507 1107 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_03610 3018 2737 gene locus_tag LOCUS_03620 3018 2737 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 protein_id gnl|my_center|LOCUS_03620 4654 3266 gene locus_tag LOCUS_03630 4654 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5863 4661 gene locus_tag LOCUS_03640 5863 4661 CDS product dehydrogenase MviM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706516.1 protein_id gnl|my_center|LOCUS_03640 6765 5947 gene locus_tag LOCUS_03650 6765 5947 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_03650 6969 7952 gene locus_tag LOCUS_03660 6969 7952 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_03660 8414 11602 gene locus_tag LOCUS_03670 8414 11602 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_03670 11624 13228 gene locus_tag LOCUS_03680 11624 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence0029 883 1728 gene locus_tag LOCUS_03690 883 1728 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705040.1 protein_id gnl|my_center|LOCUS_03690 1682 2500 gene locus_tag LOCUS_03700 1682 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2599 3720 gene locus_tag LOCUS_03710 2599 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4093 5283 gene locus_tag LOCUS_03720 4093 5283 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_03720 6576 5485 gene locus_tag LOCUS_03730 6576 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7201 6659 gene locus_tag LOCUS_03740 7201 6659 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203650.1 protein_id gnl|my_center|LOCUS_03740 10195 7391 gene locus_tag LOCUS_03750 10195 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 10376 11029 gene locus_tag LOCUS_03760 10376 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11051 11422 gene locus_tag LOCUS_03770 11051 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 12825 11746 gene locus_tag LOCUS_03780 gene prfA 12825 11746 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_03780 >Feature sequence0030 2419 1070 gene locus_tag LOCUS_03790 2419 1070 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_03790 3790 2432 gene locus_tag LOCUS_03800 3790 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_03800 3980 5218 gene locus_tag LOCUS_03810 3980 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5404 7092 gene locus_tag LOCUS_03820 5404 7092 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_03820 7670 7942 gene locus_tag LOCUS_03830 7670 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8098 8373 gene locus_tag LOCUS_03840 8098 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8469 9329 gene locus_tag LOCUS_03850 8469 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9451 10272 gene locus_tag LOCUS_03860 9451 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230326.1 protein_id gnl|my_center|LOCUS_03860 10391 11740 gene locus_tag LOCUS_03870 10391 11740 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_03870 11953 13053 gene locus_tag LOCUS_03880 11953 13053 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706350.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence0031 2390 918 gene locus_tag LOCUS_03890 2390 918 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_03890 4014 2662 gene locus_tag LOCUS_03900 4014 2662 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_03900 4248 5126 gene locus_tag LOCUS_03910 4248 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5416 6729 gene locus_tag LOCUS_03920 5416 6729 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_03920 6824 7579 gene locus_tag LOCUS_03930 6824 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7648 9924 gene locus_tag LOCUS_03940 7648 9924 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_03940 9921 10796 gene locus_tag LOCUS_03950 gene fdhD 9921 10796 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_03950 11850 10807 gene locus_tag LOCUS_03960 gene pam 11850 10807 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_03960 12046 12825 gene locus_tag LOCUS_03970 12046 12825 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0032 75 518 gene locus_tag LOCUS_03980 75 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 520 1716 gene locus_tag LOCUS_03990 gene yciC 520 1716 CDS product putative metal chaperone YciC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94400 protein_id gnl|my_center|LOCUS_03990 1727 1909 gene locus_tag LOCUS_04000 1727 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1960 2799 gene locus_tag LOCUS_04010 1960 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3680 2838 gene locus_tag LOCUS_04020 3680 2838 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_04020 4431 3724 gene locus_tag LOCUS_04030 4431 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_04030 5507 4431 gene locus_tag LOCUS_04040 5507 4431 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_04040 5648 6487 gene locus_tag LOCUS_04050 5648 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7603 6491 gene locus_tag LOCUS_04060 7603 6491 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_04060 7821 8243 gene locus_tag LOCUS_04070 7821 8243 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 protein_id gnl|my_center|LOCUS_04070 8474 8244 gene locus_tag LOCUS_04080 8474 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8642 9115 gene locus_tag LOCUS_04090 8642 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9679 9179 gene locus_tag LOCUS_04100 9679 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085261.1 protein_id gnl|my_center|LOCUS_04100 9936 10409 gene locus_tag LOCUS_04110 gene rlmH 9936 10409 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_04110 10717 11544 gene locus_tag LOCUS_04120 10717 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12819 11584 gene locus_tag LOCUS_04130 12819 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence0033 1617 622 gene locus_tag LOCUS_04140 1617 622 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_04140 2996 1989 gene locus_tag LOCUS_04150 2996 1989 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_04150 3941 3312 gene locus_tag LOCUS_04160 3941 3312 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_04160 4384 3941 gene locus_tag LOCUS_04170 4384 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4664 4401 gene locus_tag LOCUS_04180 4664 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5544 4753 gene locus_tag LOCUS_04190 5544 4753 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_04190 6315 5647 gene locus_tag LOCUS_04200 gene folE2 6315 5647 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_04200 6715 6305 gene locus_tag LOCUS_04210 gene ygcM 6715 6305 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_04210 7009 7719 gene locus_tag LOCUS_04220 7009 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9399 7708 gene locus_tag LOCUS_04230 9399 7708 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_04230 10275 9430 gene locus_tag LOCUS_04240 gene kdsA 10275 9430 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV0 protein_id gnl|my_center|LOCUS_04240 10829 10278 gene locus_tag LOCUS_04250 10829 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 12372 10831 gene locus_tag LOCUS_04260 12372 10831 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0034 1646 582 gene locus_tag LOCUS_04270 1646 582 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_04270 2368 4197 gene locus_tag LOCUS_04280 2368 4197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_04280 4194 5246 gene locus_tag LOCUS_04290 4194 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5715 5395 gene locus_tag LOCUS_04300 5715 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_04300 6131 5712 gene locus_tag LOCUS_04310 6131 5712 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_04310 6217 6936 gene locus_tag LOCUS_04320 6217 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_04320 7865 6942 gene locus_tag LOCUS_04330 gene pyrB 7865 6942 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_04330 8416 7874 gene locus_tag LOCUS_04340 gene pyrR1 8416 7874 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_04340 10062 8497 gene locus_tag LOCUS_04350 10062 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 10649 10119 gene locus_tag LOCUS_04360 10649 10119 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_04360 10681 12339 gene locus_tag LOCUS_04370 10681 12339 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_04370 12346 12633 gene locus_tag LOCUS_04380 12346 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence0035 <1 1170 gene locus_tag LOCUS_04390 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919625.1:glucosylceramidase 1367 4510 gene locus_tag LOCUS_04400 1367 4510 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_04400 4529 6175 gene locus_tag LOCUS_04410 4529 6175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_04410 6175 7416 gene locus_tag LOCUS_04420 6175 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7441 9003 gene locus_tag LOCUS_04430 7441 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9269 10954 gene locus_tag LOCUS_04440 gene egl2 9269 10954 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_04440 11491 11171 gene locus_tag LOCUS_04450 11491 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 11610 12131 gene locus_tag LOCUS_04460 11610 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_04460 12139 12558 gene locus_tag LOCUS_04470 12139 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933873.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence0036 1550 225 gene locus_tag LOCUS_04480 1550 225 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_04480 2084 1800 gene locus_tag LOCUS_04490 2084 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04490 2810 2157 gene locus_tag LOCUS_04500 2810 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04500 8064 3259 gene locus_tag LOCUS_04510 8064 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_04510 8622 9560 gene locus_tag LOCUS_04520 gene gnl 8622 9560 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_04520 12116 9738 gene locus_tag LOCUS_04530 12116 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence0037 1200 145 gene locus_tag LOCUS_04540 gene lpxK 1200 145 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_04540 1243 2343 gene locus_tag LOCUS_04550 1243 2343 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_04550 2347 3111 gene locus_tag LOCUS_04560 2347 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_04560 3221 3643 gene locus_tag LOCUS_04570 3221 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4250 3621 gene locus_tag LOCUS_04580 gene gpm 4250 3621 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_04580 4305 4727 gene locus_tag LOCUS_04590 gene menI 4305 4727 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83KW0 protein_id gnl|my_center|LOCUS_04590 4729 5940 gene locus_tag LOCUS_04600 4729 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_04600 6120 7628 gene locus_tag LOCUS_04610 gene menD 6120 7628 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_04610 8800 7676 gene locus_tag LOCUS_04620 8800 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10300 8813 gene locus_tag LOCUS_04630 10300 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11781 10315 gene locus_tag LOCUS_04640 11781 10315 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_04640 <12776 11787 gene locus_tag LOCUS_04650 <12776 11787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0038 1193 435 gene locus_tag LOCUS_04660 1193 435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_04660 1983 1186 gene locus_tag LOCUS_04670 1983 1186 CDS product putative ABC transporter permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE51 protein_id gnl|my_center|LOCUS_04670 2405 2031 gene locus_tag LOCUS_04680 2405 2031 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_04680 2828 4204 gene locus_tag LOCUS_04690 2828 4204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_04690 4770 5231 gene locus_tag LOCUS_04700 4770 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5282 6625 gene locus_tag LOCUS_04710 gene xylE 5282 6625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_04710 6618 7505 gene locus_tag LOCUS_04720 6618 7505 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_04720 7931 7536 gene locus_tag LOCUS_04730 7931 7536 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_04730 8524 7982 gene locus_tag LOCUS_04740 gene greA 8524 7982 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_04740 8807 10108 gene locus_tag LOCUS_04750 8807 10108 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_04750 12055 11174 gene locus_tag LOCUS_04760 12055 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 <12719 12112 gene locus_tag LOCUS_04770 <12719 12112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962245.1:2-hydroxyacid dehydrogenase >Feature sequence0039 2335 200 gene locus_tag LOCUS_04780 2335 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4263 2728 gene locus_tag LOCUS_04790 4263 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4424 7315 gene locus_tag LOCUS_04800 gene gcvP 4424 7315 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_04800 7715 9148 gene locus_tag LOCUS_04810 7715 9148 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_04810 9111 9875 gene locus_tag LOCUS_04820 9111 9875 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023523.1 protein_id gnl|my_center|LOCUS_04820 10028 9900 gene locus_tag LOCUS_04830 10028 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10540 10394 gene locus_tag LOCUS_04840 10540 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10604 11200 gene locus_tag LOCUS_04850 10604 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence0040 <1 1953 gene locus_tag LOCUS_04860 <1 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706114.1:catecholate siderophore receptor CirA 1977 3041 gene locus_tag LOCUS_04870 1977 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3615 3163 gene locus_tag LOCUS_04880 3615 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3740 4711 gene locus_tag LOCUS_04890 3740 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4708 4950 gene locus_tag LOCUS_04900 4708 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5564 4956 gene locus_tag LOCUS_04910 gene coaE 5564 4956 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_04910 6522 5557 gene locus_tag LOCUS_04920 6522 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6845 6531 gene locus_tag LOCUS_04930 6845 6531 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_04930 7382 6849 gene locus_tag LOCUS_04940 7382 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_04940 7698 7396 gene locus_tag LOCUS_04950 7698 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8886 7711 gene locus_tag LOCUS_04960 gene nusB 8886 7711 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_04960 10129 9029 gene locus_tag LOCUS_04970 gene vdh 10129 9029 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_04970 10332 12065 gene locus_tag LOCUS_04980 10332 12065 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_04980 12170 12478 gene locus_tag LOCUS_04990 12170 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence0041 187 426 gene locus_tag LOCUS_05000 187 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 485 1960 gene locus_tag LOCUS_05010 485 1960 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_05010 2024 3076 gene locus_tag LOCUS_05020 2024 3076 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 protein_id gnl|my_center|LOCUS_05020 3446 4300 gene locus_tag LOCUS_05030 3446 4300 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_05030 4725 6224 gene locus_tag LOCUS_05040 4725 6224 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_05040 6241 7695 gene locus_tag LOCUS_05050 gene arsA 6241 7695 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_05050 7804 11328 gene locus_tag LOCUS_05060 7804 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence0042 1552 1187 gene locus_tag LOCUS_05070 1552 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2693 2043 gene locus_tag LOCUS_05080 2693 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4574 2868 gene locus_tag LOCUS_05090 4574 2868 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_05090 5121 4567 gene locus_tag LOCUS_05100 5121 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5476 6312 gene locus_tag LOCUS_05110 5476 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 8398 6365 gene locus_tag LOCUS_05120 8398 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_05120 8586 9785 gene locus_tag LOCUS_05130 8586 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9973 10530 gene locus_tag LOCUS_05140 9973 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10541 11305 gene locus_tag LOCUS_05150 10541 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 11302 12270 gene locus_tag LOCUS_05160 11302 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence0043 <1 1054 gene locus_tag LOCUS_05170 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791103.1:cytochrome c4 1361 2458 gene locus_tag LOCUS_05180 1361 2458 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_05180 2720 3634 gene locus_tag LOCUS_05190 2720 3634 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD2 protein_id gnl|my_center|LOCUS_05190 3698 4912 gene locus_tag LOCUS_05200 gene aroA 3698 4912 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_05200 5388 5627 gene locus_tag LOCUS_05210 5388 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5702 6004 gene locus_tag LOCUS_05220 5702 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6019 6834 gene locus_tag LOCUS_05230 gene pheA 6019 6834 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_05230 6834 7976 gene locus_tag LOCUS_05240 gene aspC3 6834 7976 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_05240 8154 9002 gene locus_tag LOCUS_05250 gene tyrA 8154 9002 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_05250 9351 9989 gene locus_tag LOCUS_05260 9351 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 <12168 9991 gene locus_tag LOCUS_05270 <12168 9991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208034.1:phospholipase C, phosphocholine-specific >Feature sequence0044 <1 599 gene locus_tag LOCUS_05280 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118436.1:DNA ligase-associated DEXH box helicase 744 2657 gene locus_tag LOCUS_05290 744 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4146 2695 gene locus_tag LOCUS_05300 4146 2695 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_05300 5494 4148 gene locus_tag LOCUS_05310 5494 4148 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_05310 6271 5597 gene locus_tag LOCUS_05320 6271 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7558 6308 gene locus_tag LOCUS_05330 7558 6308 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765517.1 protein_id gnl|my_center|LOCUS_05330 8561 7548 gene locus_tag LOCUS_05340 8561 7548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_05340 8735 9787 gene locus_tag LOCUS_05350 8735 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_05350 9784 11007 gene locus_tag LOCUS_05360 gene mntH 9784 11007 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_05360 11225 11635 gene locus_tag LOCUS_05370 gene osmC 11225 11635 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_05370 11731 11991 gene locus_tag LOCUS_05380 11731 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence0045 <1 910 gene locus_tag LOCUS_05390 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963198.1:DNA polymerase III subunit delta 928 3915 gene locus_tag LOCUS_05400 928 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_05400 3931 5607 gene locus_tag LOCUS_05410 3931 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5703 6473 gene locus_tag LOCUS_05420 5703 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6475 7167 gene locus_tag LOCUS_05430 6475 7167 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_05430 7169 7561 gene locus_tag LOCUS_05440 7169 7561 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_05440 7564 8523 gene locus_tag LOCUS_05450 7564 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8527 9810 gene locus_tag LOCUS_05460 gene folC 8527 9810 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_05460 9767 9970 gene locus_tag LOCUS_05470 9767 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 9973 10632 gene locus_tag LOCUS_05480 gene trmB 9973 10632 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_05480 11320 10862 gene locus_tag LOCUS_05490 11320 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_05490 11754 11320 gene locus_tag LOCUS_05500 11754 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0046 1202 684 gene locus_tag LOCUS_05510 1202 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 2247 1405 gene locus_tag LOCUS_05520 2247 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3308 2262 gene locus_tag LOCUS_05530 3308 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5744 3312 gene locus_tag LOCUS_05540 5744 3312 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_05540 7104 6094 gene locus_tag LOCUS_05550 7104 6094 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_05550 8852 7350 gene locus_tag LOCUS_05560 gene araA 8852 7350 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_05560 10751 8886 gene locus_tag LOCUS_05570 gene yidK 10751 8886 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_05570 11567 10857 gene locus_tag LOCUS_05580 11567 10857 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0047 4104 2992 gene locus_tag LOCUS_05590 4104 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_05590 4497 4826 gene locus_tag LOCUS_05600 4497 4826 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_05600 4830 6740 gene locus_tag LOCUS_05610 4830 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7045 8445 gene locus_tag LOCUS_05620 7045 8445 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_05620 9152 8505 gene locus_tag LOCUS_05630 9152 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10372 9284 gene locus_tag LOCUS_05640 10372 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11329 10604 gene locus_tag LOCUS_05650 11329 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11813 11364 gene locus_tag LOCUS_05660 11813 11364 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence0048 2514 1453 gene locus_tag LOCUS_05670 gene fba 2514 1453 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173534.1 protein_id gnl|my_center|LOCUS_05670 5318 2538 gene locus_tag LOCUS_05680 5318 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6351 5419 gene locus_tag LOCUS_05690 6351 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 6832 7863 gene locus_tag LOCUS_05700 6832 7863 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_05700 8075 10507 gene locus_tag LOCUS_05710 8075 10507 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence0049 2 1738 gene locus_tag LOCUS_05720 2 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1945 4377 gene locus_tag LOCUS_05730 1945 4377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05730 4499 6949 gene locus_tag LOCUS_05740 4499 6949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05740 7030 9438 gene locus_tag LOCUS_05750 7030 9438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence0050 1305 1156 gene locus_tag LOCUS_05760 1305 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1914 1552 gene locus_tag LOCUS_05770 1914 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05770 2865 4067 gene locus_tag LOCUS_05780 2865 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 6276 4075 gene locus_tag LOCUS_05790 6276 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6693 9149 gene locus_tag LOCUS_05800 gene chb 6693 9149 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence0051 3 524 gene locus_tag LOCUS_05810 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 615 4091 gene locus_tag LOCUS_05820 615 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_05820 4783 4316 gene locus_tag LOCUS_05830 4783 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4947 4780 gene locus_tag LOCUS_05840 4947 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5133 7004 gene locus_tag LOCUS_05850 5133 7004 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_05850 7546 7265 gene locus_tag LOCUS_05860 7546 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_05860 7932 7543 gene locus_tag LOCUS_05870 7932 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8237 9145 gene locus_tag LOCUS_05880 8237 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9592 10194 gene locus_tag LOCUS_05890 9592 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11234 10479 gene locus_tag LOCUS_05900 11234 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence0052 <1 890 gene locus_tag LOCUS_05910 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532900.1:oxidoreductase subunit beta 975 1430 gene locus_tag LOCUS_05920 975 1430 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_05920 1449 3713 gene locus_tag LOCUS_05930 1449 3713 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_05930 3943 4446 gene locus_tag LOCUS_05940 3943 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 4586 5419 gene locus_tag LOCUS_05950 4586 5419 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_05950 6018 5737 gene locus_tag LOCUS_05960 6018 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6304 8682 gene locus_tag LOCUS_05970 6304 8682 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_05970 8684 10198 gene locus_tag LOCUS_05980 8684 10198 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_05980 10213 11652 gene locus_tag LOCUS_05990 10213 11652 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence0053 1573 1244 gene locus_tag LOCUS_06000 1573 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485389.1 protein_id gnl|my_center|LOCUS_06000 2017 1577 gene locus_tag LOCUS_06010 2017 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2337 2017 gene locus_tag LOCUS_06020 2337 2017 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040014.1 protein_id gnl|my_center|LOCUS_06020 2903 2478 gene locus_tag LOCUS_06030 2903 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3880 3053 gene locus_tag LOCUS_06040 3880 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_06040 4314 5129 gene locus_tag LOCUS_06050 4314 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6933 6724 gene locus_tag LOCUS_06060 6933 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7386 7063 gene locus_tag LOCUS_06070 7386 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 7532 7978 gene locus_tag LOCUS_06080 7532 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8112 8747 gene locus_tag LOCUS_06090 8112 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9440 9252 gene locus_tag LOCUS_06100 9440 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10666 9833 gene locus_tag LOCUS_06110 10666 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 <11640 10765 gene locus_tag LOCUS_06120 <11640 10765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005805141.1:transposase >Feature sequence0054 551 261 gene locus_tag LOCUS_06130 551 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_06130 3039 685 gene locus_tag LOCUS_06140 3039 685 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_06140 3118 3885 gene locus_tag LOCUS_06150 3118 3885 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_06150 3888 4874 gene locus_tag LOCUS_06160 3888 4874 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 protein_id gnl|my_center|LOCUS_06160 6166 4940 gene locus_tag LOCUS_06170 6166 4940 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_06170 6321 7577 gene locus_tag LOCUS_06180 6321 7577 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_06180 7580 8965 gene locus_tag LOCUS_06190 7580 8965 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_06190 10789 9083 gene locus_tag LOCUS_06200 gene ggt 10789 9083 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_06200 11251 10919 gene locus_tag LOCUS_06210 11251 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence0055 509 207 gene locus_tag LOCUS_06220 509 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2251 851 gene locus_tag LOCUS_06230 2251 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2538 2879 gene locus_tag LOCUS_06240 gene ytxJ 2538 2879 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_06240 3802 3161 gene locus_tag LOCUS_06250 3802 3161 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_06250 4250 7525 gene locus_tag LOCUS_06260 4250 7525 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_06260 7775 9103 gene locus_tag LOCUS_06270 7775 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403050.1 protein_id gnl|my_center|LOCUS_06270 9142 10611 gene locus_tag LOCUS_06280 9142 10611 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ33 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0056 41 994 gene locus_tag LOCUS_06290 41 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1314 1688 gene locus_tag LOCUS_06300 gene groES-2 1314 1688 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_06300 2591 1893 gene locus_tag LOCUS_06310 2591 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3982 3059 gene locus_tag LOCUS_06320 gene hemB 3982 3059 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_06320 4810 4091 gene locus_tag LOCUS_06330 4810 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5507 4815 gene locus_tag LOCUS_06340 5507 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6102 5554 gene locus_tag LOCUS_06350 6102 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6597 6352 gene locus_tag LOCUS_06360 6597 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7732 7070 gene locus_tag LOCUS_06370 7732 7070 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_06370 9178 7907 gene locus_tag LOCUS_06380 gene rocD 9178 7907 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_06380 9572 9814 gene locus_tag LOCUS_06390 gene rpmB 9572 9814 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_06390 9847 10029 gene locus_tag LOCUS_06400 gene rpmG 9847 10029 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_06400 10070 10222 gene locus_tag LOCUS_06410 10070 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10313 11269 gene locus_tag LOCUS_06420 gene ftsY 10313 11269 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0057 1471 1893 gene locus_tag LOCUS_06430 1471 1893 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_06430 2310 1900 gene locus_tag LOCUS_06440 2310 1900 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_06440 3523 2423 gene locus_tag LOCUS_06450 3523 2423 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_06450 3735 4313 gene locus_tag LOCUS_06460 3735 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5203 4397 gene locus_tag LOCUS_06470 5203 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6475 5378 gene locus_tag LOCUS_06480 gene ychF 6475 5378 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_06480 7570 6488 gene locus_tag LOCUS_06490 7570 6488 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_06490 8022 7693 gene locus_tag LOCUS_06500 8022 7693 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_06500 8542 8195 gene locus_tag LOCUS_06510 gene fdx1 8542 8195 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_06510 8684 9700 gene locus_tag LOCUS_06520 8684 9700 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_06520 <11435 9683 gene locus_tag LOCUS_06530 <11435 9683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064963.1:histidine kinase >Feature sequence0058 1555 98 gene locus_tag LOCUS_06540 1555 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_06540 4662 1555 gene locus_tag LOCUS_06550 4662 1555 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_06550 6015 5536 gene locus_tag LOCUS_06560 6015 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6662 6093 gene locus_tag LOCUS_06570 gene ygfA 6662 6093 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_06570 8226 6655 gene locus_tag LOCUS_06580 gene bshC 8226 6655 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_06580 8543 9778 gene locus_tag LOCUS_06590 8543 9778 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_06590 10131 10613 gene locus_tag LOCUS_06600 gene ispF 10131 10613 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_06600 10613 11299 gene locus_tag LOCUS_06610 10613 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence0059 206 913 gene locus_tag LOCUS_06620 206 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3759 916 gene locus_tag LOCUS_06630 3759 916 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_06630 5868 3949 gene locus_tag LOCUS_06640 5868 3949 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_06640 6511 5990 gene locus_tag LOCUS_06650 6511 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6872 7348 gene locus_tag LOCUS_06660 6872 7348 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_06660 7627 9072 gene locus_tag LOCUS_06670 gene ycf24 7627 9072 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_06670 9109 9870 gene locus_tag LOCUS_06680 gene sufC 9109 9870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_06680 9905 11182 gene locus_tag LOCUS_06690 gene sufD 9905 11182 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence0060 541 194 gene locus_tag LOCUS_06700 541 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1622 579 gene locus_tag LOCUS_06710 1622 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2016 1798 gene locus_tag LOCUS_06720 2016 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2236 3297 gene locus_tag LOCUS_06730 gene rlmN 2236 3297 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_06730 3711 4178 gene locus_tag LOCUS_06740 3711 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5112 4183 gene locus_tag LOCUS_06750 5112 4183 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_06750 5918 5115 gene locus_tag LOCUS_06760 5918 5115 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_06760 7793 5922 gene locus_tag LOCUS_06770 gene mutL 7793 5922 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_06770 8200 7790 gene locus_tag LOCUS_06780 8200 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence0061 1433 2005 gene locus_tag LOCUS_06790 1433 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2008 5331 gene locus_tag LOCUS_06800 2008 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 5328 8690 gene locus_tag LOCUS_06810 5328 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 8851 10200 gene locus_tag LOCUS_06820 8851 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 10385 11017 gene locus_tag LOCUS_06830 gene rsmG 10385 11017 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_06830 >Feature sequence0062 151 468 gene locus_tag LOCUS_06840 151 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 529 822 gene locus_tag LOCUS_06850 529 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1042 1950 gene locus_tag LOCUS_06860 1042 1950 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_06860 2874 2356 gene locus_tag LOCUS_06870 2874 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3764 3453 gene locus_tag LOCUS_06880 3764 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4528 3929 gene locus_tag LOCUS_06890 4528 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5627 4812 gene locus_tag LOCUS_06900 5627 4812 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942221.1 protein_id gnl|my_center|LOCUS_06900 6543 5935 gene locus_tag LOCUS_06910 6543 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7128 7700 gene locus_tag LOCUS_06920 7128 7700 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_06920 7850 8248 gene locus_tag LOCUS_06930 7850 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687566.1 protein_id gnl|my_center|LOCUS_06930 9516 8563 gene locus_tag LOCUS_06940 9516 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 9739 10896 gene locus_tag LOCUS_06950 9739 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence0063 2316 391 gene locus_tag LOCUS_06960 2316 391 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_06960 2862 2371 gene locus_tag LOCUS_06970 2862 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_06970 2863 3120 gene locus_tag LOCUS_06980 2863 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3567 3238 gene locus_tag LOCUS_06990 3567 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4504 3737 gene locus_tag LOCUS_07000 4504 3737 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_07000 5979 4645 gene locus_tag LOCUS_07010 5979 4645 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_07010 6084 6157 gene locus_tag LOCUS_t00010 6084 6157 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6365 6853 gene locus_tag LOCUS_07020 6365 6853 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_07020 6843 7271 gene locus_tag LOCUS_07030 6843 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7268 7810 gene locus_tag LOCUS_07040 7268 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801902.1 protein_id gnl|my_center|LOCUS_07040 7982 8500 gene locus_tag LOCUS_07050 7982 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 8976 9569 gene locus_tag LOCUS_07060 8976 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9867 10742 gene locus_tag LOCUS_07070 9867 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence0064 3285 139 gene locus_tag LOCUS_07080 3285 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4803 3373 gene locus_tag LOCUS_07090 gene arsA 4803 3373 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_07090 5496 5050 gene locus_tag LOCUS_07100 5496 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6599 5508 gene locus_tag LOCUS_07110 gene pfkA 6599 5508 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ0 protein_id gnl|my_center|LOCUS_07110 6770 7507 gene locus_tag LOCUS_07120 6770 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_07120 7583 8827 gene locus_tag LOCUS_07130 gene mnmA 7583 8827 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_07130 10183 9074 gene locus_tag LOCUS_07140 10183 9074 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_07140 10805 10173 gene locus_tag LOCUS_07150 10805 10173 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_07150 10996 11070 gene locus_tag LOCUS_t00020 10996 11070 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0065 666 460 gene locus_tag LOCUS_07160 666 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2154 1027 gene locus_tag LOCUS_07170 2154 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2958 2158 gene locus_tag LOCUS_07180 2958 2158 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_07180 4171 3650 gene locus_tag LOCUS_07190 4171 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5626 4235 gene locus_tag LOCUS_07200 5626 4235 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403781.1 protein_id gnl|my_center|LOCUS_07200 5964 7073 gene locus_tag LOCUS_07210 5964 7073 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_07210 7384 7133 gene locus_tag LOCUS_07220 7384 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8647 7409 gene locus_tag LOCUS_07230 8647 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_07230 10858 8654 gene locus_tag LOCUS_07240 10858 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence0066 3522 5057 gene locus_tag LOCUS_07250 3522 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5048 6220 gene locus_tag LOCUS_07260 5048 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7350 8204 gene locus_tag LOCUS_07270 7350 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8216 9538 gene locus_tag LOCUS_07280 8216 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence0067 251 640 gene locus_tag LOCUS_07290 251 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 758 1747 gene locus_tag LOCUS_07300 758 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941376.1 protein_id gnl|my_center|LOCUS_07300 4175 1812 gene locus_tag LOCUS_07310 4175 1812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_07310 4707 5444 gene locus_tag LOCUS_07320 4707 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5463 6266 gene locus_tag LOCUS_07330 5463 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6779 6342 gene locus_tag LOCUS_07340 6779 6342 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_07340 7632 6772 gene locus_tag LOCUS_07350 gene tatC 7632 6772 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_07350 8916 7648 gene locus_tag LOCUS_07360 gene glyA 8916 7648 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_07360 <10733 9065 gene locus_tag LOCUS_07370 <10733 9065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor >Feature sequence0068 <1 697 gene locus_tag LOCUS_07380 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119313.1:sialidase 1952 705 gene locus_tag LOCUS_07390 1952 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5007 1972 gene locus_tag LOCUS_07400 5007 1972 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_07400 5367 7337 gene locus_tag LOCUS_07410 5367 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_07410 7799 9160 gene locus_tag LOCUS_07420 7799 9160 CDS product xylitol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0069 581 2692 gene locus_tag LOCUS_07430 581 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3125 6325 gene locus_tag LOCUS_07440 3125 6325 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_07440 6361 7839 gene locus_tag LOCUS_07450 6361 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_07450 7936 9663 gene locus_tag LOCUS_07460 7936 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0070 1503 343 gene locus_tag LOCUS_07470 1503 343 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_07470 1723 1493 gene locus_tag LOCUS_07480 1723 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2732 1701 gene locus_tag LOCUS_07490 2732 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_07490 4031 2826 gene locus_tag LOCUS_07500 4031 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_07500 5156 4104 gene locus_tag LOCUS_07510 5156 4104 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_07510 5568 6353 gene locus_tag LOCUS_07520 5568 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7298 6516 gene locus_tag LOCUS_07530 7298 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10190 7539 gene locus_tag LOCUS_07540 10190 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0071 1349 588 gene locus_tag LOCUS_07550 1349 588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_07550 2417 1521 gene locus_tag LOCUS_07560 gene fjo11 2417 1521 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_07560 3419 2418 gene locus_tag LOCUS_07570 3419 2418 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_07570 3457 4398 gene locus_tag LOCUS_07580 3457 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4391 4597 gene locus_tag LOCUS_07590 4391 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4599 5438 gene locus_tag LOCUS_07600 4599 5438 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_07600 5511 6788 gene locus_tag LOCUS_07610 gene gdhA 5511 6788 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S582 protein_id gnl|my_center|LOCUS_07610 6862 7521 gene locus_tag LOCUS_07620 gene psd 6862 7521 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_07620 8210 7791 gene locus_tag LOCUS_07630 8210 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8791 8414 gene locus_tag LOCUS_07640 8791 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8967 9569 gene locus_tag LOCUS_07650 8967 9569 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_07650 9721 10266 gene locus_tag LOCUS_07660 9721 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0072 <1 750 gene locus_tag LOCUS_07670 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105032.1:non-ribosomal peptide synthetase 919 4323 gene locus_tag LOCUS_07680 919 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4320 5033 gene locus_tag LOCUS_07690 4320 5033 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195517.1 protein_id gnl|my_center|LOCUS_07690 5175 6590 gene locus_tag LOCUS_07700 5175 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence0073 902 375 gene locus_tag LOCUS_07710 902 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_07710 1428 979 gene locus_tag LOCUS_07720 1428 979 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_07720 2335 1535 gene locus_tag LOCUS_07730 2335 1535 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405393.1 protein_id gnl|my_center|LOCUS_07730 4126 2603 gene locus_tag LOCUS_07740 4126 2603 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_07740 7311 4438 gene locus_tag LOCUS_07750 7311 4438 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_07750 8252 7365 gene locus_tag LOCUS_07760 8252 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 9067 8612 gene locus_tag LOCUS_07770 9067 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 <10380 9165 gene locus_tag LOCUS_07780 <10380 9165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:permease >Feature sequence0074 1323 289 gene locus_tag LOCUS_07790 gene ctaC 1323 289 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_07790 2637 1345 gene locus_tag LOCUS_07800 gene actF 2637 1345 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_07800 3275 2640 gene locus_tag LOCUS_07810 3275 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3810 3280 gene locus_tag LOCUS_07820 gene actD 3810 3280 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_07820 5179 3815 gene locus_tag LOCUS_07830 gene actC 5179 3815 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_07830 8279 5199 gene locus_tag LOCUS_07840 gene actB 8279 5199 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_07840 9576 8317 gene locus_tag LOCUS_07850 gene actA 9576 8317 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_07850 10138 10208 gene locus_tag LOCUS_t00030 10138 10208 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0075 1801 3141 gene locus_tag LOCUS_07860 1801 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_07860 4337 3621 gene locus_tag LOCUS_07870 4337 3621 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_07870 7042 5576 gene locus_tag LOCUS_07880 7042 5576 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_07880 9345 7801 gene locus_tag LOCUS_07890 9345 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 <10321 9342 gene locus_tag LOCUS_07900 <10321 9342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808330.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence0076 491 1981 gene locus_tag LOCUS_07910 491 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4659 2170 gene locus_tag LOCUS_07920 4659 2170 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_07920 5252 5043 gene locus_tag LOCUS_07930 5252 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5672 5597 gene locus_tag LOCUS_t00040 5672 5597 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6442 5825 gene locus_tag LOCUS_07940 6442 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7340 6432 gene locus_tag LOCUS_07950 gene rssA 7340 6432 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_07950 7405 7827 gene locus_tag LOCUS_07960 7405 7827 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0077 128 280 gene locus_tag LOCUS_07970 128 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 587 955 gene locus_tag LOCUS_07980 587 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 972 2390 gene locus_tag LOCUS_07990 972 2390 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_07990 2592 2816 gene locus_tag LOCUS_08000 2592 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2797 3273 gene locus_tag LOCUS_08010 2797 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_08010 3263 3850 gene locus_tag LOCUS_08020 3263 3850 CDS product tryptophan repressor-binding protein (wrbA) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877850.1 protein_id gnl|my_center|LOCUS_08020 4992 3883 gene locus_tag LOCUS_08030 4992 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5189 6535 gene locus_tag LOCUS_08040 5189 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence0078 2057 1164 gene locus_tag LOCUS_08050 2057 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3208 2117 gene locus_tag LOCUS_08060 3208 2117 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_08060 3741 3938 gene locus_tag LOCUS_08070 3741 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4884 4387 gene locus_tag LOCUS_08080 4884 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5885 5439 gene locus_tag LOCUS_08090 5885 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_08090 6637 5972 gene locus_tag LOCUS_08100 6637 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7581 6643 gene locus_tag LOCUS_08110 7581 6643 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642344.1 protein_id gnl|my_center|LOCUS_08110 7935 9929 gene locus_tag LOCUS_08120 7935 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence0079 2461 158 gene locus_tag LOCUS_08130 2461 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3814 2540 gene locus_tag LOCUS_08140 3814 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5597 3855 gene locus_tag LOCUS_08150 5597 3855 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_08150 8976 5641 gene locus_tag LOCUS_08160 8976 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence0080 <1 1105 gene locus_tag LOCUS_08170 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803946.1:glycosyl transferase 2240 1683 gene locus_tag LOCUS_08180 2240 1683 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_08180 2373 3284 gene locus_tag LOCUS_08190 2373 3284 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403447.1 protein_id gnl|my_center|LOCUS_08190 4599 3379 gene locus_tag LOCUS_08200 gene wcaJ 4599 3379 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_08200 6089 5064 gene locus_tag LOCUS_08210 6089 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762717.1 protein_id gnl|my_center|LOCUS_08210 6764 6207 gene locus_tag LOCUS_08220 6764 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 7012 6812 gene locus_tag LOCUS_08230 7012 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 8768 7182 gene locus_tag LOCUS_08240 8768 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0081 984 1733 gene locus_tag LOCUS_08250 984 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2379 3527 gene locus_tag LOCUS_08260 2379 3527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_08260 4949 3732 gene locus_tag LOCUS_08270 4949 3732 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_08270 5562 5005 gene locus_tag LOCUS_08280 5562 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_08280 8216 5910 gene locus_tag LOCUS_08290 8216 5910 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769101.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence0082 405 833 gene locus_tag LOCUS_08300 405 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 897 1421 gene locus_tag LOCUS_08310 897 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2175 1678 gene locus_tag LOCUS_08320 2175 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5811 2404 gene locus_tag LOCUS_08330 5811 2404 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_08330 6946 5819 gene locus_tag LOCUS_08340 6946 5819 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_08340 8363 6978 gene locus_tag LOCUS_08350 8363 6978 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_08350 8970 8347 gene locus_tag LOCUS_08360 8970 8347 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0083 1152 2501 gene locus_tag LOCUS_08370 gene purB 1152 2501 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_08370 2660 4222 gene locus_tag LOCUS_08380 2660 4222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_08380 5119 4214 gene locus_tag LOCUS_08390 5119 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_08390 6091 5177 gene locus_tag LOCUS_08400 6091 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_08400 7156 6209 gene locus_tag LOCUS_08410 7156 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9745 7217 gene locus_tag LOCUS_08420 gene clpC 9745 7217 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence0084 <1 1496 gene locus_tag LOCUS_08430 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109108.1:SusC/RagA family TonB-linked outer membrane protein 1516 3273 gene locus_tag LOCUS_08440 1516 3273 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_08440 3263 4948 gene locus_tag LOCUS_08450 3263 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5131 6519 gene locus_tag LOCUS_08460 5131 6519 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_08460 6546 6938 gene locus_tag LOCUS_08470 6546 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6955 8328 gene locus_tag LOCUS_08480 6955 8328 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_08480 8572 8859 gene locus_tag LOCUS_08490 8572 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_08490 8978 9199 gene locus_tag LOCUS_08500 8978 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08500 9217 9549 gene locus_tag LOCUS_08510 9217 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence0085 <1 1004 gene locus_tag LOCUS_08520 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462892.1:prolyl endopeptidase 1001 1429 gene locus_tag LOCUS_08530 1001 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3124 1493 gene locus_tag LOCUS_08540 3124 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5173 3164 gene locus_tag LOCUS_08550 5173 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7096 5465 gene locus_tag LOCUS_08560 7096 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8816 7515 gene locus_tag LOCUS_08570 8816 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence0086 1651 734 gene locus_tag LOCUS_08580 1651 734 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_08580 3944 1734 gene locus_tag LOCUS_08590 gene dpp4 3944 1734 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_08590 5117 4239 gene locus_tag LOCUS_08600 5117 4239 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103119.1 protein_id gnl|my_center|LOCUS_08600 5406 6866 gene locus_tag LOCUS_08610 5406 6866 CDS product serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122093.1 protein_id gnl|my_center|LOCUS_08610 <9937 7771 gene locus_tag LOCUS_08620 <9937 7771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence0087 941 567 gene locus_tag LOCUS_08630 941 567 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496939.1 protein_id gnl|my_center|LOCUS_08630 1171 938 gene locus_tag LOCUS_08640 1171 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1379 2473 gene locus_tag LOCUS_08650 1379 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2653 2892 gene locus_tag LOCUS_08660 2653 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2882 3208 gene locus_tag LOCUS_08670 2882 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4030 3299 gene locus_tag LOCUS_08680 4030 3299 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_08680 5985 4090 gene locus_tag LOCUS_08690 5985 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963813.1 protein_id gnl|my_center|LOCUS_08690 6539 5982 gene locus_tag LOCUS_08700 6539 5982 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_08700 8034 6610 gene locus_tag LOCUS_08710 8034 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8178 9188 gene locus_tag LOCUS_08720 gene ykfB 8178 9188 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_08720 9349 9600 gene locus_tag LOCUS_08730 9349 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence0088 <1 671 gene locus_tag LOCUS_08740 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0C9:dihydrolipoyl dehydrogenase 2595 1021 gene locus_tag LOCUS_08750 2595 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2773 3264 gene locus_tag LOCUS_08760 gene defA 2773 3264 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 protein_id gnl|my_center|LOCUS_08760 3392 6211 gene locus_tag LOCUS_08770 gene carB 3392 6211 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_08770 6303 6560 gene locus_tag LOCUS_08780 6303 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9631 6575 gene locus_tag LOCUS_08790 9631 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence0089 174 1388 gene locus_tag LOCUS_08800 174 1388 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_08800 1385 2761 gene locus_tag LOCUS_08810 1385 2761 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_08810 3183 4187 gene locus_tag LOCUS_08820 3183 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 6063 4663 gene locus_tag LOCUS_08830 6063 4663 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_08830 7318 6287 gene locus_tag LOCUS_08840 7318 6287 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_08840 7482 9590 gene locus_tag LOCUS_08850 7482 9590 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence0090 1497 1099 gene locus_tag LOCUS_08860 1497 1099 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404441.1 protein_id gnl|my_center|LOCUS_08860 1768 1490 gene locus_tag LOCUS_08870 gene mrpF 1768 1490 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_08870 2247 1765 gene locus_tag LOCUS_08880 gene mrpE 2247 1765 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_08880 3767 2244 gene locus_tag LOCUS_08890 gene mrpD 3767 2244 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_08890 4117 3764 gene locus_tag LOCUS_08900 gene mrpC 4117 3764 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_08900 4529 4119 gene locus_tag LOCUS_08910 gene mrpB 4529 4119 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_08910 6834 4531 gene locus_tag LOCUS_08920 6834 4531 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 protein_id gnl|my_center|LOCUS_08920 7075 9630 gene locus_tag LOCUS_08930 gene ppc 7075 9630 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0091 1 1656 gene locus_tag LOCUS_08940 1 1656 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_08940 3878 1704 gene locus_tag LOCUS_08950 3878 1704 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_08950 4145 5656 gene locus_tag LOCUS_08960 gene treA 4145 5656 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHG0 protein_id gnl|my_center|LOCUS_08960 5707 7053 gene locus_tag LOCUS_08970 5707 7053 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_08970 8642 7152 gene locus_tag LOCUS_08980 8642 7152 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_08980 9598 8666 gene locus_tag LOCUS_08990 9598 8666 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence0092 617 535 gene locus_tag LOCUS_t00050 617 535 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 752 2974 gene locus_tag LOCUS_09000 gene relA 752 2974 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_09000 3047 3514 gene locus_tag LOCUS_09010 3047 3514 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_09010 3511 3855 gene locus_tag LOCUS_09020 3511 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3994 3836 gene locus_tag LOCUS_09030 3994 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3993 4292 gene locus_tag LOCUS_09040 3993 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4435 5700 gene locus_tag LOCUS_09050 gene purA 4435 5700 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_09050 5903 8212 gene locus_tag LOCUS_09060 5903 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8214 9236 gene locus_tag LOCUS_09070 gene porP 8214 9236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0093 226 999 gene locus_tag LOCUS_09080 226 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2404 1049 gene locus_tag LOCUS_09090 gene kmo 2404 1049 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_09090 3720 2431 gene locus_tag LOCUS_09100 gene kynU 3720 2431 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_09100 3888 4268 gene locus_tag LOCUS_09110 gene yjgF 3888 4268 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_09110 4902 4459 gene locus_tag LOCUS_09120 4902 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4961 5434 gene locus_tag LOCUS_09130 4961 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5506 6906 gene locus_tag LOCUS_09140 gene fumC 5506 6906 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_09140 6925 7245 gene locus_tag LOCUS_09150 6925 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0094 1604 330 gene locus_tag LOCUS_09160 gene rodA 1604 330 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_09160 3407 1608 gene locus_tag LOCUS_09170 3407 1608 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_09170 3928 3407 gene locus_tag LOCUS_09180 gene mreD 3928 3407 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_09180 4754 3921 gene locus_tag LOCUS_09190 4754 3921 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_09190 5790 4762 gene locus_tag LOCUS_09200 gene mreB 5790 4762 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_09200 6009 6479 gene locus_tag LOCUS_09210 gene rimP 6009 6479 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_09210 6485 7732 gene locus_tag LOCUS_09220 gene nusA 6485 7732 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_09220 >Feature sequence0095 699 184 gene locus_tag LOCUS_09230 699 184 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHW5 protein_id gnl|my_center|LOCUS_09230 859 1443 gene locus_tag LOCUS_09240 859 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1495 4311 gene locus_tag LOCUS_09250 gene uvrA1 1495 4311 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_09250 5353 4850 gene locus_tag LOCUS_09260 5353 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5713 6756 gene locus_tag LOCUS_09270 gene hemH 5713 6756 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_09270 7270 8160 gene locus_tag LOCUS_09280 7270 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8248 8850 gene locus_tag LOCUS_09290 8248 8850 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_09290 9419 9078 gene locus_tag LOCUS_09300 9419 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0096 3590 2121 gene locus_tag LOCUS_09310 3590 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_09310 6579 3637 gene locus_tag LOCUS_09320 6579 3637 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_09320 8631 7639 gene locus_tag LOCUS_09330 gene fabH 8631 7639 CDS product protein GumO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637793.2 protein_id gnl|my_center|LOCUS_09330 >Feature sequence0097 545 844 gene locus_tag LOCUS_09340 545 844 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_09340 837 1175 gene locus_tag LOCUS_09350 837 1175 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_09350 1424 1260 gene locus_tag LOCUS_09360 1424 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1650 1408 gene locus_tag LOCUS_09370 1650 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2310 1750 gene locus_tag LOCUS_09380 2310 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_09380 2670 3959 gene locus_tag LOCUS_09390 2670 3959 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_09390 4064 4390 gene locus_tag LOCUS_09400 4064 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7156 4802 gene locus_tag LOCUS_09410 7156 4802 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_09410 7433 8410 gene locus_tag LOCUS_09420 7433 8410 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_09420 <9543 8587 gene locus_tag LOCUS_09430 <9543 8587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258398.1:amylosucrase >Feature sequence0098 4766 6331 gene locus_tag LOCUS_09440 4766 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 7764 6334 gene locus_tag LOCUS_09450 7764 6334 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_09450 9033 7774 gene locus_tag LOCUS_09460 9033 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence0099 4590 2749 gene locus_tag LOCUS_09470 gene glmS 4590 2749 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_09470 6019 4712 gene locus_tag LOCUS_09480 6019 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 6851 6036 gene locus_tag LOCUS_09490 6851 6036 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_09490 7064 7825 gene locus_tag LOCUS_09500 gene panC 7064 7825 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_09500 7847 8194 gene locus_tag LOCUS_09510 gene panD 7847 8194 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_09510 8451 9197 gene locus_tag LOCUS_09520 8451 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence0100 1819 239 gene locus_tag LOCUS_09530 gene prfC 1819 239 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WR5 protein_id gnl|my_center|LOCUS_09530 3173 1935 gene locus_tag LOCUS_09540 gene porY 3173 1935 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_09540 3317 3787 gene locus_tag LOCUS_09550 3317 3787 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_09550 4756 3842 gene locus_tag LOCUS_09560 gene lipA 4756 3842 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_09560 5512 4781 gene locus_tag LOCUS_09570 5512 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5743 6291 gene locus_tag LOCUS_09580 5743 6291 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_09580 6272 7642 gene locus_tag LOCUS_09590 6272 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7644 8606 gene locus_tag LOCUS_09600 7644 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence0101 2 208 gene locus_tag LOCUS_09610 2 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 218 1291 gene locus_tag LOCUS_09620 218 1291 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_09620 1284 1841 gene locus_tag LOCUS_09630 1284 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1834 2172 gene locus_tag LOCUS_09640 1834 2172 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_09640 3022 2588 gene locus_tag LOCUS_09650 3022 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_09650 4427 3246 gene locus_tag LOCUS_09660 4427 3246 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_09660 5808 4396 gene locus_tag LOCUS_09670 5808 4396 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_09670 7679 6066 gene locus_tag LOCUS_09680 7679 6066 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_09680 9342 7963 gene locus_tag LOCUS_09690 9342 7963 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence0102 >Feature sequence0103 2847 1423 gene locus_tag LOCUS_09700 2847 1423 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_09700 3133 5151 gene locus_tag LOCUS_09710 gene glgX-1 3133 5151 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV9 protein_id gnl|my_center|LOCUS_09710 6299 5154 gene locus_tag LOCUS_09720 6299 5154 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_09720 7543 6302 gene locus_tag LOCUS_09730 7543 6302 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_09730 7806 8756 gene locus_tag LOCUS_09740 gene rocF 7806 8756 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_09740 8805 9206 gene locus_tag LOCUS_09750 8805 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0104 244 1161 gene locus_tag LOCUS_09760 244 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1182 1550 gene locus_tag LOCUS_09770 1182 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1661 2377 gene locus_tag LOCUS_09780 1661 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2381 2782 gene locus_tag LOCUS_09790 2381 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3037 3582 gene locus_tag LOCUS_09800 3037 3582 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_09800 3976 3662 gene locus_tag LOCUS_09810 3976 3662 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI5 protein_id gnl|my_center|LOCUS_09810 4200 3973 gene locus_tag LOCUS_09820 4200 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4554 4895 gene locus_tag LOCUS_09830 4554 4895 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_09830 6834 5074 gene locus_tag LOCUS_09840 gene aspS 6834 5074 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9E3 protein_id gnl|my_center|LOCUS_09840 7125 8396 gene locus_tag LOCUS_09850 7125 8396 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence0105 <1 1714 gene locus_tag LOCUS_09860 <1 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942949.1:sodium-independent anion transporter 1714 2331 gene locus_tag LOCUS_09870 gene cynT 1714 2331 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_09870 2984 2328 gene locus_tag LOCUS_09880 2984 2328 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_09880 3867 3103 gene locus_tag LOCUS_09890 3867 3103 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_09890 4017 4844 gene locus_tag LOCUS_09900 gene uspA 4017 4844 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_09900 6847 5195 gene locus_tag LOCUS_09910 6847 5195 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_09910 7484 6921 gene locus_tag LOCUS_09920 7484 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 8416 7568 gene locus_tag LOCUS_09930 gene mvaB 8416 7568 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_09930 <9212 8631 gene locus_tag LOCUS_09940 <9212 8631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NU8:methylenetetrahydrofolate reductase >Feature sequence0106 7137 2968 gene locus_tag LOCUS_09950 7137 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 <9200 7143 gene locus_tag LOCUS_09960 <9200 7143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence0107 954 256 gene locus_tag LOCUS_09970 gene radC 954 256 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_09970 1600 1346 gene locus_tag LOCUS_09980 gene rpsT 1600 1346 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_09980 1805 2818 gene locus_tag LOCUS_09990 1805 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4485 3163 gene locus_tag LOCUS_10000 4485 3163 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_10000 4899 6254 gene locus_tag LOCUS_10010 4899 6254 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_10010 8122 6443 gene locus_tag LOCUS_10020 8122 6443 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0108 107 1552 gene locus_tag LOCUS_10030 107 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2939 1914 gene locus_tag LOCUS_10040 2939 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7885 2939 gene locus_tag LOCUS_10050 7885 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8837 7992 gene locus_tag LOCUS_10060 8837 7992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence0109 3443 480 gene locus_tag LOCUS_10070 3443 480 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_10070 4896 3826 gene locus_tag LOCUS_10080 4896 3826 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_10080 5507 5043 gene locus_tag LOCUS_10090 5507 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_10090 6915 5602 gene locus_tag LOCUS_10100 gene gntT 6915 5602 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence0110 <1 1021 gene locus_tag LOCUS_10110 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64VS5:galactokinase 2503 1262 gene locus_tag LOCUS_10120 2503 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6208 2813 gene locus_tag LOCUS_10130 6208 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7239 6490 gene locus_tag LOCUS_10140 7239 6490 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNJ8 protein_id gnl|my_center|LOCUS_10140 >Feature sequence0111 2177 1455 gene locus_tag LOCUS_10150 gene gldF 2177 1455 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_10150 3090 2182 gene locus_tag LOCUS_10160 gene gldA 3090 2182 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_10160 3793 4020 gene locus_tag LOCUS_10170 3793 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4002 4301 gene locus_tag LOCUS_10180 4002 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4323 4916 gene locus_tag LOCUS_10190 4323 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7766 5115 gene locus_tag LOCUS_10200 7766 5115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence0112 988 206 gene locus_tag LOCUS_10210 988 206 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_10210 1098 1577 gene locus_tag LOCUS_10220 1098 1577 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_10220 1654 2124 gene locus_tag LOCUS_10230 1654 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2141 2599 gene locus_tag LOCUS_10240 2141 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_10240 2735 3493 gene locus_tag LOCUS_10250 2735 3493 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_10250 3787 4386 gene locus_tag LOCUS_10260 3787 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4700 5428 gene locus_tag LOCUS_10270 4700 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 7840 5441 gene locus_tag LOCUS_10280 7840 5441 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_10280 9084 8239 gene locus_tag LOCUS_10290 9084 8239 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence0113 332 1264 gene locus_tag LOCUS_10300 332 1264 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_10300 1416 1625 gene locus_tag LOCUS_10310 1416 1625 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_10310 1851 3260 gene locus_tag LOCUS_10320 1851 3260 CDS product glycosyl hydrolase family 109 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS1 protein_id gnl|my_center|LOCUS_10320 4002 3544 gene locus_tag LOCUS_10330 4002 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4879 4010 gene locus_tag LOCUS_10340 4879 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5231 4866 gene locus_tag LOCUS_10350 gene folB 5231 4866 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28823 protein_id gnl|my_center|LOCUS_10350 6076 5231 gene locus_tag LOCUS_10360 6076 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6992 6084 gene locus_tag LOCUS_10370 6992 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 7029 7658 gene locus_tag LOCUS_10380 7029 7658 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107823.1 protein_id gnl|my_center|LOCUS_10380 7735 8289 gene locus_tag LOCUS_10390 7735 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 <9079 8282 gene locus_tag LOCUS_10400 <9079 8282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069743.1:transglutaminase >Feature sequence0114 4065 1954 gene locus_tag LOCUS_10410 gene exaA 4065 1954 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_10410 5290 4070 gene locus_tag LOCUS_10420 5290 4070 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201946.1 protein_id gnl|my_center|LOCUS_10420 6752 7048 gene locus_tag LOCUS_10430 6752 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7682 8872 gene locus_tag LOCUS_10440 7682 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0115 562 1488 gene locus_tag LOCUS_10450 562 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1825 1502 gene locus_tag LOCUS_10460 1825 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_10460 6206 1893 gene locus_tag LOCUS_10470 gene rpoC 6206 1893 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_10470 <9005 6255 gene locus_tag LOCUS_10480 <9005 6255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYU0:DNA-directed RNA polymerase subunit beta >Feature sequence0116 1273 437 gene locus_tag LOCUS_10490 1273 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1581 2039 gene locus_tag LOCUS_10500 1581 2039 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_10500 2150 4201 gene locus_tag LOCUS_10510 2150 4201 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_10510 5094 4336 gene locus_tag LOCUS_10520 gene menH 5094 4336 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816H8 protein_id gnl|my_center|LOCUS_10520 5550 5194 gene locus_tag LOCUS_10530 5550 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5628 6770 gene locus_tag LOCUS_10540 gene iscS 5628 6770 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXH1 protein_id gnl|my_center|LOCUS_10540 7366 6767 gene locus_tag LOCUS_10550 7366 6767 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_10550 8484 7363 gene locus_tag LOCUS_10560 gene xdhC 8484 7363 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence0117 2406 763 gene locus_tag LOCUS_10570 2406 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460116.1 protein_id gnl|my_center|LOCUS_10570 3115 2399 gene locus_tag LOCUS_10580 3115 2399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048140.1 protein_id gnl|my_center|LOCUS_10580 3230 3838 gene locus_tag LOCUS_10590 3230 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4516 3893 gene locus_tag LOCUS_10600 4516 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5834 4605 gene locus_tag LOCUS_10610 5834 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5873 6073 gene locus_tag LOCUS_10620 5873 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6425 6009 gene locus_tag LOCUS_10630 6425 6009 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_10630 7974 6517 gene locus_tag LOCUS_10640 7974 6517 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0118 2393 1122 gene locus_tag LOCUS_10650 2393 1122 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_10650 3228 2503 gene locus_tag LOCUS_10660 3228 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3345 4325 gene locus_tag LOCUS_10670 3345 4325 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_10670 4329 5525 gene locus_tag LOCUS_10680 4329 5525 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_10680 6477 6184 gene locus_tag LOCUS_10690 6477 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_10690 7402 6518 gene locus_tag LOCUS_10700 gene xerC 7402 6518 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A461 protein_id gnl|my_center|LOCUS_10700 8127 7492 gene locus_tag LOCUS_10710 8127 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8478 8284 gene locus_tag LOCUS_10720 gene rpsU 8478 8284 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_10720 8885 8637 gene locus_tag LOCUS_10730 8885 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence0119 <1 872 gene locus_tag LOCUS_10740 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107669.1:RNA-binding transcriptional accessory protein 1074 1715 gene locus_tag LOCUS_10750 1074 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2821 1940 gene locus_tag LOCUS_10760 2821 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3260 3517 gene locus_tag LOCUS_10770 3260 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3528 4298 gene locus_tag LOCUS_10780 3528 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5036 4356 gene locus_tag LOCUS_10790 5036 4356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_10790 5890 5156 gene locus_tag LOCUS_10800 5890 5156 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_10800 6031 8424 gene locus_tag LOCUS_10810 6031 8424 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0120 5405 1428 gene locus_tag LOCUS_10820 5405 1428 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_10820 5713 7191 gene locus_tag LOCUS_10830 5713 7191 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_10830 8603 7338 gene locus_tag LOCUS_10840 8603 7338 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0121 1683 493 gene locus_tag LOCUS_10850 1683 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2604 1738 gene locus_tag LOCUS_10860 2604 1738 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_10860 3923 2616 gene locus_tag LOCUS_10870 3923 2616 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_10870 4120 5025 gene locus_tag LOCUS_10880 gene rbsK 4120 5025 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_10880 5266 6189 gene locus_tag LOCUS_10890 5266 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_10890 6193 7191 gene locus_tag LOCUS_10900 6193 7191 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_10900 8225 7188 gene locus_tag LOCUS_10910 8225 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 <8856 8246 gene locus_tag LOCUS_10920 <8856 8246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388526.1:iron ABC transporter permease >Feature sequence0122 1303 1983 gene locus_tag LOCUS_10930 gene cmk 1303 1983 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_10930 1994 2896 gene locus_tag LOCUS_10940 gene ispH 1994 2896 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_10940 3029 4414 gene locus_tag LOCUS_10950 gene nqrA 3029 4414 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_10950 4420 5634 gene locus_tag LOCUS_10960 gene nqrB 4420 5634 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_10960 5621 6394 gene locus_tag LOCUS_10970 gene nqrC 5621 6394 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_10970 6420 7103 gene locus_tag LOCUS_10980 gene nqrD 6420 7103 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_10980 7119 7730 gene locus_tag LOCUS_10990 gene nqrE 7119 7730 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_10990 7915 8484 gene locus_tag LOCUS_11000 7915 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0123 154 2349 gene locus_tag LOCUS_11010 154 2349 CDS product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 protein_id gnl|my_center|LOCUS_11010 2565 2353 gene locus_tag LOCUS_11020 2565 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4234 2783 gene locus_tag LOCUS_11030 4234 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4652 4260 gene locus_tag LOCUS_11040 4652 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4873 5091 gene locus_tag LOCUS_11050 4873 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7879 5273 gene locus_tag LOCUS_11060 7879 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11060 8806 7898 gene locus_tag LOCUS_11070 8806 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence0124 1310 2287 gene locus_tag LOCUS_11080 1310 2287 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_11080 4618 2462 gene locus_tag LOCUS_11090 4618 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6604 4853 gene locus_tag LOCUS_11100 gene yfiC 6604 4853 CDS product putative ABC transporter ATP-binding protein YfiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54719 protein_id gnl|my_center|LOCUS_11100 6939 7475 gene locus_tag LOCUS_11110 6939 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7532 8098 gene locus_tag LOCUS_11120 7532 8098 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0125 <1 1281 gene locus_tag LOCUS_11130 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:restriction endonuclease subunit M 1278 2693 gene locus_tag LOCUS_11140 gene hsdS 1278 2693 CDS product type I restriction-modification system restriction endonuclease DNA specificity subunit HsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_11140 2678 6823 gene locus_tag LOCUS_11150 2678 6823 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_11150 6826 8388 gene locus_tag LOCUS_11160 6826 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0126 469 1833 gene locus_tag LOCUS_11170 469 1833 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_11170 1939 2658 gene locus_tag LOCUS_11180 1939 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986895.1 protein_id gnl|my_center|LOCUS_11180 3594 2716 gene locus_tag LOCUS_11190 gene cysM 3594 2716 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_11190 4424 3591 gene locus_tag LOCUS_11200 4424 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4991 4437 gene locus_tag LOCUS_11210 4991 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5265 4972 gene locus_tag LOCUS_11220 5265 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5498 8281 gene locus_tag LOCUS_11230 5498 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8543 8346 gene locus_tag LOCUS_11240 8543 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0127 1482 2000 gene locus_tag LOCUS_11250 1482 2000 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528492.1 protein_id gnl|my_center|LOCUS_11250 2625 2047 gene locus_tag LOCUS_11260 2625 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_11260 3006 6272 gene locus_tag LOCUS_11270 3006 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_11270 7676 6426 gene locus_tag LOCUS_11280 7676 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence0128 1739 540 gene locus_tag LOCUS_11290 1739 540 CDS product family 88 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_11290 3089 1836 gene locus_tag LOCUS_11300 3089 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3395 4234 gene locus_tag LOCUS_11310 gene kduI 3395 4234 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_11310 4236 5018 gene locus_tag LOCUS_11320 4236 5018 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_11320 5142 6164 gene locus_tag LOCUS_11330 5142 6164 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_11330 6185 7615 gene locus_tag LOCUS_11340 gene uxaC 6185 7615 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0129 <1 1981 gene locus_tag LOCUS_11350 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor 1993 2646 gene locus_tag LOCUS_11360 1993 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3532 3272 gene locus_tag LOCUS_11370 3532 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3626 4579 gene locus_tag LOCUS_11380 3626 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4576 5328 gene locus_tag LOCUS_11390 4576 5328 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_11390 6819 5614 gene locus_tag LOCUS_11400 6819 5614 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_11400 7057 8193 gene locus_tag LOCUS_11410 7057 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence0130 1 549 gene locus_tag LOCUS_11420 1 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2160 748 gene locus_tag LOCUS_11430 2160 748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_11430 2557 2276 gene locus_tag LOCUS_11440 2557 2276 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_11440 3131 2559 gene locus_tag LOCUS_11450 3131 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3647 3141 gene locus_tag LOCUS_11460 3647 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3798 4169 gene locus_tag LOCUS_11470 3798 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4184 4951 gene locus_tag LOCUS_11480 4184 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 <8525 5136 gene locus_tag LOCUS_11490 <8525 5136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031012.1:glycosyl hydrolase >Feature sequence0131 439 128 gene locus_tag LOCUS_11500 439 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 546 1739 gene locus_tag LOCUS_11510 546 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2219 3205 gene locus_tag LOCUS_11520 2219 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11520 6075 3526 gene locus_tag LOCUS_11530 6075 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_11530 6237 7289 gene locus_tag LOCUS_11540 6237 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_11540 7399 8250 gene locus_tag LOCUS_11550 7399 8250 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0132 1780 425 gene locus_tag LOCUS_11560 gene nfeD 1780 425 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881185.1 protein_id gnl|my_center|LOCUS_11560 1904 3766 gene locus_tag LOCUS_11570 1904 3766 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_11570 4035 3859 gene locus_tag LOCUS_11580 4035 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5388 4138 gene locus_tag LOCUS_11590 5388 4138 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_11590 5569 7071 gene locus_tag LOCUS_11600 gene accC 5569 7071 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_11600 7071 8369 gene locus_tag LOCUS_11610 7071 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0133 <1 1550 gene locus_tag LOCUS_11620 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q726T1:pyruvate synthase 1555 2904 gene locus_tag LOCUS_11630 1555 2904 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY86 protein_id gnl|my_center|LOCUS_11630 2897 3910 gene locus_tag LOCUS_11640 2897 3910 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_11640 3907 4602 gene locus_tag LOCUS_11650 3907 4602 CDS product Na+-transporting NADH:ubiquinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_11650 4599 5240 gene locus_tag LOCUS_11660 4599 5240 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIJ8 protein_id gnl|my_center|LOCUS_11660 5237 5815 gene locus_tag LOCUS_11670 gene rnfA 5237 5815 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B02 protein_id gnl|my_center|LOCUS_11670 5928 6095 gene locus_tag LOCUS_11680 5928 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6097 6282 gene locus_tag LOCUS_11690 6097 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6388 7245 gene locus_tag LOCUS_11700 gene petH 6388 7245 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0134 1183 1974 gene locus_tag LOCUS_11710 1183 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1987 2532 gene locus_tag LOCUS_11720 1987 2532 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_11720 2598 3140 gene locus_tag LOCUS_11730 2598 3140 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0135 2853 1408 gene locus_tag LOCUS_11740 2853 1408 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_11740 3088 3519 gene locus_tag LOCUS_11750 3088 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3794 3564 gene locus_tag LOCUS_11760 3794 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4098 5303 gene locus_tag LOCUS_11770 4098 5303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_11770 5321 6448 gene locus_tag LOCUS_11780 5321 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_11780 6530 7984 gene locus_tag LOCUS_11790 6530 7984 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_11790 8336 8052 gene locus_tag LOCUS_11800 8336 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence0136 790 2976 gene locus_tag LOCUS_11810 790 2976 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_11810 2992 4290 gene locus_tag LOCUS_11820 gene purD 2992 4290 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_11820 4426 5748 gene locus_tag LOCUS_11830 gene fjo17 4426 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_11830 5772 6227 gene locus_tag LOCUS_11840 5772 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 <8335 6436 gene locus_tag LOCUS_11850 <8335 6436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865167.1:ATPase AAA >Feature sequence0137 <1 961 gene locus_tag LOCUS_11860 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000440662.1:MFS transporter 1318 1875 gene locus_tag LOCUS_11870 1318 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3235 1883 gene locus_tag LOCUS_11880 3235 1883 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_11880 4660 3293 gene locus_tag LOCUS_11890 gene norM 4660 3293 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_11890 5221 4682 gene locus_tag LOCUS_11900 5221 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5761 5279 gene locus_tag LOCUS_11910 5761 5279 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_11910 7159 5972 gene locus_tag LOCUS_11920 7159 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404922.1 protein_id gnl|my_center|LOCUS_11920 7328 7885 gene locus_tag LOCUS_11930 7328 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence0138 39 461 gene locus_tag LOCUS_11940 39 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 439 1089 gene locus_tag LOCUS_11950 439 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1086 1850 gene locus_tag LOCUS_11960 1086 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1853 2713 gene locus_tag LOCUS_11970 1853 2713 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_11970 2706 4382 gene locus_tag LOCUS_11980 2706 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4375 5469 gene locus_tag LOCUS_11990 4375 5469 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_11990 5660 6541 gene locus_tag LOCUS_12000 5660 6541 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAK1 protein_id gnl|my_center|LOCUS_12000 6715 7869 gene locus_tag LOCUS_12010 6715 7869 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence0139 1304 549 gene locus_tag LOCUS_12020 gene truA 1304 549 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_12020 1515 1889 gene locus_tag LOCUS_12030 1515 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1903 3006 gene locus_tag LOCUS_12040 1903 3006 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730426.1 protein_id gnl|my_center|LOCUS_12040 4716 3178 gene locus_tag LOCUS_12050 4716 3178 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_12050 5160 4795 gene locus_tag LOCUS_12060 5160 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7026 5194 gene locus_tag LOCUS_12070 7026 5194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence0140 477 151 gene locus_tag LOCUS_12080 gene sufA 477 151 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_12080 568 978 gene locus_tag LOCUS_12090 568 978 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_12090 1063 1659 gene locus_tag LOCUS_12100 1063 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1671 2699 gene locus_tag LOCUS_12110 gene thiL 1671 2699 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_12110 2813 3493 gene locus_tag LOCUS_12120 2813 3493 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879905.1 protein_id gnl|my_center|LOCUS_12120 4673 3642 gene locus_tag LOCUS_12130 4673 3642 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_12130 6492 5002 gene locus_tag LOCUS_12140 6492 5002 CDS product MR-MLE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236009.1 protein_id gnl|my_center|LOCUS_12140 7476 6544 gene locus_tag LOCUS_12150 7476 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 8205 7654 gene locus_tag LOCUS_12160 8205 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0141 141 722 gene locus_tag LOCUS_12170 141 722 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 protein_id gnl|my_center|LOCUS_12170 727 1797 gene locus_tag LOCUS_12180 727 1797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_12180 2826 2110 gene locus_tag LOCUS_12190 gene pdxJ 2826 2110 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_12190 2888 3337 gene locus_tag LOCUS_12200 2888 3337 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_12200 3350 3892 gene locus_tag LOCUS_12210 3350 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3873 4463 gene locus_tag LOCUS_12220 gene pabA 3873 4463 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262695.1 protein_id gnl|my_center|LOCUS_12220 4554 5222 gene locus_tag LOCUS_12230 4554 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5236 6111 gene locus_tag LOCUS_12240 gene nadK 5236 6111 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_12240 6291 7001 gene locus_tag LOCUS_12250 6291 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7084 7821 gene locus_tag LOCUS_12260 gene uppS 7084 7821 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_12260 >Feature sequence0142 880 446 gene locus_tag LOCUS_12270 gene dut 880 446 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_12270 2400 877 gene locus_tag LOCUS_12280 2400 877 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_12280 3209 2424 gene locus_tag LOCUS_12290 gene crt 3209 2424 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_12290 3440 4894 gene locus_tag LOCUS_12300 gene leuB 3440 4894 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_12300 5166 5396 gene locus_tag LOCUS_12310 5166 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5396 5680 gene locus_tag LOCUS_12320 5396 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6109 7299 gene locus_tag LOCUS_12330 6109 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7292 7720 gene locus_tag LOCUS_12340 gene rcp1 7292 7720 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0143 <1 2871 gene locus_tag LOCUS_12350 <1 2871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203101.1:type II restriction endonuclease 2876 3253 gene locus_tag LOCUS_12360 2876 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3568 6948 gene locus_tag LOCUS_12370 gene ileS 3568 6948 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_12370 7024 7677 gene locus_tag LOCUS_12380 gene lspA 7024 7677 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_12380 >Feature sequence0144 339 1466 gene locus_tag LOCUS_12390 gene xynA 339 1466 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_12390 1831 2709 gene locus_tag LOCUS_12400 1831 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2706 4268 gene locus_tag LOCUS_12410 2706 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4469 5212 gene locus_tag LOCUS_12420 4469 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0145 1282 59 gene locus_tag LOCUS_12430 gene nptA 1282 59 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_12430 1615 2748 gene locus_tag LOCUS_12440 1615 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_12440 2824 3267 gene locus_tag LOCUS_12450 gene tadA 2824 3267 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_12450 3372 3974 gene locus_tag LOCUS_12460 gene sodA 3372 3974 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_12460 4239 6620 gene locus_tag LOCUS_12470 4239 6620 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963135.1 protein_id gnl|my_center|LOCUS_12470 6719 8041 gene locus_tag LOCUS_12480 6719 8041 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0146 408 3911 gene locus_tag LOCUS_12490 408 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3908 6241 gene locus_tag LOCUS_12500 3908 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence0147 987 538 gene locus_tag LOCUS_12510 gene rnhA 987 538 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_12510 1662 1078 gene locus_tag LOCUS_12520 1662 1078 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_12520 2793 1738 gene locus_tag LOCUS_12530 2793 1738 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846900.1 protein_id gnl|my_center|LOCUS_12530 3375 2953 gene locus_tag LOCUS_12540 gene aroQ 3375 2953 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_12540 3497 3706 gene locus_tag LOCUS_12550 3497 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3703 3996 gene locus_tag LOCUS_12560 3703 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4081 4911 gene locus_tag LOCUS_12570 gene xerD 4081 4911 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_12570 5631 6686 gene locus_tag LOCUS_12580 gene pyrD 5631 6686 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_12580 >Feature sequence0148 <1 767 gene locus_tag LOCUS_12590 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG 1710 772 gene locus_tag LOCUS_12600 1710 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1959 1732 gene locus_tag LOCUS_12610 1959 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3266 2160 gene locus_tag LOCUS_12620 gene gfo 3266 2160 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_12620 3396 3851 gene locus_tag LOCUS_12630 gene glcG 3396 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284399.1 protein_id gnl|my_center|LOCUS_12630 3888 5609 gene locus_tag LOCUS_12640 3888 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6041 5763 gene locus_tag LOCUS_12650 6041 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7540 6407 gene locus_tag LOCUS_12660 7540 6407 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0149 213 974 gene locus_tag LOCUS_12670 213 974 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_12670 4924 1403 gene locus_tag LOCUS_12680 4924 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6721 5042 gene locus_tag LOCUS_12690 6721 5042 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_12690 <7947 6777 gene locus_tag LOCUS_12700 <7947 6777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0150 142 387 gene locus_tag LOCUS_12710 142 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 368 661 gene locus_tag LOCUS_12720 368 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 738 3701 gene locus_tag LOCUS_12730 738 3701 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_12730 4589 4437 gene locus_tag LOCUS_12740 4589 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4689 5117 gene locus_tag LOCUS_12750 4689 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5994 6422 gene locus_tag LOCUS_12760 5994 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 6427 7092 gene locus_tag LOCUS_12770 6427 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence0151 226 1308 gene locus_tag LOCUS_12780 gene fabH1 226 1308 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_12780 2738 1311 gene locus_tag LOCUS_12790 2738 1311 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_12790 3040 2750 gene locus_tag LOCUS_12800 3040 2750 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_12800 3278 4291 gene locus_tag LOCUS_12810 3278 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4393 6144 gene locus_tag LOCUS_12820 gene ggt 4393 6144 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_12820 6255 7547 gene locus_tag LOCUS_12830 gene tyrS 6255 7547 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0152 <1 1063 gene locus_tag LOCUS_12840 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962921.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA 1216 1857 gene locus_tag LOCUS_12850 1216 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2499 2143 gene locus_tag LOCUS_12860 2499 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2687 3502 gene locus_tag LOCUS_12870 2687 3502 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_12870 4870 3623 gene locus_tag LOCUS_12880 4870 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_12880 6177 4939 gene locus_tag LOCUS_12890 6177 4939 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence0153 17 643 gene locus_tag LOCUS_12900 17 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 640 1002 gene locus_tag LOCUS_12910 640 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1014 1628 gene locus_tag LOCUS_12920 1014 1628 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_12920 1881 2861 gene locus_tag LOCUS_12930 1881 2861 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_12930 2870 4462 gene locus_tag LOCUS_12940 2870 4462 CDS product cytochrome-c3 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_12940 4627 5142 gene locus_tag LOCUS_12950 4627 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5126 5500 gene locus_tag LOCUS_12960 5126 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5497 7014 gene locus_tag LOCUS_12970 5497 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 7688 7053 gene locus_tag LOCUS_12980 7688 7053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence0154 360 941 gene locus_tag LOCUS_12990 gene mobA 360 941 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM7 protein_id gnl|my_center|LOCUS_12990 944 2047 gene locus_tag LOCUS_13000 944 2047 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_13000 2037 2483 gene locus_tag LOCUS_13010 2037 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3111 2557 gene locus_tag LOCUS_13020 3111 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3400 4032 gene locus_tag LOCUS_13030 3400 4032 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA8 protein_id gnl|my_center|LOCUS_13030 3996 5552 gene locus_tag LOCUS_13040 gene nrfA 3996 5552 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA7 protein_id gnl|my_center|LOCUS_13040 5567 6895 gene locus_tag LOCUS_13050 5567 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0155 3227 3769 gene locus_tag LOCUS_13060 3227 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4270 3848 gene locus_tag LOCUS_13070 gene ndk 4270 3848 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_13070 4462 5502 gene locus_tag LOCUS_13080 gene fjo19 4462 5502 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_13080 5489 6427 gene locus_tag LOCUS_13090 5489 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6414 6968 gene locus_tag LOCUS_13100 6414 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6984 7532 gene locus_tag LOCUS_13110 6984 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0156 1967 726 gene locus_tag LOCUS_13120 1967 726 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_13120 2972 2037 gene locus_tag LOCUS_13130 2972 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4578 3058 gene locus_tag LOCUS_13140 4578 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107590.1 protein_id gnl|my_center|LOCUS_13140 <7827 4590 gene locus_tag LOCUS_13150 <7827 4590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0157 289 1209 gene locus_tag LOCUS_13160 289 1209 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_13160 1990 1319 gene locus_tag LOCUS_13170 1990 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2833 2210 gene locus_tag LOCUS_13180 2833 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2997 3380 gene locus_tag LOCUS_13190 2997 3380 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_13190 3388 4083 gene locus_tag LOCUS_13200 3388 4083 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_13200 4458 6092 gene locus_tag LOCUS_13210 gene pruA 4458 6092 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_13210 6526 7623 gene locus_tag LOCUS_13220 6526 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence0158 797 2347 gene locus_tag LOCUS_13230 797 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_13230 3831 2446 gene locus_tag LOCUS_13240 3831 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7666 4127 gene locus_tag LOCUS_13250 gene smc 7666 4127 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBS6 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0159 <1 526 gene locus_tag LOCUS_13260 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528503.1:fasciclin 1130 684 gene locus_tag LOCUS_13270 1130 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1522 1130 gene locus_tag LOCUS_13280 1522 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2052 1528 gene locus_tag LOCUS_13290 2052 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2341 2841 gene locus_tag LOCUS_13300 2341 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2838 3221 gene locus_tag LOCUS_13310 2838 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_13310 6324 3445 gene locus_tag LOCUS_13320 6324 3445 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_13320 6451 6597 gene locus_tag LOCUS_13330 6451 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0160 19 3252 gene locus_tag LOCUS_13340 gene hsdR 19 3252 CDS product type I restriction-modification system deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_13340 3262 4725 gene locus_tag LOCUS_13350 gene hsdM 3262 4725 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_13350 4722 6131 gene locus_tag LOCUS_13360 gene hsdS 4722 6131 CDS product type I restriction-modification system restriction endonuclease DNA specificity subunit HsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_13360 6128 6730 gene locus_tag LOCUS_13370 6128 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6723 7724 gene locus_tag LOCUS_13380 6723 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence0161 <1 563 gene locus_tag LOCUS_13390 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin 573 3092 gene locus_tag LOCUS_13400 gene priA 573 3092 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_13400 3131 3826 gene locus_tag LOCUS_13410 3131 3826 CDS product DUF4918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_13410 6953 3924 gene locus_tag LOCUS_13420 6953 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7487 7131 gene locus_tag LOCUS_13430 7487 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence0162 770 1831 gene locus_tag LOCUS_13440 770 1831 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_13440 1843 2622 gene locus_tag LOCUS_13450 1843 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_13450 2755 3177 gene locus_tag LOCUS_13460 2755 3177 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_13460 3398 3661 gene locus_tag LOCUS_13470 3398 3661 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_13470 3687 5375 gene locus_tag LOCUS_13480 3687 5375 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_13480 5493 5849 gene locus_tag LOCUS_13490 5493 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0163 197 1084 gene locus_tag LOCUS_13500 197 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1129 2028 gene locus_tag LOCUS_13510 gene natA 1129 2028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_13510 2021 3328 gene locus_tag LOCUS_13520 gene natB 2021 3328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_13520 3815 3375 gene locus_tag LOCUS_13530 3815 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4543 3905 gene locus_tag LOCUS_13540 4543 3905 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_13540 5025 4543 gene locus_tag LOCUS_13550 5025 4543 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709924.1 protein_id gnl|my_center|LOCUS_13550 5158 6489 gene locus_tag LOCUS_13560 5158 6489 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_13560 7599 6526 gene locus_tag LOCUS_13570 7599 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0164 2271 16 gene locus_tag LOCUS_13580 2271 16 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_13580 2463 3236 gene locus_tag LOCUS_13590 gene thyA 2463 3236 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_13590 4076 3258 gene locus_tag LOCUS_13600 4076 3258 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957563.1 protein_id gnl|my_center|LOCUS_13600 4233 4910 gene locus_tag LOCUS_13610 gene sdhB 4233 4910 CDS product putative L-serine dehydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_270097.1 protein_id gnl|my_center|LOCUS_13610 4910 6256 gene locus_tag LOCUS_13620 4910 6256 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_13620 6272 7579 gene locus_tag LOCUS_13630 6272 7579 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence0165 277 95 gene locus_tag LOCUS_13640 277 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 400 816 gene locus_tag LOCUS_13650 400 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1064 834 gene locus_tag LOCUS_13660 1064 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1604 1188 gene locus_tag LOCUS_13670 1604 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2910 1651 gene locus_tag LOCUS_13680 2910 1651 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_13680 4126 3284 gene locus_tag LOCUS_13690 4126 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4878 4123 gene locus_tag LOCUS_13700 4878 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_13700 5855 4875 gene locus_tag LOCUS_13710 5855 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_13710 7274 5967 gene locus_tag LOCUS_13720 7274 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence0166 215 712 gene locus_tag LOCUS_13730 215 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2046 763 gene locus_tag LOCUS_13740 2046 763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_13740 2522 2043 gene locus_tag LOCUS_13750 2522 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970522.1 protein_id gnl|my_center|LOCUS_13750 4083 2524 gene locus_tag LOCUS_13760 4083 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635999.1 protein_id gnl|my_center|LOCUS_13760 4872 4213 gene locus_tag LOCUS_13770 4872 4213 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143308.1 protein_id gnl|my_center|LOCUS_13770 5040 5789 gene locus_tag LOCUS_13780 5040 5789 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978584.1 protein_id gnl|my_center|LOCUS_13780 6771 5911 gene locus_tag LOCUS_13790 gene hutG 6771 5911 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI04 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0167 413 1510 gene locus_tag LOCUS_13800 413 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2045 2356 gene locus_tag LOCUS_13810 2045 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2396 3202 gene locus_tag LOCUS_13820 2396 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3259 4449 gene locus_tag LOCUS_13830 3259 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4459 6657 gene locus_tag LOCUS_13840 4459 6657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0168 1989 415 gene locus_tag LOCUS_13850 gene cafA 1989 415 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_13850 2989 2171 gene locus_tag LOCUS_13860 2989 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3319 3011 gene locus_tag LOCUS_13870 3319 3011 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_13870 3609 4553 gene locus_tag LOCUS_13880 gene mutY 3609 4553 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_13880 4605 5048 gene locus_tag LOCUS_13890 gene ssb 4605 5048 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44409 protein_id gnl|my_center|LOCUS_13890 5112 6461 gene locus_tag LOCUS_13900 5112 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence0169 2612 240 gene locus_tag LOCUS_13910 2612 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4392 2734 gene locus_tag LOCUS_13920 4392 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5358 6179 gene locus_tag LOCUS_13930 5358 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13930 6180 6662 gene locus_tag LOCUS_13940 6180 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13940 >Feature sequence0170 <1 1053 gene locus_tag LOCUS_13950 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762307.1:ABC transporter permease 1226 1579 gene locus_tag LOCUS_13960 1226 1579 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_13960 1752 2450 gene locus_tag LOCUS_13970 1752 2450 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_13970 2620 4980 gene locus_tag LOCUS_13980 2620 4980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_13980 5036 7405 gene locus_tag LOCUS_13990 5036 7405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0171 1905 1042 gene locus_tag LOCUS_14000 1905 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3821 1962 gene locus_tag LOCUS_14010 3821 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4671 3922 gene locus_tag LOCUS_14020 4671 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5470 4754 gene locus_tag LOCUS_14030 5470 4754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_14030 6111 5467 gene locus_tag LOCUS_14040 6111 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6471 6247 gene locus_tag LOCUS_14050 6471 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence0172 3321 22 gene locus_tag LOCUS_14060 3321 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6686 3318 gene locus_tag LOCUS_14070 6686 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7280 6699 gene locus_tag LOCUS_14080 7280 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0173 2268 3233 gene locus_tag LOCUS_14090 2268 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3250 4095 gene locus_tag LOCUS_14100 3250 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4261 5439 gene locus_tag LOCUS_14110 4261 5439 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_14110 5496 6569 gene locus_tag LOCUS_14120 5496 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence0174 <1 830 gene locus_tag LOCUS_14130 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403786.1:protease 914 1477 gene locus_tag LOCUS_14140 914 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1657 3012 gene locus_tag LOCUS_14150 1657 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3895 3020 gene locus_tag LOCUS_14160 3895 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7087 4229 gene locus_tag LOCUS_14170 7087 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence0175 1215 1418 gene locus_tag LOCUS_14180 1215 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1772 3559 gene locus_tag LOCUS_14190 1772 3559 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_14190 3590 5014 gene locus_tag LOCUS_14200 3590 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5214 5011 gene locus_tag LOCUS_14210 5214 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0176 <1 1053 gene locus_tag LOCUS_14220 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7USY7:DNA polymerase IV 1424 1173 gene locus_tag LOCUS_14230 1424 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3084 1699 gene locus_tag LOCUS_14240 gene pepP 3084 1699 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 protein_id gnl|my_center|LOCUS_14240 3283 4932 gene locus_tag LOCUS_14250 gene pafA 3283 4932 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_14250 5049 5297 gene locus_tag LOCUS_14260 5049 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5294 5566 gene locus_tag LOCUS_14270 5294 5566 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 protein_id gnl|my_center|LOCUS_14270 6841 5678 gene locus_tag LOCUS_14280 gene hmgA 6841 5678 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_14280 7108 6905 gene locus_tag LOCUS_14290 7108 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence0177 535 1167 gene locus_tag LOCUS_14300 535 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1274 1975 gene locus_tag LOCUS_14310 1274 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3340 2348 gene locus_tag LOCUS_14320 3340 2348 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039196.1 protein_id gnl|my_center|LOCUS_14320 3490 4230 gene locus_tag LOCUS_14330 3490 4230 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762581.1 protein_id gnl|my_center|LOCUS_14330 4240 5451 gene locus_tag LOCUS_14340 4240 5451 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086636.1 protein_id gnl|my_center|LOCUS_14340 5444 6475 gene locus_tag LOCUS_14350 5444 6475 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_14350 6479 7357 gene locus_tag LOCUS_14360 6479 7357 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0178 <1 1065 gene locus_tag LOCUS_14370 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H192:cell division protein FtsA 1163 2815 gene locus_tag LOCUS_14380 1163 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3391 2816 gene locus_tag LOCUS_14390 3391 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3716 4552 gene locus_tag LOCUS_14400 3716 4552 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_14400 4688 5410 gene locus_tag LOCUS_14410 4688 5410 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_14410 5928 5437 gene locus_tag LOCUS_14420 5928 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6835 6428 gene locus_tag LOCUS_14430 6835 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7419 6847 gene locus_tag LOCUS_14440 gene frdB 7419 6847 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN89 protein_id gnl|my_center|LOCUS_14440 >Feature sequence0179 1760 888 gene locus_tag LOCUS_14450 1760 888 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_14450 2082 2504 gene locus_tag LOCUS_14460 2082 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3743 2517 gene locus_tag LOCUS_14470 3743 2517 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_14470 5232 3850 gene locus_tag LOCUS_14480 5232 3850 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_14480 5256 5441 gene locus_tag LOCUS_14490 5256 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5448 5876 gene locus_tag LOCUS_14500 5448 5876 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_14500 6761 5931 gene locus_tag LOCUS_14510 6761 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 <7362 6758 gene locus_tag LOCUS_14520 <7362 6758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964460.1:UDP-2,3-diacylglucosamine hydrolase >Feature sequence0180 1806 3302 gene locus_tag LOCUS_14530 1806 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3556 5481 gene locus_tag LOCUS_14540 3556 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence0181 1540 233 gene locus_tag LOCUS_14550 1540 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3059 1704 gene locus_tag LOCUS_14560 gene argH 3059 1704 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_14560 4452 3376 gene locus_tag LOCUS_14570 4452 3376 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_14570 5347 4547 gene locus_tag LOCUS_14580 gene argB 5347 4547 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_14580 6321 5377 gene locus_tag LOCUS_14590 6321 5377 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_14590 <7325 6520 gene locus_tag LOCUS_14600 <7325 6520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YZ6:acetylornithine aminotransferase >Feature sequence0182 371 1225 gene locus_tag LOCUS_14610 gene purU 371 1225 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_14610 1587 2504 gene locus_tag LOCUS_14620 1587 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_14620 3218 2637 gene locus_tag LOCUS_14630 3218 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4855 3827 gene locus_tag LOCUS_14640 gene arsB 4855 3827 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 protein_id gnl|my_center|LOCUS_14640 5613 4999 gene locus_tag LOCUS_14650 gene arsC 5613 4999 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_14650 6240 5698 gene locus_tag LOCUS_14660 6240 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888245.1 protein_id gnl|my_center|LOCUS_14660 6668 6339 gene locus_tag LOCUS_14670 6668 6339 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0183 1202 828 gene locus_tag LOCUS_14680 1202 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1668 2642 gene locus_tag LOCUS_14690 1668 2642 CDS product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 protein_id gnl|my_center|LOCUS_14690 4193 2667 gene locus_tag LOCUS_14700 4193 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 5651 5010 gene locus_tag LOCUS_14710 5651 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6180 6749 gene locus_tag LOCUS_14720 6180 6749 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence0184 379 2610 gene locus_tag LOCUS_14730 379 2610 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_14730 3218 2619 gene locus_tag LOCUS_14740 3218 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5330 3558 gene locus_tag LOCUS_14750 5330 3558 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_14750 5794 6522 gene locus_tag LOCUS_14760 5794 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0185 2824 449 gene locus_tag LOCUS_14770 2824 449 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_14770 3753 2815 gene locus_tag LOCUS_14780 3753 2815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence0186 535 1332 gene locus_tag LOCUS_14790 535 1332 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_14790 1395 4385 gene locus_tag LOCUS_14800 1395 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5325 4420 gene locus_tag LOCUS_14810 5325 4420 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035429.1 protein_id gnl|my_center|LOCUS_14810 5419 5649 gene locus_tag LOCUS_14820 5419 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6020 5646 gene locus_tag LOCUS_14830 6020 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6221 6532 gene locus_tag LOCUS_14840 6221 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence0187 164 2653 gene locus_tag LOCUS_14850 gene lon 164 2653 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_14850 2657 3712 gene locus_tag LOCUS_14860 2657 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3693 5126 gene locus_tag LOCUS_14870 gene hslU 3693 5126 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD63 protein_id gnl|my_center|LOCUS_14870 5197 5934 gene locus_tag LOCUS_14880 gene yueD 5197 5934 CDS product benzil reductase ((S)-benzoin forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32099 protein_id gnl|my_center|LOCUS_14880 5970 6749 gene locus_tag LOCUS_14890 5970 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence0188 213 19 gene locus_tag LOCUS_14900 213 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1574 408 gene locus_tag LOCUS_14910 1574 408 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_14910 1918 1703 gene locus_tag LOCUS_14920 1918 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4391 1986 gene locus_tag LOCUS_14930 4391 1986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_14930 6952 4508 gene locus_tag LOCUS_14940 6952 4508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence0189 <7144 594 gene locus_tag LOCUS_14950 <7144 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence0190 <1 701 gene locus_tag LOCUS_14960 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A5I1:GTPase HflX 2092 710 gene locus_tag LOCUS_14970 2092 710 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_14970 2823 2128 gene locus_tag LOCUS_14980 2823 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3896 2988 gene locus_tag LOCUS_14990 3896 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5030 4230 gene locus_tag LOCUS_15000 5030 4230 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_15000 5102 5332 gene locus_tag LOCUS_15010 5102 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5392 6783 gene locus_tag LOCUS_15020 5392 6783 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0191 551 2722 gene locus_tag LOCUS_15030 551 2722 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_15030 3569 2991 gene locus_tag LOCUS_15040 3569 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5243 3654 gene locus_tag LOCUS_15050 5243 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 <7142 5310 gene locus_tag LOCUS_15060 <7142 5310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403216.1:outer membrane protein >Feature sequence0192 2571 166 gene locus_tag LOCUS_15070 2571 166 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_15070 3460 2645 gene locus_tag LOCUS_15080 gene crtO 3460 2645 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_15080 4239 3394 gene locus_tag LOCUS_15090 gene ispH 4239 3394 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_15090 4953 4243 gene locus_tag LOCUS_15100 4953 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5803 4955 gene locus_tag LOCUS_15110 gene crtB 5803 4955 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15110 <7027 5822 gene locus_tag LOCUS_15120 <7027 5822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963567.1:phytoene dehydrogenase >Feature sequence0193 2098 176 gene locus_tag LOCUS_15130 2098 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5039 2622 gene locus_tag LOCUS_15140 5039 2622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_15140 6283 5216 gene locus_tag LOCUS_15150 6283 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence0194 781 530 gene locus_tag LOCUS_15160 781 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1335 982 gene locus_tag LOCUS_15170 1335 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2239 1361 gene locus_tag LOCUS_15180 2239 1361 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875954.1 protein_id gnl|my_center|LOCUS_15180 2395 2547 gene locus_tag LOCUS_15190 2395 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3113 2691 gene locus_tag LOCUS_15200 3113 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3557 3219 gene locus_tag LOCUS_15210 3557 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4776 3718 gene locus_tag LOCUS_15220 4776 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5218 4814 gene locus_tag LOCUS_15230 5218 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5742 6002 gene locus_tag LOCUS_15240 5742 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0195 1267 2787 gene locus_tag LOCUS_15250 1267 2787 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_15250 3307 2777 gene locus_tag LOCUS_15260 gene aroK 3307 2777 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57605 protein_id gnl|my_center|LOCUS_15260 4404 3304 gene locus_tag LOCUS_15270 4404 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_15270 4870 4397 gene locus_tag LOCUS_15280 4870 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_15280 5065 5841 gene locus_tag LOCUS_15290 gene folP 5065 5841 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_15290 5838 6707 gene locus_tag LOCUS_15300 5838 6707 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence0196 1221 2489 gene locus_tag LOCUS_15310 1221 2489 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_15310 2779 2576 gene locus_tag LOCUS_15320 2779 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3768 2962 gene locus_tag LOCUS_15330 3768 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4397 4122 gene locus_tag LOCUS_15340 4397 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5832 4594 gene locus_tag LOCUS_15350 5832 4594 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005837038.1 protein_id gnl|my_center|LOCUS_15350 6478 5822 gene locus_tag LOCUS_15360 6478 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence0197 568 344 gene locus_tag LOCUS_15370 568 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 939 2141 gene locus_tag LOCUS_15380 939 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2303 3943 gene locus_tag LOCUS_15390 2303 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4834 4196 gene locus_tag LOCUS_15400 4834 4196 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_15400 6381 4831 gene locus_tag LOCUS_15410 6381 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence0198 <1 2009 gene locus_tag LOCUS_15420 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108336.1:alpha-rhamnosidase 2220 3557 gene locus_tag LOCUS_15430 2220 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0199 <1 674 gene locus_tag LOCUS_15440 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966274.1:short-chain dehydrogenase 1307 690 gene locus_tag LOCUS_15450 1307 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1594 2307 gene locus_tag LOCUS_15460 1594 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2356 2985 gene locus_tag LOCUS_15470 2356 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3127 5007 gene locus_tag LOCUS_15480 3127 5007 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_15480 5343 5089 gene locus_tag LOCUS_15490 5343 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6405 5812 gene locus_tag LOCUS_15500 6405 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0200 2369 858 gene locus_tag LOCUS_15510 2369 858 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_15510 5103 2371 gene locus_tag LOCUS_15520 5103 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6491 5544 gene locus_tag LOCUS_15530 gene ltd 6491 5544 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0201 132 743 gene locus_tag LOCUS_15540 132 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15540 782 1393 gene locus_tag LOCUS_15550 782 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15550 2303 1428 gene locus_tag LOCUS_15560 2303 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2556 3173 gene locus_tag LOCUS_15570 2556 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_15570 3282 3506 gene locus_tag LOCUS_15580 3282 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3485 3835 gene locus_tag LOCUS_15590 3485 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4150 4764 gene locus_tag LOCUS_15600 4150 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4766 5059 gene locus_tag LOCUS_15610 4766 5059 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_15610 5134 5451 gene locus_tag LOCUS_15620 5134 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence0202 770 1363 gene locus_tag LOCUS_15630 770 1363 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_15630 1360 1821 gene locus_tag LOCUS_15640 1360 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3027 1984 gene locus_tag LOCUS_15650 3027 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_15650 3612 3073 gene locus_tag LOCUS_15660 gene ppa 3612 3073 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_15660 4849 3734 gene locus_tag LOCUS_15670 4849 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 <6790 4842 gene locus_tag LOCUS_15680 <6790 4842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:two-component sensor histidine kinase >Feature sequence0203 482 1720 gene locus_tag LOCUS_15690 482 1720 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_15690 1750 3882 gene locus_tag LOCUS_15700 1750 3882 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_15700 4001 6262 gene locus_tag LOCUS_15710 4001 6262 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence0204 305 778 gene locus_tag LOCUS_15720 305 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1989 775 gene locus_tag LOCUS_15730 gene ald 1989 775 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_15730 2413 1970 gene locus_tag LOCUS_15740 2413 1970 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_15740 3979 2420 gene locus_tag LOCUS_15750 gene porX 3979 2420 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_15750 4031 5269 gene locus_tag LOCUS_15760 4031 5269 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_15760 5287 6309 gene locus_tag LOCUS_15770 gene lpxD 5287 6309 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_15770 >Feature sequence0205 78 1271 gene locus_tag LOCUS_15780 78 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1426 1650 gene locus_tag LOCUS_15790 1426 1650 CDS product antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971328.1 protein_id gnl|my_center|LOCUS_15790 1647 2042 gene locus_tag LOCUS_15800 gene vapC 1647 2042 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_15800 2844 2077 gene locus_tag LOCUS_15810 2844 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3061 4185 gene locus_tag LOCUS_15820 gene pntA 3061 4185 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_15820 4188 4505 gene locus_tag LOCUS_15830 gene pntA 4188 4505 CDS product NADP transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_15830 4502 5902 gene locus_tag LOCUS_15840 gene pntB 4502 5902 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_15840 >Feature sequence0206 2274 1270 gene locus_tag LOCUS_15850 2274 1270 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_15850 3623 2535 gene locus_tag LOCUS_15860 3623 2535 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_15860 4240 3767 gene locus_tag LOCUS_15870 4240 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5663 4254 gene locus_tag LOCUS_15880 5663 4254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_15880 <6745 5678 gene locus_tag LOCUS_15890 <6745 5678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404908.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0207 485 144 gene locus_tag LOCUS_15900 gene rsbV_1 485 144 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84431 protein_id gnl|my_center|LOCUS_15900 2576 513 gene locus_tag LOCUS_15910 2576 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2670 3383 gene locus_tag LOCUS_15920 2670 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_15920 3700 3386 gene locus_tag LOCUS_15930 3700 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4756 3722 gene locus_tag LOCUS_15940 4756 3722 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_15940 4975 6621 gene locus_tag LOCUS_15950 4975 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0208 521 90 gene locus_tag LOCUS_15960 521 90 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_15960 1402 659 gene locus_tag LOCUS_15970 1402 659 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_15970 2117 1419 gene locus_tag LOCUS_15980 2117 1419 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_15980 3370 2297 gene locus_tag LOCUS_15990 3370 2297 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_15990 3623 3408 gene locus_tag LOCUS_16000 3623 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4495 3878 gene locus_tag LOCUS_16010 4495 3878 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_16010 4718 5836 gene locus_tag LOCUS_16020 4718 5836 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_16020 <6733 5942 gene locus_tag LOCUS_16030 <6733 5942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000698132.1:alpha/beta hydrolase >Feature sequence0209 1628 282 gene locus_tag LOCUS_16040 1628 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1713 3653 gene locus_tag LOCUS_16050 1713 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3761 4444 gene locus_tag LOCUS_16060 3761 4444 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_16060 4441 5694 gene locus_tag LOCUS_16070 4441 5694 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence0210 537 2576 gene locus_tag LOCUS_16080 537 2576 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181435.1 protein_id gnl|my_center|LOCUS_16080 2773 3915 gene locus_tag LOCUS_16090 2773 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6432 4684 gene locus_tag LOCUS_16100 6432 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence0211 <1 1459 gene locus_tag LOCUS_16110 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P13799:signal transduction histidine-protein kinase/phosphatase DegS 1586 2149 gene locus_tag LOCUS_16120 gene yhcZ 1586 2149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 protein_id gnl|my_center|LOCUS_16120 2299 3510 gene locus_tag LOCUS_16130 2299 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3805 4359 gene locus_tag LOCUS_16140 3805 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4623 5618 gene locus_tag LOCUS_16150 4623 5618 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_16150 5620 6699 gene locus_tag LOCUS_16160 5620 6699 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence0212 <1 1074 gene locus_tag LOCUS_16170 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404972.1:methylmalonyl-CoA carboxyltransferase 1248 2315 gene locus_tag LOCUS_16180 1248 2315 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_16180 2452 3219 gene locus_tag LOCUS_16190 2452 3219 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_16190 3410 4759 gene locus_tag LOCUS_16200 3410 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4768 5526 gene locus_tag LOCUS_16210 4768 5526 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_16210 5523 6128 gene locus_tag LOCUS_16220 5523 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0213 1612 1085 gene locus_tag LOCUS_16230 1612 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2931 1609 gene locus_tag LOCUS_16240 gene tilS 2931 1609 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_16240 2981 4597 gene locus_tag LOCUS_16250 2981 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_16250 4786 5493 gene locus_tag LOCUS_16260 4786 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5528 6496 gene locus_tag LOCUS_16270 5528 6496 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence0214 3003 1132 gene locus_tag LOCUS_16280 3003 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5898 3007 gene locus_tag LOCUS_16290 5898 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6191 5898 gene locus_tag LOCUS_16300 6191 5898 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0215 3800 3462 gene locus_tag LOCUS_16310 3800 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4159 6126 gene locus_tag LOCUS_16320 4159 6126 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0216 1632 271 gene locus_tag LOCUS_16330 gene hemN 1632 271 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_16330 2007 3377 gene locus_tag LOCUS_16340 2007 3377 CDS product 4,5-dihydroxyphthalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_16340 3533 3973 gene locus_tag LOCUS_16350 3533 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4803 4039 gene locus_tag LOCUS_16360 4803 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 5153 4800 gene locus_tag LOCUS_16370 5153 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 6191 5160 gene locus_tag LOCUS_16380 gene adh 6191 5160 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence0217 512 99 gene locus_tag LOCUS_16390 512 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1692 946 gene locus_tag LOCUS_16400 1692 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_16400 3578 2220 gene locus_tag LOCUS_16410 gene rhlE 3578 2220 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_16410 3715 5064 gene locus_tag LOCUS_16420 gene pyrC1 3715 5064 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_16420 5139 5213 gene locus_tag LOCUS_t00060 5139 5213 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0218 >Feature sequence0219 296 1075 gene locus_tag LOCUS_16430 296 1075 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_16430 1078 2829 gene locus_tag LOCUS_16440 gene arsA 1078 2829 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121660.1 protein_id gnl|my_center|LOCUS_16440 3052 5814 gene locus_tag LOCUS_16450 3052 5814 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence0220 553 1833 gene locus_tag LOCUS_16460 553 1833 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_16460 3325 1943 gene locus_tag LOCUS_16470 3325 1943 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_16470 4157 3318 gene locus_tag LOCUS_16480 4157 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 6186 4177 gene locus_tag LOCUS_16490 6186 4177 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0221 47 673 gene locus_tag LOCUS_16500 gene uvrY 47 673 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 protein_id gnl|my_center|LOCUS_16500 670 1704 gene locus_tag LOCUS_16510 670 1704 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704793.1 protein_id gnl|my_center|LOCUS_16510 1930 4113 gene locus_tag LOCUS_16520 1930 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4775 4266 gene locus_tag LOCUS_16530 4775 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence0222 995 366 gene locus_tag LOCUS_16540 995 366 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_16540 2370 1381 gene locus_tag LOCUS_16550 2370 1381 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_16550 4531 2342 gene locus_tag LOCUS_16560 gene rnr 4531 2342 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_16560 4709 5488 gene locus_tag LOCUS_16570 4709 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 <6497 5839 gene locus_tag LOCUS_16580 <6497 5839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962213.1:3'-5' exonuclease >Feature sequence0223 1596 2429 gene locus_tag LOCUS_16590 1596 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3602 2619 gene locus_tag LOCUS_16600 3602 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5088 3727 gene locus_tag LOCUS_16610 5088 3727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_16610 6092 5196 gene locus_tag LOCUS_16620 6092 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6476 6159 gene locus_tag LOCUS_16630 6476 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence0224 <1 2269 gene locus_tag LOCUS_16640 <1 2269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261385.1:chitinase 3200 2391 gene locus_tag LOCUS_16650 3200 2391 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_16650 4570 3197 gene locus_tag LOCUS_16660 4570 3197 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_16660 5955 4744 gene locus_tag LOCUS_16670 5955 4744 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0225 969 511 gene locus_tag LOCUS_16680 969 511 CDS product DUF4890 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108962.1 protein_id gnl|my_center|LOCUS_16680 1132 1578 gene locus_tag LOCUS_16690 1132 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2930 1587 gene locus_tag LOCUS_16700 2930 1587 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_16700 3084 3791 gene locus_tag LOCUS_16710 3084 3791 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_16710 3860 4429 gene locus_tag LOCUS_16720 3860 4429 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E1 protein_id gnl|my_center|LOCUS_16720 4515 4829 gene locus_tag LOCUS_16730 4515 4829 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_16730 4810 5070 gene locus_tag LOCUS_16740 4810 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_16740 6118 5138 gene locus_tag LOCUS_16750 6118 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0226 1223 2311 gene locus_tag LOCUS_16760 1223 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2322 2876 gene locus_tag LOCUS_16770 2322 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2876 3640 gene locus_tag LOCUS_16780 2876 3640 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_16780 4467 3823 gene locus_tag LOCUS_16790 gene pyrE 4467 3823 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 protein_id gnl|my_center|LOCUS_16790 4575 5261 gene locus_tag LOCUS_16800 4575 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5704 5249 gene locus_tag LOCUS_16810 gene coaD 5704 5249 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831P9 protein_id gnl|my_center|LOCUS_16810 >Feature sequence0227 1425 868 gene locus_tag LOCUS_16820 1425 868 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_16820 3122 1443 gene locus_tag LOCUS_16830 3122 1443 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_16830 4023 3151 gene locus_tag LOCUS_16840 4023 3151 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_16840 5192 4026 gene locus_tag LOCUS_16850 5192 4026 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence0228 583 1695 gene locus_tag LOCUS_16860 583 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2562 1831 gene locus_tag LOCUS_16870 2562 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2830 3822 gene locus_tag LOCUS_16880 2830 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3981 4745 gene locus_tag LOCUS_16890 3981 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5955 4750 gene locus_tag LOCUS_16900 5955 4750 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582901.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence0229 549 3359 gene locus_tag LOCUS_16910 gene sucA 549 3359 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_16910 3485 5026 gene locus_tag LOCUS_16920 gene sucB 3485 5026 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_16920 5183 5536 gene locus_tag LOCUS_16930 5183 5536 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence0230 2813 1389 gene locus_tag LOCUS_16940 2813 1389 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_16940 4334 2841 gene locus_tag LOCUS_16950 4334 2841 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789258.1 protein_id gnl|my_center|LOCUS_16950 5931 4465 gene locus_tag LOCUS_16960 gene yidJ 5931 4465 CDS product sulfatase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_16960 6328 5942 gene locus_tag LOCUS_16970 6328 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence0231 1313 51 gene locus_tag LOCUS_16980 1313 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1491 2399 gene locus_tag LOCUS_16990 1491 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2484 3011 gene locus_tag LOCUS_17000 gene hpt 2484 3011 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_17000 3042 3614 gene locus_tag LOCUS_17010 gene adk 3042 3614 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_17010 3700 4695 gene locus_tag LOCUS_17020 gene obg 3700 4695 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_17020 4696 5343 gene locus_tag LOCUS_17030 4696 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0232 1104 730 gene locus_tag LOCUS_17040 1104 730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_17040 2910 1282 gene locus_tag LOCUS_17050 gene groL 2910 1282 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_17050 3231 2953 gene locus_tag LOCUS_17060 gene groS 3231 2953 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_17060 3450 4157 gene locus_tag LOCUS_17070 3450 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4556 4191 gene locus_tag LOCUS_17080 4556 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5388 4567 gene locus_tag LOCUS_17090 5388 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_17090 5967 5425 gene locus_tag LOCUS_17100 5967 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence0233 388 2082 gene locus_tag LOCUS_17110 388 2082 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_17110 3232 2114 gene locus_tag LOCUS_17120 3232 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4780 3548 gene locus_tag LOCUS_17130 4780 3548 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_17130 5797 4787 gene locus_tag LOCUS_17140 5797 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence0234 <1 1045 gene locus_tag LOCUS_17150 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIS0:N-acetyl-gamma-glutamyl-phosphate reductase 1056 2270 gene locus_tag LOCUS_17160 gene argJ 1056 2270 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A3 protein_id gnl|my_center|LOCUS_17160 2986 2438 gene locus_tag LOCUS_17170 2986 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3372 4037 gene locus_tag LOCUS_17180 3372 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4034 5086 gene locus_tag LOCUS_17190 4034 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 <6265 5073 gene locus_tag LOCUS_17200 <6265 5073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037710.1:D-amino-acid dehydrogenase >Feature sequence0235 846 70 gene locus_tag LOCUS_17210 846 70 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_17210 2834 927 gene locus_tag LOCUS_17220 2834 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3514 2978 gene locus_tag LOCUS_17230 3514 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4018 3554 gene locus_tag LOCUS_17240 4018 3554 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 protein_id gnl|my_center|LOCUS_17240 4949 3948 gene locus_tag LOCUS_17250 4949 3948 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_17250 5054 5830 gene locus_tag LOCUS_17260 gene fjo14 5054 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_17260 5830 6126 gene locus_tag LOCUS_17270 5830 6126 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0236 1406 420 gene locus_tag LOCUS_17280 1406 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3271 1493 gene locus_tag LOCUS_17290 3271 1493 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_17290 <6244 3283 gene locus_tag LOCUS_17300 <6244 3283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107218.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0237 <1 2509 gene locus_tag LOCUS_17310 <1 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator 2493 2903 gene locus_tag LOCUS_17320 2493 2903 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_17320 3326 3075 gene locus_tag LOCUS_17330 3326 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3591 5594 gene locus_tag LOCUS_17340 3591 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence0238 470 1663 gene locus_tag LOCUS_17350 470 1663 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_17350 2361 1729 gene locus_tag LOCUS_17360 2361 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2786 2358 gene locus_tag LOCUS_17370 2786 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2954 3484 gene locus_tag LOCUS_17380 2954 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4598 3726 gene locus_tag LOCUS_17390 gene ykuF 4598 3726 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_17390 4722 5540 gene locus_tag LOCUS_17400 4722 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5973 5596 gene locus_tag LOCUS_17410 5973 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0239 258 1331 gene locus_tag LOCUS_17420 258 1331 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_17420 1337 4402 gene locus_tag LOCUS_17430 1337 4402 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence0240 94 408 gene locus_tag LOCUS_17440 94 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 421 675 gene locus_tag LOCUS_17450 421 675 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_17450 694 978 gene locus_tag LOCUS_17460 694 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1687 2727 gene locus_tag LOCUS_17470 1687 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2948 3571 gene locus_tag LOCUS_17480 2948 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3568 4272 gene locus_tag LOCUS_17490 3568 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0241 <1 502 gene locus_tag LOCUS_17500 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931922.1:NAD-dependent epimerase 607 1659 gene locus_tag LOCUS_17510 gene rmlB 607 1659 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_17510 2211 2420 gene locus_tag LOCUS_17520 2211 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2420 2671 gene locus_tag LOCUS_17530 2420 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_17530 3032 2826 gene locus_tag LOCUS_17540 3032 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3249 3040 gene locus_tag LOCUS_17550 3249 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0242 255 2048 gene locus_tag LOCUS_17560 gene lepA 255 2048 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_17560 2147 2497 gene locus_tag LOCUS_17570 2147 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_17570 2577 3458 gene locus_tag LOCUS_17580 gene folD 2577 3458 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_17580 3620 3704 gene locus_tag LOCUS_t00070 3620 3704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3812 4351 gene locus_tag LOCUS_17590 3812 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4947 4348 gene locus_tag LOCUS_17600 gene rnhB 4947 4348 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_17600 <6199 4919 gene locus_tag LOCUS_17610 <6199 4919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0243 930 1301 gene locus_tag LOCUS_17620 gene yjbI 930 1301 CDS product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31607 protein_id gnl|my_center|LOCUS_17620 1304 2062 gene locus_tag LOCUS_17630 1304 2062 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_17630 2204 2491 gene locus_tag LOCUS_17640 gene gatC 2204 2491 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_17640 2693 2466 gene locus_tag LOCUS_17650 2693 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3200 2922 gene locus_tag LOCUS_17660 3200 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3379 5301 gene locus_tag LOCUS_17670 3379 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5424 6101 gene locus_tag LOCUS_17680 5424 6101 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0244 142 477 gene locus_tag LOCUS_17690 142 477 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976375.1 protein_id gnl|my_center|LOCUS_17690 799 479 gene locus_tag LOCUS_17700 799 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 850 1593 gene locus_tag LOCUS_17710 850 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2415 1873 gene locus_tag LOCUS_17720 gene tag 2415 1873 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_17720 2921 2616 gene locus_tag LOCUS_17730 2921 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_17730 3026 3715 gene locus_tag LOCUS_17740 3026 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4207 5103 gene locus_tag LOCUS_17750 4207 5103 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_17750 5326 5838 gene locus_tag LOCUS_17760 5326 5838 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0245 1571 591 gene locus_tag LOCUS_17770 1571 591 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_17770 2231 1572 gene locus_tag LOCUS_17780 2231 1572 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_17780 3383 2388 gene locus_tag LOCUS_17790 3383 2388 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_17790 3488 5134 gene locus_tag LOCUS_17800 gene uxaA 3488 5134 CDS product carbohydrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_17800 <6187 5562 gene locus_tag LOCUS_17810 <6187 5562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EMZ6:2,3-diketo-L-gulonate reductase >Feature sequence0246 684 64 gene locus_tag LOCUS_17820 684 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_17820 869 2407 gene locus_tag LOCUS_17830 gene gltX 869 2407 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_17830 2413 2619 gene locus_tag LOCUS_17840 2413 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2855 5614 gene locus_tag LOCUS_17850 2855 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence0247 3743 489 gene locus_tag LOCUS_17860 3743 489 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_17860 5045 4584 gene locus_tag LOCUS_17870 5045 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5459 5049 gene locus_tag LOCUS_17880 5459 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17880 5574 6023 gene locus_tag LOCUS_17890 5574 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0248 361 1374 gene locus_tag LOCUS_17900 361 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1463 3334 gene locus_tag LOCUS_17910 1463 3334 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_17910 3376 4959 gene locus_tag LOCUS_17920 gene yidK 3376 4959 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0249 616 1614 gene locus_tag LOCUS_17930 gene fabH2 616 1614 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_17930 1618 2160 gene locus_tag LOCUS_17940 1618 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2246 3829 gene locus_tag LOCUS_17950 2246 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3879 4058 gene locus_tag LOCUS_17960 3879 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4292 5608 gene locus_tag LOCUS_17970 4292 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 <6164 5659 gene locus_tag LOCUS_17980 <6164 5659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868347.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase >Feature sequence0250 3213 229 gene locus_tag LOCUS_17990 3213 229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_17990 3350 3679 gene locus_tag LOCUS_18000 3350 3679 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_18000 3757 5178 gene locus_tag LOCUS_18010 3757 5178 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_18010 5153 5338 gene locus_tag LOCUS_18020 5153 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5619 6059 gene locus_tag LOCUS_18030 5619 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0251 1558 2 gene locus_tag LOCUS_18040 1558 2 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_18040 1900 3123 gene locus_tag LOCUS_18050 1900 3123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_18050 4261 3194 gene locus_tag LOCUS_18060 4261 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5303 4647 gene locus_tag LOCUS_18070 5303 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence0252 1322 60 gene locus_tag LOCUS_18080 1322 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18080 1671 3140 gene locus_tag LOCUS_18090 1671 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3150 4601 gene locus_tag LOCUS_18100 3150 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence0253 <1 869 gene locus_tag LOCUS_18110 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940551.1:aldehyde dehydrogenase 1037 1600 gene locus_tag LOCUS_18120 1037 1600 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_18120 1618 1809 gene locus_tag LOCUS_18130 gene rpmF 1618 1809 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_18130 2062 3060 gene locus_tag LOCUS_18140 gene fabH 2062 3060 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_18140 3086 3649 gene locus_tag LOCUS_18150 gene efp 3086 3649 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_18150 3762 4235 gene locus_tag LOCUS_18160 gene accB 3762 4235 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_18160 4330 5613 gene locus_tag LOCUS_18170 gene accC 4330 5613 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0254 <1 1179 gene locus_tag LOCUS_18180 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA 1190 1753 gene locus_tag LOCUS_18190 1190 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1719 2906 gene locus_tag LOCUS_18200 1719 2906 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_18200 3089 3865 gene locus_tag LOCUS_18210 3089 3865 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_18210 3981 4943 gene locus_tag LOCUS_18220 gene hpnA 3981 4943 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_18220 5004 5870 gene locus_tag LOCUS_18230 5004 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence0255 1726 4101 gene locus_tag LOCUS_18240 1726 4101 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0256 <1 2978 gene locus_tag LOCUS_18250 <1 2978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein 2991 4733 gene locus_tag LOCUS_18260 2991 4733 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence0257 592 951 gene locus_tag LOCUS_18270 592 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 944 1729 gene locus_tag LOCUS_18280 944 1729 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_18280 1726 3936 gene locus_tag LOCUS_18290 1726 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 4807 4001 gene locus_tag LOCUS_18300 4807 4001 CDS product alpha/beta hydrolase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence0258 379 1635 gene locus_tag LOCUS_18310 379 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2054 4024 gene locus_tag LOCUS_18320 2054 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence0259 3 878 gene locus_tag LOCUS_18330 gene hemC 3 878 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_18330 875 1708 gene locus_tag LOCUS_18340 875 1708 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_18340 1692 2636 gene locus_tag LOCUS_18350 1692 2636 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_18350 2736 4064 gene locus_tag LOCUS_18360 2736 4064 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_18360 4087 4554 gene locus_tag LOCUS_18370 4087 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4651 5241 gene locus_tag LOCUS_18380 4651 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5595 5344 gene locus_tag LOCUS_18390 5595 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0260 206 2344 gene locus_tag LOCUS_18400 gene recQ 206 2344 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_18400 2450 3307 gene locus_tag LOCUS_18410 2450 3307 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_18410 3480 4676 gene locus_tag LOCUS_18420 3480 4676 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_18420 5572 4868 gene locus_tag LOCUS_18430 5572 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_18430 5768 5950 gene locus_tag LOCUS_18440 5768 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence0261 123 2651 gene locus_tag LOCUS_18450 123 2651 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_18450 2773 3549 gene locus_tag LOCUS_18460 2773 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_18460 4564 3707 gene locus_tag LOCUS_18470 4564 3707 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947995.1 protein_id gnl|my_center|LOCUS_18470 5656 4655 gene locus_tag LOCUS_18480 5656 4655 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence0262 263 1546 gene locus_tag LOCUS_18490 gene hemA 263 1546 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93ST4 protein_id gnl|my_center|LOCUS_18490 1685 3265 gene locus_tag LOCUS_18500 1685 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4380 3364 gene locus_tag LOCUS_18510 4380 3364 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_18510 4845 4384 gene locus_tag LOCUS_18520 4845 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <5961 5315 gene locus_tag LOCUS_18530 <5961 5315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF3:proline--tRNA ligase >Feature sequence0263 205 630 gene locus_tag LOCUS_18540 205 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1526 957 gene locus_tag LOCUS_18550 1526 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1560 1751 gene locus_tag LOCUS_18560 1560 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2305 1880 gene locus_tag LOCUS_18570 2305 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2846 2406 gene locus_tag LOCUS_18580 2846 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3240 4337 gene locus_tag LOCUS_18590 3240 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0264 1279 275 gene locus_tag LOCUS_18600 1279 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1546 1307 gene locus_tag LOCUS_18610 1546 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1959 1543 gene locus_tag LOCUS_18620 1959 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_18620 5403 2023 gene locus_tag LOCUS_18630 gene icmF 5403 2023 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_18630 >Feature sequence0265 <1 948 gene locus_tag LOCUS_18640 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase 2076 976 gene locus_tag LOCUS_18650 gene wecE 2076 976 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_18650 3343 2051 gene locus_tag LOCUS_18660 3343 2051 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_18660 4857 3871 gene locus_tag LOCUS_18670 4857 3871 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706684.1 protein_id gnl|my_center|LOCUS_18670 4935 5324 gene locus_tag LOCUS_18680 4935 5324 CDS product DabB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence0266 3177 2131 gene locus_tag LOCUS_18690 3177 2131 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_18690 5048 3426 gene locus_tag LOCUS_18700 5048 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203329.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence0267 1027 650 gene locus_tag LOCUS_18710 1027 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1370 1014 gene locus_tag LOCUS_18720 1370 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2035 1424 gene locus_tag LOCUS_18730 2035 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2322 3056 gene locus_tag LOCUS_18740 2322 3056 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_18740 3167 4006 gene locus_tag LOCUS_18750 3167 4006 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_18750 4073 5875 gene locus_tag LOCUS_18760 4073 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence0268 2015 522 gene locus_tag LOCUS_18770 gene cysS 2015 522 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F4 protein_id gnl|my_center|LOCUS_18770 2617 2378 gene locus_tag LOCUS_18780 2617 2378 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_18780 4388 2862 gene locus_tag LOCUS_18790 gene purH 4388 2862 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_18790 5055 4498 gene locus_tag LOCUS_18800 gene purN 5055 4498 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_18800 5435 5139 gene locus_tag LOCUS_18810 gene relE 5435 5139 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_18810 5691 5437 gene locus_tag LOCUS_18820 5691 5437 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence0269 303 2717 gene locus_tag LOCUS_18830 303 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2935 3762 gene locus_tag LOCUS_18840 2935 3762 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_18840 3796 5574 gene locus_tag LOCUS_18850 3796 5574 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0270 1400 2506 gene locus_tag LOCUS_18860 1400 2506 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225122.1 protein_id gnl|my_center|LOCUS_18860 2819 3862 gene locus_tag LOCUS_18870 2819 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3970 5025 gene locus_tag LOCUS_18880 3970 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence0271 <1 721 gene locus_tag LOCUS_18890 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156916.1:symporter 734 1741 gene locus_tag LOCUS_18900 734 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1919 3013 gene locus_tag LOCUS_18910 gene hppD 1919 3013 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_18910 3242 4975 gene locus_tag LOCUS_18920 3242 4975 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_18920 5242 5811 gene locus_tag LOCUS_18930 5242 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0272 1936 152 gene locus_tag LOCUS_18940 1936 152 CDS product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_18940 2765 2142 gene locus_tag LOCUS_18950 2765 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764790.1 protein_id gnl|my_center|LOCUS_18950 3706 2819 gene locus_tag LOCUS_18960 3706 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5256 3961 gene locus_tag LOCUS_18970 5256 3961 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_18970 5719 5261 gene locus_tag LOCUS_18980 5719 5261 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence0273 2118 598 gene locus_tag LOCUS_18990 gene gpmI 2118 598 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_18990 2327 2737 gene locus_tag LOCUS_19000 2327 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2772 3632 gene locus_tag LOCUS_19010 2772 3632 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_19010 4998 3766 gene locus_tag LOCUS_19020 4998 3766 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_19020 5513 5175 gene locus_tag LOCUS_19030 5513 5175 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704615.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence0274 687 121 gene locus_tag LOCUS_19040 687 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 950 2353 gene locus_tag LOCUS_19050 950 2353 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_19050 2673 2392 gene locus_tag LOCUS_19060 2673 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2904 3284 gene locus_tag LOCUS_19070 2904 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3354 4247 gene locus_tag LOCUS_19080 3354 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4699 4460 gene locus_tag LOCUS_19090 4699 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5224 4724 gene locus_tag LOCUS_19100 5224 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 <5831 5292 gene locus_tag LOCUS_19110 <5831 5292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WBS2:peptide methionine sulfoxide reductase MsrA >Feature sequence0275 2667 436 gene locus_tag LOCUS_19120 2667 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2893 4170 gene locus_tag LOCUS_19130 gene fahA 2893 4170 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_19130 4527 4294 gene locus_tag LOCUS_19140 4527 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence0276 12 686 gene locus_tag LOCUS_19150 12 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 747 1493 gene locus_tag LOCUS_19160 747 1493 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_19160 1666 1959 gene locus_tag LOCUS_19170 1666 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1970 2218 gene locus_tag LOCUS_19180 1970 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_19180 2458 2874 gene locus_tag LOCUS_19190 2458 2874 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_19190 3206 3403 gene locus_tag LOCUS_19200 3206 3403 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_19200 3408 5429 gene locus_tag LOCUS_19210 3408 5429 CDS product type III restriction endonuclease EcoP15I subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367546.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence0277 20 104 gene locus_tag LOCUS_t00080 20 104 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 829 341 gene locus_tag LOCUS_19220 829 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 923 1174 gene locus_tag LOCUS_19230 923 1174 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CY23 protein_id gnl|my_center|LOCUS_19230 1187 1441 gene locus_tag LOCUS_19240 1187 1441 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_19240 1626 1450 gene locus_tag LOCUS_19250 1626 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2695 1682 gene locus_tag LOCUS_19260 gene ltaE 2695 1682 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_19260 3900 2938 gene locus_tag LOCUS_19270 3900 2938 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_19270 4345 3893 gene locus_tag LOCUS_19280 4345 3893 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_19280 4650 5747 gene locus_tag LOCUS_19290 4650 5747 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence0278 1795 566 gene locus_tag LOCUS_19300 1795 566 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_19300 1936 3225 gene locus_tag LOCUS_19310 gene pepP 1936 3225 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_19310 3654 3277 gene locus_tag LOCUS_19320 3654 3277 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_19320 3727 4752 gene locus_tag LOCUS_19330 3727 4752 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108897.1 protein_id gnl|my_center|LOCUS_19330 5768 4968 gene locus_tag LOCUS_19340 5768 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0279 3165 697 gene locus_tag LOCUS_19350 gene mur/alr 3165 697 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_19350 4244 3195 gene locus_tag LOCUS_19360 4244 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_19360 4997 4248 gene locus_tag LOCUS_19370 gene scpA 4997 4248 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_19370 >Feature sequence0280 <1 613 gene locus_tag LOCUS_19380 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968694.1:membrane protein 648 2012 gene locus_tag LOCUS_19390 648 2012 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_19390 2009 2431 gene locus_tag LOCUS_19400 2009 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2428 3693 gene locus_tag LOCUS_19410 gene hsdS 2428 3693 CDS product specificity protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_19410 3762 4151 gene locus_tag LOCUS_19420 3762 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0281 202 588 gene locus_tag LOCUS_19430 gene apaG 202 588 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257425.1 protein_id gnl|my_center|LOCUS_19430 585 1370 gene locus_tag LOCUS_19440 585 1370 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_19440 1957 1364 gene locus_tag LOCUS_19450 gene tpm 1957 1364 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_19450 1998 2912 gene locus_tag LOCUS_19460 1998 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3505 3876 gene locus_tag LOCUS_19470 gene rpsF 3505 3876 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_19470 3873 4124 gene locus_tag LOCUS_19480 gene rpsR 3873 4124 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH8 protein_id gnl|my_center|LOCUS_19480 4167 4610 gene locus_tag LOCUS_19490 gene rplI 4167 4610 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_19490 4928 4680 gene locus_tag LOCUS_19500 4928 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence0282 423 2198 gene locus_tag LOCUS_19510 gene sglT 423 2198 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_19510 2794 2246 gene locus_tag LOCUS_19520 2794 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2907 3437 gene locus_tag LOCUS_19530 2907 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4203 3601 gene locus_tag LOCUS_19540 4203 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4322 5338 gene locus_tag LOCUS_19550 4322 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0283 408 857 gene locus_tag LOCUS_19560 408 857 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_19560 1642 923 gene locus_tag LOCUS_19570 1642 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3064 1646 gene locus_tag LOCUS_19580 3064 1646 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_19580 3534 3061 gene locus_tag LOCUS_19590 3534 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3868 5487 gene locus_tag LOCUS_19600 3868 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0284 406 1404 gene locus_tag LOCUS_19610 406 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1442 2464 gene locus_tag LOCUS_19620 1442 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2471 3778 gene locus_tag LOCUS_19630 gene algD 2471 3778 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_19630 3924 5078 gene locus_tag LOCUS_19640 3924 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence0285 1261 185 gene locus_tag LOCUS_19650 gene aroC 1261 185 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_19650 2639 1254 gene locus_tag LOCUS_19660 2639 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2820 3011 gene locus_tag LOCUS_19670 2820 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4254 3043 gene locus_tag LOCUS_19680 4254 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_19680 5208 4264 gene locus_tag LOCUS_19690 gene queG 5208 4264 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_19690 >Feature sequence0286 1907 144 gene locus_tag LOCUS_19700 gene rho 1907 144 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_19700 2795 2103 gene locus_tag LOCUS_19710 2795 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4771 2792 gene locus_tag LOCUS_19720 4771 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 5633 5046 gene locus_tag LOCUS_19730 gene tdk 5633 5046 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_19730 >Feature sequence0287 533 246 gene locus_tag LOCUS_19740 533 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1011 535 gene locus_tag LOCUS_19750 1011 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1785 1345 gene locus_tag LOCUS_19760 1785 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2165 1782 gene locus_tag LOCUS_19770 2165 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3398 2277 gene locus_tag LOCUS_19780 3398 2277 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_19780 4698 3775 gene locus_tag LOCUS_19790 4698 3775 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM52 protein_id gnl|my_center|LOCUS_19790 <5621 4695 gene locus_tag LOCUS_19800 <5621 4695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118593.1:oxidoreductase >Feature sequence0288 1300 428 gene locus_tag LOCUS_19810 1300 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1502 1852 gene locus_tag LOCUS_19820 gene yqjZ 1502 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_19820 3165 2086 gene locus_tag LOCUS_19830 gene dinB2 3165 2086 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_19830 4377 3181 gene locus_tag LOCUS_19840 gene pabB 4377 3181 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_19840 5230 4511 gene locus_tag LOCUS_19850 5230 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence0289 <1 1203 gene locus_tag LOCUS_19860 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203525.1:single-stranded-DNA-specific exonuclease RecJ 1206 1943 gene locus_tag LOCUS_19870 gene lptB 1206 1943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_19870 1943 3460 gene locus_tag LOCUS_19880 1943 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_19880 4242 3664 gene locus_tag LOCUS_19890 gene mtgA 4242 3664 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_19890 5181 4366 gene locus_tag LOCUS_19900 5181 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence0290 1602 1408 gene locus_tag LOCUS_19910 1602 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2577 1639 gene locus_tag LOCUS_19920 gene thrB 2577 1639 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_19920 5072 2577 gene locus_tag LOCUS_19930 gene thrA 5072 2577 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence0291 660 4013 gene locus_tag LOCUS_19940 gene mfd 660 4013 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_19940 4192 5418 gene locus_tag LOCUS_19950 4192 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0292 <1 1557 gene locus_tag LOCUS_19960 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase 1596 1907 gene locus_tag LOCUS_19970 1596 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2385 3218 gene locus_tag LOCUS_19980 gene prmC 2385 3218 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_19980 3311 3838 gene locus_tag LOCUS_19990 3311 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3944 4780 gene locus_tag LOCUS_20000 3944 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4782 5456 gene locus_tag LOCUS_20010 4782 5456 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence0293 1124 2248 gene locus_tag LOCUS_20020 1124 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2273 2530 gene locus_tag LOCUS_20030 2273 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2967 2497 gene locus_tag LOCUS_20040 2967 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3591 4859 gene locus_tag LOCUS_20050 3591 4859 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250162.1 protein_id gnl|my_center|LOCUS_20050 4883 5473 gene locus_tag LOCUS_20060 4883 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence0294 2939 1737 gene locus_tag LOCUS_20070 gene galA 2939 1737 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0295 3835 2828 gene locus_tag LOCUS_20080 3835 2828 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence0296 1955 435 gene locus_tag LOCUS_20090 1955 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2611 2859 gene locus_tag LOCUS_20100 2611 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4533 2938 gene locus_tag LOCUS_20110 4533 2938 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 protein_id gnl|my_center|LOCUS_20110 <5537 4652 gene locus_tag LOCUS_20120 <5537 4652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase >Feature sequence0297 1176 226 gene locus_tag LOCUS_20130 1176 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_20130 2468 1260 gene locus_tag LOCUS_20140 2468 1260 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_20140 3243 2482 gene locus_tag LOCUS_20150 3243 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_20150 3404 3859 gene locus_tag LOCUS_20160 3404 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence0298 2237 774 gene locus_tag LOCUS_20170 gene murE 2237 774 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_20170 4352 2238 gene locus_tag LOCUS_20180 gene ftsI 4352 2238 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_20180 4729 4349 gene locus_tag LOCUS_20190 4729 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 <5513 4891 gene locus_tag LOCUS_20200 <5513 4891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A251:ribosomal RNA small subunit methyltransferase H >Feature sequence0299 3 761 gene locus_tag LOCUS_20210 3 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1345 926 gene locus_tag LOCUS_20220 1345 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1703 1380 gene locus_tag LOCUS_20230 1703 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064648.1 protein_id gnl|my_center|LOCUS_20230 1709 1966 gene locus_tag LOCUS_20240 1709 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2218 1988 gene locus_tag LOCUS_20250 2218 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2284 3402 gene locus_tag LOCUS_20260 2284 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3384 4259 gene locus_tag LOCUS_20270 3384 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4397 4564 gene locus_tag LOCUS_20280 4397 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4557 5159 gene locus_tag LOCUS_20290 4557 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence0300 <1 1060 gene locus_tag LOCUS_20300 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64QS2:histidine--tRNA ligase 1485 1117 gene locus_tag LOCUS_20310 1485 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1609 1941 gene locus_tag LOCUS_20320 1609 1941 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44711 protein_id gnl|my_center|LOCUS_20320 1941 2945 gene locus_tag LOCUS_20330 1941 2945 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_20330 3213 2995 gene locus_tag LOCUS_20340 3213 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_20340 3281 5068 gene locus_tag LOCUS_20350 3281 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0301 <1 732 gene locus_tag LOCUS_20360 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZV9:ribonuclease 3 778 2625 gene locus_tag LOCUS_20370 gene nadE 778 2625 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_20370 2666 3775 gene locus_tag LOCUS_20380 2666 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0302 387 1193 gene locus_tag LOCUS_20390 387 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1758 1276 gene locus_tag LOCUS_20400 1758 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4244 1842 gene locus_tag LOCUS_20410 gene nrdA 4244 1842 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_20410 5267 4287 gene locus_tag LOCUS_20420 gene nrdB 5267 4287 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence0303 1 1434 gene locus_tag LOCUS_20430 1 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_20430 1427 2164 gene locus_tag LOCUS_20440 1427 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2167 3411 gene locus_tag LOCUS_20450 2167 3411 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_20450 3526 3729 gene locus_tag LOCUS_20460 3526 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3751 5181 gene locus_tag LOCUS_20470 gene gatA 3751 5181 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_20470 >Feature sequence0304 1318 2769 gene locus_tag LOCUS_20480 gene asnS 1318 2769 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_20480 4072 2825 gene locus_tag LOCUS_20490 4072 2825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_20490 <5470 4141 gene locus_tag LOCUS_20500 <5470 4141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme >Feature sequence0305 2629 2216 gene locus_tag LOCUS_20510 2629 2216 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_20510 2930 2631 gene locus_tag LOCUS_20520 2930 2631 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_20520 4734 2941 gene locus_tag LOCUS_20530 4734 2941 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_20530 5401 4739 gene locus_tag LOCUS_20540 5401 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence0306 822 361 gene locus_tag LOCUS_20550 822 361 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_20550 1452 3266 gene locus_tag LOCUS_20560 1452 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3449 5248 gene locus_tag LOCUS_20570 3449 5248 CDS product large multi-functional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence0307 1305 4 gene locus_tag LOCUS_20580 gene bfmBB 1305 4 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_20580 2654 1389 gene locus_tag LOCUS_20590 2654 1389 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_20590 3144 2641 gene locus_tag LOCUS_20600 gene dfrA 3144 2641 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_20600 4296 3367 gene locus_tag LOCUS_20610 4296 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5407 4484 gene locus_tag LOCUS_20620 gene fmt 5407 4484 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0308 763 470 gene locus_tag LOCUS_20630 763 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1490 987 gene locus_tag LOCUS_20640 1490 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2050 1535 gene locus_tag LOCUS_20650 gene recX 2050 1535 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_20650 2124 2885 gene locus_tag LOCUS_20660 gene tpiA 2124 2885 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_20660 3025 3855 gene locus_tag LOCUS_20670 gene prmA 3025 3855 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_20670 <5456 4270 gene locus_tag LOCUS_20680 <5456 4270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter >Feature sequence0309 2003 1305 gene locus_tag LOCUS_20690 gene ulaF 2003 1305 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z167 protein_id gnl|my_center|LOCUS_20690 3793 2129 gene locus_tag LOCUS_20700 gene araB 3793 2129 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58542 protein_id gnl|my_center|LOCUS_20700 5379 3847 gene locus_tag LOCUS_20710 gene abf2 5379 3847 CDS product intracellular exo-alpha-L-arabinofuranosidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94552 protein_id gnl|my_center|LOCUS_20710 >Feature sequence0310 4430 3315 gene locus_tag LOCUS_20720 gene smf 4430 3315 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_20720 4773 4414 gene locus_tag LOCUS_20730 4773 4414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_20730 5150 4812 gene locus_tag LOCUS_20740 5150 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence0311 <1 807 gene locus_tag LOCUS_20750 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein 821 2560 gene locus_tag LOCUS_20760 821 2560 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_20760 3457 2726 gene locus_tag LOCUS_20770 3457 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4525 3464 gene locus_tag LOCUS_20780 4525 3464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence0312 <1 1234 gene locus_tag LOCUS_20790 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920868.1:peptidase M20 1592 2785 gene locus_tag LOCUS_20800 1592 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3245 2877 gene locus_tag LOCUS_20810 3245 2877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_20810 3553 3257 gene locus_tag LOCUS_20820 3553 3257 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_20820 3629 3811 gene locus_tag LOCUS_20830 3629 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 4226 4014 gene locus_tag LOCUS_20840 4226 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 >Feature sequence0313 <1 1911 gene locus_tag LOCUS_20850 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120603.1:potassium transporter 3071 2298 gene locus_tag LOCUS_20860 3071 2298 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_20860 4294 3044 gene locus_tag LOCUS_20870 4294 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4344 5132 gene locus_tag LOCUS_20880 4344 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704094.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence0314 755 435 gene locus_tag LOCUS_20890 gene trx2 755 435 CDS product thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE49 protein_id gnl|my_center|LOCUS_20890 5216 930 gene locus_tag LOCUS_20900 gene dnaE 5216 930 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence0315 1058 1234 gene locus_tag LOCUS_20910 1058 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence0316 143 216 gene locus_tag LOCUS_t00090 143 216 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 504 1118 gene locus_tag LOCUS_20920 gene grpB 504 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957538.1 protein_id gnl|my_center|LOCUS_20920 1920 3590 gene locus_tag LOCUS_20930 gene snf 1920 3590 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_20930 3704 4669 gene locus_tag LOCUS_20940 3704 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0317 1099 2796 gene locus_tag LOCUS_20950 1099 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2842 4371 gene locus_tag LOCUS_20960 2842 4371 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_20960 <5360 4381 gene locus_tag LOCUS_20970 <5360 4381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404668.1:D-aminopeptidase >Feature sequence0318 77 712 gene locus_tag LOCUS_20980 gene trpF 77 712 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_20980 885 2063 gene locus_tag LOCUS_20990 gene trpB 885 2063 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_20990 2219 2992 gene locus_tag LOCUS_21000 gene trpA 2219 2992 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_21000 2996 4015 gene locus_tag LOCUS_21010 2996 4015 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_21010 4341 5123 gene locus_tag LOCUS_21020 4341 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0319 846 1301 gene locus_tag LOCUS_21030 846 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1508 2431 gene locus_tag LOCUS_21040 1508 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_21040 3038 3826 gene locus_tag LOCUS_21050 3038 3826 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_21050 5264 3969 gene locus_tag LOCUS_21060 5264 3969 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence0320 1604 462 gene locus_tag LOCUS_21070 1604 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3109 2141 gene locus_tag LOCUS_21080 3109 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 5257 3989 gene locus_tag LOCUS_21090 5257 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence0321 5009 4524 gene locus_tag LOCUS_21100 5009 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence0322 4352 1290 gene locus_tag LOCUS_21110 4352 1290 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_21110 <5308 4355 gene locus_tag LOCUS_21120 <5308 4355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784707.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence0323 656 1057 gene locus_tag LOCUS_21130 656 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1197 1643 gene locus_tag LOCUS_21140 1197 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1764 2771 gene locus_tag LOCUS_21150 1764 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2764 3213 gene locus_tag LOCUS_21160 2764 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3206 3610 gene locus_tag LOCUS_21170 3206 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3750 5240 gene locus_tag LOCUS_21180 3750 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence0324 2299 1127 gene locus_tag LOCUS_21190 2299 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3837 2380 gene locus_tag LOCUS_21200 3837 2380 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0325 1141 275 gene locus_tag LOCUS_21210 1141 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_21210 1391 1846 gene locus_tag LOCUS_21220 1391 1846 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088958.1 protein_id gnl|my_center|LOCUS_21220 1876 4155 gene locus_tag LOCUS_21230 1876 4155 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 protein_id gnl|my_center|LOCUS_21230 5267 4317 gene locus_tag LOCUS_21240 5267 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0326 388 996 gene locus_tag LOCUS_21250 gene engB 388 996 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T4 protein_id gnl|my_center|LOCUS_21250 1054 1491 gene locus_tag LOCUS_21260 1054 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_21260 1555 1860 gene locus_tag LOCUS_21270 1555 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2951 1914 gene locus_tag LOCUS_21280 gene fbp 2951 1914 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_21280 3009 4292 gene locus_tag LOCUS_21290 gene lysC 3009 4292 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_21290 5161 4289 gene locus_tag LOCUS_21300 5161 4289 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence0327 <1 1755 gene locus_tag LOCUS_21310 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119677.1:large multi-functional protein 1803 2732 gene locus_tag LOCUS_21320 1803 2732 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_21320 2897 4321 gene locus_tag LOCUS_21330 2897 4321 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_21330 4318 5145 gene locus_tag LOCUS_21340 4318 5145 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532465.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence0328 129 797 gene locus_tag LOCUS_21350 129 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 815 2062 gene locus_tag LOCUS_21360 815 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2141 4096 gene locus_tag LOCUS_21370 2141 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4940 4068 gene locus_tag LOCUS_21380 4940 4068 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence0329 4068 3514 gene locus_tag LOCUS_21390 gene yozB 4068 3514 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_21390 4723 4055 gene locus_tag LOCUS_21400 4723 4055 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_21400 5129 4800 gene locus_tag LOCUS_21410 5129 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence0330 1032 3974 gene locus_tag LOCUS_21420 1032 3974 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence0331 1965 742 gene locus_tag LOCUS_21430 1965 742 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657265.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21430 2695 2396 gene locus_tag LOCUS_21440 2695 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 <5234 2846 gene locus_tag LOCUS_21450 <5234 2846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter >Feature sequence0332 740 1591 gene locus_tag LOCUS_21460 740 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1594 2337 gene locus_tag LOCUS_21470 1594 2337 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_21470 2437 2688 gene locus_tag LOCUS_21480 2437 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2828 3604 gene locus_tag LOCUS_21490 2828 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3665 4318 gene locus_tag LOCUS_21500 3665 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 <5219 4386 gene locus_tag LOCUS_21510 <5219 4386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964024.1:flagellar motor protein MotB >Feature sequence0333 2106 1039 gene locus_tag LOCUS_21520 gene idiA 2106 1039 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_21520 2210 3142 gene locus_tag LOCUS_21530 2210 3142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_21530 3382 4002 gene locus_tag LOCUS_21540 3382 4002 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_21540 <5213 4052 gene locus_tag LOCUS_21550 <5213 4052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083236.1:two-component sensor histidine kinase >Feature sequence0334 535 460 gene locus_tag LOCUS_t00100 535 460 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 637 562 gene locus_tag LOCUS_t00110 637 562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2650 860 gene locus_tag LOCUS_21560 gene btuB 2650 860 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_21560 2873 4825 gene locus_tag LOCUS_21570 2873 4825 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0335 111 734 gene locus_tag LOCUS_21580 111 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 744 914 gene locus_tag LOCUS_21590 744 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1035 1430 gene locus_tag LOCUS_21600 1035 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_21600 1653 2402 gene locus_tag LOCUS_21610 1653 2402 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_21610 2692 3321 gene locus_tag LOCUS_21620 2692 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4154 3384 gene locus_tag LOCUS_21630 4154 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0336 695 255 gene locus_tag LOCUS_21640 695 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1970 747 gene locus_tag LOCUS_21650 1970 747 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_21650 2602 1967 gene locus_tag LOCUS_21660 2602 1967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_21660 3780 2602 gene locus_tag LOCUS_21670 3780 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4968 3832 gene locus_tag LOCUS_21680 4968 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence0337 2350 1616 gene locus_tag LOCUS_21690 gene wza 2350 1616 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence0338 2954 1965 gene locus_tag LOCUS_21700 2954 1965 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_21700 3240 3031 gene locus_tag LOCUS_21710 3240 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3958 3383 gene locus_tag LOCUS_21720 3958 3383 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_21720 5097 3955 gene locus_tag LOCUS_21730 gene porR 5097 3955 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence0339 202 1032 gene locus_tag LOCUS_21740 202 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1081 2250 gene locus_tag LOCUS_21750 gene rlmL 1081 2250 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_21750 4393 2294 gene locus_tag LOCUS_21760 4393 2294 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_21760 4644 4562 gene locus_tag LOCUS_t00120 4644 4562 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0340 1528 794 gene locus_tag LOCUS_21770 1528 794 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_21770 2460 1525 gene locus_tag LOCUS_21780 2460 1525 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_21780 3278 2508 gene locus_tag LOCUS_21790 3278 2508 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_21790 4726 3305 gene locus_tag LOCUS_21800 4726 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence0341 <1 622 gene locus_tag LOCUS_21810 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583579.1:adenylate/guanylate cyclase domain-containing protein 1445 771 gene locus_tag LOCUS_21820 1445 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3393 1447 gene locus_tag LOCUS_21830 3393 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_21830 4709 3720 gene locus_tag LOCUS_21840 4709 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence0342 486 2042 gene locus_tag LOCUS_21850 486 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2201 3058 gene locus_tag LOCUS_21860 2201 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_21860 3777 3055 gene locus_tag LOCUS_21870 gene truC 3777 3055 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence0343 739 299 gene locus_tag LOCUS_21880 739 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1833 796 gene locus_tag LOCUS_21890 1833 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2223 2008 gene locus_tag LOCUS_21900 2223 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2738 2310 gene locus_tag LOCUS_21910 2738 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3856 2900 gene locus_tag LOCUS_21920 3856 2900 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0344 398 1453 gene locus_tag LOCUS_21930 398 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1450 2709 gene locus_tag LOCUS_21940 gene lolC 1450 2709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_21940 2865 3587 gene locus_tag LOCUS_21950 gene lolD 2865 3587 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_21950 3700 4710 gene locus_tag LOCUS_21960 3700 4710 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0345 <1 1609 gene locus_tag LOCUS_21970 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108599.1:peptidase S41 2047 2448 gene locus_tag LOCUS_21980 2047 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3157 2561 gene locus_tag LOCUS_21990 3157 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 4313 3240 gene locus_tag LOCUS_22000 4313 3240 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_22000 4762 4316 gene locus_tag LOCUS_22010 4762 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence0346 1280 369 gene locus_tag LOCUS_22020 gene prs 1280 369 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZY1 protein_id gnl|my_center|LOCUS_22020 2751 1258 gene locus_tag LOCUS_22030 2751 1258 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_22030 2919 3533 gene locus_tag LOCUS_22040 2919 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3523 4278 gene locus_tag LOCUS_22050 3523 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0347 1 252 gene locus_tag LOCUS_22060 1 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 295 1185 gene locus_tag LOCUS_22070 295 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1322 1654 gene locus_tag LOCUS_22080 1322 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1783 3444 gene locus_tag LOCUS_22090 1783 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4952 3468 gene locus_tag LOCUS_22100 4952 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence0348 653 2980 gene locus_tag LOCUS_22110 653 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3068 3952 gene locus_tag LOCUS_22120 3068 3952 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence0349 1442 735 gene locus_tag LOCUS_22130 1442 735 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_22130 3195 1453 gene locus_tag LOCUS_22140 3195 1453 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_22140 3930 3427 gene locus_tag LOCUS_22150 3930 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4838 3999 gene locus_tag LOCUS_22160 4838 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence0350 756 1181 gene locus_tag LOCUS_22170 756 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1301 1582 gene locus_tag LOCUS_22180 1301 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3125 1797 gene locus_tag LOCUS_22190 3125 1797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_22190 4891 3377 gene locus_tag LOCUS_22200 4891 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0351 569 2098 gene locus_tag LOCUS_22210 gene cps2I 569 2098 CDS product oligosaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_22210 2805 2188 gene locus_tag LOCUS_22220 2805 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0352 43 2100 gene locus_tag LOCUS_22230 43 2100 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107156.1 protein_id gnl|my_center|LOCUS_22230 2252 2728 gene locus_tag LOCUS_22240 2252 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3999 2971 gene locus_tag LOCUS_22250 3999 2971 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_22250 <4918 4098 gene locus_tag LOCUS_22260 <4918 4098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545566.1:NAD-dependent dehydratase >Feature sequence0353 348 1736 gene locus_tag LOCUS_22270 gene speA 348 1736 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_22270 2030 3985 gene locus_tag LOCUS_22280 2030 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3998 4828 gene locus_tag LOCUS_22290 3998 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence0354 <1 3754 gene locus_tag LOCUS_22300 <1 3754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262574.1:glutamate synthase >Feature sequence0355 1998 694 gene locus_tag LOCUS_22310 1998 694 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_22310 2223 2444 gene locus_tag LOCUS_22320 2223 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_22320 4037 2493 gene locus_tag LOCUS_22330 4037 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0356 <1 748 gene locus_tag LOCUS_22340 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111559.1:anaerobic ribonucleoside triphosphate reductase 726 917 gene locus_tag LOCUS_22350 726 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 877 1596 gene locus_tag LOCUS_22360 877 1596 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_22360 3468 1789 gene locus_tag LOCUS_22370 3468 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4747 3731 gene locus_tag LOCUS_22380 4747 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0357 1570 140 gene locus_tag LOCUS_22390 1570 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_22390 3904 1574 gene locus_tag LOCUS_22400 3904 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0358 2325 505 gene locus_tag LOCUS_22410 2325 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3049 2327 gene locus_tag LOCUS_22420 gene dnrN 3049 2327 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_22420 3400 3104 gene locus_tag LOCUS_22430 3400 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4391 3864 gene locus_tag LOCUS_22440 4391 3864 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence0359 590 267 gene locus_tag LOCUS_22450 590 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1433 891 gene locus_tag LOCUS_22460 gene hslV 1433 891 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGY8 protein_id gnl|my_center|LOCUS_22460 3417 1729 gene locus_tag LOCUS_22470 gene pdhC 3417 1729 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_22470 3540 4499 gene locus_tag LOCUS_22480 3540 4499 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence0360 70 1032 gene locus_tag LOCUS_22490 70 1032 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_22490 1616 1053 gene locus_tag LOCUS_22500 1616 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2034 1603 gene locus_tag LOCUS_22510 2034 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_22510 3089 2733 gene locus_tag LOCUS_22520 3089 2733 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_22520 3942 3091 gene locus_tag LOCUS_22530 3942 3091 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403447.1 protein_id gnl|my_center|LOCUS_22530 <4842 4016 gene locus_tag LOCUS_22540 <4842 4016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44739:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence0361 <1 741 gene locus_tag LOCUS_22550 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946567.1:monooxygenase 1234 743 gene locus_tag LOCUS_22560 1234 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2300 1245 gene locus_tag LOCUS_22570 2300 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3550 3023 gene locus_tag LOCUS_22580 3550 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence0362 1655 225 gene locus_tag LOCUS_22590 1655 225 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713291.1 protein_id gnl|my_center|LOCUS_22590 3717 2695 gene locus_tag LOCUS_22600 3717 2695 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_22600 4187 4684 gene locus_tag LOCUS_22610 gene rfaY 4187 4684 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence0363 1619 885 gene locus_tag LOCUS_22620 1619 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_22620 3765 1624 gene locus_tag LOCUS_22630 3765 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 <4811 3781 gene locus_tag LOCUS_22640 <4811 3781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase >Feature sequence0364 3251 2172 gene locus_tag LOCUS_22650 3251 2172 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22650 4595 3663 gene locus_tag LOCUS_22660 4595 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence0365 866 588 gene locus_tag LOCUS_22670 866 588 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_22670 1087 863 gene locus_tag LOCUS_22680 1087 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1564 1253 gene locus_tag LOCUS_22690 1564 1253 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964042.1 protein_id gnl|my_center|LOCUS_22690 1798 1565 gene locus_tag LOCUS_22700 1798 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964043.1 protein_id gnl|my_center|LOCUS_22700 3376 2027 gene locus_tag LOCUS_22710 3376 2027 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920961.1 protein_id gnl|my_center|LOCUS_22710 3678 4391 gene locus_tag LOCUS_22720 3678 4391 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0366 1850 2998 gene locus_tag LOCUS_22730 1850 2998 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_22730 3055 3906 gene locus_tag LOCUS_22740 3055 3906 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_22740 4273 4121 gene locus_tag LOCUS_22750 4273 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence0367 <1 1467 gene locus_tag LOCUS_22760 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:membrane protein 1589 2611 gene locus_tag LOCUS_22770 1589 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2684 4495 gene locus_tag LOCUS_22780 2684 4495 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence0368 211 429 gene locus_tag LOCUS_22790 211 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 654 2078 gene locus_tag LOCUS_22800 654 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3311 2388 gene locus_tag LOCUS_22810 gene rsgA 3311 2388 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_22810 4567 3308 gene locus_tag LOCUS_22820 4567 3308 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence0369 1646 102 gene locus_tag LOCUS_22830 gene pcd 1646 102 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_22830 2786 1713 gene locus_tag LOCUS_22840 2786 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4100 3390 gene locus_tag LOCUS_22850 4100 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_22850 <4757 4198 gene locus_tag LOCUS_22860 <4757 4198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWQ0:aminotransferase >Feature sequence0370 1657 167 gene locus_tag LOCUS_22870 gene glpK 1657 167 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X50 protein_id gnl|my_center|LOCUS_22870 3565 2003 gene locus_tag LOCUS_22880 gene glpA 3565 2003 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_22880 3728 4489 gene locus_tag LOCUS_22890 3728 4489 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence0371 <1 778 gene locus_tag LOCUS_22900 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P3F6:beta-xylanase 1012 2163 gene locus_tag LOCUS_22910 1012 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2437 4110 gene locus_tag LOCUS_22920 2437 4110 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_22920 <4745 4127 gene locus_tag LOCUS_22930 <4745 4127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760470.1:esterase >Feature sequence0372 735 118 gene locus_tag LOCUS_22940 gene udk 735 118 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_22940 1324 755 gene locus_tag LOCUS_22950 1324 755 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_22950 1655 2236 gene locus_tag LOCUS_22960 1655 2236 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_22960 2778 2296 gene locus_tag LOCUS_22970 2778 2296 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_22970 3914 2874 gene locus_tag LOCUS_22980 gene ribD 3914 2874 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_22980 4728 3916 gene locus_tag LOCUS_22990 4728 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence0373 <1 878 gene locus_tag LOCUS_23000 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962856.1:RNA methyltransferase 979 1422 gene locus_tag LOCUS_23010 979 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_23010 1419 2183 gene locus_tag LOCUS_23020 1419 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2337 3815 gene locus_tag LOCUS_23030 gene guaB 2337 3815 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_23030 3993 4391 gene locus_tag LOCUS_23040 3993 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence0374 1889 648 gene locus_tag LOCUS_23050 1889 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_23050 4051 2021 gene locus_tag LOCUS_23060 4051 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence0375 106 1227 gene locus_tag LOCUS_23070 106 1227 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_23070 2772 1453 gene locus_tag LOCUS_23080 2772 1453 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_23080 3549 3073 gene locus_tag LOCUS_23090 gene ribH 3549 3073 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS0 protein_id gnl|my_center|LOCUS_23090 4347 3637 gene locus_tag LOCUS_23100 4347 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403954.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence0376 407 1288 gene locus_tag LOCUS_23110 gene sucD 407 1288 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_23110 1412 3007 gene locus_tag LOCUS_23120 1412 3007 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_23120 3028 3162 gene locus_tag LOCUS_23130 3028 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3129 3497 gene locus_tag LOCUS_23140 3129 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 4185 3898 gene locus_tag LOCUS_23150 4185 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0377 211 786 gene locus_tag LOCUS_23160 211 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 869 3349 gene locus_tag LOCUS_23170 869 3349 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_23170 3628 4617 gene locus_tag LOCUS_23180 gene hpnA 3628 4617 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence0378 611 841 gene locus_tag LOCUS_23190 611 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2013 919 gene locus_tag LOCUS_23200 2013 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4085 2082 gene locus_tag LOCUS_23210 4085 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence0379 <1 882 gene locus_tag LOCUS_23220 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0X6:iron-sulfur cluster carrier protein 887 1135 gene locus_tag LOCUS_23230 887 1135 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_23230 1146 4193 gene locus_tag LOCUS_23240 1146 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence0380 2039 618 gene locus_tag LOCUS_23250 gene cry 2039 618 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_23250 2148 2717 gene locus_tag LOCUS_23260 2148 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_23260 2907 3980 gene locus_tag LOCUS_23270 2907 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0381 <1 513 gene locus_tag LOCUS_23280 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T09:UvrABC system protein B 1213 1851 gene locus_tag LOCUS_23290 1213 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2754 1846 gene locus_tag LOCUS_23300 gene acdS 2754 1846 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_23300 2816 3859 gene locus_tag LOCUS_23310 2816 3859 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_23310 >Feature sequence0382 <1 973 gene locus_tag LOCUS_23320 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405145.1:sterol desaturase 966 1370 gene locus_tag LOCUS_23330 966 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2370 1441 gene locus_tag LOCUS_23340 2370 1441 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_23340 3015 3374 gene locus_tag LOCUS_23350 3015 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4198 3371 gene locus_tag LOCUS_23360 4198 3371 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0383 1211 207 gene locus_tag LOCUS_23370 1211 207 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_23370 2347 1361 gene locus_tag LOCUS_23380 2347 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2985 2524 gene locus_tag LOCUS_23390 2985 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0384 423 785 gene locus_tag LOCUS_23400 423 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 838 1839 gene locus_tag LOCUS_23410 gene argK 838 1839 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_23410 3277 1853 gene locus_tag LOCUS_23420 gene dnaA 3277 1853 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_23420 3551 3396 gene locus_tag LOCUS_23430 3551 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence0385 1519 605 gene locus_tag LOCUS_23440 gene glsA1 1519 605 CDS product glutaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHF1 protein_id gnl|my_center|LOCUS_23440 1699 2862 gene locus_tag LOCUS_23450 1699 2862 CDS product serine proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_23450 3953 3291 gene locus_tag LOCUS_23460 3953 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4237 4581 gene locus_tag LOCUS_23470 4237 4581 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence0386 427 161 gene locus_tag LOCUS_23480 427 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2330 975 gene locus_tag LOCUS_23490 2330 975 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_23490 3708 2320 gene locus_tag LOCUS_23500 3708 2320 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence0387 1161 205 gene locus_tag LOCUS_23510 1161 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1243 2799 gene locus_tag LOCUS_23520 1243 2799 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_23520 3786 3088 gene locus_tag LOCUS_23530 3786 3088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596582.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence0388 563 2026 gene locus_tag LOCUS_23540 563 2026 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_23540 2343 2516 gene locus_tag LOCUS_23550 2343 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3413 2517 gene locus_tag LOCUS_23560 3413 2517 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence0389 770 943 gene locus_tag LOCUS_23570 770 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 943 1278 gene locus_tag LOCUS_23580 943 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1362 1568 gene locus_tag LOCUS_23590 1362 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1948 2799 gene locus_tag LOCUS_23600 1948 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2872 4182 gene locus_tag LOCUS_23610 2872 4182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0390 2462 336 gene locus_tag LOCUS_23620 2462 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3307 2522 gene locus_tag LOCUS_23630 3307 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 <4596 3307 gene locus_tag LOCUS_23640 <4596 3307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000411031.1:RNA-directed DNA polymerase >Feature sequence0391 604 1995 gene locus_tag LOCUS_23650 604 1995 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_23650 2170 3072 gene locus_tag LOCUS_23660 2170 3072 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_23660 3630 3926 gene locus_tag LOCUS_23670 3630 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence0392 2677 3681 gene locus_tag LOCUS_23680 gene tsaD 2677 3681 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_23680 3816 4283 gene locus_tag LOCUS_23690 gene smpB 3816 4283 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence0393 992 480 gene locus_tag LOCUS_23700 992 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1129 2721 gene locus_tag LOCUS_23710 gene lig2 1129 2721 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence0394 508 2214 gene locus_tag LOCUS_23720 508 2214 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence0395 2488 935 gene locus_tag LOCUS_23730 2488 935 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_23730 3010 2666 gene locus_tag LOCUS_23740 3010 2666 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_23740 3303 3010 gene locus_tag LOCUS_23750 3303 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence0396 1233 289 gene locus_tag LOCUS_23760 1233 289 CDS product putative transposase y4qJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55631 protein_id gnl|my_center|LOCUS_23760 2224 1433 gene locus_tag LOCUS_23770 2224 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2791 2973 gene locus_tag LOCUS_23780 2791 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23780 2970 3260 gene locus_tag LOCUS_23790 2970 3260 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_23790 3250 3660 gene locus_tag LOCUS_23800 3250 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence0397 962 300 gene locus_tag LOCUS_23810 962 300 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_23810 1245 1613 gene locus_tag LOCUS_23820 1245 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2049 1615 gene locus_tag LOCUS_23830 2049 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2177 2740 gene locus_tag LOCUS_23840 2177 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2869 3708 gene locus_tag LOCUS_23850 2869 3708 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_23850 3709 3957 gene locus_tag LOCUS_23860 3709 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence0398 1504 1851 gene locus_tag LOCUS_23870 1504 1851 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_23870 2086 3060 gene locus_tag LOCUS_23880 gene pfkA 2086 3060 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_23880 3070 3438 gene locus_tag LOCUS_23890 3070 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4378 3458 gene locus_tag LOCUS_23900 gene miaA1 4378 3458 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_23900 >Feature sequence0399 434 1021 gene locus_tag LOCUS_23910 434 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1158 1727 gene locus_tag LOCUS_23920 1158 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1887 2681 gene locus_tag LOCUS_23930 1887 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2786 3586 gene locus_tag LOCUS_23940 2786 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3593 3853 gene locus_tag LOCUS_23950 3593 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4126 4052 gene locus_tag LOCUS_t00130 4126 4052 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0400 667 2145 gene locus_tag LOCUS_23960 667 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_23960 2693 3616 gene locus_tag LOCUS_23970 2693 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3867 4415 gene locus_tag LOCUS_23980 3867 4415 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence0401 956 252 gene locus_tag LOCUS_23990 956 252 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_23990 1999 959 gene locus_tag LOCUS_24000 gene ykfA 1999 959 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_24000 2973 2698 gene locus_tag LOCUS_24010 2973 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4375 3065 gene locus_tag LOCUS_24020 gene dacB 4375 3065 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence0402 1047 2069 gene locus_tag LOCUS_24030 gene rbsR 1047 2069 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104055.1 protein_id gnl|my_center|LOCUS_24030 2292 3185 gene locus_tag LOCUS_24040 2292 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence0403 298 1569 gene locus_tag LOCUS_24050 298 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1551 2339 gene locus_tag LOCUS_24060 1551 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2341 3159 gene locus_tag LOCUS_24070 2341 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3389 4051 gene locus_tag LOCUS_24080 3389 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence0404 294 497 gene locus_tag LOCUS_24090 294 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 494 943 gene locus_tag LOCUS_24100 494 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1004 2728 gene locus_tag LOCUS_24110 gene ilvB 1004 2728 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_24110 2811 4331 gene locus_tag LOCUS_24120 2811 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence0405 394 888 gene locus_tag LOCUS_24130 gene pycA 394 888 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_24130 988 1698 gene locus_tag LOCUS_24140 gene pyrH 988 1698 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_24140 1710 2270 gene locus_tag LOCUS_24150 gene frr 1710 2270 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_24150 2516 4264 gene locus_tag LOCUS_24160 gene frdA 2516 4264 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64175 protein_id gnl|my_center|LOCUS_24160 >Feature sequence0406 1432 188 gene locus_tag LOCUS_24170 1432 188 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_24170 2580 1489 gene locus_tag LOCUS_24180 2580 1489 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_24180 3445 2570 gene locus_tag LOCUS_24190 3445 2570 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence0407 785 60 gene locus_tag LOCUS_24200 gene hypB 785 60 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_24200 2369 969 gene locus_tag LOCUS_24210 gene lpdA2 2369 969 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_24210 2548 2934 gene locus_tag LOCUS_24220 2548 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_24220 3047 3793 gene locus_tag LOCUS_24230 3047 3793 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence0408 1722 871 gene locus_tag LOCUS_24240 1722 871 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_24240 2844 1729 gene locus_tag LOCUS_24250 2844 1729 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_24250 3632 2916 gene locus_tag LOCUS_24260 3632 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4335 3709 gene locus_tag LOCUS_24270 4335 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0409 1406 360 gene locus_tag LOCUS_24280 1406 360 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_24280 2210 1410 gene locus_tag LOCUS_24290 gene hmuV 2210 1410 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56993 protein_id gnl|my_center|LOCUS_24290 3213 2212 gene locus_tag LOCUS_24300 3213 2212 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_24300 4101 3277 gene locus_tag LOCUS_24310 4101 3277 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0410 223 136 gene locus_tag LOCUS_t00140 223 136 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1377 298 gene locus_tag LOCUS_24320 gene ansA 1377 298 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_24320 2150 1374 gene locus_tag LOCUS_24330 gene tatD 2150 1374 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_24330 3310 2210 gene locus_tag LOCUS_24340 3310 2210 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_24340 3936 3307 gene locus_tag LOCUS_24350 3936 3307 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence0411 210 1025 gene locus_tag LOCUS_24360 gene dapD 210 1025 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_24360 1040 1645 gene locus_tag LOCUS_24370 1040 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2487 1723 gene locus_tag LOCUS_24380 2487 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2743 3195 gene locus_tag LOCUS_24390 2743 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3220 3627 gene locus_tag LOCUS_24400 3220 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0412 2447 1110 gene locus_tag LOCUS_24410 gene aofH 2447 1110 CDS product putative flavin-containing monoamine oxidase AofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63534 protein_id gnl|my_center|LOCUS_24410 3242 2574 gene locus_tag LOCUS_24420 3242 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3926 3345 gene locus_tag LOCUS_24430 3926 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4259 3960 gene locus_tag LOCUS_24440 4259 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence0413 869 654 gene locus_tag LOCUS_24450 869 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1336 1995 gene locus_tag LOCUS_24460 gene tal 1336 1995 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_24460 2121 2324 gene locus_tag LOCUS_24470 2121 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2326 3036 gene locus_tag LOCUS_24480 gene ftsE 2326 3036 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence0414 1676 1906 gene locus_tag LOCUS_24490 1676 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_24490 2450 4240 gene locus_tag LOCUS_24500 2450 4240 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence0415 572 844 gene locus_tag LOCUS_24510 572 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 846 1523 gene locus_tag LOCUS_24520 gene cysH 846 1523 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_24520 1660 2559 gene locus_tag LOCUS_24530 gene cysD 1660 2559 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_24530 2812 4065 gene locus_tag LOCUS_24540 gene cysN 2812 4065 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_24540 >Feature sequence0416 954 748 gene locus_tag LOCUS_24550 954 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1120 2244 gene locus_tag LOCUS_24560 1120 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2610 2341 gene locus_tag LOCUS_24570 2610 2341 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_24570 2825 2607 gene locus_tag LOCUS_24580 2825 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 <4344 3323 gene locus_tag LOCUS_24590 <4344 3323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A681:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0417 595 1419 gene locus_tag LOCUS_24600 595 1419 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_24600 1827 2606 gene locus_tag LOCUS_24610 1827 2606 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_24610 3025 4227 gene locus_tag LOCUS_24620 gene fucP 3025 4227 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_24620 >Feature sequence0418 1012 410 gene locus_tag LOCUS_24630 1012 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2318 1347 gene locus_tag LOCUS_24640 2318 1347 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_24640 2940 2311 gene locus_tag LOCUS_24650 2940 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_24650 3988 2945 gene locus_tag LOCUS_24660 3988 2945 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence0419 1107 658 gene locus_tag LOCUS_24670 1107 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1308 2126 gene locus_tag LOCUS_24680 1308 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2323 3207 gene locus_tag LOCUS_24690 2323 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence0420 242 63 gene locus_tag LOCUS_24700 gene rpmD 242 63 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7I8 protein_id gnl|my_center|LOCUS_24700 765 247 gene locus_tag LOCUS_24710 gene rpsE 765 247 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_24710 1119 772 gene locus_tag LOCUS_24720 gene rplR 1119 772 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E2B8 protein_id gnl|my_center|LOCUS_24720 1682 1125 gene locus_tag LOCUS_24730 gene rplF 1682 1125 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_24730 2087 1692 gene locus_tag LOCUS_24740 gene rpsH 2087 1692 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_24740 2442 2173 gene locus_tag LOCUS_24750 gene rpsN 2442 2173 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_24750 3005 2445 gene locus_tag LOCUS_24760 gene rplE 3005 2445 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_24760 3342 2998 gene locus_tag LOCUS_24770 gene rplX 3342 2998 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_24770 3713 3345 gene locus_tag LOCUS_24780 gene rplN 3713 3345 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_24780 3979 3716 gene locus_tag LOCUS_24790 gene rpsQ 3979 3716 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL7 protein_id gnl|my_center|LOCUS_24790 4181 3987 gene locus_tag LOCUS_24800 4181 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence0421 302 532 gene locus_tag LOCUS_24810 302 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1396 608 gene locus_tag LOCUS_24820 gene truA 1396 608 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_24820 2903 1842 gene locus_tag LOCUS_24830 gene leuB 2903 1842 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_24830 <4322 2872 gene locus_tag LOCUS_24840 <4322 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108024.1:2-isopropylmalate synthase >Feature sequence0422 283 3393 gene locus_tag LOCUS_24850 283 3393 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence0423 <1 1007 gene locus_tag LOCUS_24860 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118059.1:N-acetylgalactosamine-6-sulfatase 1229 2662 gene locus_tag LOCUS_24870 1229 2662 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence0424 1392 325 gene locus_tag LOCUS_24880 1392 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1604 2014 gene locus_tag LOCUS_24890 1604 2014 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 protein_id gnl|my_center|LOCUS_24890 2661 2119 gene locus_tag LOCUS_24900 2661 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_24900 2672 3349 gene locus_tag LOCUS_24910 2672 3349 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_24910 3406 4296 gene locus_tag LOCUS_24920 gene ftsX 3406 4296 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_24920 >Feature sequence0425 778 1491 gene locus_tag LOCUS_24930 778 1491 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_24930 1511 2467 gene locus_tag LOCUS_24940 1511 2467 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_24940 2471 3580 gene locus_tag LOCUS_24950 2471 3580 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAH5 protein_id gnl|my_center|LOCUS_24950 >Feature sequence0426 1275 238 gene locus_tag LOCUS_24960 1275 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1768 3000 gene locus_tag LOCUS_24970 gene sbcD 1768 3000 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ16 protein_id gnl|my_center|LOCUS_24970 >Feature sequence0427 <1 954 gene locus_tag LOCUS_24980 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin containing oxidoreductase 2135 1167 gene locus_tag LOCUS_24990 2135 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3666 2185 gene locus_tag LOCUS_25000 3666 2185 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942823.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence0428 <1 562 gene locus_tag LOCUS_25010 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1C2:ATP-dependent Clp protease ATP-binding subunit ClpX 717 1484 gene locus_tag LOCUS_25020 717 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1603 2391 gene locus_tag LOCUS_25030 1603 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2928 2515 gene locus_tag LOCUS_25040 2928 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_25040 4281 3343 gene locus_tag LOCUS_25050 gene lpxB 4281 3343 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence0429 1160 255 gene locus_tag LOCUS_25060 1160 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2385 1615 gene locus_tag LOCUS_25070 gene rhaT 2385 1615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124908.1 protein_id gnl|my_center|LOCUS_25070 2645 3121 gene locus_tag LOCUS_25080 2645 3121 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_25080 3784 3107 gene locus_tag LOCUS_25090 gene lolD 3784 3107 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_25090 >Feature sequence0430 4094 1119 gene locus_tag LOCUS_25100 4094 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0431 390 1076 gene locus_tag LOCUS_25110 390 1076 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776602.1 protein_id gnl|my_center|LOCUS_25110 1491 1117 gene locus_tag LOCUS_25120 1491 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2352 1810 gene locus_tag LOCUS_25130 2352 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3433 2579 gene locus_tag LOCUS_25140 3433 2579 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_25140 4053 3505 gene locus_tag LOCUS_25150 4053 3505 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNH4 protein_id gnl|my_center|LOCUS_25150 >Feature sequence0432 846 37 gene locus_tag LOCUS_25160 gene murQ 846 37 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA1 protein_id gnl|my_center|LOCUS_25160 1685 843 gene locus_tag LOCUS_25170 1685 843 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_25170 1917 1687 gene locus_tag LOCUS_25180 1917 1687 CDS product cytochrome b5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023631.1 protein_id gnl|my_center|LOCUS_25180 3069 1918 gene locus_tag LOCUS_25190 gene fjo29 3069 1918 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_25190 <4233 3157 gene locus_tag LOCUS_25200 <4233 3157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS0:Na(+)-translocating NADH-quinone reductase subunit F >Feature sequence0433 <1 1111 gene locus_tag LOCUS_25210 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 1477 1253 gene locus_tag LOCUS_25220 1477 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25220 1611 2693 gene locus_tag LOCUS_25230 gene proB 1611 2693 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 protein_id gnl|my_center|LOCUS_25230 2686 3927 gene locus_tag LOCUS_25240 gene proA 2686 3927 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_25240 >Feature sequence0434 54 494 gene locus_tag LOCUS_25250 54 494 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence0435 684 103 gene locus_tag LOCUS_25260 684 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1589 687 gene locus_tag LOCUS_25270 gene ctaB 1589 687 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_25270 2668 1586 gene locus_tag LOCUS_25280 gene ctaA 2668 1586 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_25280 <4222 2649 gene locus_tag LOCUS_25290 <4222 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962550.1:cytochrome-c oxidase >Feature sequence0436 3 1109 gene locus_tag LOCUS_25300 gene merA2 3 1109 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975665.1 protein_id gnl|my_center|LOCUS_25300 1406 1687 gene locus_tag LOCUS_25310 1406 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_25310 2049 3416 gene locus_tag LOCUS_25320 2049 3416 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591565.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence0437 862 2313 gene locus_tag LOCUS_25330 862 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2524 3018 gene locus_tag LOCUS_25340 2524 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3681 3091 gene locus_tag LOCUS_25350 3681 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence0438 <1 964 gene locus_tag LOCUS_25360 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207247.1:MFS transporter >Feature sequence0439 194 1693 gene locus_tag LOCUS_25370 194 1693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_25370 2193 1999 gene locus_tag LOCUS_25380 2193 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2751 2266 gene locus_tag LOCUS_25390 2751 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3192 2836 gene locus_tag LOCUS_25400 3192 2836 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_25400 4025 3645 gene locus_tag LOCUS_25410 4025 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence0440 2500 1019 gene locus_tag LOCUS_25420 gene malT 2500 1019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_25420 <4200 2803 gene locus_tag LOCUS_25430 <4200 2803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119180.1:oxidoreductase >Feature sequence0441 440 961 gene locus_tag LOCUS_25440 440 961 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_25440 1187 3787 gene locus_tag LOCUS_25450 1187 3787 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0442 436 816 gene locus_tag LOCUS_25460 436 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_25460 <4171 1016 gene locus_tag LOCUS_25470 <4171 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64R22:phosphoribosylformylglycinamidine synthase >Feature sequence0443 1427 375 gene locus_tag LOCUS_25480 1427 375 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_25480 3521 1638 gene locus_tag LOCUS_25490 gene purF 3521 1638 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_25490 4032 3802 gene locus_tag LOCUS_25500 4032 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0444 3517 542 gene locus_tag LOCUS_25510 3517 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0445 387 998 gene locus_tag LOCUS_25520 gene miaE 387 998 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_25520 1114 2358 gene locus_tag LOCUS_25530 1114 2358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_25530 2361 4052 gene locus_tag LOCUS_25540 2361 4052 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence0446 <1 989 gene locus_tag LOCUS_25550 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107799.1:prevent-host-death protein 1261 1070 gene locus_tag LOCUS_25560 1261 1070 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_25560 1793 2275 gene locus_tag LOCUS_25570 1793 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4025 2550 gene locus_tag LOCUS_25580 4025 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence0447 2616 355 gene locus_tag LOCUS_25590 gene acn 2616 355 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_25590 4065 2743 gene locus_tag LOCUS_25600 4065 2743 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879035.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence0448 424 723 gene locus_tag LOCUS_25610 424 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1565 810 gene locus_tag LOCUS_25620 1565 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2446 1712 gene locus_tag LOCUS_25630 gene algR 2446 1712 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_25630 3511 2459 gene locus_tag LOCUS_25640 3511 2459 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_25640 <4133 3604 gene locus_tag LOCUS_25650 <4133 3604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXX6:UvrABC system protein A >Feature sequence0449 1188 340 gene locus_tag LOCUS_25660 1188 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1521 2315 gene locus_tag LOCUS_25670 1521 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2869 4089 gene locus_tag LOCUS_25680 2869 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence0450 223 720 gene locus_tag LOCUS_25690 223 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 763 984 gene locus_tag LOCUS_25700 763 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 984 2270 gene locus_tag LOCUS_25710 984 2270 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence0451 2024 396 gene locus_tag LOCUS_25720 2024 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3072 2170 gene locus_tag LOCUS_25730 3072 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence0452 416 1645 gene locus_tag LOCUS_25740 416 1645 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_25740 2103 1663 gene locus_tag LOCUS_25750 2103 1663 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_25750 <4091 2265 gene locus_tag LOCUS_25760 <4091 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase >Feature sequence0453 1666 284 gene locus_tag LOCUS_25770 1666 284 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_25770 3382 1679 gene locus_tag LOCUS_25780 3382 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3628 3990 gene locus_tag LOCUS_25790 3628 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence0454 74 1 gene locus_tag LOCUS_t00150 74 1 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3085 473 gene locus_tag LOCUS_25800 gene mutS 3085 473 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_25800 3171 3710 gene locus_tag LOCUS_25810 3171 3710 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0455 2137 1388 gene locus_tag LOCUS_25820 gene sdhB 2137 1388 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_25820 <4088 2162 gene locus_tag LOCUS_25830 <4088 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence0456 <1 790 gene locus_tag LOCUS_25840 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802867.1:DNA polymerase III subunit gamma/tau 1117 1374 gene locus_tag LOCUS_25850 1117 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2309 1371 gene locus_tag LOCUS_25860 2309 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_25860 3991 2390 gene locus_tag LOCUS_25870 3991 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence0457 2437 1271 gene locus_tag LOCUS_25880 gene gcdH 2437 1271 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_25880 2597 3556 gene locus_tag LOCUS_25890 2597 3556 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence0458 1058 60 gene locus_tag LOCUS_25900 1058 60 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_25900 2645 1200 gene locus_tag LOCUS_25910 2645 1200 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_25910 3803 2880 gene locus_tag LOCUS_25920 3803 2880 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence0459 2351 762 gene locus_tag LOCUS_25930 gene dnaB 2351 762 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_25930 <4063 2737 gene locus_tag LOCUS_25940 <4063 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963361.1:FAD-dependent dehydrogenase >Feature sequence0460 144 476 gene locus_tag LOCUS_25950 144 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 660 1307 gene locus_tag LOCUS_25960 660 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1451 1888 gene locus_tag LOCUS_25970 1451 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 <4059 1898 gene locus_tag LOCUS_25980 <4059 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852963.1:cytochrome c biogenesis protein >Feature sequence0461 325 840 gene locus_tag LOCUS_25990 325 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_25990 944 2614 gene locus_tag LOCUS_26000 944 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_26000 2851 3387 gene locus_tag LOCUS_26010 2851 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0462 <1 781 gene locus_tag LOCUS_26020 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941165.1:multidrug ABC transporter substrate-binding protein 774 2255 gene locus_tag LOCUS_26030 774 2255 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_26030 2843 2673 gene locus_tag LOCUS_26040 2843 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3315 2833 gene locus_tag LOCUS_26050 3315 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3821 3339 gene locus_tag LOCUS_26060 3821 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence0463 1125 1550 gene locus_tag LOCUS_26070 1125 1550 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_26070 1609 2070 gene locus_tag LOCUS_26080 1609 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2332 2508 gene locus_tag LOCUS_26090 2332 2508 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_26090 3130 2663 gene locus_tag LOCUS_26100 3130 2663 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence0464 878 408 gene locus_tag LOCUS_26110 gene scpB 878 408 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_26110 1353 970 gene locus_tag LOCUS_26120 1353 970 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0465 983 402 gene locus_tag LOCUS_26130 983 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1598 2710 gene locus_tag LOCUS_26140 1598 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_26140 2767 3402 gene locus_tag LOCUS_26150 gene perB 2767 3402 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence0466 295 540 gene locus_tag LOCUS_26160 gene rpmE2 295 540 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_26160 613 1812 gene locus_tag LOCUS_26170 613 1812 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_26170 1820 2971 gene locus_tag LOCUS_26180 1820 2971 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_26180 2968 3399 gene locus_tag LOCUS_26190 2968 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768489.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0467 358 1503 gene locus_tag LOCUS_26200 358 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1526 1957 gene locus_tag LOCUS_26210 1526 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1950 3074 gene locus_tag LOCUS_26220 1950 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 <3987 3113 gene locus_tag LOCUS_26230 <3987 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XWH7:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence0468 176 667 gene locus_tag LOCUS_26240 176 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 702 2606 gene locus_tag LOCUS_26250 gene parE 702 2606 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_26250 2810 3445 gene locus_tag LOCUS_26260 gene satD 2810 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269317.1 protein_id gnl|my_center|LOCUS_26260 3553 3774 gene locus_tag LOCUS_26270 3553 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0469 901 2292 gene locus_tag LOCUS_26280 901 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2394 3401 gene locus_tag LOCUS_26290 2394 3401 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence0470 <1 1345 gene locus_tag LOCUS_26300 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073644.1:L-sorbosone dehydrogenase <3971 1374 gene locus_tag LOCUS_26310 <3971 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:organic solvent tolerance protein OstA >Feature sequence0471 477 1193 gene locus_tag LOCUS_26320 477 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1196 1867 gene locus_tag LOCUS_26330 1196 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1864 2247 gene locus_tag LOCUS_26340 1864 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence0472 <1 1817 gene locus_tag LOCUS_26350 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease 2560 2120 gene locus_tag LOCUS_26360 2560 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2940 2557 gene locus_tag LOCUS_26370 2940 2557 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_26370 3624 3301 gene locus_tag LOCUS_26380 3624 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence0473 327 695 gene locus_tag LOCUS_26390 327 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 protein_id gnl|my_center|LOCUS_26390 932 2047 gene locus_tag LOCUS_26400 932 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence0474 1032 181 gene locus_tag LOCUS_26410 1032 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_26410 1235 2155 gene locus_tag LOCUS_26420 1235 2155 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_26420 2167 3009 gene locus_tag LOCUS_26430 2167 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3740 3006 gene locus_tag LOCUS_26440 3740 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence0475 1005 268 gene locus_tag LOCUS_26450 1005 268 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_26450 2071 974 gene locus_tag LOCUS_26460 2071 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2249 2049 gene locus_tag LOCUS_26470 2249 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2626 2432 gene locus_tag LOCUS_26480 2626 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3675 3232 gene locus_tag LOCUS_26490 3675 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963661.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence0476 <1 1002 gene locus_tag LOCUS_26500 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDE6:phosphoenolpyruvate carboxylase 1133 3433 gene locus_tag LOCUS_26510 1133 3433 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence0477 2262 964 gene locus_tag LOCUS_26520 2262 964 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_26520 3728 2469 gene locus_tag LOCUS_26530 3728 2469 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085933.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0478 1010 1801 gene locus_tag LOCUS_26540 1010 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2001 2726 gene locus_tag LOCUS_26550 2001 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2765 3556 gene locus_tag LOCUS_26560 2765 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3606 3734 gene locus_tag LOCUS_26570 3606 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence0479 3122 1110 gene locus_tag LOCUS_26580 3122 1110 CDS product potassium transporter KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_26580 3679 3200 gene locus_tag LOCUS_26590 3679 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence0480 1956 3038 gene locus_tag LOCUS_26600 1956 3038 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_26600 3069 3539 gene locus_tag LOCUS_26610 3069 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence0481 1046 147 gene locus_tag LOCUS_26620 1046 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <3911 1099 gene locus_tag LOCUS_26630 <3911 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0482 198 581 gene locus_tag LOCUS_26640 198 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 668 2485 gene locus_tag LOCUS_26650 668 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2502 3179 gene locus_tag LOCUS_26660 2502 3179 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_26660 3635 3186 gene locus_tag LOCUS_26670 3635 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence0483 1620 325 gene locus_tag LOCUS_26680 1620 325 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_26680 2920 1862 gene locus_tag LOCUS_26690 gene gpsA 2920 1862 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_26690 3884 2898 gene locus_tag LOCUS_26700 3884 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence0484 872 2173 gene locus_tag LOCUS_26710 872 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence0485 281 1108 gene locus_tag LOCUS_26720 281 1108 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_26720 1980 1243 gene locus_tag LOCUS_26730 1980 1243 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109262.1 protein_id gnl|my_center|LOCUS_26730 2399 1980 gene locus_tag LOCUS_26740 2399 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3477 2425 gene locus_tag LOCUS_26750 3477 2425 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence0486 2053 701 gene locus_tag LOCUS_26760 2053 701 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_26760 3766 2066 gene locus_tag LOCUS_26770 3766 2066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence0487 522 1850 gene locus_tag LOCUS_26780 522 1850 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_26780 2652 1855 gene locus_tag LOCUS_26790 2652 1855 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_26790 3361 2657 gene locus_tag LOCUS_26800 gene agaI 3361 2657 CDS product putative galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42912 protein_id gnl|my_center|LOCUS_26800 >Feature sequence0488 672 7 gene locus_tag LOCUS_26810 672 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_26810 1596 754 gene locus_tag LOCUS_26820 1596 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3160 1748 gene locus_tag LOCUS_26830 3160 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence0489 2256 256 gene locus_tag LOCUS_26840 gene hutU 2256 256 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_26840 3725 2481 gene locus_tag LOCUS_26850 gene hutI 3725 2481 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI05 protein_id gnl|my_center|LOCUS_26850 >Feature sequence0490 833 1762 gene locus_tag LOCUS_26860 833 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2231 1932 gene locus_tag LOCUS_26870 2231 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3138 2218 gene locus_tag LOCUS_26880 3138 2218 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence0491 <1 2430 gene locus_tag LOCUS_26890 <1 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108893.1:DNA topoisomerase IV subunit A 2778 3224 gene locus_tag LOCUS_26900 2778 3224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056732.1 protein_id gnl|my_center|LOCUS_26900 <3855 3279 gene locus_tag LOCUS_26910 <3855 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence0492 80 2074 gene locus_tag LOCUS_26920 80 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2068 3225 gene locus_tag LOCUS_26930 2068 3225 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYG9 protein_id gnl|my_center|LOCUS_26930 <3847 3291 gene locus_tag LOCUS_26940 <3847 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582952.1:ATP-grasp protein >Feature sequence0493 258 1334 gene locus_tag LOCUS_26950 258 1334 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_26950 1401 2627 gene locus_tag LOCUS_26960 1401 2627 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence0494 1649 3823 gene locus_tag LOCUS_26970 1649 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence0495 917 2521 gene locus_tag LOCUS_26980 917 2521 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_26980 3569 2766 gene locus_tag LOCUS_26990 3569 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence0496 <1 898 gene locus_tag LOCUS_27000 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764493.1:alpha-amylase 975 1430 gene locus_tag LOCUS_27010 975 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1417 1686 gene locus_tag LOCUS_27020 1417 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2375 1695 gene locus_tag LOCUS_27030 2375 1695 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_27030 3128 2523 gene locus_tag LOCUS_27040 3128 2523 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_27040 <3835 3130 gene locus_tag LOCUS_27050 <3835 3130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975719.1:dioxygenase >Feature sequence0497 1889 1041 gene locus_tag LOCUS_27060 1889 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27060 3476 2040 gene locus_tag LOCUS_27070 3476 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence0498 706 1512 gene locus_tag LOCUS_27080 706 1512 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_27080 1572 1901 gene locus_tag LOCUS_27090 1572 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1901 2542 gene locus_tag LOCUS_27100 1901 2542 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_27100 2544 3005 gene locus_tag LOCUS_27110 2544 3005 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence0499 924 833 gene locus_tag LOCUS_t00160 924 833 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1263 1709 gene locus_tag LOCUS_27120 1263 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2267 2449 gene locus_tag LOCUS_27130 2267 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0500 205 987 gene locus_tag LOCUS_27140 205 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 968 1873 gene locus_tag LOCUS_27150 968 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_27150 1991 2476 gene locus_tag LOCUS_27160 1991 2476 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837388.1 protein_id gnl|my_center|LOCUS_27160 2718 2518 gene locus_tag LOCUS_27170 2718 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3250 2747 gene locus_tag LOCUS_27180 3250 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence0501 <3813 756 gene locus_tag LOCUS_27190 <3813 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0502 <1 922 gene locus_tag LOCUS_27200 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228406.1:ATPase AAA 1771 1286 gene locus_tag LOCUS_27210 1771 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3108 1939 gene locus_tag LOCUS_27220 3108 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3797 3405 gene locus_tag LOCUS_27230 3797 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence0503 <1 656 gene locus_tag LOCUS_27240 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766268.1:arylsulfatase 985 2616 gene locus_tag LOCUS_27250 985 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence0504 1681 566 gene locus_tag LOCUS_27260 1681 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2567 2085 gene locus_tag LOCUS_27270 2567 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3788 2943 gene locus_tag LOCUS_27280 3788 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0505 228 632 gene locus_tag LOCUS_27290 228 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1095 904 gene locus_tag LOCUS_27300 1095 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2110 1169 gene locus_tag LOCUS_27310 2110 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3687 2116 gene locus_tag LOCUS_27320 3687 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence0506 1023 1445 gene locus_tag LOCUS_27330 gene yuxK 1023 1445 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_27330 1527 2186 gene locus_tag LOCUS_27340 1527 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2272 3150 gene locus_tag LOCUS_27350 gene fabD 2272 3150 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_27350 3662 3165 gene locus_tag LOCUS_27360 3662 3165 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence0507 1397 498 gene locus_tag LOCUS_27370 1397 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2268 1390 gene locus_tag LOCUS_27380 2268 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_27380 2393 2731 gene locus_tag LOCUS_27390 2393 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence0508 1 2490 gene locus_tag LOCUS_27400 gene valS 1 2490 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_27400 2893 3453 gene locus_tag LOCUS_27410 2893 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3457 3663 gene locus_tag LOCUS_27420 3457 3663 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence0509 364 954 gene locus_tag LOCUS_27430 364 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2535 994 gene locus_tag LOCUS_27440 2535 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2873 3016 gene locus_tag LOCUS_27450 2873 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3643 3236 gene locus_tag LOCUS_27460 3643 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence0510 1735 209 gene locus_tag LOCUS_27470 1735 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0511 <3740 1028 gene locus_tag LOCUS_27480 <3740 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203715.1:hybrid sensor histidine kinase/response regulator >Feature sequence0512 3672 2164 gene locus_tag LOCUS_27490 3672 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence0513 450 286 gene locus_tag LOCUS_27500 450 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1508 489 gene locus_tag LOCUS_27510 gene pdhA 1508 489 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_27510 1614 2723 gene locus_tag LOCUS_27520 gene recF 1614 2723 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_27520 3055 2717 gene locus_tag LOCUS_27530 3055 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence0514 1888 458 gene locus_tag LOCUS_27540 1888 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3261 2116 gene locus_tag LOCUS_27550 3261 2116 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_27550 3581 3354 gene locus_tag LOCUS_27560 3581 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence0515 3109 1097 gene locus_tag LOCUS_27570 3109 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3640 3257 gene locus_tag LOCUS_27580 3640 3257 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_27580 >Feature sequence0516 614 225 gene locus_tag LOCUS_27590 614 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1019 2635 gene locus_tag LOCUS_27600 1019 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2716 3159 gene locus_tag LOCUS_27610 2716 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376389.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence0517 2536 113 gene locus_tag LOCUS_27620 2536 113 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_27620 3354 2779 gene locus_tag LOCUS_27630 3354 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence0518 892 3666 gene locus_tag LOCUS_27640 gene leuS 892 3666 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_27640 >Feature sequence0519 336 989 gene locus_tag LOCUS_27650 336 989 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_27650 989 1681 gene locus_tag LOCUS_27660 gene pssA 989 1681 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence0520 1192 2235 gene locus_tag LOCUS_27670 1192 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2506 3348 gene locus_tag LOCUS_27680 gene accD 2506 3348 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_27680 >Feature sequence0521 719 1615 gene locus_tag LOCUS_27690 719 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1687 2595 gene locus_tag LOCUS_27700 1687 2595 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_27700 2605 3516 gene locus_tag LOCUS_27710 2605 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0522 <1 806 gene locus_tag LOCUS_27720 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZC2:N5-carboxyaminoimidazole ribonucleotide synthase 810 1316 gene locus_tag LOCUS_27730 gene purE 810 1316 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_27730 1442 1591 gene locus_tag LOCUS_27740 1442 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2046 1588 gene locus_tag LOCUS_27750 2046 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2489 2133 gene locus_tag LOCUS_27760 2489 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_27760 2897 3499 gene locus_tag LOCUS_27770 2897 3499 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence0523 231 1226 gene locus_tag LOCUS_27780 gene gapA 231 1226 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_27780 1608 1228 gene locus_tag LOCUS_27790 1608 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2809 1595 gene locus_tag LOCUS_27800 2809 1595 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_27800 <3679 2813 gene locus_tag LOCUS_27810 <3679 2813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:ATPase >Feature sequence0524 >Feature sequence0525 556 1770 gene locus_tag LOCUS_27820 gene arcA1 556 1770 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXW2 protein_id gnl|my_center|LOCUS_27820 2743 2925 gene locus_tag LOCUS_27830 2743 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence0526 922 1632 gene locus_tag LOCUS_27840 922 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1660 2523 gene locus_tag LOCUS_27850 1660 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence0527 610 1083 gene locus_tag LOCUS_27860 610 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1144 2775 gene locus_tag LOCUS_27870 1144 2775 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_27870 3459 2824 gene locus_tag LOCUS_27880 3459 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence0528 18 620 gene locus_tag LOCUS_27890 gene rpsD 18 620 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_27890 652 1641 gene locus_tag LOCUS_27900 gene rpoA 652 1641 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_27900 1704 2177 gene locus_tag LOCUS_27910 gene rplQ 1704 2177 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A3 protein_id gnl|my_center|LOCUS_27910 2308 3405 gene locus_tag LOCUS_27920 gene carA 2308 3405 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_27920 >Feature sequence0529 309 1763 gene locus_tag LOCUS_27930 309 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence0530 417 677 gene locus_tag LOCUS_27940 417 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 736 2832 gene locus_tag LOCUS_27950 736 2832 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence0531 529 2316 gene locus_tag LOCUS_27960 529 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0532 337 2589 gene locus_tag LOCUS_27970 gene uvrD 337 2589 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_27970 2633 3313 gene locus_tag LOCUS_27980 2633 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence0533 <1 1215 gene locus_tag LOCUS_27990 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266447.1:acyl-CoA dehydrogenase 1401 1240 gene locus_tag LOCUS_28000 1401 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1721 2245 gene locus_tag LOCUS_28010 1721 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence0534 274 1275 gene locus_tag LOCUS_28020 274 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1279 1845 gene locus_tag LOCUS_28030 1279 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2382 3311 gene locus_tag LOCUS_28040 2382 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence0535 349 651 gene locus_tag LOCUS_28050 349 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_28050 2009 1134 gene locus_tag LOCUS_28060 2009 1134 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530722.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence0536 456 1901 gene locus_tag LOCUS_28070 456 1901 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_28070 <3603 2045 gene locus_tag LOCUS_28080 <3603 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 >Feature sequence0537 107 247 gene locus_tag LOCUS_28090 107 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 594 1313 gene locus_tag LOCUS_28100 gene hisA 594 1313 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_28100 2269 1466 gene locus_tag LOCUS_28110 gene proC 2269 1466 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_28110 2489 2932 gene locus_tag LOCUS_28120 2489 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2929 3129 gene locus_tag LOCUS_28130 2929 3129 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence0538 1955 2857 gene locus_tag LOCUS_28140 1955 2857 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence0539 793 176 gene locus_tag LOCUS_28150 793 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1386 796 gene locus_tag LOCUS_28160 1386 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2184 1525 gene locus_tag LOCUS_28170 2184 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence0540 817 2199 gene locus_tag LOCUS_28180 817 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2508 3413 gene locus_tag LOCUS_28190 2508 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence0541 1119 2492 gene locus_tag LOCUS_28200 1119 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence0542 631 2805 gene locus_tag LOCUS_28210 631 2805 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence0543 1311 880 gene locus_tag LOCUS_28220 1311 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1771 1646 gene locus_tag LOCUS_28230 1771 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1961 3394 gene locus_tag LOCUS_28240 gene putA 1961 3394 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_28240 >Feature sequence0544 >Feature sequence0545 >Feature sequence0546 772 1563 gene locus_tag LOCUS_28250 772 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2215 1607 gene locus_tag LOCUS_28260 2215 1607 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_28260 2950 2528 gene locus_tag LOCUS_28270 2950 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245307.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence0547 462 977 gene locus_tag LOCUS_28280 462 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1349 1534 gene locus_tag LOCUS_28290 1349 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2341 1823 gene locus_tag LOCUS_28300 2341 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107174.1 protein_id gnl|my_center|LOCUS_28300 3407 2490 gene locus_tag LOCUS_28310 3407 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0548 137 1303 gene locus_tag LOCUS_28320 137 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_28320 1421 1747 gene locus_tag LOCUS_28330 1421 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28330 1748 2416 gene locus_tag LOCUS_28340 1748 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28340 2647 2880 gene locus_tag LOCUS_28350 2647 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence0549 228 3371 gene locus_tag LOCUS_28360 228 3371 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence0550 <1 1819 gene locus_tag LOCUS_28370 <1 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226244.1:alpha-N-arabinofuranosidase 1964 3352 gene locus_tag LOCUS_28380 1964 3352 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence0551 878 309 gene locus_tag LOCUS_28390 878 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2156 924 gene locus_tag LOCUS_28400 2156 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2616 3035 gene locus_tag LOCUS_28410 2616 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28410 >Feature sequence0552 571 395 gene locus_tag LOCUS_28420 571 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 802 1935 gene locus_tag LOCUS_28430 802 1935 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_28430 3072 1945 gene locus_tag LOCUS_28440 3072 1945 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence0553 964 1590 gene locus_tag LOCUS_28450 964 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1980 3263 gene locus_tag LOCUS_28460 1980 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0554 743 234 gene locus_tag LOCUS_28470 gene ilvH 743 234 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_28470 2442 760 gene locus_tag LOCUS_28480 gene ilvB 2442 760 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_28480 <3489 2457 gene locus_tag LOCUS_28490 <3489 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWT7:dihydroxy-acid dehydratase >Feature sequence0555 1588 137 gene locus_tag LOCUS_28500 1588 137 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_28500 1796 1924 gene locus_tag LOCUS_28510 1796 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2170 2048 gene locus_tag LOCUS_28520 2170 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2328 2840 gene locus_tag LOCUS_28530 2328 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3486 3010 gene locus_tag LOCUS_28540 3486 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence0556 460 1539 gene locus_tag LOCUS_28550 460 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263255.1 protein_id gnl|my_center|LOCUS_28550 1592 2215 gene locus_tag LOCUS_28560 1592 2215 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_28560 2302 2736 gene locus_tag LOCUS_28570 2302 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 <3480 2784 gene locus_tag LOCUS_28580 <3480 2784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403194.1:DNA-binding response regulator >Feature sequence0557 >Feature sequence0558 1783 515 gene locus_tag LOCUS_28590 1783 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2624 1794 gene locus_tag LOCUS_28600 2624 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence0559 1889 1179 gene locus_tag LOCUS_28610 1889 1179 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_28610 2488 3180 gene locus_tag LOCUS_28620 2488 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence0560 91 534 gene locus_tag LOCUS_28630 gene rplK 91 534 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_28630 546 1244 gene locus_tag LOCUS_28640 gene rplA 546 1244 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_28640 1247 1783 gene locus_tag LOCUS_28650 1247 1783 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_28650 1835 2218 gene locus_tag LOCUS_28660 gene rplL 1835 2218 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence0561 <1 1609 gene locus_tag LOCUS_28670 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease >Feature sequence0562 917 69 gene locus_tag LOCUS_28680 917 69 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181763.1 protein_id gnl|my_center|LOCUS_28680 1921 914 gene locus_tag LOCUS_28690 1921 914 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268818.1 protein_id gnl|my_center|LOCUS_28690 2067 1933 gene locus_tag LOCUS_28700 2067 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2162 2956 gene locus_tag LOCUS_28710 2162 2956 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence0563 <1 955 gene locus_tag LOCUS_28720 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789258.1:sulfatase 1203 1490 gene locus_tag LOCUS_28730 1203 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence0564 297 1094 gene locus_tag LOCUS_28740 297 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_28740 1156 2169 gene locus_tag LOCUS_28750 1156 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2144 2878 gene locus_tag LOCUS_28760 2144 2878 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_28760 3123 2902 gene locus_tag LOCUS_28770 3123 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence0565 2378 1008 gene locus_tag LOCUS_28780 2378 1008 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_28780 3370 2375 gene locus_tag LOCUS_28790 3370 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence0566 <1 1028 gene locus_tag LOCUS_28800 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119680.1:acetylxylan esterase <3403 1193 gene locus_tag LOCUS_28810 <3403 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119627.1:cytochrome c >Feature sequence0567 1021 317 gene locus_tag LOCUS_28820 1021 317 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence0568 <1 2712 gene locus_tag LOCUS_28830 <1 2712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122060.1:cytochrome c >Feature sequence0569 188 964 gene locus_tag LOCUS_28840 188 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 968 1864 gene locus_tag LOCUS_28850 968 1864 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_28850 2081 3166 gene locus_tag LOCUS_28860 2081 3166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence0570 1782 1108 gene locus_tag LOCUS_28870 1782 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2882 1809 gene locus_tag LOCUS_28880 gene idh 2882 1809 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_28880 <3394 2894 gene locus_tag LOCUS_28890 <3394 2894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18D70:peptidyl-prolyl cis-trans isomerase >Feature sequence0571 595 2532 gene locus_tag LOCUS_28900 595 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 <3391 2761 gene locus_tag LOCUS_28910 <3391 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225011.1:ribonuclease activity regulator RraA >Feature sequence0572 2790 328 gene locus_tag LOCUS_28920 2790 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence0573 <1 573 gene locus_tag LOCUS_28930 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783729.1:DNA alkylation repair protein 630 1217 gene locus_tag LOCUS_28940 630 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2391 1252 gene locus_tag LOCUS_28950 2391 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2609 2965 gene locus_tag LOCUS_28960 2609 2965 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769911.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence0574 332 1252 gene locus_tag LOCUS_28970 gene era 332 1252 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV2 protein_id gnl|my_center|LOCUS_28970 1265 2578 gene locus_tag LOCUS_28980 gene der 1265 2578 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_28980 2660 2854 gene locus_tag LOCUS_28990 2660 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence0575 <1 1587 gene locus_tag LOCUS_29000 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107218.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0576 1034 399 gene locus_tag LOCUS_29010 gene pdxH 1034 399 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_29010 1126 1695 gene locus_tag LOCUS_29020 1126 1695 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_29020 >Feature sequence0577 2088 1135 gene locus_tag LOCUS_29030 2088 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2542 2063 gene locus_tag LOCUS_29040 2542 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence0578 1213 2055 gene locus_tag LOCUS_29050 gene dhaA 1213 2055 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_29050 3259 2483 gene locus_tag LOCUS_29060 3259 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0579 78 1004 gene locus_tag LOCUS_29070 78 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1731 1492 gene locus_tag LOCUS_29080 1731 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3261 2080 gene locus_tag LOCUS_29090 3261 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence0580 1 1572 gene locus_tag LOCUS_29100 1 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1955 2350 gene locus_tag LOCUS_29110 1955 2350 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_29110 >Feature sequence0581 501 1007 gene locus_tag LOCUS_29120 501 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1062 1439 gene locus_tag LOCUS_29130 1062 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1436 1846 gene locus_tag LOCUS_29140 1436 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1843 3273 gene locus_tag LOCUS_29150 1843 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence0582 2026 2904 gene locus_tag LOCUS_29160 2026 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_29160 3060 3275 gene locus_tag LOCUS_29170 3060 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0583 2211 565 gene locus_tag LOCUS_29180 gene pgi 2211 565 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_29180 2368 3117 gene locus_tag LOCUS_29190 2368 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0584 1593 652 gene locus_tag LOCUS_29200 1593 652 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405243.1 protein_id gnl|my_center|LOCUS_29200 1820 2983 gene locus_tag LOCUS_29210 1820 2983 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence0585 1671 1168 gene locus_tag LOCUS_29220 1671 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2094 3113 gene locus_tag LOCUS_29230 2094 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence0586 1301 375 gene locus_tag LOCUS_29240 gene prsA 1301 375 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_29240 2136 1417 gene locus_tag LOCUS_29250 gene comB 2136 1417 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_29250 3301 2207 gene locus_tag LOCUS_29260 gene gcvT 3301 2207 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0587 <1 1331 gene locus_tag LOCUS_29270 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405041.1:magnesium chelatase 1427 1636 gene locus_tag LOCUS_29280 1427 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3041 1689 gene locus_tag LOCUS_29290 3041 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence0588 506 48 gene locus_tag LOCUS_29300 506 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1479 1637 gene locus_tag LOCUS_29310 1479 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2800 1736 gene locus_tag LOCUS_29320 2800 1736 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0589 <1 601 gene locus_tag LOCUS_29330 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZL1:type III pantothenate kinase 585 1868 gene locus_tag LOCUS_29340 585 1868 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_29340 1881 3185 gene locus_tag LOCUS_29350 1881 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence0590 333 1022 gene locus_tag LOCUS_29360 333 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_29360 1032 2372 gene locus_tag LOCUS_29370 1032 2372 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_29370 2751 3131 gene locus_tag LOCUS_29380 2751 3131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence0591 <1 1341 gene locus_tag LOCUS_29390 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005422351.1:transporter 1354 2844 gene locus_tag LOCUS_29400 1354 2844 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence0592 1730 849 gene locus_tag LOCUS_29410 1730 849 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0593 601 2967 gene locus_tag LOCUS_29420 601 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence0594 <1 705 gene locus_tag LOCUS_29430 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108126.1:ketol-acid reductoisomerase 709 2220 gene locus_tag LOCUS_29440 gene leuA 709 2220 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0595 746 2842 gene locus_tag LOCUS_29450 gene pta 746 2842 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 protein_id gnl|my_center|LOCUS_29450 >Feature sequence0596 <1 2135 gene locus_tag LOCUS_29460 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114327.1:hybrid sensor histidine kinase/response regulator >Feature sequence0597 <1 906 gene locus_tag LOCUS_29470 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease 1995 964 gene locus_tag LOCUS_29480 gene recA 1995 964 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_29480 2172 2960 gene locus_tag LOCUS_29490 2172 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence0598 1647 2045 gene locus_tag LOCUS_29500 1647 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2804 2049 gene locus_tag LOCUS_29510 2804 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066174.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence0599 477 79 gene locus_tag LOCUS_29520 gene rpsK 477 79 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_29520 870 493 gene locus_tag LOCUS_29530 gene rpsM 870 493 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_29530 1304 1086 gene locus_tag LOCUS_29540 gene infA 1304 1086 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_29540 2080 1307 gene locus_tag LOCUS_29550 gene map 2080 1307 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM9 protein_id gnl|my_center|LOCUS_29550 <3279 2077 gene locus_tag LOCUS_29560 <3279 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A496:protein translocase subunit SecY >Feature sequence0600 <1 783 gene locus_tag LOCUS_29570 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558370.1:glycosyl transferase note possible pseudo, internal stop codon 892 1854 gene locus_tag LOCUS_29580 892 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2004 3002 gene locus_tag LOCUS_29590 2004 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0601 <1 1936 gene locus_tag LOCUS_29600 <1 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203587.1:membrane protein <3267 2187 gene locus_tag LOCUS_29610 <3267 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222156.1:aminopeptidase >Feature sequence0602 722 411 gene locus_tag LOCUS_29620 722 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2513 729 gene locus_tag LOCUS_29630 2513 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 <3264 2570 gene locus_tag LOCUS_29640 <3264 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962813.1:PASTA domain-containing protein >Feature sequence0603 2194 887 gene locus_tag LOCUS_29650 2194 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 2863 2300 gene locus_tag LOCUS_29660 2863 2300 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence0604 1 381 gene locus_tag LOCUS_29670 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 492 1202 gene locus_tag LOCUS_29680 492 1202 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_29680 1358 1801 gene locus_tag LOCUS_29690 gene rplM 1358 1801 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_29690 1813 2199 gene locus_tag LOCUS_29700 gene rpsI 1813 2199 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_29700 2245 3006 gene locus_tag LOCUS_29710 gene rpsB 2245 3006 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_29710 >Feature sequence0605 1306 173 gene locus_tag LOCUS_29720 1306 173 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence0606 >Feature sequence0607 405 2855 gene locus_tag LOCUS_29730 405 2855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence0608 210 1226 gene locus_tag LOCUS_29740 210 1226 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_29740 2114 1323 gene locus_tag LOCUS_29750 2114 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0609 1145 669 gene locus_tag LOCUS_29760 1145 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_29760 1902 1438 gene locus_tag LOCUS_29770 1902 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 2368 2069 gene locus_tag LOCUS_29780 2368 2069 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_29780 2741 2355 gene locus_tag LOCUS_29790 2741 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence0610 2205 493 gene locus_tag LOCUS_29800 2205 493 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence0611 2851 1607 gene locus_tag LOCUS_29810 2851 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence0612 <3230 2413 gene locus_tag LOCUS_29820 <3230 2413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108337.1:cephalosporin deacetylase >Feature sequence0613 302 1072 gene locus_tag LOCUS_29830 302 1072 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797186.1 protein_id gnl|my_center|LOCUS_29830 1076 1450 gene locus_tag LOCUS_29840 1076 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3022 1457 gene locus_tag LOCUS_29850 3022 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence0614 637 194 gene locus_tag LOCUS_29860 637 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_29860 1518 682 gene locus_tag LOCUS_29870 1518 682 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_29870 2086 1601 gene locus_tag LOCUS_29880 2086 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2861 2184 gene locus_tag LOCUS_29890 gene menG 2861 2184 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67055 protein_id gnl|my_center|LOCUS_29890 >Feature sequence0615 2 231 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttcaattcctctatggtgcgattaatgg 466 317 gene locus_tag LOCUS_29900 466 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 707 444 gene locus_tag LOCUS_29910 gene cas2 707 444 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_29910 2251 1247 gene locus_tag LOCUS_29920 gene cas1 2251 1247 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_29920 2613 2248 gene locus_tag LOCUS_29930 2613 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2849 2613 gene locus_tag LOCUS_29940 2849 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0616 1580 867 gene locus_tag LOCUS_29950 1580 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1820 2572 gene locus_tag LOCUS_29960 1820 2572 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223729.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0617 <1 3199 gene locus_tag LOCUS_29970 <1 3199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence0618 <1 1187 gene locus_tag LOCUS_29980 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 1184 2404 gene locus_tag LOCUS_29990 gene porV 1184 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence0619 879 529 gene locus_tag LOCUS_30000 gene yffB 879 529 CDS product protein YffB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24178 protein_id gnl|my_center|LOCUS_30000 2344 1052 gene locus_tag LOCUS_30010 gene hemL 2344 1052 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_30010 >Feature sequence0620 >Feature sequence0621 <1 1035 gene locus_tag LOCUS_30020 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291518.1:conjugative transposon protein TraJ 1051 1668 gene locus_tag LOCUS_30030 1051 1668 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776802.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence0622 1070 393 gene locus_tag LOCUS_30040 gene fabG 1070 393 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056775.1 protein_id gnl|my_center|LOCUS_30040 1220 2008 gene locus_tag LOCUS_30050 1220 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1998 2339 gene locus_tag LOCUS_30060 gene ogt2 1998 2339 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_30060 2452 2817 gene locus_tag LOCUS_30070 2452 2817 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817315.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence0623 >Feature sequence0624 544 1245 gene locus_tag LOCUS_30080 544 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1522 2280 gene locus_tag LOCUS_30090 1522 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence0625 <1 1072 gene locus_tag LOCUS_30100 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964437.1:FAD-dependent oxidoreductase 1124 2605 gene locus_tag LOCUS_30110 1124 2605 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence0626 1994 1398 gene locus_tag LOCUS_30120 1994 1398 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence0627 1444 482 gene locus_tag LOCUS_30130 1444 482 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_30130 1996 1451 gene locus_tag LOCUS_30140 1996 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2515 2003 gene locus_tag LOCUS_30150 2515 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 <3169 2516 gene locus_tag LOCUS_30160 <3169 2516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DP4:dihydroorotase >Feature sequence0628 939 331 gene locus_tag LOCUS_30170 gene hisI 939 331 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_30170 1952 1197 gene locus_tag LOCUS_30180 gene hisF 1952 1197 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_30180 <3164 2025 gene locus_tag LOCUS_30190 <3164 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404981.1:glutamate dehydrogenase >Feature sequence0629 <1 1316 gene locus_tag LOCUS_30200 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963545.1:xenobiotic ABC transporter ATP-binding protein 2178 1363 gene locus_tag LOCUS_30210 gene pyrF 2178 1363 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_30210 2897 2241 gene locus_tag LOCUS_30220 2897 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence0630 105 3089 gene locus_tag LOCUS_30230 105 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence0631 1713 2810 gene locus_tag LOCUS_30240 1713 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence0632 284 1891 gene locus_tag LOCUS_30250 284 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 >Feature sequence0633 244 1626 gene locus_tag LOCUS_30260 244 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1771 2745 gene locus_tag LOCUS_30270 1771 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0634 <1 1238 gene locus_tag LOCUS_30280 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028586.1:beta-N-acetylhexosaminidase 1485 2297 gene locus_tag LOCUS_30290 1485 2297 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence0635 439 924 gene locus_tag LOCUS_30300 439 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 931 3072 gene locus_tag LOCUS_30310 931 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence0636 1867 1055 gene locus_tag LOCUS_30320 1867 1055 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence0637 2122 923 gene locus_tag LOCUS_30330 2122 923 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_30330 2274 2852 gene locus_tag LOCUS_30340 2274 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0638 2549 564 gene locus_tag LOCUS_30350 2549 564 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291482.1 protein_id gnl|my_center|LOCUS_30350 <3116 2569 gene locus_tag LOCUS_30360 <3116 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107110.1:mobilization protein >Feature sequence0639 635 1264 gene locus_tag LOCUS_30370 635 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932420.1 protein_id gnl|my_center|LOCUS_30370 1435 2433 gene locus_tag LOCUS_30380 1435 2433 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_30380 3108 2581 gene locus_tag LOCUS_30390 3108 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence0640 2641 461 gene locus_tag LOCUS_30400 2641 461 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0641 417 2186 gene locus_tag LOCUS_30410 417 2186 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence0642 321 1697 gene locus_tag LOCUS_30420 321 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <3092 1761 gene locus_tag LOCUS_30430 <3092 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203174.1:dipeptidyl carboxypeptidase II >Feature sequence0643 1581 586 gene locus_tag LOCUS_30440 1581 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_30440 2459 1626 gene locus_tag LOCUS_30450 2459 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence0644 985 3027 gene locus_tag LOCUS_30460 gene glnA 985 3027 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence0645 <1 2178 gene locus_tag LOCUS_30470 <1 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767240.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0646 92 1654 gene locus_tag LOCUS_30480 gene tnpA 92 1654 CDS product transposase for insertion sequence element IS21-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NF0 protein_id gnl|my_center|LOCUS_30480 1725 2480 gene locus_tag LOCUS_30490 1725 2480 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0647 740 144 gene locus_tag LOCUS_30500 740 144 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122143.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence0648 479 72 gene locus_tag LOCUS_30510 479 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 886 539 gene locus_tag LOCUS_30520 gene rsfS 886 539 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_30520 978 1742 gene locus_tag LOCUS_30530 978 1742 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence0649 1309 1127 gene locus_tag LOCUS_30540 1309 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1934 1356 gene locus_tag LOCUS_30550 1934 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_30550 <3044 1939 gene locus_tag LOCUS_30560 <3044 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932589.1:ATPase >Feature sequence0650 2860 1208 gene locus_tag LOCUS_30570 gene recN 2860 1208 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_30570 >Feature sequence0651 <3026 742 gene locus_tag LOCUS_30580 <3026 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0652 2361 238 gene locus_tag LOCUS_30590 gene mcm3 2361 238 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_30590 <3017 2358 gene locus_tag LOCUS_30600 <3017 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000013245.1:methylmalonyl-CoA mutase >Feature sequence0653 183 1388 gene locus_tag LOCUS_30610 183 1388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence0654 1430 2563 gene locus_tag LOCUS_30620 1430 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence0655 >Feature sequence0656 184 666 gene locus_tag LOCUS_30630 184 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 722 1684 gene locus_tag LOCUS_30640 722 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence0657 <1 512 gene locus_tag LOCUS_30650 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000680175.1:nucleoside-diphosphate sugar epimerase 515 967 gene locus_tag LOCUS_30660 gene dtd 515 967 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_30660 1003 2493 gene locus_tag LOCUS_30670 1003 2493 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence0658 284 736 gene locus_tag LOCUS_30680 284 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_30680 1189 773 gene locus_tag LOCUS_30690 gene mscL 1189 773 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1X9 protein_id gnl|my_center|LOCUS_30690 1430 1804 gene locus_tag LOCUS_30700 gene mgsA 1430 1804 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ00 protein_id gnl|my_center|LOCUS_30700 1804 2790 gene locus_tag LOCUS_30710 gene pfkA 1804 2790 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_30710 >Feature sequence0659 1664 300 gene locus_tag LOCUS_30720 1664 300 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_30720 1771 2274 gene locus_tag LOCUS_30730 1771 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2330 2911 gene locus_tag LOCUS_30740 2330 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0660 1104 1325 gene locus_tag LOCUS_30750 1104 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1934 2476 gene locus_tag LOCUS_30760 1934 2476 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0661 1665 538 gene locus_tag LOCUS_30770 1665 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2567 1671 gene locus_tag LOCUS_30780 2567 1671 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence0662 1016 1483 gene locus_tag LOCUS_30790 1016 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence0663 1149 112 gene locus_tag LOCUS_30800 1149 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1264 1866 gene locus_tag LOCUS_30810 1264 1866 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0664 954 271 gene locus_tag LOCUS_30820 954 271 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence0665 290 964 gene locus_tag LOCUS_30830 290 964 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_30830 1083 1751 gene locus_tag LOCUS_30840 1083 1751 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_30840 >Feature sequence0666 >Feature sequence0667 <1 1978 gene locus_tag LOCUS_30850 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein 1981 2532 gene locus_tag LOCUS_30860 1981 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30860 >Feature sequence0668 1224 2699 gene locus_tag LOCUS_30870 1224 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0669 1240 185 gene locus_tag LOCUS_30880 1240 185 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24892 protein_id gnl|my_center|LOCUS_30880 1747 1358 gene locus_tag LOCUS_30890 1747 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2009 1827 gene locus_tag LOCUS_30900 2009 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence0670 622 2655 gene locus_tag LOCUS_30910 gene ptrB 622 2655 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence0671 865 584 gene locus_tag LOCUS_30920 865 584 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30920 1155 865 gene locus_tag LOCUS_30930 1155 865 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_30930 2204 1257 gene locus_tag LOCUS_30940 2204 1257 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence0672 2599 1070 gene locus_tag LOCUS_30950 gene guaA 2599 1070 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_30950 >Feature sequence0673 >Feature sequence0674 >Feature sequence0675 298 441 gene locus_tag LOCUS_30960 298 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1083 583 gene locus_tag LOCUS_30970 1083 583 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_30970 1153 1566 gene locus_tag LOCUS_30980 1153 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1693 2670 gene locus_tag LOCUS_30990 gene pdhB 1693 2670 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence0676 365 841 gene locus_tag LOCUS_31000 gene guaD 365 841 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_31000 869 1405 gene locus_tag LOCUS_31010 869 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1617 2879 gene locus_tag LOCUS_31020 1617 2879 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0677 845 2791 gene locus_tag LOCUS_31030 845 2791 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence0678 23 160 gene locus_tag LOCUS_31040 23 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 857 1492 gene locus_tag LOCUS_31050 857 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2417 1545 gene locus_tag LOCUS_31060 gene atpG 2417 1545 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_31060 >Feature sequence0679 690 1355 gene locus_tag LOCUS_31070 690 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence0680 1118 366 gene locus_tag LOCUS_31080 1118 366 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_31080 <2894 1221 gene locus_tag LOCUS_31090 <2894 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437464.1:RNA helicase >Feature sequence0681 1162 398 gene locus_tag LOCUS_31100 1162 398 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705015.1 protein_id gnl|my_center|LOCUS_31100 1945 1427 gene locus_tag LOCUS_31110 1945 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 2725 1976 gene locus_tag LOCUS_31120 2725 1976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence0682 <1 604 gene locus_tag LOCUS_31130 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081188.1:glycosyl transferase family 1 601 1725 gene locus_tag LOCUS_31140 601 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0683 >Feature sequence0684 471 896 gene locus_tag LOCUS_31150 471 896 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_31150 1080 2576 gene locus_tag LOCUS_31160 1080 2576 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence0685 <2874 913 gene locus_tag LOCUS_31170 <2874 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NLX1:alpha-1,4 glucan phosphorylase >Feature sequence0686 >Feature sequence0687 1033 2328 gene locus_tag LOCUS_31180 1033 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2503 2769 gene locus_tag LOCUS_31190 2503 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence0688 1675 902 gene locus_tag LOCUS_31200 gene dapF 1675 902 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_31200 1835 2641 gene locus_tag LOCUS_31210 1835 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0689 1787 453 gene locus_tag LOCUS_31220 1787 453 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_31220 2679 2005 gene locus_tag LOCUS_31230 2679 2005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence0690 <1 506 gene locus_tag LOCUS_31240 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CIH3:glyceraldehyde-3-phosphate dehydrogenase 625 1308 gene locus_tag LOCUS_31250 625 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1504 2139 gene locus_tag LOCUS_31260 1504 2139 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence0691 2212 1472 gene locus_tag LOCUS_31270 2212 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_31270 2388 2462 gene locus_tag LOCUS_t00170 2388 2462 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0692 2832 1495 gene locus_tag LOCUS_31280 gene ffh 2832 1495 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_31280 >Feature sequence0693 333 893 gene locus_tag LOCUS_31290 gene pth 333 893 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ2 protein_id gnl|my_center|LOCUS_31290 >Feature sequence0694 <1 581 gene locus_tag LOCUS_31300 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090937.1:transposase 771 1151 gene locus_tag LOCUS_31310 771 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2335 1373 gene locus_tag LOCUS_31320 2335 1373 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_31320 2692 2393 gene locus_tag LOCUS_31330 2692 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0695 283 1137 gene locus_tag LOCUS_31340 283 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1574 1296 gene locus_tag LOCUS_31350 1574 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1839 2228 gene locus_tag LOCUS_31360 1839 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence0696 29 346 gene locus_tag LOCUS_31370 29 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 376 900 gene locus_tag LOCUS_31380 376 900 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLE7 protein_id gnl|my_center|LOCUS_31380 1258 1512 gene locus_tag LOCUS_31390 1258 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2642 1689 gene locus_tag LOCUS_31400 2642 1689 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence0697 2424 964 gene locus_tag LOCUS_31410 gene miaB 2424 964 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_31410 >Feature sequence0698 1693 485 gene locus_tag LOCUS_31420 1693 485 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_31420 1960 2298 gene locus_tag LOCUS_31430 1960 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence0699 <2819 320 gene locus_tag LOCUS_31440 <2819 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMU6:aconitate hydratase >Feature sequence0700 <1 628 gene locus_tag LOCUS_31450 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963713.1:O-succinylbenzoic acid--CoA ligase 625 1050 gene locus_tag LOCUS_31460 625 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1082 2275 gene locus_tag LOCUS_31470 1082 2275 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence0701 689 1354 gene locus_tag LOCUS_31480 689 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2688 1444 gene locus_tag LOCUS_31490 2688 1444 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110007.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence0702 >Feature sequence0703 1240 1371 gene locus_tag LOCUS_31500 1240 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 1355 1552 gene locus_tag LOCUS_31510 1355 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 <2808 1984 gene locus_tag LOCUS_31520 <2808 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107154.1:lytic transglycosylase F >Feature sequence0704 <1 1363 gene locus_tag LOCUS_31530 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:peptidase S41 1363 2052 gene locus_tag LOCUS_31540 1363 2052 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_31540 2049 2555 gene locus_tag LOCUS_31550 2049 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence0705 2648 1218 gene locus_tag LOCUS_31560 gene pyk 2648 1218 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_31560 2797 2663 gene locus_tag LOCUS_31570 2797 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence0706 1051 443 gene locus_tag LOCUS_31580 1051 443 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_31580 1655 2707 gene locus_tag LOCUS_31590 1655 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence0707 648 2459 gene locus_tag LOCUS_31600 648 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence0708 <1 927 gene locus_tag LOCUS_31610 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N73:polyribonucleotide nucleotidyltransferase 1032 1895 gene locus_tag LOCUS_31620 gene rpoD 1032 1895 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence0709 192 503 gene locus_tag LOCUS_31630 192 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 536 796 gene locus_tag LOCUS_31640 gene rpmA 536 796 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR3 protein_id gnl|my_center|LOCUS_31640 >Feature sequence0710 645 1985 gene locus_tag LOCUS_31650 645 1985 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_31650 2715 2041 gene locus_tag LOCUS_31660 2715 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence0711 824 252 gene locus_tag LOCUS_31670 824 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_31670 1037 828 gene locus_tag LOCUS_31680 1037 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2215 1040 gene locus_tag LOCUS_31690 2215 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728269.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence0712 955 365 gene locus_tag LOCUS_31700 955 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 <2763 955 gene locus_tag LOCUS_31710 <2763 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109026.1:ATP-dependent DNA helicase RecQ >Feature sequence0713 1079 558 gene locus_tag LOCUS_31720 1079 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1645 1184 gene locus_tag LOCUS_31730 1645 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_31730 1756 2622 gene locus_tag LOCUS_31740 1756 2622 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence0714 325 2562 gene locus_tag LOCUS_31750 325 2562 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence0715 >Feature sequence0716 1333 434 gene locus_tag LOCUS_31760 1333 434 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972116.1 protein_id gnl|my_center|LOCUS_31760 <2731 1493 gene locus_tag LOCUS_31770 <2731 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142384.1:Na+/H+ antiporter >Feature sequence0717 333 1013 gene locus_tag LOCUS_31780 333 1013 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_31780 2454 1696 gene locus_tag LOCUS_31790 2454 1696 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence0718 442 1866 gene locus_tag LOCUS_31800 gene ccoG 442 1866 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence0719 <2721 1698 gene locus_tag LOCUS_31810 <2721 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392274.1:carbamoyl phosphate synthase-like protein >Feature sequence0720 <1 1099 gene locus_tag LOCUS_31820 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A296:cysteine desulfurase 1096 1527 gene locus_tag LOCUS_31830 gene sufE 1096 1527 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_31830 1533 1874 gene locus_tag LOCUS_31840 1533 1874 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_31840 1896 2315 gene locus_tag LOCUS_31850 gene yqiW 1896 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence0721 1155 2453 gene locus_tag LOCUS_31860 gene phrB1 1155 2453 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence0722 135 530 gene locus_tag LOCUS_31870 135 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_31870 604 2508 gene locus_tag LOCUS_31880 604 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence0723 794 357 gene locus_tag LOCUS_31890 gene ppi 794 357 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_31890 2526 919 gene locus_tag LOCUS_31900 gene pckA2 2526 919 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_31900 >Feature sequence0724 <1 967 gene locus_tag LOCUS_31910 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein 986 2524 gene locus_tag LOCUS_31920 986 2524 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence0725 365 2656 gene locus_tag LOCUS_31930 365 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence0726 1223 261 gene locus_tag LOCUS_31940 1223 261 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_31940 1975 1223 gene locus_tag LOCUS_31950 1975 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2414 1965 gene locus_tag LOCUS_31960 2414 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence0727 343 591 gene locus_tag LOCUS_31970 343 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 588 1022 gene locus_tag LOCUS_31980 588 1022 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_31980 2577 1108 gene locus_tag LOCUS_31990 gene phrB2 2577 1108 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence0728 1053 124 gene locus_tag LOCUS_32000 1053 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2333 1194 gene locus_tag LOCUS_32010 2333 1194 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence0729 1 414 gene locus_tag LOCUS_32020 1 414 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_32020 1249 554 gene locus_tag LOCUS_32030 1249 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 1494 2372 gene locus_tag LOCUS_32040 gene gluQ 1494 2372 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_32040 >Feature sequence0730 >Feature sequence0731 2205 1252 gene locus_tag LOCUS_32050 2205 1252 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101916.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence0732 1206 154 gene locus_tag LOCUS_32060 1206 154 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_32060 <2660 1181 gene locus_tag LOCUS_32070 <2660 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089482.1:ferredoxin oxidoreductase >Feature sequence0733 973 278 gene locus_tag LOCUS_32080 973 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2399 1392 gene locus_tag LOCUS_32090 2399 1392 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence0734 3 668 gene locus_tag LOCUS_32100 3 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 1047 2414 gene locus_tag LOCUS_32110 1047 2414 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence0735 >Feature sequence0736 <2648 64 gene locus_tag LOCUS_32120 <2648 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941940.1:histidine kinase >Feature sequence0737 >Feature sequence0738 298 1608 gene locus_tag LOCUS_32130 gene rimO 298 1608 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_32130 >Feature sequence0739 <1 692 gene locus_tag LOCUS_32140 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990043.1:autolysin 763 1872 gene locus_tag LOCUS_32150 763 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1894 2490 gene locus_tag LOCUS_32160 1894 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32160 >Feature sequence0740 <1 760 gene locus_tag LOCUS_32170 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase >Feature sequence0741 >Feature sequence0742 1753 71 gene locus_tag LOCUS_32180 1753 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence0743 <1 603 gene locus_tag LOCUS_32190 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918074.1:TonB-dependent receptor 697 1569 gene locus_tag LOCUS_32200 697 1569 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_32200 1634 2044 gene locus_tag LOCUS_32210 1634 2044 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724669.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence0744 <2623 1343 gene locus_tag LOCUS_32220 <2623 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109263.1:dehydrogenase >Feature sequence0745 <1 1999 gene locus_tag LOCUS_32230 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MY0:DNA topoisomerase 1 >Feature sequence0746 <1 1162 gene locus_tag LOCUS_32240 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TX9:queuine tRNA-ribosyltransferase 1166 2239 gene locus_tag LOCUS_32250 1166 2239 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence0747 <1 2371 gene locus_tag LOCUS_32260 <1 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:hybrid sensor histidine kinase/response regulator >Feature sequence0748 <1 918 gene locus_tag LOCUS_32270 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence0749 1195 182 gene locus_tag LOCUS_32280 1195 182 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_32280 1249 1923 gene locus_tag LOCUS_32290 1249 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 <2586 1976 gene locus_tag LOCUS_32300 <2586 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase >Feature sequence0750 711 277 gene locus_tag LOCUS_32310 711 277 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_32310 1266 1814 gene locus_tag LOCUS_32320 1266 1814 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence0751 >Feature sequence0752 2284 1319 gene locus_tag LOCUS_32330 2284 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence0753 >Feature sequence0754 194 559 gene locus_tag LOCUS_32340 194 559 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence0755 >Feature sequence0756 <1 1474 gene locus_tag LOCUS_32350 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405424.1:acylaminoacyl-peptidase 1937 1743 gene locus_tag LOCUS_32360 1937 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence0757 >Feature sequence0758 241 1146 gene locus_tag LOCUS_32370 241 1146 CDS product sugar phosphate isomerase/epimerase IoIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706509.1 protein_id gnl|my_center|LOCUS_32370 1216 2220 gene locus_tag LOCUS_32380 1216 2220 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence0759 765 535 gene locus_tag LOCUS_32390 765 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1934 1188 gene locus_tag LOCUS_32400 1934 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_32400 1959 2132 gene locus_tag LOCUS_32410 1959 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence0760 940 2085 gene locus_tag LOCUS_32420 940 2085 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence0761 691 1953 gene locus_tag LOCUS_32430 691 1953 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence0762 2180 390 gene locus_tag LOCUS_32440 gene argS 2180 390 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_32440 >Feature sequence0763 47 1771 gene locus_tag LOCUS_32450 gene thrS 47 1771 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_32450 1860 2411 gene locus_tag LOCUS_32460 gene infC 1860 2411 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32460 >Feature sequence0764 2369 795 gene locus_tag LOCUS_32470 2369 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_32470 >Feature sequence0765 2133 34 gene locus_tag LOCUS_32480 2133 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0766 1458 763 gene locus_tag LOCUS_32490 1458 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2129 1710 gene locus_tag LOCUS_32500 2129 1710 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_32500 2383 2126 gene locus_tag LOCUS_32510 2383 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0767 1661 213 gene locus_tag LOCUS_32520 1661 213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_32520 <2509 1673 gene locus_tag LOCUS_32530 <2509 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0768 <1 1006 gene locus_tag LOCUS_32540 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073389.1:peptidase M16 >Feature sequence0769 231 725 gene locus_tag LOCUS_32550 gene atpF 231 725 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_32550 728 1288 gene locus_tag LOCUS_32560 gene atpH 728 1288 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_32560 >Feature sequence0770 2 472 gene locus_tag LOCUS_32570 2 472 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_32570 696 493 gene locus_tag LOCUS_32580 696 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2055 850 gene locus_tag LOCUS_32590 gene dnaN 2055 850 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_32590 >Feature sequence0771 <1 530 gene locus_tag LOCUS_32600 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q837T2:UPF0176 protein 487 1353 gene locus_tag LOCUS_32610 gene udp 487 1353 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_32610 1657 1376 gene locus_tag LOCUS_32620 1657 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 2379 1753 gene locus_tag LOCUS_32630 2379 1753 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969688.1 protein_id gnl|my_center|LOCUS_32630 >Feature sequence0772 <1 1351 gene locus_tag LOCUS_32640 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963130.1:TonB-dependent receptor 1722 1363 gene locus_tag LOCUS_32650 1722 1363 CDS product bleomycin binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242578.1 protein_id gnl|my_center|LOCUS_32650 1902 2087 gene locus_tag LOCUS_32660 1902 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2401 2475 gene locus_tag LOCUS_t00180 2401 2475 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0773 1203 649 gene locus_tag LOCUS_32670 gene def 1203 649 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_32670 1613 1200 gene locus_tag LOCUS_32680 1613 1200 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_32680 2374 1613 gene locus_tag LOCUS_32690 2374 1613 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence0774 384 629 gene locus_tag LOCUS_32700 384 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 963 691 gene locus_tag LOCUS_32710 963 691 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_32710 981 1133 gene locus_tag LOCUS_32720 981 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 1221 2321 gene locus_tag LOCUS_32730 1221 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence0775 >Feature sequence0776 2353 212 gene locus_tag LOCUS_32740 2353 212 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4L9 protein_id gnl|my_center|LOCUS_32740 >Feature sequence0777 526 38 gene locus_tag LOCUS_32750 526 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 1206 574 gene locus_tag LOCUS_32760 1206 574 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_32760 1986 1207 gene locus_tag LOCUS_32770 gene lpxA 1986 1207 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_32770 >Feature sequence0778 757 1302 gene locus_tag LOCUS_32780 757 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1448 1996 gene locus_tag LOCUS_32790 1448 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence0779 586 281 gene locus_tag LOCUS_32800 gene rpsJ 586 281 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_32800 <2465 600 gene locus_tag LOCUS_32810 <2465 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZA1:elongation factor G >Feature sequence0780 154 1185 gene locus_tag LOCUS_32820 154 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1398 2435 gene locus_tag LOCUS_32830 1398 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence0781 <2452 311 gene locus_tag LOCUS_32840 <2452 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963021.1:aminotransferase >Feature sequence0782 1233 400 gene locus_tag LOCUS_32850 1233 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0783 1192 797 gene locus_tag LOCUS_32860 1192 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 <2443 1268 gene locus_tag LOCUS_32870 <2443 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771113.1:ATP-binding protein >Feature sequence0784 736 1881 gene locus_tag LOCUS_32880 736 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0785 <1 2348 gene locus_tag LOCUS_32890 <1 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter >Feature sequence0786 <1 1684 gene locus_tag LOCUS_32900 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201930.1:TonB-dependent receptor 1713 2321 gene locus_tag LOCUS_32910 1713 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence0787 <1 1353 gene locus_tag LOCUS_32920 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962677.1:anthranilate synthase component I 1662 2228 gene locus_tag LOCUS_32930 1662 2228 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803788.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence0788 <1 1967 gene locus_tag LOCUS_32940 <1 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789008.1:multidrug efflux pump protein >Feature sequence0789 1232 1603 gene locus_tag LOCUS_32950 1232 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1786 2031 gene locus_tag LOCUS_32960 1786 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence0790 <1 1858 gene locus_tag LOCUS_32970 <1 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791675.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0791 >Feature sequence0792 323 2161 gene locus_tag LOCUS_32980 323 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence0793 575 276 gene locus_tag LOCUS_32990 575 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 787 578 gene locus_tag LOCUS_33000 787 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1574 1014 gene locus_tag LOCUS_33010 1574 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_33010 <2421 1571 gene locus_tag LOCUS_33020 <2421 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121485.1:4Fe-4S ferredoxin >Feature sequence0794 <2419 1222 gene locus_tag LOCUS_33030 <2419 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207594.1:glucose dehydrogenase >Feature sequence0795 <1 545 gene locus_tag LOCUS_33040 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804186.1:GTPase subunit of restriction endonuclease 618 767 gene locus_tag LOCUS_33050 618 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 767 2080 gene locus_tag LOCUS_33060 767 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence0796 524 123 gene locus_tag LOCUS_33070 524 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_33070 1471 680 gene locus_tag LOCUS_33080 gene lipB 1471 680 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_33080 1480 1836 gene locus_tag LOCUS_33090 1480 1836 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_33090 >Feature sequence0797 337 795 gene locus_tag LOCUS_33100 337 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 820 1464 gene locus_tag LOCUS_33110 820 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1607 2170 gene locus_tag LOCUS_33120 1607 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence0798 >Feature sequence0799 <1 1684 gene locus_tag LOCUS_33130 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A4T0:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) >Feature sequence0800 1115 363 gene locus_tag LOCUS_33140 1115 363 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_33140 1729 1115 gene locus_tag LOCUS_33150 1729 1115 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence0801 <1 573 gene locus_tag LOCUS_33160 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964015.1:3-hydroxybutyryl-CoA dehydrogenase 575 1192 gene locus_tag LOCUS_33170 575 1192 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_33170 1850 1206 gene locus_tag LOCUS_33180 1850 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2321 1860 gene locus_tag LOCUS_33190 2321 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence0802 247 891 gene locus_tag LOCUS_33200 247 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence0803 <1 643 gene locus_tag LOCUS_33210 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920359.1:aminopeptidase 1354 1845 gene locus_tag LOCUS_33220 1354 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence0804 1655 2251 gene locus_tag LOCUS_33230 1655 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33230 >Feature sequence0805 1562 567 gene locus_tag LOCUS_33240 1562 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 2142 1564 gene locus_tag LOCUS_33250 2142 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence0806 113 832 gene locus_tag LOCUS_33260 gene ispE 113 832 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_33260 875 1117 gene locus_tag LOCUS_33270 875 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1104 1436 gene locus_tag LOCUS_33280 gene mazF 1104 1436 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE71 protein_id gnl|my_center|LOCUS_33280 1527 1772 gene locus_tag LOCUS_33290 1527 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1753 2175 gene locus_tag LOCUS_33300 1753 2175 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence0807 1244 435 gene locus_tag LOCUS_33310 1244 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 2295 1270 gene locus_tag LOCUS_33320 2295 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence0808 486 1850 gene locus_tag LOCUS_33330 486 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence0809 >Feature sequence0810 81 743 gene locus_tag LOCUS_33340 81 743 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_33340 881 1576 gene locus_tag LOCUS_33350 881 1576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358553.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence0811 166 393 gene locus_tag LOCUS_33360 166 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence0812 <1 879 gene locus_tag LOCUS_33370 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256447.1:deoxyhypusine synthase >Feature sequence0813 304 915 gene locus_tag LOCUS_33380 gene sigW 304 915 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_33380 >Feature sequence0814 928 389 gene locus_tag LOCUS_33390 928 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 1544 918 gene locus_tag LOCUS_33400 gene pnuC 1544 918 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_33400 2366 1860 gene locus_tag LOCUS_33410 2366 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0815 161 1696 gene locus_tag LOCUS_33420 161 1696 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence0816 691 1260 gene locus_tag LOCUS_33430 691 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1283 2221 gene locus_tag LOCUS_33440 1283 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence0817 <2355 335 gene locus_tag LOCUS_33450 <2355 335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000096036.1:methionine synthase >Feature sequence0818 190 1059 gene locus_tag LOCUS_33460 190 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence0819 2339 798 gene locus_tag LOCUS_33470 gene kefB 2339 798 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence0820 708 1808 gene locus_tag LOCUS_33480 708 1808 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016475.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence0821 1010 348 gene locus_tag LOCUS_33490 1010 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence0822 2 907 gene locus_tag LOCUS_33500 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 986 1660 gene locus_tag LOCUS_33510 gene clpP 986 1660 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_33510 >Feature sequence0823 1415 402 gene locus_tag LOCUS_33520 gene murB 1415 402 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_33520 >Feature sequence0824 >Feature sequence0825 422 243 gene locus_tag LOCUS_33530 422 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 457 855 gene locus_tag LOCUS_33540 457 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1012 2022 gene locus_tag LOCUS_33550 gene prfB 1012 2022 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_33550 >Feature sequence0826 <1 1185 gene locus_tag LOCUS_33560 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039191.1:alpha-N-arabinofuranosidase 1257 1829 gene locus_tag LOCUS_33570 1257 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence0827 <1 713 gene locus_tag LOCUS_33580 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405469.1:X-Pro dipeptidyl-peptidase >Feature sequence0828 446 1684 gene locus_tag LOCUS_33590 446 1684 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence0829 <1 696 gene locus_tag LOCUS_33600 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122293.1:ABC transporter ATP-binding protein 701 1084 gene locus_tag LOCUS_33610 701 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1088 1969 gene locus_tag LOCUS_33620 1088 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence0830 519 1475 gene locus_tag LOCUS_33630 519 1475 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_33630 1753 1499 gene locus_tag LOCUS_33640 1753 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 2021 1761 gene locus_tag LOCUS_33650 2021 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 2239 2024 gene locus_tag LOCUS_33660 2239 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence0831 >Feature sequence0832 1383 787 gene locus_tag LOCUS_33670 1383 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1910 1470 gene locus_tag LOCUS_33680 1910 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence0833 149 9 gene locus_tag LOCUS_33690 149 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 <2282 240 gene locus_tag LOCUS_33700 <2282 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence0834 <1 1875 gene locus_tag LOCUS_33710 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0835 504 1649 gene locus_tag LOCUS_33720 504 1649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence0836 97 750 gene locus_tag LOCUS_33730 gene upp 97 750 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_33730 716 1681 gene locus_tag LOCUS_33740 716 1681 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_33740 1678 2136 gene locus_tag LOCUS_33750 1678 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence0837 453 856 gene locus_tag LOCUS_tm00010 453 856 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0838 939 1232 gene locus_tag LOCUS_33760 939 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence0839 388 1503 gene locus_tag LOCUS_33770 388 1503 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_33770 <2263 1600 gene locus_tag LOCUS_33780 <2263 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786603.1:capsular polysaccharide biosynthesis protein >Feature sequence0840 >Feature sequence0841 481 2124 gene locus_tag LOCUS_33790 481 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence0842 861 1241 gene locus_tag LOCUS_33800 861 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1685 1242 gene locus_tag LOCUS_33810 1685 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 <2252 1691 gene locus_tag LOCUS_33820 <2252 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962268.1:SCO family protein >Feature sequence0843 1677 64 gene locus_tag LOCUS_33830 1677 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence0844 1954 1250 gene locus_tag LOCUS_33840 1954 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence0845 1895 501 gene locus_tag LOCUS_33850 1895 501 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence0846 1992 121 gene locus_tag LOCUS_33860 1992 121 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYN6 protein_id gnl|my_center|LOCUS_33860 >Feature sequence0847 >Feature sequence0848 2 268 gene locus_tag LOCUS_33870 2 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 1583 519 gene locus_tag LOCUS_33880 gene speB 1583 519 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0849 >Feature sequence0850 98 1321 gene locus_tag LOCUS_33890 98 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 <2236 1332 gene locus_tag LOCUS_33900 <2236 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207007.1:bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB >Feature sequence0851 394 1050 gene locus_tag LOCUS_33910 394 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 1122 1595 gene locus_tag LOCUS_33920 1122 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 1780 1604 gene locus_tag LOCUS_33930 1780 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence0852 780 1055 gene locus_tag LOCUS_33940 780 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence0853 372 605 gene locus_tag LOCUS_33950 372 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001007670.2 protein_id gnl|my_center|LOCUS_33950 661 1422 gene locus_tag LOCUS_33960 661 1422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence0854 574 245 gene locus_tag LOCUS_33970 574 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 1402 896 gene locus_tag LOCUS_33980 1402 896 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_33980 >Feature sequence0855 178 1650 gene locus_tag LOCUS_33990 178 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence0856 <1 1146 gene locus_tag LOCUS_34000 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108125.1:helicase 1940 1395 gene locus_tag LOCUS_34010 1940 1395 CDS product DUF4924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767803.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence0857 <1 981 gene locus_tag LOCUS_34020 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:peptidase S9 1336 2163 gene locus_tag LOCUS_34030 1336 2163 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence0858 <1 683 gene locus_tag LOCUS_34040 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047985.1:cytochrome d ubiquinol oxidase subunit I 1175 1414 gene locus_tag LOCUS_34050 1175 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_34050 1395 1715 gene locus_tag LOCUS_34060 1395 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 2212 1793 gene locus_tag LOCUS_34070 2212 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 >Feature sequence0862 >Feature sequence0863 <2171 897 gene locus_tag LOCUS_34080 <2171 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257798.1:DEAD/DEAH box helicase >Feature sequence0864 <1 1017 gene locus_tag LOCUS_34090 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964485.1:peptidase S8 1553 1867 gene locus_tag LOCUS_34100 1553 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250024.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence0865 >Feature sequence0866 <1 1546 gene locus_tag LOCUS_34110 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000323161.1:SLC13 family permease >Feature sequence0867 630 370 gene locus_tag LOCUS_34120 630 370 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_34120 <2166 910 gene locus_tag LOCUS_34130 <2166 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZ68:citrate synthase >Feature sequence0868 <1 790 gene locus_tag LOCUS_34140 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124074.1:N-acetylgalactosamine-6-sulfatase >Feature sequence0869 <1 829 gene locus_tag LOCUS_34150 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528172.1:dihydroxy-acid dehydratase 1115 1876 gene locus_tag LOCUS_34160 1115 1876 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence0870 >Feature sequence0871 1 240 gene locus_tag LOCUS_34170 1 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 467 1831 gene locus_tag LOCUS_34180 467 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence0872 >Feature sequence0873 >Feature sequence0874 1269 1688 gene locus_tag LOCUS_34190 1269 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence0875 242 781 gene locus_tag LOCUS_34200 242 781 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_34200 1271 1852 gene locus_tag LOCUS_34210 1271 1852 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence0876 1445 363 gene locus_tag LOCUS_34220 gene murG 1445 363 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_34220 <2104 1478 gene locus_tag LOCUS_34230 <2104 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784004.1:rod shape-determining protein RodA >Feature sequence0877 314 1357 gene locus_tag LOCUS_34240 314 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence0878 2100 1213 gene locus_tag LOCUS_34250 2100 1213 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_34250 >Feature sequence0879 <2099 639 gene locus_tag LOCUS_34260 <2099 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:ATPase >Feature sequence0880 140 280 gene locus_tag LOCUS_34270 140 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 425 1150 gene locus_tag LOCUS_34280 425 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence0881 >Feature sequence0882 <1 1483 gene locus_tag LOCUS_34290 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226667.1:type IV secretion protein Rhs 1489 1779 gene locus_tag LOCUS_34300 1489 1779 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence0883 >Feature sequence0884 1300 161 gene locus_tag LOCUS_34310 1300 161 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_34310 1782 1402 gene locus_tag LOCUS_34320 1782 1402 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence0885 678 872 gene locus_tag LOCUS_34330 678 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 891 1931 gene locus_tag LOCUS_34340 891 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence0886 3 215 gene locus_tag LOCUS_34350 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 269 910 gene locus_tag LOCUS_34360 gene ydeI 269 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_34360 1297 1019 gene locus_tag LOCUS_34370 1297 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 1545 1363 gene locus_tag LOCUS_34380 1545 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence0887 >Feature sequence0888 204 647 gene locus_tag LOCUS_34390 204 647 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_34390 648 1193 gene locus_tag LOCUS_34400 648 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 1212 1898 gene locus_tag LOCUS_34410 1212 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence0889 >Feature sequence0890 106 1413 gene locus_tag LOCUS_34420 106 1413 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P23 protein_id gnl|my_center|LOCUS_34420 >Feature sequence0891 1435 488 gene locus_tag LOCUS_34430 gene accA 1435 488 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_34430 1766 1840 gene locus_tag LOCUS_t00190 1766 1840 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1867 1944 gene locus_tag LOCUS_t00200 1867 1944 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0892 234 896 gene locus_tag LOCUS_34440 234 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence0893 >Feature sequence0894 1777 302 gene locus_tag LOCUS_34450 gene dnaG 1777 302 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34450 >Feature sequence0895 1375 854 gene locus_tag LOCUS_34460 1375 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence0896 1664 1062 gene locus_tag LOCUS_34470 1664 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence0897 >Feature sequence0898 1493 588 gene locus_tag LOCUS_34480 1493 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence0899 464 952 gene locus_tag LOCUS_34490 464 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 963 1373 gene locus_tag LOCUS_34500 963 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1386 1835 gene locus_tag LOCUS_34510 1386 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence0900 >Feature sequence0901 >Feature sequence0902 855 253 gene locus_tag LOCUS_34520 855 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence0903 178 1074 gene locus_tag LOCUS_34530 gene moaA 178 1074 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_34530 >Feature sequence0904 <1 1515 gene locus_tag LOCUS_34540 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887610.1:GMC oxidoreductase >Feature sequence0905 477 950 gene locus_tag LOCUS_34550 477 950 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_34550 1065 1739 gene locus_tag LOCUS_34560 1065 1739 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence0906 708 1847 gene locus_tag LOCUS_34570 gene rhlE 708 1847 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LU9 protein_id gnl|my_center|LOCUS_34570 >Feature sequence0907 <1 1626 gene locus_tag LOCUS_34580 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101357.1:acetolactate synthase >Feature sequence0908 226 1332 gene locus_tag LOCUS_34590 226 1332 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_34590 1399 1977 gene locus_tag LOCUS_34600 1399 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence0909 289 1113 gene locus_tag LOCUS_34610 289 1113 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496896.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence0910 <1 878 gene locus_tag LOCUS_34620 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876140.1:5-methylcytosine-specific restriction enzyme McrB-like protein note possible pseudo, internal stop codon 879 1346 gene locus_tag LOCUS_34630 879 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence0911 >Feature sequence0912 201 641 gene locus_tag LOCUS_34640 201 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 867 1625 gene locus_tag LOCUS_34650 867 1625 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence0913 <1 1334 gene locus_tag LOCUS_34660 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389839.1:type III restriction endonuclease >Feature sequence0914 >Feature sequence0915 400 1212 gene locus_tag LOCUS_34670 gene pip 400 1212 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q890D8 protein_id gnl|my_center|LOCUS_34670 1690 1370 gene locus_tag LOCUS_34680 1690 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence0916 368 1768 gene locus_tag LOCUS_34690 368 1768 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_34690 >Feature sequence0917 >Feature sequence0918 483 1799 gene locus_tag LOCUS_34700 483 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119390.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence0919 349 1728 gene locus_tag LOCUS_34710 gene xylE 349 1728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence0920 >Feature sequence0921 <1940 1089 gene locus_tag LOCUS_34720 <1940 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A9M2:xylose isomerase >Feature sequence0922 369 1172 gene locus_tag LOCUS_34730 369 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_34730 1169 1729 gene locus_tag LOCUS_34740 1169 1729 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence0923 <1 572 gene locus_tag LOCUS_34750 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081423274.1:restriction endonuclease subunit S 612 1154 gene locus_tag LOCUS_34760 612 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 protein_id gnl|my_center|LOCUS_34760 1159 1503 gene locus_tag LOCUS_34770 1159 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence0924 1498 95 gene locus_tag LOCUS_34780 1498 95 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence0925 <1 1589 gene locus_tag LOCUS_34790 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108547.1:hybrid sensor histidine kinase/response regulator >Feature sequence0926 >Feature sequence0927 704 120 gene locus_tag LOCUS_34800 704 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 1688 918 gene locus_tag LOCUS_34810 1688 918 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence0928 577 170 gene locus_tag LOCUS_34820 577 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919817.1 protein_id gnl|my_center|LOCUS_34820 1004 570 gene locus_tag LOCUS_34830 1004 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1378 1800 gene locus_tag LOCUS_34840 1378 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence0929 122 433 gene locus_tag LOCUS_34850 122 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence0930 723 1865 gene locus_tag LOCUS_34860 723 1865 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence0931 1112 540 gene locus_tag LOCUS_34870 gene gmk 1112 540 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_34870 1391 1119 gene locus_tag LOCUS_34880 1391 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence0932 <1 504 gene locus_tag LOCUS_34890 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962529.1:DNA-binding response regulator 509 1561 gene locus_tag LOCUS_34900 gene phoR 509 1561 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence0933 1762 554 gene locus_tag LOCUS_34910 1762 554 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence0934 1572 1219 gene locus_tag LOCUS_34920 1572 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence0935 916 233 gene locus_tag LOCUS_34930 gene truB 916 233 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_34930 1712 918 gene locus_tag LOCUS_34940 gene uppP 1712 918 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_34940 >Feature sequence0936 1605 700 gene locus_tag LOCUS_34950 1605 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence0937 575 378 gene locus_tag LOCUS_34960 575 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence0938 <1887 1171 gene locus_tag LOCUS_34970 <1887 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404896.1:ATPase >Feature sequence0939 <1 977 gene locus_tag LOCUS_34980 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067533.1:oxidoreductase 996 1766 gene locus_tag LOCUS_34990 gene fabG 996 1766 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence0940 <1880 969 gene locus_tag LOCUS_35000 <1880 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801521.1:membrane protein >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 1040 1819 gene locus_tag LOCUS_35010 1040 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence0944 207 539 gene locus_tag LOCUS_35020 207 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 575 1585 gene locus_tag LOCUS_35030 575 1585 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence0945 161 439 gene locus_tag LOCUS_35040 gene rpsS 161 439 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_35040 442 831 gene locus_tag LOCUS_35050 gene rplV 442 831 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_35050 841 1578 gene locus_tag LOCUS_35060 gene rpsC 841 1578 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_35060 >Feature sequence0946 1223 405 gene locus_tag LOCUS_35070 1223 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_35070 1825 1484 gene locus_tag LOCUS_35080 1825 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0947 <1 1204 gene locus_tag LOCUS_35090 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0P8:S-adenosylmethionine:tRNA ribosyltransferase-isomerase 1627 1208 gene locus_tag LOCUS_35100 1627 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence0948 366 1136 gene locus_tag LOCUS_35110 366 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence0949 87 1100 gene locus_tag LOCUS_35120 gene trpD 87 1100 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_35120 >Feature sequence0950 <1 1467 gene locus_tag LOCUS_35130 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence0951 434 213 gene locus_tag LOCUS_35140 434 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 642 1526 gene locus_tag LOCUS_35150 642 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence0952 767 522 gene locus_tag LOCUS_35160 767 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 826 951 gene locus_tag LOCUS_35170 826 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 <1840 1301 gene locus_tag LOCUS_35180 <1840 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140483.1:fused response regulator/thioredoxin-disulfide reductase >Feature sequence0953 729 1403 gene locus_tag LOCUS_35190 729 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence0954 1738 530 gene locus_tag LOCUS_35200 1738 530 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence0955 116 1243 gene locus_tag LOCUS_35210 116 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35210 >Feature sequence0956 >Feature sequence0957 1616 165 gene locus_tag LOCUS_35220 1616 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence0958 <1834 306 gene locus_tag LOCUS_35230 <1834 306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000615086.1:cholesterol oxidase >Feature sequence0959 832 164 gene locus_tag LOCUS_35240 832 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 1207 845 gene locus_tag LOCUS_35250 1207 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 1431 1204 gene locus_tag LOCUS_35260 1431 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 335 976 gene locus_tag LOCUS_35270 335 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 960 1619 gene locus_tag LOCUS_35280 960 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence0963 1211 681 gene locus_tag LOCUS_35290 1211 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence0964 <1 831 gene locus_tag LOCUS_35300 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963816.1:proline dehydrogenase >Feature sequence0965 <1 828 gene locus_tag LOCUS_35310 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291522.1:conjugative transposon protein TraN 877 1656 gene locus_tag LOCUS_35320 877 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence0966 <1 987 gene locus_tag LOCUS_35330 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085890.1:sensor histidine kinase 994 1377 gene locus_tag LOCUS_35340 994 1377 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_35340 >Feature sequence0967 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 482 1732 gene locus_tag LOCUS_35350 482 1732 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence0971 <1780 908 gene locus_tag LOCUS_35360 <1780 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434910.1:SAM-dependent methyltransferase >Feature sequence0972 <1 560 gene locus_tag LOCUS_35370 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X0P5:UPF0173 metal-dependent hydrolase 568 1347 gene locus_tag LOCUS_35380 568 1347 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence0973 <1778 722 gene locus_tag LOCUS_35390 <1778 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase >Feature sequence0974 >Feature sequence0975 1279 209 gene locus_tag LOCUS_35400 1279 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 <1775 1276 gene locus_tag LOCUS_35410 <1775 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107550.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0976 <1773 214 gene locus_tag LOCUS_35420 <1773 214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase >Feature sequence0977 >Feature sequence0978 <1772 746 gene locus_tag LOCUS_35430 <1772 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator >Feature sequence0979 <1767 471 gene locus_tag LOCUS_35440 <1767 471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203507.1:peptidoglycan-binding protein >Feature sequence0980 1446 481 gene locus_tag LOCUS_35450 1446 481 CDS product fructose-1,6-bisphosphate aldolase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence0981 >Feature sequence0982 1692 82 gene locus_tag LOCUS_35460 1692 82 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266183.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence0983 87 278 gene locus_tag LOCUS_35470 87 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 807 1028 gene locus_tag LOCUS_35480 807 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1382 1651 gene locus_tag LOCUS_35490 1382 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence0984 <1 1439 gene locus_tag LOCUS_35500 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence0985 206 1189 gene locus_tag LOCUS_35510 gene aspG 206 1189 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_35510 >Feature sequence0986 277 918 gene locus_tag LOCUS_35520 277 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 1010 1315 gene locus_tag LOCUS_35530 1010 1315 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704671.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence0987 >Feature sequence0988 >Feature sequence0989 1677 721 gene locus_tag LOCUS_35540 1677 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence0990 404 1024 gene locus_tag LOCUS_35550 404 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence0991 633 1499 gene locus_tag LOCUS_35560 633 1499 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence0992 <1 1542 gene locus_tag LOCUS_35570 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme >Feature sequence0993 >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 361 1242 gene locus_tag LOCUS_35580 361 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence0998 >Feature sequence0999 1568 543 gene locus_tag LOCUS_35590 gene hemE 1568 543 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_35590 >Feature sequence1000 834 562 gene locus_tag LOCUS_35600 834 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence1001 <1 870 gene locus_tag LOCUS_35610 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119413.1:endo-1,4-beta-xylanase 959 1213 gene locus_tag LOCUS_35620 959 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1671 1321 gene locus_tag LOCUS_35630 1671 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence1002 892 215 gene locus_tag LOCUS_35640 892 215 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_35640 <1693 1182 gene locus_tag LOCUS_35650 <1693 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084098.1:isopenicillin-N epimerase >Feature sequence1003 1096 209 gene locus_tag LOCUS_35660 1096 209 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882364.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence1004 1545 202 gene locus_tag LOCUS_35670 1545 202 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence1005 <1 856 gene locus_tag LOCUS_35680 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963410.1:pyridoxal phosphate-dependent aminotransferase 1049 1477 gene locus_tag LOCUS_35690 1049 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence1006 758 27 gene locus_tag LOCUS_35700 758 27 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_35700 1675 761 gene locus_tag LOCUS_35710 1675 761 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence1007 >Feature sequence1008 1058 360 gene locus_tag LOCUS_35720 gene atoD 1058 360 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_35720 <1678 1078 gene locus_tag LOCUS_35730 <1678 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW76:riboflavin biosynthesis protein >Feature sequence1009 <1 1268 gene locus_tag LOCUS_35740 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZB5:glycine--tRNA ligase >Feature sequence1010 1651 1394 gene locus_tag LOCUS_35750 1651 1394 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence1011 >Feature sequence1012 806 177 gene locus_tag LOCUS_35760 806 177 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_35760 1231 815 gene locus_tag LOCUS_35770 1231 815 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755946.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence1013 >Feature sequence1014 <1 1102 gene locus_tag LOCUS_35780 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:alanine dehydrogenase >Feature sequence1015 >Feature sequence1016 <1652 645 gene locus_tag LOCUS_35790 <1652 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208292.1:endonuclease >Feature sequence1017 >Feature sequence1018 >Feature sequence1019 760 167 gene locus_tag LOCUS_35800 760 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence1020 >Feature sequence1021 450 1172 gene locus_tag LOCUS_35810 450 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963056.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence1022 >Feature sequence1023 174 590 gene locus_tag LOCUS_35820 174 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 606 971 gene locus_tag LOCUS_35830 606 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 1587 1420 gene locus_tag LOCUS_35840 1587 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence1024 >Feature sequence1025 497 231 gene locus_tag LOCUS_35850 497 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 <1635 598 gene locus_tag LOCUS_35860 <1635 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW00:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence1026 1071 1376 gene locus_tag LOCUS_35870 1071 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence1027 >Feature sequence1028 1327 101 gene locus_tag LOCUS_35880 1327 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence1029 230 967 gene locus_tag LOCUS_35890 gene etfB 230 967 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence1030 630 881 gene locus_tag LOCUS_35900 630 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence1031 88 552 gene locus_tag LOCUS_35910 88 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 25 567 gene locus_tag LOCUS_35920 25 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 <1593 999 gene locus_tag LOCUS_35930 <1593 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480646.1:peptidase S41 >Feature sequence1035 1439 585 gene locus_tag LOCUS_35940 gene dapA 1439 585 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_35940 >Feature sequence1036 <1593 820 gene locus_tag LOCUS_35950 <1593 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32272:putative teichuronic acid biosynthesis glycosyltransferase TuaC >Feature sequence1037 1089 619 gene locus_tag LOCUS_35960 1089 619 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326945.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence1038 366 752 gene locus_tag LOCUS_35970 366 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 759 1037 gene locus_tag LOCUS_35980 759 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence1039 >Feature sequence1040 409 1431 gene locus_tag LOCUS_35990 409 1431 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence1041 <1 1500 gene locus_tag LOCUS_36000 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter >Feature sequence1042 <1 796 gene locus_tag LOCUS_36010 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762743.1:nucleotidyltransferase 1567 896 gene locus_tag LOCUS_36020 1567 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence1043 133 561 gene locus_tag LOCUS_36030 133 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1043 918 gene locus_tag LOCUS_36040 1043 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1418 1059 gene locus_tag LOCUS_36050 1418 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence1044 >Feature sequence1045 >Feature sequence1046 1 600 gene locus_tag LOCUS_36060 1 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence1047 326 1558 gene locus_tag LOCUS_36070 326 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence1048 235 717 gene locus_tag LOCUS_36080 235 717 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_36080 1332 910 gene locus_tag LOCUS_36090 1332 910 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence1049 396 752 gene locus_tag LOCUS_36100 396 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 818 1432 gene locus_tag LOCUS_36110 818 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence1050 <1 1538 gene locus_tag LOCUS_36120 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q836Q9:6-phosphogluconate dehydrogenase, decarboxylating >Feature sequence1051 788 165 gene locus_tag LOCUS_36130 788 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 <1547 800 gene locus_tag LOCUS_36140 <1547 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113207.1:two-component sensor >Feature sequence1052 >Feature sequence1053 >Feature sequence1054 464 844 gene locus_tag LOCUS_36150 464 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence1055 >Feature sequence1056 <1 842 gene locus_tag LOCUS_36160 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVL5:phosphoglycerate kinase 1103 1306 gene locus_tag LOCUS_36170 1103 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence1057 326 1342 gene locus_tag LOCUS_36180 326 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence1058 <1 1239 gene locus_tag LOCUS_36190 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q813A5:UPF0061 protein >Feature sequence1059 1095 238 gene locus_tag LOCUS_36200 1095 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_36200 >Feature sequence1060 114 1151 gene locus_tag LOCUS_36210 114 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence1061 55 330 gene locus_tag LOCUS_36220 55 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 361 672 gene locus_tag LOCUS_36230 361 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36230 >Feature sequence1062 >Feature sequence1063 226 1089 gene locus_tag LOCUS_36240 226 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1064 760 131 gene locus_tag LOCUS_36250 760 131 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_36250