>Feature sequence01 1842 106 gene locus_tag LOCUS_00010 1842 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3366 2119 gene locus_tag LOCUS_00020 3366 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5108 3651 gene locus_tag LOCUS_00030 5108 3651 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_00030 5812 5114 gene locus_tag LOCUS_00040 gene drrA 5812 5114 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_00040 7116 5923 gene locus_tag LOCUS_00050 7116 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8430 7483 gene locus_tag LOCUS_00060 8430 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9662 8427 gene locus_tag LOCUS_00070 9662 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10616 9993 gene locus_tag LOCUS_00080 10616 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11411 10785 gene locus_tag LOCUS_00090 11411 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13196 11700 gene locus_tag LOCUS_00100 13196 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14577 13612 gene locus_tag LOCUS_00110 14577 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15397 14822 gene locus_tag LOCUS_00120 15397 14822 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_00120 18121 15692 gene locus_tag LOCUS_00130 18121 15692 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_00130 18835 18122 gene locus_tag LOCUS_00140 gene ku 18835 18122 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34859 protein_id gnl|my_center|LOCUS_00140 20778 19351 gene locus_tag LOCUS_00150 20778 19351 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_00150 21550 21323 gene locus_tag LOCUS_00160 21550 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21958 21623 gene locus_tag LOCUS_00170 21958 21623 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_00170 23857 22280 gene locus_tag LOCUS_00180 23857 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_00180 25159 24029 gene locus_tag LOCUS_00190 25159 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_00190 25671 25279 gene locus_tag LOCUS_00200 25671 25279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27077 26274 gene locus_tag LOCUS_00210 27077 26274 CDS product alpha/beta hydrolase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_00210 27905 27081 gene locus_tag LOCUS_00220 27905 27081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28815 27964 gene locus_tag LOCUS_00230 28815 27964 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 protein_id gnl|my_center|LOCUS_00230 29884 28844 gene locus_tag LOCUS_00240 29884 28844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_00240 31720 30215 gene locus_tag LOCUS_00250 31720 30215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_00250 34849 31748 gene locus_tag LOCUS_00260 34849 31748 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_00260 35411 36295 gene locus_tag LOCUS_00270 35411 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 36470 36865 gene locus_tag LOCUS_00280 36470 36865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38216 37374 gene locus_tag LOCUS_00290 38216 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38748 40559 gene locus_tag LOCUS_00300 gene rho 38748 40559 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RC3 protein_id gnl|my_center|LOCUS_00300 40803 42527 gene locus_tag LOCUS_00310 40803 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 42778 44904 gene locus_tag LOCUS_00320 gene recQ 42778 44904 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_00320 46191 45187 gene locus_tag LOCUS_00330 46191 45187 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_00330 47276 46380 gene locus_tag LOCUS_00340 47276 46380 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_00340 47438 48694 gene locus_tag LOCUS_00350 47438 48694 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_00350 48931 50379 gene locus_tag LOCUS_00360 48931 50379 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039243.1 protein_id gnl|my_center|LOCUS_00360 50876 50562 gene locus_tag LOCUS_00370 50876 50562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 51931 50900 gene locus_tag LOCUS_00380 51931 50900 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_00380 52315 53235 gene locus_tag LOCUS_00390 52315 53235 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_00390 53355 54965 gene locus_tag LOCUS_00400 53355 54965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 54965 56077 gene locus_tag LOCUS_00410 54965 56077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 56094 56867 gene locus_tag LOCUS_00420 56094 56867 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00420 56945 57919 gene locus_tag LOCUS_00430 56945 57919 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_00430 58089 59129 gene locus_tag LOCUS_00440 58089 59129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 59238 59996 gene locus_tag LOCUS_00450 59238 59996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 60057 61661 gene locus_tag LOCUS_00460 gene gldM 60057 61661 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_00460 61771 62529 gene locus_tag LOCUS_00470 61771 62529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 64388 62586 gene locus_tag LOCUS_00480 gene uvrC 64388 62586 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_00480 66913 64604 gene locus_tag LOCUS_00490 gene mrcA 66913 64604 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_00490 69513 66922 gene locus_tag LOCUS_00500 gene sprE 69513 66922 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_00500 69663 70532 gene locus_tag LOCUS_00510 69663 70532 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_00510 70535 70954 gene locus_tag LOCUS_00520 70535 70954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_00520 71606 72628 gene locus_tag LOCUS_00530 gene atpB 71606 72628 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_00530 72671 72928 gene locus_tag LOCUS_00540 72671 72928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 73008 73502 gene locus_tag LOCUS_00550 gene atpF 73008 73502 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_00550 73513 74073 gene locus_tag LOCUS_00560 gene atpH 73513 74073 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_00560 74111 75688 gene locus_tag LOCUS_00570 gene atpA 74111 75688 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_00570 75734 76606 gene locus_tag LOCUS_00580 gene atpG 75734 76606 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_00580 77758 76868 gene locus_tag LOCUS_00590 77758 76868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 79008 77887 gene locus_tag LOCUS_00600 79008 77887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 79888 81297 gene locus_tag LOCUS_00610 79888 81297 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_00610 81633 82355 gene locus_tag LOCUS_00620 81633 82355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403954.1 protein_id gnl|my_center|LOCUS_00620 82433 82909 gene locus_tag LOCUS_00630 gene ribH 82433 82909 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_00630 82951 84276 gene locus_tag LOCUS_00640 82951 84276 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_00640 84663 86474 gene locus_tag LOCUS_00650 84663 86474 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_00650 87309 86431 gene locus_tag LOCUS_00660 87309 86431 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_00660 87607 87353 gene locus_tag LOCUS_00670 87607 87353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 87663 87830 gene locus_tag LOCUS_00680 87663 87830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 88005 89534 gene locus_tag LOCUS_00690 gene gpmI 88005 89534 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_00690 89570 90103 gene locus_tag LOCUS_00700 89570 90103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 92009 90501 gene locus_tag LOCUS_00710 92009 90501 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931986.1 protein_id gnl|my_center|LOCUS_00710 93412 92186 gene locus_tag LOCUS_00720 93412 92186 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_00720 94490 93420 gene locus_tag LOCUS_00730 94490 93420 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_00730 94599 95357 gene locus_tag LOCUS_00740 gene coaX 94599 95357 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_00740 95344 96639 gene locus_tag LOCUS_00750 95344 96639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403554.1 protein_id gnl|my_center|LOCUS_00750 96693 97955 gene locus_tag LOCUS_00760 96693 97955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 98457 99008 gene locus_tag LOCUS_00770 98457 99008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 99018 99236 gene locus_tag LOCUS_00780 99018 99236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 99236 100495 gene locus_tag LOCUS_00790 99236 100495 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00790 100590 102704 gene locus_tag LOCUS_00800 100590 102704 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_00800 102801 103067 gene locus_tag LOCUS_00810 102801 103067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 103080 103310 gene locus_tag LOCUS_00820 103080 103310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 103312 103998 gene locus_tag LOCUS_00830 gene rsmI 103312 103998 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_00830 104000 104791 gene locus_tag LOCUS_00840 104000 104791 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_00840 105021 105629 gene locus_tag LOCUS_00850 105021 105629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 105968 108979 gene locus_tag LOCUS_00860 105968 108979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 109908 108985 gene locus_tag LOCUS_00870 109908 108985 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_00870 110354 109983 gene locus_tag LOCUS_00880 110354 109983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 110801 112069 gene locus_tag LOCUS_00890 gene glyA 110801 112069 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_00890 112081 112926 gene locus_tag LOCUS_00900 gene tatC 112081 112926 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_00900 112937 113371 gene locus_tag LOCUS_00910 gene rpiB 112937 113371 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_00910 114714 113395 gene locus_tag LOCUS_00920 114714 113395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 114887 115276 gene locus_tag LOCUS_00930 114887 115276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 115434 116573 gene locus_tag LOCUS_00940 115434 116573 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_00940 116672 119608 gene locus_tag LOCUS_00950 116672 119608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 119657 120511 gene locus_tag LOCUS_00960 gene purU 119657 120511 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_00960 121102 120698 gene locus_tag LOCUS_00970 121102 120698 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257335.1 protein_id gnl|my_center|LOCUS_00970 122337 121183 gene locus_tag LOCUS_00980 gene alr 122337 121183 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_00980 123472 122342 gene locus_tag LOCUS_00990 gene celE 123472 122342 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_00990 124130 123456 gene locus_tag LOCUS_01000 124130 123456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 124315 125271 gene locus_tag LOCUS_01010 124315 125271 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_01010 126427 125279 gene locus_tag LOCUS_01020 126427 125279 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_01020 127840 126452 gene locus_tag LOCUS_01030 127840 126452 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_01030 128069 127890 gene locus_tag LOCUS_01040 128069 127890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 128195 128998 gene locus_tag LOCUS_01050 128195 128998 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_01050 131042 129525 gene locus_tag LOCUS_01060 131042 129525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_01060 131795 131064 gene locus_tag LOCUS_01070 gene lptB 131795 131064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_01070 133498 131798 gene locus_tag LOCUS_01080 133498 131798 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_01080 134204 133608 gene locus_tag LOCUS_01090 134204 133608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 135326 134448 gene locus_tag LOCUS_01100 gene lipA 135326 134448 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_01100 136117 135395 gene locus_tag LOCUS_01110 136117 135395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 136580 137044 gene locus_tag LOCUS_01120 136580 137044 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_01120 137025 138350 gene locus_tag LOCUS_01130 137025 138350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 138423 139331 gene locus_tag LOCUS_01140 138423 139331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 139846 139388 gene locus_tag LOCUS_01150 139846 139388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 140769 139843 gene locus_tag LOCUS_01160 gene yrbG 140769 139843 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_01160 141431 140784 gene locus_tag LOCUS_01170 gene upp 141431 140784 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_01170 142749 141502 gene locus_tag LOCUS_01180 142749 141502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 142951 143868 gene locus_tag LOCUS_01190 142951 143868 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080462.1 protein_id gnl|my_center|LOCUS_01190 143951 144487 gene locus_tag LOCUS_01200 143951 144487 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_01200 144512 145084 gene locus_tag LOCUS_01210 gene adk 144512 145084 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_01210 145203 146192 gene locus_tag LOCUS_01220 gene obg 145203 146192 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_01220 146273 146839 gene locus_tag LOCUS_01230 gene grpE 146273 146839 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_01230 146846 147958 gene locus_tag LOCUS_01240 gene dnaJ 146846 147958 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_01240 148028 148915 gene locus_tag LOCUS_01250 148028 148915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 148983 149885 gene locus_tag LOCUS_01260 gene natA 148983 149885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01260 149875 151185 gene locus_tag LOCUS_01270 gene natB 149875 151185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_01270 151316 152524 gene locus_tag LOCUS_01280 gene porY 151316 152524 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_01280 152541 154052 gene locus_tag LOCUS_01290 gene sacC 152541 154052 CDS product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05656 protein_id gnl|my_center|LOCUS_01290 155738 154098 gene locus_tag LOCUS_01300 gene pruA 155738 154098 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_01300 156561 155887 gene locus_tag LOCUS_01310 156561 155887 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_01310 156972 156589 gene locus_tag LOCUS_01320 156972 156589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 157120 157764 gene locus_tag LOCUS_01330 157120 157764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 157885 159525 gene locus_tag LOCUS_01340 gene pafA 157885 159525 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_01340 160034 160849 gene locus_tag LOCUS_01350 160034 160849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 160834 161733 gene locus_tag LOCUS_01360 160834 161733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 162210 163289 gene locus_tag LOCUS_01370 162210 163289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 163286 164005 gene locus_tag LOCUS_01380 163286 164005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 164657 165595 gene locus_tag LOCUS_01390 164657 165595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202017.1 protein_id gnl|my_center|LOCUS_01390 166338 165961 gene locus_tag LOCUS_01400 166338 165961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_01400 167786 167370 gene locus_tag LOCUS_01410 167786 167370 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_01410 168037 168507 gene locus_tag LOCUS_01420 168037 168507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 168536 169273 gene locus_tag LOCUS_01430 168536 169273 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_01430 169621 172419 gene locus_tag LOCUS_01440 gene acnB 169621 172419 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_01440 172715 173464 gene locus_tag LOCUS_01450 172715 173464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 173745 174482 gene locus_tag LOCUS_01460 173745 174482 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_01460 174514 176412 gene locus_tag LOCUS_01470 174514 176412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 176664 177359 gene locus_tag LOCUS_01480 176664 177359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 177356 178786 gene locus_tag LOCUS_01490 177356 178786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 178805 179533 gene locus_tag LOCUS_01500 178805 179533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 179979 180413 gene locus_tag LOCUS_01510 179979 180413 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313302.1 protein_id gnl|my_center|LOCUS_01510 181885 180488 gene locus_tag LOCUS_01520 gene lpdA1 181885 180488 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_01520 183518 181950 gene locus_tag LOCUS_01530 gene sucB 183518 181950 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_01530 186396 183604 gene locus_tag LOCUS_01540 gene sucA 186396 183604 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01540 187539 186724 gene locus_tag LOCUS_01550 187539 186724 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_01550 188476 187853 gene locus_tag LOCUS_01560 188476 187853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 189770 188628 gene locus_tag LOCUS_01570 189770 188628 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_01570 192749 189834 gene locus_tag LOCUS_01580 192749 189834 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_01580 193051 193467 gene locus_tag LOCUS_01590 193051 193467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 193464 195317 gene locus_tag LOCUS_01600 gene mutL 193464 195317 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_01600 195334 196125 gene locus_tag LOCUS_01610 195334 196125 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_01610 196136 197059 gene locus_tag LOCUS_01620 196136 197059 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_01620 198292 197216 gene locus_tag LOCUS_01630 gene rlmN 198292 197216 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_01630 199846 198404 gene locus_tag LOCUS_01640 199846 198404 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_01640 200085 202700 gene locus_tag LOCUS_01650 gene clpB 200085 202700 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 protein_id gnl|my_center|LOCUS_01650 203282 204793 gene locus_tag LOCUS_01660 203282 204793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 206312 204858 gene locus_tag LOCUS_01670 206312 204858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 206891 206418 gene locus_tag LOCUS_01680 206891 206418 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_01680 207826 207236 gene locus_tag LOCUS_01690 207826 207236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 208449 207961 gene locus_tag LOCUS_01700 208449 207961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 209408 208455 gene locus_tag LOCUS_01710 gene ltd 209408 208455 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_01710 209551 210747 gene locus_tag LOCUS_01720 gene kbl 209551 210747 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_01720 211619 210753 gene locus_tag LOCUS_01730 211619 210753 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_01730 212500 211616 gene locus_tag LOCUS_01740 gene folP 212500 211616 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_01740 212515 213063 gene locus_tag LOCUS_01750 212515 213063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_01750 213053 214159 gene locus_tag LOCUS_01760 213053 214159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_01760 214159 214692 gene locus_tag LOCUS_01770 gene aroK 214159 214692 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 protein_id gnl|my_center|LOCUS_01770 216141 214675 gene locus_tag LOCUS_01780 216141 214675 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_01780 217811 216420 gene locus_tag LOCUS_01790 217811 216420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 217944 219425 gene locus_tag LOCUS_01800 gene proS 217944 219425 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_01800 220069 220530 gene locus_tag LOCUS_01810 220069 220530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 220534 221547 gene locus_tag LOCUS_01820 220534 221547 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_01820 223142 221559 gene locus_tag LOCUS_01830 223142 221559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 224532 223255 gene locus_tag LOCUS_01840 gene hemA 224532 223255 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_01840 224716 225429 gene locus_tag LOCUS_01850 224716 225429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 225484 225957 gene locus_tag LOCUS_01860 225484 225957 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_01860 226058 226771 gene locus_tag LOCUS_01870 226058 226771 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_01870 227441 226809 gene locus_tag LOCUS_01880 227441 226809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 228308 227592 gene locus_tag LOCUS_01890 228308 227592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 230052 228313 gene locus_tag LOCUS_01900 230052 228313 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_01900 230846 230157 gene locus_tag LOCUS_01910 230846 230157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 230940 231617 gene locus_tag LOCUS_01920 230940 231617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_01920 231610 234129 gene locus_tag LOCUS_01930 231610 234129 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_01930 234213 234662 gene locus_tag LOCUS_01940 234213 234662 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_01940 234941 235648 gene locus_tag LOCUS_01950 234941 235648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 235981 235655 gene locus_tag LOCUS_01960 235981 235655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 236161 236844 gene locus_tag LOCUS_01970 236161 236844 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_01970 237656 236841 gene locus_tag LOCUS_01980 237656 236841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 protein_id gnl|my_center|LOCUS_01980 239024 237687 gene locus_tag LOCUS_01990 gene hemN 239024 237687 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_01990 240270 239149 gene locus_tag LOCUS_02000 240270 239149 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7H0 protein_id gnl|my_center|LOCUS_02000 240624 243044 gene locus_tag LOCUS_02010 240624 243044 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_02010 243818 243144 gene locus_tag LOCUS_02020 243818 243144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 243896 244891 gene locus_tag LOCUS_02030 243896 244891 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_02030 246233 245076 gene locus_tag LOCUS_02040 246233 245076 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_02040 247001 247603 gene locus_tag LOCUS_02050 247001 247603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_02050 249164 247857 gene locus_tag LOCUS_02060 gene murA 249164 247857 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_02060 249838 249164 gene locus_tag LOCUS_02070 249838 249164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 252179 249933 gene locus_tag LOCUS_02080 gene uvrD 252179 249933 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_02080 253295 252438 gene locus_tag LOCUS_02090 253295 252438 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_02090 253410 254000 gene locus_tag LOCUS_02100 253410 254000 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_02100 254024 254296 gene locus_tag LOCUS_02110 254024 254296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 254302 254874 gene locus_tag LOCUS_02120 gene gmk 254302 254874 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_02120 254880 255446 gene locus_tag LOCUS_02130 gene nadD 254880 255446 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_02130 257003 255648 gene locus_tag LOCUS_02140 257003 255648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 258334 257039 gene locus_tag LOCUS_02150 258334 257039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 261734 258402 gene locus_tag LOCUS_02160 261734 258402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 262286 263566 gene locus_tag LOCUS_02170 262286 263566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 263596 267918 gene locus_tag LOCUS_02180 263596 267918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_02180 270005 268143 gene locus_tag LOCUS_02190 270005 268143 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108583.1 protein_id gnl|my_center|LOCUS_02190 273199 270023 gene locus_tag LOCUS_02200 273199 270023 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_02200 274459 273899 gene locus_tag LOCUS_02210 gene frr 274459 273899 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_02210 275178 274468 gene locus_tag LOCUS_02220 gene pyrH 275178 274468 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_02220 275850 278411 gene locus_tag LOCUS_02230 275850 278411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 278570 278653 gene locus_tag LOCUS_t00010 278570 278653 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 278800 278873 gene locus_tag LOCUS_t00020 278800 278873 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 278907 278979 gene locus_tag LOCUS_t00030 278907 278979 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 279038 280225 gene locus_tag LOCUS_02240 gene tuf 279038 280225 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_02240 280340 280411 gene locus_tag LOCUS_t00040 280340 280411 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 280538 280726 gene locus_tag LOCUS_02250 280538 280726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 280744 281301 gene locus_tag LOCUS_02260 gene nusG 280744 281301 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_02260 281305 281748 gene locus_tag LOCUS_02270 gene rplK 281305 281748 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_02270 281759 282457 gene locus_tag LOCUS_02280 gene rplA 281759 282457 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_02280 282461 283003 gene locus_tag LOCUS_02290 282461 283003 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_02290 283053 283433 gene locus_tag LOCUS_02300 gene rplL 283053 283433 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_02300 283591 287466 gene locus_tag LOCUS_02310 gene rpoB 283591 287466 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_02310 287515 291825 gene locus_tag LOCUS_02320 gene rpoC 287515 291825 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_02320 291894 292223 gene locus_tag LOCUS_02330 291894 292223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_02330 292377 292760 gene locus_tag LOCUS_02340 gene rpsL 292377 292760 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_02340 292783 293250 gene locus_tag LOCUS_02350 gene rpsG 292783 293250 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_02350 293257 295404 gene locus_tag LOCUS_02360 gene fusA 293257 295404 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_02360 295416 295721 gene locus_tag LOCUS_02370 gene rpsJ 295416 295721 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_02370 295969 296601 gene locus_tag LOCUS_02380 gene rplC 295969 296601 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_02380 296606 297235 gene locus_tag LOCUS_02390 gene rplD 296606 297235 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_02390 297240 297527 gene locus_tag LOCUS_02400 gene rplW 297240 297527 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_02400 297541 298365 gene locus_tag LOCUS_02410 gene rplB 297541 298365 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_02410 298368 298646 gene locus_tag LOCUS_02420 gene rpsS 298368 298646 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_02420 298649 299038 gene locus_tag LOCUS_02430 gene rplV 298649 299038 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_02430 299042 299779 gene locus_tag LOCUS_02440 gene rpsC 299042 299779 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_02440 299800 300222 gene locus_tag LOCUS_02450 gene rplP 299800 300222 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_02450 300227 300421 gene locus_tag LOCUS_02460 gene rpmC 300227 300421 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A484 protein_id gnl|my_center|LOCUS_02460 300430 300693 gene locus_tag LOCUS_02470 gene rpsQ 300430 300693 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_02470 300697 301065 gene locus_tag LOCUS_02480 gene rplN 300697 301065 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_02480 301068 301412 gene locus_tag LOCUS_02490 gene rplX 301068 301412 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_02490 301405 301965 gene locus_tag LOCUS_02500 gene rplE 301405 301965 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_02500 301968 302237 gene locus_tag LOCUS_02510 gene rpsN 301968 302237 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_02510 302321 302716 gene locus_tag LOCUS_02520 gene rpsH 302321 302716 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_02520 302726 303283 gene locus_tag LOCUS_02530 gene rplF 302726 303283 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_02530 303291 303641 gene locus_tag LOCUS_02540 gene rplR 303291 303641 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSX0 protein_id gnl|my_center|LOCUS_02540 303647 304165 gene locus_tag LOCUS_02550 gene rpsE 303647 304165 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_02550 304170 304349 gene locus_tag LOCUS_02560 gene rpmD 304170 304349 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CK82 protein_id gnl|my_center|LOCUS_02560 304406 304852 gene locus_tag LOCUS_02570 gene rplO 304406 304852 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_02570 304856 306172 gene locus_tag LOCUS_02580 gene secY 304856 306172 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_02580 306175 306948 gene locus_tag LOCUS_02590 gene map 306175 306948 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_02590 306951 307169 gene locus_tag LOCUS_02600 gene infA 306951 307169 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_02600 307331 307708 gene locus_tag LOCUS_02610 gene rpsM 307331 307708 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_02610 307724 308122 gene locus_tag LOCUS_02620 gene rpsK 307724 308122 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_02620 308140 308745 gene locus_tag LOCUS_02630 gene rpsD 308140 308745 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_02630 308778 309767 gene locus_tag LOCUS_02640 gene rpoA 308778 309767 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A2 protein_id gnl|my_center|LOCUS_02640 309774 310346 gene locus_tag LOCUS_02650 gene rplQ 309774 310346 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN6 protein_id gnl|my_center|LOCUS_02650 310479 311570 gene locus_tag LOCUS_02660 gene carA 310479 311570 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_02660 311592 312869 gene locus_tag LOCUS_02670 gene eno2 311592 312869 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_02670 313119 313406 gene locus_tag LOCUS_02680 313119 313406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 313387 313956 gene locus_tag LOCUS_02690 313387 313956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 313972 314808 gene locus_tag LOCUS_02700 313972 314808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 314820 315698 gene locus_tag LOCUS_02710 gene cysM 314820 315698 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_02710 315838 317112 gene locus_tag LOCUS_02720 315838 317112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 318514 317180 gene locus_tag LOCUS_02730 318514 317180 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_02730 318817 319848 gene locus_tag LOCUS_02740 318817 319848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 319965 320339 gene locus_tag LOCUS_02750 319965 320339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 321332 320364 gene locus_tag LOCUS_02760 321332 320364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 321487 321969 gene locus_tag LOCUS_02770 321487 321969 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_02770 323799 322078 gene locus_tag LOCUS_02780 gene lysS 323799 322078 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_02780 325003 323813 gene locus_tag LOCUS_02790 gene putA 325003 323813 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_02790 325221 326285 gene locus_tag LOCUS_02800 325221 326285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 326282 327640 gene locus_tag LOCUS_02810 326282 327640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 328055 329161 gene locus_tag LOCUS_02820 328055 329161 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_02820 329487 330437 gene locus_tag LOCUS_02830 gene aroB 329487 330437 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_02830 330496 331728 gene locus_tag LOCUS_02840 gene aroA 330496 331728 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_02840 331839 332654 gene locus_tag LOCUS_02850 gene pheA 331839 332654 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_02850 332654 333814 gene locus_tag LOCUS_02860 gene aspC3 332654 333814 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_02860 333811 334659 gene locus_tag LOCUS_02870 gene tyrA 333811 334659 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_02870 334717 335931 gene locus_tag LOCUS_02880 gene arcA1 334717 335931 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXW2 protein_id gnl|my_center|LOCUS_02880 338683 335951 gene locus_tag LOCUS_02890 338683 335951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403549.1 protein_id gnl|my_center|LOCUS_02890 338783 339583 gene locus_tag LOCUS_02900 338783 339583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 339697 340545 gene locus_tag LOCUS_02910 339697 340545 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_02910 341042 340548 gene locus_tag LOCUS_02920 341042 340548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 341787 341158 gene locus_tag LOCUS_02930 341787 341158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 341830 342744 gene locus_tag LOCUS_02940 341830 342744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 342780 343622 gene locus_tag LOCUS_02950 342780 343622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 343622 343987 gene locus_tag LOCUS_02960 gene folB 343622 343987 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28823 protein_id gnl|my_center|LOCUS_02960 344001 344462 gene locus_tag LOCUS_02970 344001 344462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 344817 344500 gene locus_tag LOCUS_02980 344817 344500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 344930 345451 gene locus_tag LOCUS_02990 344930 345451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 345478 345894 gene locus_tag LOCUS_03000 345478 345894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933873.1 protein_id gnl|my_center|LOCUS_03000 345891 346613 gene locus_tag LOCUS_03010 345891 346613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 346610 347062 gene locus_tag LOCUS_03020 gene dtd 346610 347062 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_03020 347102 348643 gene locus_tag LOCUS_03030 347102 348643 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_03030 348649 348975 gene locus_tag LOCUS_03040 348649 348975 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_03040 349810 349016 gene locus_tag LOCUS_03050 349810 349016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 350006 351928 gene locus_tag LOCUS_03060 gene dnaK 350006 351928 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_03060 352192 352566 gene locus_tag LOCUS_03070 gene groES-2 352192 352566 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_03070 352916 355519 gene locus_tag LOCUS_03080 352916 355519 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581323.1 protein_id gnl|my_center|LOCUS_03080 356779 355610 gene locus_tag LOCUS_03090 356779 355610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 358182 356884 gene locus_tag LOCUS_03100 gene amt-2 358182 356884 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_03100 359647 358679 gene locus_tag LOCUS_03110 gene hemB 359647 358679 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_03110 360374 359718 gene locus_tag LOCUS_03120 360374 359718 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_03120 361660 360371 gene locus_tag LOCUS_03130 gene rocD 361660 360371 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_03130 361884 362126 gene locus_tag LOCUS_03140 gene rpmB 361884 362126 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_03140 362161 362343 gene locus_tag LOCUS_03150 gene rpmG 362161 362343 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_03150 362375 362527 gene locus_tag LOCUS_03160 362375 362527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 362617 363573 gene locus_tag LOCUS_03170 gene ftsY 362617 363573 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_03170 363821 367321 gene locus_tag LOCUS_03180 363821 367321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 367477 368367 gene locus_tag LOCUS_03190 367477 368367 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_03190 368791 369678 gene locus_tag LOCUS_03200 368791 369678 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_03200 370807 369788 gene locus_tag LOCUS_03210 370807 369788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 373359 370870 gene locus_tag LOCUS_03220 373359 370870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 373726 375075 gene locus_tag LOCUS_03230 373726 375075 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_03230 376705 375149 gene locus_tag LOCUS_03240 376705 375149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 377567 376698 gene locus_tag LOCUS_03250 377567 376698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 377876 378157 gene locus_tag LOCUS_03260 377876 378157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_108210.2 protein_id gnl|my_center|LOCUS_03260 378361 379269 gene locus_tag LOCUS_03270 378361 379269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 379684 380652 gene locus_tag LOCUS_03280 379684 380652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 380842 382356 gene locus_tag LOCUS_03290 380842 382356 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_03290 382409 384058 gene locus_tag LOCUS_03300 382409 384058 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_03300 384125 385138 gene locus_tag LOCUS_03310 384125 385138 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_03310 385398 386387 gene locus_tag LOCUS_03320 385398 386387 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210584.1 protein_id gnl|my_center|LOCUS_03320 387273 386473 gene locus_tag LOCUS_03330 387273 386473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_03330 388190 387276 gene locus_tag LOCUS_03340 gene rnz 388190 387276 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 protein_id gnl|my_center|LOCUS_03340 388584 388204 gene locus_tag LOCUS_03350 388584 388204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 389639 388704 gene locus_tag LOCUS_03360 gene purC 389639 388704 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_03360 390567 389770 gene locus_tag LOCUS_03370 390567 389770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 391788 390589 gene locus_tag LOCUS_03380 391788 390589 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_03380 392454 391804 gene locus_tag LOCUS_03390 392454 391804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 393091 392438 gene locus_tag LOCUS_03400 393091 392438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 393942 393115 gene locus_tag LOCUS_03410 gene batB 393942 393115 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_03410 394524 396938 gene locus_tag LOCUS_03420 394524 396938 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_03420 396942 397625 gene locus_tag LOCUS_03430 396942 397625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence02 387 1283 gene locus_tag LOCUS_03440 387 1283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_03440 1437 2819 gene locus_tag LOCUS_03450 1437 2819 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_03450 2816 3646 gene locus_tag LOCUS_03460 2816 3646 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_03460 3659 4801 gene locus_tag LOCUS_03470 3659 4801 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067533.1 protein_id gnl|my_center|LOCUS_03470 4812 5582 gene locus_tag LOCUS_03480 4812 5582 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_03480 5696 5923 gene locus_tag LOCUS_03490 5696 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 5920 7341 gene locus_tag LOCUS_03500 5920 7341 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208498.1 protein_id gnl|my_center|LOCUS_03500 9027 7675 gene locus_tag LOCUS_03510 9027 7675 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_03510 10277 9273 gene locus_tag LOCUS_03520 gene socC 10277 9273 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_03520 10818 11204 gene locus_tag LOCUS_03530 10818 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12097 11219 gene locus_tag LOCUS_03540 12097 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_03540 12639 12094 gene locus_tag LOCUS_03550 12639 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13020 12646 gene locus_tag LOCUS_03560 13020 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 14277 13108 gene locus_tag LOCUS_03570 14277 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14833 14270 gene locus_tag LOCUS_03580 14833 14270 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03580 15335 15574 gene locus_tag LOCUS_03590 15335 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 15744 18548 gene locus_tag LOCUS_03600 15744 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 18545 20032 gene locus_tag LOCUS_03610 18545 20032 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_03610 20137 21489 gene locus_tag LOCUS_03620 20137 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 22682 21714 gene locus_tag LOCUS_03630 22682 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 24116 22974 gene locus_tag LOCUS_03640 24116 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 27236 24276 gene locus_tag LOCUS_03650 27236 24276 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_03650 27979 27347 gene locus_tag LOCUS_03660 27979 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 28481 30325 gene locus_tag LOCUS_03670 28481 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 30743 31381 gene locus_tag LOCUS_03680 30743 31381 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_03680 31401 31988 gene locus_tag LOCUS_03690 31401 31988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_03690 32184 32747 gene locus_tag LOCUS_03700 32184 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 32945 33310 gene locus_tag LOCUS_03710 32945 33310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_03710 34967 33447 gene locus_tag LOCUS_03720 34967 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_03720 38140 34979 gene locus_tag LOCUS_03730 38140 34979 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403145.1 protein_id gnl|my_center|LOCUS_03730 38780 39517 gene locus_tag LOCUS_03740 38780 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 39666 40493 gene locus_tag LOCUS_03750 39666 40493 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109398.1 protein_id gnl|my_center|LOCUS_03750 41505 40732 gene locus_tag LOCUS_03760 41505 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 42525 41683 gene locus_tag LOCUS_03770 gene phuW 42525 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_03770 42745 43197 gene locus_tag LOCUS_03780 42745 43197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 43321 44163 gene locus_tag LOCUS_03790 43321 44163 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_03790 46380 44554 gene locus_tag LOCUS_03800 46380 44554 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_03800 49506 46402 gene locus_tag LOCUS_03810 49506 46402 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_03810 50129 50758 gene locus_tag LOCUS_03820 50129 50758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 50822 53275 gene locus_tag LOCUS_03830 gene ccoI 50822 53275 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_03830 53266 53448 gene locus_tag LOCUS_03840 53266 53448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 53450 55582 gene locus_tag LOCUS_03850 gene ccoN/ccoO 53450 55582 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_03850 55594 55785 gene locus_tag LOCUS_03860 55594 55785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 55772 56698 gene locus_tag LOCUS_03870 55772 56698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 56760 58175 gene locus_tag LOCUS_03880 gene ccoG 56760 58175 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_03880 58198 58623 gene locus_tag LOCUS_03890 58198 58623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 58624 59337 gene locus_tag LOCUS_03900 58624 59337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_03900 59674 60735 gene locus_tag LOCUS_03910 59674 60735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 61003 61587 gene locus_tag LOCUS_03920 61003 61587 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_03920 61701 63032 gene locus_tag LOCUS_03930 61701 63032 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_03930 63840 63058 gene locus_tag LOCUS_03940 63840 63058 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_03940 64942 63851 gene locus_tag LOCUS_03950 64942 63851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 67522 64949 gene locus_tag LOCUS_03960 67522 64949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 68518 71712 gene locus_tag LOCUS_03970 68518 71712 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_03970 71740 73515 gene locus_tag LOCUS_03980 71740 73515 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_03980 73867 74289 gene locus_tag LOCUS_03990 73867 74289 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_03990 74881 75966 gene locus_tag LOCUS_04000 74881 75966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 76050 76862 gene locus_tag LOCUS_04010 76050 76862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 76865 79312 gene locus_tag LOCUS_04020 gene wzc 76865 79312 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_04020 79501 80547 gene locus_tag LOCUS_04030 gene rmlB 79501 80547 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_04030 80560 81354 gene locus_tag LOCUS_04040 gene thyA 80560 81354 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_04040 82183 81386 gene locus_tag LOCUS_04050 82183 81386 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_04050 82422 83762 gene locus_tag LOCUS_04060 82422 83762 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_04060 83775 85082 gene locus_tag LOCUS_04070 83775 85082 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_04070 86338 85163 gene locus_tag LOCUS_04080 gene metZ 86338 85163 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_04080 87444 86794 gene locus_tag LOCUS_04090 87444 86794 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974692.1 protein_id gnl|my_center|LOCUS_04090 87864 88829 gene locus_tag LOCUS_04100 87864 88829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_04100 88993 90426 gene locus_tag LOCUS_04110 88993 90426 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_04110 92105 90456 gene locus_tag LOCUS_04120 92105 90456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 93255 92098 gene locus_tag LOCUS_04130 93255 92098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 95969 93255 gene locus_tag LOCUS_04140 95969 93255 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_04140 96715 96014 gene locus_tag LOCUS_04150 96715 96014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 97187 98518 gene locus_tag LOCUS_04160 97187 98518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 99337 98594 gene locus_tag LOCUS_04170 99337 98594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_04170 100719 99496 gene locus_tag LOCUS_04180 gene queA 100719 99496 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_04180 100924 102027 gene locus_tag LOCUS_04190 gene menC 100924 102027 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_04190 102072 103478 gene locus_tag LOCUS_04200 102072 103478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_04200 103492 104649 gene locus_tag LOCUS_04210 103492 104649 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_04210 104763 106490 gene locus_tag LOCUS_04220 104763 106490 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_04220 107860 106577 gene locus_tag LOCUS_04230 107860 106577 CDS product cephalosporin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108337.1 protein_id gnl|my_center|LOCUS_04230 108370 108828 gene locus_tag LOCUS_04240 108370 108828 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_04240 109606 109091 gene locus_tag LOCUS_04250 gene yorS 109606 109091 CDS product 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68522 protein_id gnl|my_center|LOCUS_04250 110202 109603 gene locus_tag LOCUS_04260 110202 109603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 111598 110417 gene locus_tag LOCUS_04270 gene argD 111598 110417 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_04270 111865 112626 gene locus_tag LOCUS_04280 111865 112626 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_04280 112655 113998 gene locus_tag LOCUS_04290 112655 113998 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_04290 114526 114083 gene locus_tag LOCUS_04300 114526 114083 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_04300 114684 115505 gene locus_tag LOCUS_04310 114684 115505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_04310 115569 117050 gene locus_tag LOCUS_04320 115569 117050 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_04320 117040 117672 gene locus_tag LOCUS_04330 gene pncA 117040 117672 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 protein_id gnl|my_center|LOCUS_04330 118396 117848 gene locus_tag LOCUS_04340 gene ftnA 118396 117848 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_04340 120442 118562 gene locus_tag LOCUS_04350 gene gaa 120442 118562 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_04350 120617 121351 gene locus_tag LOCUS_04360 gene kdsB 120617 121351 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_04360 122090 121380 gene locus_tag LOCUS_04370 122090 121380 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_04370 122200 122661 gene locus_tag LOCUS_04380 122200 122661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 123990 122830 gene locus_tag LOCUS_04390 gene nagX 123990 122830 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_04390 124521 125273 gene locus_tag LOCUS_04400 gene nagB 124521 125273 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_04400 126032 125436 gene locus_tag LOCUS_04410 126032 125436 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_04410 127501 126038 gene locus_tag LOCUS_04420 127501 126038 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_04420 130405 127514 gene locus_tag LOCUS_04430 130405 127514 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_04430 131128 130787 gene locus_tag LOCUS_04440 gene gldC 131128 130787 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_04440 131854 131186 gene locus_tag LOCUS_04450 gene liuG 131854 131186 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_04450 132562 131867 gene locus_tag LOCUS_04460 gene atoD 132562 131867 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_04460 133505 132552 gene locus_tag LOCUS_04470 gene ribF 133505 132552 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_04470 134181 133492 gene locus_tag LOCUS_04480 gene truB 134181 133492 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_04480 134975 134181 gene locus_tag LOCUS_04490 gene uppP 134975 134181 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_04490 135184 134981 gene locus_tag LOCUS_04500 135184 134981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 136079 135189 gene locus_tag LOCUS_04510 136079 135189 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_04510 136808 136122 gene locus_tag LOCUS_04520 136808 136122 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_04520 137014 137667 gene locus_tag LOCUS_04530 137014 137667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 141377 137664 gene locus_tag LOCUS_04540 141377 137664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 143021 141507 gene locus_tag LOCUS_04550 143021 141507 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_04550 143365 144204 gene locus_tag LOCUS_04560 143365 144204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 144815 144279 gene locus_tag LOCUS_04570 144815 144279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 145376 144999 gene locus_tag LOCUS_04580 145376 144999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 146253 145795 gene locus_tag LOCUS_04590 146253 145795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 146983 146402 gene locus_tag LOCUS_04600 146983 146402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 147852 147037 gene locus_tag LOCUS_04610 147852 147037 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_04610 148488 147949 gene locus_tag LOCUS_04620 148488 147949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_04620 149405 148809 gene locus_tag LOCUS_04630 149405 148809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_04630 150964 149567 gene locus_tag LOCUS_04640 150964 149567 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_04640 152601 150961 gene locus_tag LOCUS_04650 152601 150961 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_04650 153652 152687 gene locus_tag LOCUS_04660 153652 152687 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_04660 155019 153670 gene locus_tag LOCUS_04670 gene cht1 155019 153670 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_04670 156669 155191 gene locus_tag LOCUS_04680 gene gbsA 156669 155191 CDS product betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71016 protein_id gnl|my_center|LOCUS_04680 158335 156656 gene locus_tag LOCUS_04690 gene betA 158335 156656 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_04690 159555 158428 gene locus_tag LOCUS_04700 159555 158428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_04700 162083 159639 gene locus_tag LOCUS_04710 gene helX 162083 159639 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118436.1 protein_id gnl|my_center|LOCUS_04710 162851 162510 gene locus_tag LOCUS_04720 gene phnA 162851 162510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061583.1 protein_id gnl|my_center|LOCUS_04720 164264 163158 gene locus_tag LOCUS_04730 164264 163158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_04730 165449 164448 gene locus_tag LOCUS_04740 165449 164448 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_04740 165753 167081 gene locus_tag LOCUS_04750 165753 167081 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_04750 167383 167904 gene locus_tag LOCUS_04760 167383 167904 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_04760 168043 168990 gene locus_tag LOCUS_04770 168043 168990 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_04770 169185 172568 gene locus_tag LOCUS_04780 169185 172568 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_04780 172651 174093 gene locus_tag LOCUS_04790 172651 174093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_04790 174192 175457 gene locus_tag LOCUS_04800 gene GALNS 174192 175457 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_04800 175643 176017 gene locus_tag LOCUS_04810 175643 176017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 176302 176051 gene locus_tag LOCUS_04820 176302 176051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 177867 176305 gene locus_tag LOCUS_04830 177867 176305 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_04830 178493 179815 gene locus_tag LOCUS_04840 178493 179815 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_04840 180351 179947 gene locus_tag LOCUS_04850 180351 179947 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_04850 181549 180344 gene locus_tag LOCUS_04860 181549 180344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 181818 182066 gene locus_tag LOCUS_04870 181818 182066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 182121 182327 gene locus_tag LOCUS_04880 182121 182327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 184541 183072 gene locus_tag LOCUS_04890 184541 183072 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_04890 185967 184855 gene locus_tag LOCUS_04900 185967 184855 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_04900 186869 186009 gene locus_tag LOCUS_04910 186869 186009 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_04910 190382 186891 gene locus_tag LOCUS_04920 190382 186891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 190535 191410 gene locus_tag LOCUS_04930 gene mtlR 190535 191410 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_04930 191895 191494 gene locus_tag LOCUS_04940 191895 191494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_04940 193138 192161 gene locus_tag LOCUS_04950 193138 192161 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_04950 194809 193856 gene locus_tag LOCUS_04960 194809 193856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 197158 194903 gene locus_tag LOCUS_04970 197158 194903 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107767.1 protein_id gnl|my_center|LOCUS_04970 197590 197378 gene locus_tag LOCUS_04980 197590 197378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_04980 198034 197603 gene locus_tag LOCUS_04990 198034 197603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_04990 198338 199621 gene locus_tag LOCUS_05000 198338 199621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_05000 201291 199963 gene locus_tag LOCUS_05010 gene argH 201291 199963 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_05010 202373 201288 gene locus_tag LOCUS_05020 202373 201288 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_05020 203201 202416 gene locus_tag LOCUS_05030 gene argB 203201 202416 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_05030 204155 203214 gene locus_tag LOCUS_05040 204155 203214 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_05040 205309 204164 gene locus_tag LOCUS_05050 gene argD 205309 204164 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_05050 206323 205361 gene locus_tag LOCUS_05060 gene argC 206323 205361 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_05060 207521 206316 gene locus_tag LOCUS_05070 207521 206316 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_05070 208290 207571 gene locus_tag LOCUS_05080 208290 207571 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_05080 208841 210040 gene locus_tag LOCUS_05090 208841 210040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 210058 212052 gene locus_tag LOCUS_05100 210058 212052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 212046 213203 gene locus_tag LOCUS_05110 212046 213203 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYG9 protein_id gnl|my_center|LOCUS_05110 214832 213225 gene locus_tag LOCUS_05120 214832 213225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 215546 214833 gene locus_tag LOCUS_05130 215546 214833 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107316.1 protein_id gnl|my_center|LOCUS_05130 216139 215747 gene locus_tag LOCUS_05140 216139 215747 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968539.1 protein_id gnl|my_center|LOCUS_05140 217212 216157 gene locus_tag LOCUS_05150 gene metX 217212 216157 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK89 protein_id gnl|my_center|LOCUS_05150 218527 217223 gene locus_tag LOCUS_05160 gene MET17 218527 217223 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 protein_id gnl|my_center|LOCUS_05160 219313 220965 gene locus_tag LOCUS_05170 219313 220965 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_05170 220988 222136 gene locus_tag LOCUS_05180 gene iscS 220988 222136 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_05180 222153 222638 gene locus_tag LOCUS_05190 gene moaC 222153 222638 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_05190 222622 223800 gene locus_tag LOCUS_05200 222622 223800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 223859 225049 gene locus_tag LOCUS_05210 gene rlmL 223859 225049 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_05210 227395 225290 gene locus_tag LOCUS_05220 227395 225290 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_05220 228563 227403 gene locus_tag LOCUS_05230 228563 227403 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_05230 229926 228637 gene locus_tag LOCUS_05240 229926 228637 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_05240 231348 229978 gene locus_tag LOCUS_05250 231348 229978 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_05250 232945 231341 gene locus_tag LOCUS_05260 232945 231341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 233167 233301 gene locus_tag LOCUS_05270 233167 233301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 233294 233839 gene locus_tag LOCUS_05280 233294 233839 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_05280 233877 234935 gene locus_tag LOCUS_05290 233877 234935 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930114.1 protein_id gnl|my_center|LOCUS_05290 234937 235203 gene locus_tag LOCUS_05300 234937 235203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 235351 237021 gene locus_tag LOCUS_05310 235351 237021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_05310 237725 237018 gene locus_tag LOCUS_05320 237725 237018 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_05320 239050 237863 gene locus_tag LOCUS_05330 239050 237863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_05330 239462 239998 gene locus_tag LOCUS_05340 239462 239998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 239995 240201 gene locus_tag LOCUS_05350 239995 240201 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_05350 241431 240523 gene locus_tag LOCUS_05360 241431 240523 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_05360 241945 242325 gene locus_tag LOCUS_05370 241945 242325 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_05370 242367 242795 gene locus_tag LOCUS_05380 gene phnB 242367 242795 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_05380 242934 243308 gene locus_tag LOCUS_05390 242934 243308 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_05390 243695 244564 gene locus_tag LOCUS_05400 243695 244564 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59745 protein_id gnl|my_center|LOCUS_05400 244980 245483 gene locus_tag LOCUS_05410 244980 245483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 245731 246054 gene locus_tag LOCUS_05420 245731 246054 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_05420 247969 246092 gene locus_tag LOCUS_05430 gene kefB 247969 246092 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_05430 248558 247974 gene locus_tag LOCUS_05440 248558 247974 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704323.1 protein_id gnl|my_center|LOCUS_05440 249226 249924 gene locus_tag LOCUS_05450 249226 249924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 250205 250912 gene locus_tag LOCUS_05460 gene menH 250205 250912 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6L0 protein_id gnl|my_center|LOCUS_05460 252436 251099 gene locus_tag LOCUS_05470 252436 251099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 253742 252582 gene locus_tag LOCUS_05480 253742 252582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 255198 253909 gene locus_tag LOCUS_05490 255198 253909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 256958 255396 gene locus_tag LOCUS_05500 256958 255396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 259695 257449 gene locus_tag LOCUS_05510 259695 257449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 261376 259763 gene locus_tag LOCUS_05520 261376 259763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 264709 261383 gene locus_tag LOCUS_05530 264709 261383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 265798 264734 gene locus_tag LOCUS_05540 265798 264734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705900.1 protein_id gnl|my_center|LOCUS_05540 269408 265830 gene locus_tag LOCUS_05550 269408 265830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 269828 269412 gene locus_tag LOCUS_05560 269828 269412 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_05560 270108 269821 gene locus_tag LOCUS_05570 270108 269821 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_05570 271868 270120 gene locus_tag LOCUS_05580 271868 270120 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_05580 272617 271868 gene locus_tag LOCUS_05590 272617 271868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 272782 272618 gene locus_tag LOCUS_05600 272782 272618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 273302 272793 gene locus_tag LOCUS_05610 273302 272793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 273738 273304 gene locus_tag LOCUS_05620 273738 273304 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_05620 275220 273778 gene locus_tag LOCUS_05630 275220 273778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 275978 275250 gene locus_tag LOCUS_05640 275978 275250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 276542 275994 gene locus_tag LOCUS_05650 276542 275994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 278827 276605 gene locus_tag LOCUS_05660 278827 276605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 279860 280642 gene locus_tag LOCUS_05670 279860 280642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339594.1 protein_id gnl|my_center|LOCUS_05670 280978 281322 gene locus_tag LOCUS_05680 280978 281322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_05680 281334 282689 gene locus_tag LOCUS_05690 281334 282689 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_05690 282715 283956 gene locus_tag LOCUS_05700 282715 283956 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_05700 285757 284015 gene locus_tag LOCUS_05710 285757 284015 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_05710 286055 286522 gene locus_tag LOCUS_05720 286055 286522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_05720 286714 287130 gene locus_tag LOCUS_05730 286714 287130 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_05730 288276 287236 gene locus_tag LOCUS_05740 gene ilvE 288276 287236 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_05740 288548 289948 gene locus_tag LOCUS_05750 288548 289948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_05750 292436 289977 gene locus_tag LOCUS_05760 292436 289977 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405046.1 protein_id gnl|my_center|LOCUS_05760 293335 292514 gene locus_tag LOCUS_05770 gene hpaA 293335 292514 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 protein_id gnl|my_center|LOCUS_05770 293824 294363 gene locus_tag LOCUS_05780 293824 294363 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_05780 294550 295512 gene locus_tag LOCUS_05790 294550 295512 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_05790 295632 298841 gene locus_tag LOCUS_05800 295632 298841 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_05800 298860 300473 gene locus_tag LOCUS_05810 298860 300473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_05810 304555 300617 gene locus_tag LOCUS_05820 304555 300617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 305078 308221 gene locus_tag LOCUS_05830 305078 308221 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_05830 308227 309768 gene locus_tag LOCUS_05840 308227 309768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203129.1 protein_id gnl|my_center|LOCUS_05840 309963 313229 gene locus_tag LOCUS_05850 309963 313229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_05850 313402 314727 gene locus_tag LOCUS_05860 313402 314727 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_05860 314785 316062 gene locus_tag LOCUS_05870 314785 316062 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_05870 316445 317446 gene locus_tag LOCUS_05880 316445 317446 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_05880 317462 318493 gene locus_tag LOCUS_05890 317462 318493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_05890 319001 326659 gene locus_tag LOCUS_05900 319001 326659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 328370 326901 gene locus_tag LOCUS_05910 328370 326901 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_05910 328710 328549 gene locus_tag LOCUS_05920 328710 328549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 329123 328713 gene locus_tag LOCUS_05930 329123 328713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 329962 329120 gene locus_tag LOCUS_05940 329962 329120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 330637 330305 gene locus_tag LOCUS_05950 330637 330305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 330831 331760 gene locus_tag LOCUS_05960 gene panE 330831 331760 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZX7 protein_id gnl|my_center|LOCUS_05960 334301 332598 gene locus_tag LOCUS_05970 334301 332598 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_05970 335846 334560 gene locus_tag LOCUS_05980 gene gltA 335846 334560 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_05980 336558 336142 gene locus_tag LOCUS_05990 gene yqiW 336558 336142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_05990 336936 336586 gene locus_tag LOCUS_06000 336936 336586 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_06000 337360 336929 gene locus_tag LOCUS_06010 gene sufE 337360 336929 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_06010 338616 337360 gene locus_tag LOCUS_06020 338616 337360 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A296 protein_id gnl|my_center|LOCUS_06020 339949 338591 gene locus_tag LOCUS_06030 gene sufD 339949 338591 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_06030 340685 339924 gene locus_tag LOCUS_06040 gene sufC 340685 339924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_06040 342143 340698 gene locus_tag LOCUS_06050 gene sufB 342143 340698 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_06050 342870 342397 gene locus_tag LOCUS_06060 342870 342397 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_06060 343303 343845 gene locus_tag LOCUS_06070 343303 343845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 343965 344225 gene locus_tag LOCUS_06080 343965 344225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06080 345313 344288 gene locus_tag LOCUS_06090 gene ccpA 345313 344288 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_06090 345681 346928 gene locus_tag LOCUS_06100 345681 346928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 346966 347838 gene locus_tag LOCUS_06110 346966 347838 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385614.1 protein_id gnl|my_center|LOCUS_06110 347894 349315 gene locus_tag LOCUS_06120 347894 349315 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_06120 349335 350492 gene locus_tag LOCUS_06130 gene uxuA 349335 350492 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_06130 350991 351875 gene locus_tag LOCUS_06140 350991 351875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 352219 352788 gene locus_tag LOCUS_06150 352219 352788 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_06150 352947 353915 gene locus_tag LOCUS_06160 352947 353915 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_06160 354119 357562 gene locus_tag LOCUS_06170 354119 357562 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791968.1 protein_id gnl|my_center|LOCUS_06170 357575 359572 gene locus_tag LOCUS_06180 357575 359572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_06180 360244 363339 gene locus_tag LOCUS_06190 360244 363339 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_06190 363339 365069 gene locus_tag LOCUS_06200 363339 365069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 365478 366872 gene locus_tag LOCUS_06210 365478 366872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 366874 368424 gene locus_tag LOCUS_06220 gene phoD 366874 368424 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_06220 368720 371788 gene locus_tag LOCUS_06230 368720 371788 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_06230 371834 373438 gene locus_tag LOCUS_06240 371834 373438 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_06240 373798 375261 gene locus_tag LOCUS_06250 373798 375261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 375441 375926 gene locus_tag LOCUS_06260 375441 375926 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_06260 376039 377037 gene locus_tag LOCUS_06270 376039 377037 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_06270 377158 380490 gene locus_tag LOCUS_06280 377158 380490 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_06280 380509 382092 gene locus_tag LOCUS_06290 380509 382092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_06290 382372 383805 gene locus_tag LOCUS_06300 gene GALNS 382372 383805 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_06300 383878 385272 gene locus_tag LOCUS_06310 383878 385272 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_06310 385666 385490 gene locus_tag LOCUS_06320 385666 385490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 385988 389170 gene locus_tag LOCUS_06330 385988 389170 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_06330 389200 390963 gene locus_tag LOCUS_06340 389200 390963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_06340 390960 392519 gene locus_tag LOCUS_06350 390960 392519 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_06350 393902 392733 gene locus_tag LOCUS_06360 393902 392733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 395342 394083 gene locus_tag LOCUS_06370 395342 394083 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP3 protein_id gnl|my_center|LOCUS_06370 395767 396288 gene locus_tag LOCUS_06380 395767 396288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence03 625 149 gene locus_tag LOCUS_06390 625 149 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_06390 1001 651 gene locus_tag LOCUS_06400 1001 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1254 970 gene locus_tag LOCUS_06410 1254 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2906 1908 gene locus_tag LOCUS_06420 2906 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3849 3007 gene locus_tag LOCUS_06430 gene mapB 3849 3007 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_06430 5095 3839 gene locus_tag LOCUS_06440 5095 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5774 6388 gene locus_tag LOCUS_06450 5774 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_06450 7145 6702 gene locus_tag LOCUS_06460 7145 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 7903 7127 gene locus_tag LOCUS_06470 7903 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8916 8200 gene locus_tag LOCUS_06480 8916 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11290 9293 gene locus_tag LOCUS_06490 11290 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 12954 11860 gene locus_tag LOCUS_06500 12954 11860 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209281.1 protein_id gnl|my_center|LOCUS_06500 15553 13223 gene locus_tag LOCUS_06510 15553 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 17823 15544 gene locus_tag LOCUS_06520 17823 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 19524 17845 gene locus_tag LOCUS_06530 19524 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 21235 19793 gene locus_tag LOCUS_06540 21235 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 23002 21248 gene locus_tag LOCUS_06550 23002 21248 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748760.1 protein_id gnl|my_center|LOCUS_06550 24168 23086 gene locus_tag LOCUS_06560 24168 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 26660 24207 gene locus_tag LOCUS_06570 26660 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 28115 26724 gene locus_tag LOCUS_06580 28115 26724 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_06580 29915 28227 gene locus_tag LOCUS_06590 29915 28227 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_06590 32978 29928 gene locus_tag LOCUS_06600 32978 29928 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_06600 33251 34264 gene locus_tag LOCUS_06610 33251 34264 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_06610 35781 34612 gene locus_tag LOCUS_06620 35781 34612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 36636 35908 gene locus_tag LOCUS_06630 36636 35908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 36855 36694 gene locus_tag LOCUS_06640 36855 36694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 37024 36857 gene locus_tag LOCUS_06650 37024 36857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 37457 37125 gene locus_tag LOCUS_06660 37457 37125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 39632 37470 gene locus_tag LOCUS_06670 39632 37470 CDS product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_06670 40814 39645 gene locus_tag LOCUS_06680 40814 39645 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_06680 41514 41311 gene locus_tag LOCUS_06690 41514 41311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 42752 42423 gene locus_tag LOCUS_06700 42752 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 43515 42925 gene locus_tag LOCUS_06710 43515 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 43910 43506 gene locus_tag LOCUS_06720 43910 43506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 44302 44054 gene locus_tag LOCUS_06730 44302 44054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 44746 46158 gene locus_tag LOCUS_06740 44746 46158 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_06740 46916 46155 gene locus_tag LOCUS_06750 46916 46155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 47158 47997 gene locus_tag LOCUS_06760 47158 47997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 49667 48201 gene locus_tag LOCUS_06770 49667 48201 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_06770 51091 49748 gene locus_tag LOCUS_06780 51091 49748 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06780 52147 51107 gene locus_tag LOCUS_06790 52147 51107 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_06790 53258 52536 gene locus_tag LOCUS_06800 53258 52536 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_06800 53602 53324 gene locus_tag LOCUS_06810 53602 53324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 53852 55687 gene locus_tag LOCUS_06820 53852 55687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 55966 57150 gene locus_tag LOCUS_06830 55966 57150 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_06830 59991 57178 gene locus_tag LOCUS_06840 59991 57178 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_06840 60248 61381 gene locus_tag LOCUS_06850 60248 61381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 63848 61494 gene locus_tag LOCUS_06860 63848 61494 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_06860 65104 64148 gene locus_tag LOCUS_06870 65104 64148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 65779 65378 gene locus_tag LOCUS_06880 gene csaA 65779 65378 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_06880 66478 65942 gene locus_tag LOCUS_06890 66478 65942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 67783 66497 gene locus_tag LOCUS_06900 67783 66497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 68411 67803 gene locus_tag LOCUS_06910 68411 67803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 69572 68835 gene locus_tag LOCUS_06920 69572 68835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986895.1 protein_id gnl|my_center|LOCUS_06920 77199 69991 gene locus_tag LOCUS_06930 77199 69991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 77721 77206 gene locus_tag LOCUS_06940 77721 77206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 79446 77740 gene locus_tag LOCUS_06950 79446 77740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 81807 80284 gene locus_tag LOCUS_06960 81807 80284 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_06960 82513 81866 gene locus_tag LOCUS_06970 82513 81866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 84356 82878 gene locus_tag LOCUS_06980 84356 82878 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_06980 86179 84722 gene locus_tag LOCUS_06990 86179 84722 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_06990 89431 86207 gene locus_tag LOCUS_07000 89431 86207 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_07000 91611 90541 gene locus_tag LOCUS_07010 91611 90541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 94797 91636 gene locus_tag LOCUS_07020 94797 91636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 96128 94794 gene locus_tag LOCUS_07030 96128 94794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 97912 96230 gene locus_tag LOCUS_07040 97912 96230 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_07040 101159 97923 gene locus_tag LOCUS_07050 101159 97923 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_07050 102506 101397 gene locus_tag LOCUS_07060 102506 101397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 103265 102660 gene locus_tag LOCUS_07070 103265 102660 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_07070 104244 103537 gene locus_tag LOCUS_07080 104244 103537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 105425 104538 gene locus_tag LOCUS_07090 105425 104538 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_07090 107239 105680 gene locus_tag LOCUS_07100 107239 105680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_07100 107508 108545 gene locus_tag LOCUS_07110 107508 108545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 111350 108573 gene locus_tag LOCUS_07120 111350 108573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_07120 111827 112180 gene locus_tag LOCUS_07130 111827 112180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 113979 112561 gene locus_tag LOCUS_07140 113979 112561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_07140 114982 114065 gene locus_tag LOCUS_07150 114982 114065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 115854 115006 gene locus_tag LOCUS_07160 115854 115006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 118856 115887 gene locus_tag LOCUS_07170 118856 115887 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_07170 120428 118968 gene locus_tag LOCUS_07180 120428 118968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_07180 121895 120480 gene locus_tag LOCUS_07190 121895 120480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 123362 122016 gene locus_tag LOCUS_07200 123362 122016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_07200 123250 123513 gene locus_tag LOCUS_07210 123250 123513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 125240 123654 gene locus_tag LOCUS_07220 125240 123654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_07220 126961 125336 gene locus_tag LOCUS_07230 126961 125336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_07230 130332 126973 gene locus_tag LOCUS_07240 130332 126973 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_07240 131252 130569 gene locus_tag LOCUS_07250 131252 130569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 131590 131294 gene locus_tag LOCUS_07260 131590 131294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 132254 131601 gene locus_tag LOCUS_07270 132254 131601 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_07270 132922 134187 gene locus_tag LOCUS_07280 132922 134187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 134358 134747 gene locus_tag LOCUS_07290 134358 134747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 134952 136370 gene locus_tag LOCUS_07300 134952 136370 CDS product glycosyl hydrolase family 109 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS1 protein_id gnl|my_center|LOCUS_07300 136613 137992 gene locus_tag LOCUS_07310 136613 137992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 139070 138084 gene locus_tag LOCUS_07320 139070 138084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088024.1 protein_id gnl|my_center|LOCUS_07320 140352 139294 gene locus_tag LOCUS_07330 140352 139294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 142115 140709 gene locus_tag LOCUS_07340 142115 140709 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_07340 142537 145467 gene locus_tag LOCUS_07350 142537 145467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 147276 145570 gene locus_tag LOCUS_07360 147276 145570 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_07360 150322 147284 gene locus_tag LOCUS_07370 150322 147284 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_07370 152462 150936 gene locus_tag LOCUS_07380 152462 150936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_07380 153908 152490 gene locus_tag LOCUS_07390 153908 152490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_07390 157252 153929 gene locus_tag LOCUS_07400 157252 153929 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_07400 158569 157463 gene locus_tag LOCUS_07410 158569 157463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 159298 158702 gene locus_tag LOCUS_07420 159298 158702 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_07420 160774 159392 gene locus_tag LOCUS_07430 160774 159392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_07430 162216 160777 gene locus_tag LOCUS_07440 162216 160777 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_07440 163702 162227 gene locus_tag LOCUS_07450 163702 162227 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_07450 165084 164077 gene locus_tag LOCUS_07460 165084 164077 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_07460 166001 169237 gene locus_tag LOCUS_07470 166001 169237 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_07470 169321 170796 gene locus_tag LOCUS_07480 169321 170796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_07480 170796 172373 gene locus_tag LOCUS_07490 170796 172373 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 protein_id gnl|my_center|LOCUS_07490 172414 174006 gene locus_tag LOCUS_07500 172414 174006 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_07500 174179 175693 gene locus_tag LOCUS_07510 174179 175693 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_07510 175944 177524 gene locus_tag LOCUS_07520 175944 177524 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_07520 177707 178858 gene locus_tag LOCUS_07530 177707 178858 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_07530 178873 180627 gene locus_tag LOCUS_07540 gene ansA1 178873 180627 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537808.1 protein_id gnl|my_center|LOCUS_07540 180638 182197 gene locus_tag LOCUS_07550 180638 182197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 183411 182725 gene locus_tag LOCUS_07560 183411 182725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 184341 183418 gene locus_tag LOCUS_07570 184341 183418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 185168 184362 gene locus_tag LOCUS_07580 185168 184362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_07580 186241 187467 gene locus_tag LOCUS_07590 gene crnA 186241 187467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_07590 187616 191137 gene locus_tag LOCUS_07600 187616 191137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 191323 192789 gene locus_tag LOCUS_07610 191323 192789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 193731 192973 gene locus_tag LOCUS_07620 193731 192973 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_07620 193894 196392 gene locus_tag LOCUS_07630 gene nirB 193894 196392 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_07630 196437 196820 gene locus_tag LOCUS_07640 gene nirD-2 196437 196820 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_07640 197038 198855 gene locus_tag LOCUS_07650 197038 198855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 198872 199549 gene locus_tag LOCUS_07660 198872 199549 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_07660 200880 199606 gene locus_tag LOCUS_07670 200880 199606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_07670 201825 200944 gene locus_tag LOCUS_07680 201825 200944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 202665 201985 gene locus_tag LOCUS_07690 202665 201985 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_07690 204198 202732 gene locus_tag LOCUS_07700 204198 202732 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_07700 205745 204201 gene locus_tag LOCUS_07710 205745 204201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 207088 205751 gene locus_tag LOCUS_07720 207088 205751 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_07720 208332 207259 gene locus_tag LOCUS_07730 208332 207259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 210072 208525 gene locus_tag LOCUS_07740 210072 208525 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_07740 210912 210469 gene locus_tag LOCUS_07750 210912 210469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 211346 212455 gene locus_tag LOCUS_07760 211346 212455 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_07760 213307 212582 gene locus_tag LOCUS_07770 213307 212582 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_07770 214377 213304 gene locus_tag LOCUS_07780 214377 213304 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_07780 214668 217178 gene locus_tag LOCUS_07790 214668 217178 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_07790 218589 217291 gene locus_tag LOCUS_07800 218589 217291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 219661 218690 gene locus_tag LOCUS_07810 219661 218690 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_07810 220449 219826 gene locus_tag LOCUS_07820 220449 219826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 221531 220599 gene locus_tag LOCUS_07830 221531 220599 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_07830 222268 221711 gene locus_tag LOCUS_07840 222268 221711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 222948 222565 gene locus_tag LOCUS_07850 222948 222565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 223092 222952 gene locus_tag LOCUS_07860 223092 222952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 224515 223049 gene locus_tag LOCUS_07870 224515 223049 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_07870 225751 224759 gene locus_tag LOCUS_07880 gene pfkA 225751 224759 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_07880 226141 225779 gene locus_tag LOCUS_07890 gene mgsA 226141 225779 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ00 protein_id gnl|my_center|LOCUS_07890 226526 226227 gene locus_tag LOCUS_07900 226526 226227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_07900 227736 226768 gene locus_tag LOCUS_07910 227736 226768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_07910 228638 227736 gene locus_tag LOCUS_07920 228638 227736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 230101 228908 gene locus_tag LOCUS_07930 230101 228908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 230926 230147 gene locus_tag LOCUS_07940 230926 230147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 232489 231254 gene locus_tag LOCUS_07950 232489 231254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 233619 232501 gene locus_tag LOCUS_07960 233619 232501 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07960 234751 233636 gene locus_tag LOCUS_07970 234751 233636 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07970 235860 234748 gene locus_tag LOCUS_07980 235860 234748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 236805 235930 gene locus_tag LOCUS_07990 236805 235930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 237751 236825 gene locus_tag LOCUS_08000 237751 236825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 238715 237786 gene locus_tag LOCUS_08010 238715 237786 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_08010 239535 238813 gene locus_tag LOCUS_08020 239535 238813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 240791 239532 gene locus_tag LOCUS_08030 gene xapH 240791 239532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_08030 241754 240933 gene locus_tag LOCUS_08040 241754 240933 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_08040 242677 241751 gene locus_tag LOCUS_08050 242677 241751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 244122 242680 gene locus_tag LOCUS_08060 244122 242680 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_08060 245418 244237 gene locus_tag LOCUS_08070 245418 244237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 246006 245476 gene locus_tag LOCUS_08080 246006 245476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 247297 246401 gene locus_tag LOCUS_08090 247297 246401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_08090 248125 247394 gene locus_tag LOCUS_08100 248125 247394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 249060 248128 gene locus_tag LOCUS_08110 249060 248128 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963746.1 protein_id gnl|my_center|LOCUS_08110 249488 249057 gene locus_tag LOCUS_08120 249488 249057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 249923 251068 gene locus_tag LOCUS_08130 249923 251068 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_08130 251280 251774 gene locus_tag LOCUS_08140 251280 251774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 251936 254416 gene locus_tag LOCUS_08150 251936 254416 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_08150 254642 256204 gene locus_tag LOCUS_08160 254642 256204 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_08160 258434 256290 gene locus_tag LOCUS_08170 258434 256290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 259932 258415 gene locus_tag LOCUS_08180 259932 258415 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_08180 261442 259946 gene locus_tag LOCUS_08190 261442 259946 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_08190 261708 263993 gene locus_tag LOCUS_08200 261708 263993 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_08200 263977 264846 gene locus_tag LOCUS_08210 gene fdhD 263977 264846 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_08210 265483 265298 gene locus_tag LOCUS_08220 265483 265298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 265854 268277 gene locus_tag LOCUS_08230 gene ladS 265854 268277 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_08230 269307 268492 gene locus_tag LOCUS_08240 269307 268492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071596.1 protein_id gnl|my_center|LOCUS_08240 270322 269414 gene locus_tag LOCUS_08250 270322 269414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205484.1 protein_id gnl|my_center|LOCUS_08250 270713 271249 gene locus_tag LOCUS_08260 270713 271249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 271298 271735 gene locus_tag LOCUS_08270 271298 271735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 271725 273572 gene locus_tag LOCUS_08280 271725 273572 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107548.1 protein_id gnl|my_center|LOCUS_08280 273584 274606 gene locus_tag LOCUS_08290 273584 274606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_08290 274951 276285 gene locus_tag LOCUS_08300 274951 276285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 276353 276601 gene locus_tag LOCUS_08310 276353 276601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 277186 277776 gene locus_tag LOCUS_08320 277186 277776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_08320 277789 278223 gene locus_tag LOCUS_08330 277789 278223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_08330 278230 279030 gene locus_tag LOCUS_08340 278230 279030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 280418 279213 gene locus_tag LOCUS_08350 280418 279213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_08350 281829 281344 gene locus_tag LOCUS_08360 281829 281344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 282732 281959 gene locus_tag LOCUS_08370 282732 281959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_08370 286069 283265 gene locus_tag LOCUS_08380 286069 283265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 287166 286357 gene locus_tag LOCUS_08390 287166 286357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 288788 287451 gene locus_tag LOCUS_08400 288788 287451 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_08400 289024 292488 gene locus_tag LOCUS_08410 289024 292488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 292998 292597 gene locus_tag LOCUS_08420 292998 292597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 294431 292998 gene locus_tag LOCUS_08430 294431 292998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08430 297448 294440 gene locus_tag LOCUS_08440 297448 294440 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_08440 298243 298491 gene locus_tag LOCUS_08450 298243 298491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 300390 298618 gene locus_tag LOCUS_08460 300390 298618 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_08460 301857 300412 gene locus_tag LOCUS_08470 gene arsA 301857 300412 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_08470 303215 301893 gene locus_tag LOCUS_08480 303215 301893 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_08480 304666 303275 gene locus_tag LOCUS_08490 304666 303275 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_08490 306028 304700 gene locus_tag LOCUS_08500 gene GALNS 306028 304700 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_08500 307685 306123 gene locus_tag LOCUS_08510 307685 306123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203129.1 protein_id gnl|my_center|LOCUS_08510 310866 307690 gene locus_tag LOCUS_08520 310866 307690 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_08520 313243 310958 gene locus_tag LOCUS_08530 313243 310958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 315001 313511 gene locus_tag LOCUS_08540 315001 313511 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_08540 317723 315114 gene locus_tag LOCUS_08550 317723 315114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 319378 317729 gene locus_tag LOCUS_08560 319378 317729 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_08560 322709 319401 gene locus_tag LOCUS_08570 322709 319401 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_08570 323877 322888 gene locus_tag LOCUS_08580 323877 322888 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202064.1 protein_id gnl|my_center|LOCUS_08580 324626 324096 gene locus_tag LOCUS_08590 324626 324096 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_08590 325284 326621 gene locus_tag LOCUS_08600 325284 326621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 327693 328502 gene locus_tag LOCUS_08610 327693 328502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 329053 329982 gene locus_tag LOCUS_08620 329053 329982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 330264 331361 gene locus_tag LOCUS_08630 330264 331361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 331493 332521 gene locus_tag LOCUS_08640 331493 332521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 335142 333388 gene locus_tag LOCUS_08650 335142 333388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_08650 337656 336580 gene locus_tag LOCUS_08660 337656 336580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 339947 337785 gene locus_tag LOCUS_08670 339947 337785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 340922 340107 gene locus_tag LOCUS_08680 340922 340107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 342304 341054 gene locus_tag LOCUS_08690 342304 341054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 343165 342383 gene locus_tag LOCUS_08700 343165 342383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 345582 343171 gene locus_tag LOCUS_08710 345582 343171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 347264 345783 gene locus_tag LOCUS_08720 347264 345783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08720 350597 347277 gene locus_tag LOCUS_08730 350597 347277 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_08730 351814 350813 gene locus_tag LOCUS_08740 351814 350813 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_08740 352549 351941 gene locus_tag LOCUS_08750 352549 351941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 354013 352706 gene locus_tag LOCUS_08760 354013 352706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 354947 354006 gene locus_tag LOCUS_08770 354947 354006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 355712 356161 gene locus_tag LOCUS_08780 355712 356161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 356425 359823 gene locus_tag LOCUS_08790 356425 359823 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_08790 359810 361450 gene locus_tag LOCUS_08800 359810 361450 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_08800 361542 361931 gene locus_tag LOCUS_08810 361542 361931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 364222 362291 gene locus_tag LOCUS_08820 364222 362291 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_08820 366653 366240 gene locus_tag LOCUS_08830 366653 366240 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_08830 366895 366650 gene locus_tag LOCUS_08840 366895 366650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 368178 367177 gene locus_tag LOCUS_08850 368178 367177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 369260 368811 gene locus_tag LOCUS_08860 369260 368811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 369716 369426 gene locus_tag LOCUS_08870 369716 369426 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_08870 370081 369713 gene locus_tag LOCUS_08880 370081 369713 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_08880 370932 370636 gene locus_tag LOCUS_08890 370932 370636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 371150 370917 gene locus_tag LOCUS_08900 371150 370917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 373209 371887 gene locus_tag LOCUS_08910 373209 371887 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_08910 375612 373939 gene locus_tag LOCUS_08920 375612 373939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 377080 376412 gene locus_tag LOCUS_08930 377080 376412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence04 3159 793 gene locus_tag LOCUS_08940 3159 793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_08940 3414 5297 gene locus_tag LOCUS_08950 gene htpG 3414 5297 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_08950 5536 5952 gene locus_tag LOCUS_08960 5536 5952 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_08960 6083 6808 gene locus_tag LOCUS_08970 gene cysH 6083 6808 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_08970 6847 8949 gene locus_tag LOCUS_08980 6847 8949 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_08980 8946 9722 gene locus_tag LOCUS_08990 8946 9722 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_08990 9730 10311 gene locus_tag LOCUS_09000 9730 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11656 11417 gene locus_tag LOCUS_09010 11656 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13260 12028 gene locus_tag LOCUS_09020 13260 12028 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_09020 13493 15172 gene locus_tag LOCUS_09030 gene rprX 13493 15172 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_09030 15169 15858 gene locus_tag LOCUS_09040 gene rprY 15169 15858 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_09040 15935 16315 gene locus_tag LOCUS_09050 15935 16315 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_09050 16334 16816 gene locus_tag LOCUS_09060 16334 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16937 18337 gene locus_tag LOCUS_09070 gene fumC 16937 18337 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_09070 21298 18416 gene locus_tag LOCUS_09080 gene gcvP 21298 18416 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_09080 21473 22972 gene locus_tag LOCUS_09090 21473 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 23138 23734 gene locus_tag LOCUS_09100 23138 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 23846 24301 gene locus_tag LOCUS_09110 23846 24301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_09110 25307 24348 gene locus_tag LOCUS_09120 25307 24348 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_09120 25485 26342 gene locus_tag LOCUS_09130 25485 26342 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_09130 27783 26428 gene locus_tag LOCUS_09140 27783 26428 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_09140 27854 29197 gene locus_tag LOCUS_09150 gene pyrC1 27854 29197 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_09150 29277 29351 gene locus_tag LOCUS_t00050 29277 29351 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29917 31833 gene locus_tag LOCUS_09160 29917 31833 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_09160 31845 33125 gene locus_tag LOCUS_09170 31845 33125 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_09170 33129 34331 gene locus_tag LOCUS_09180 33129 34331 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_09180 37426 34388 gene locus_tag LOCUS_09190 gene sbcC 37426 34388 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS0 protein_id gnl|my_center|LOCUS_09190 38658 37423 gene locus_tag LOCUS_09200 gene sbcD 38658 37423 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ16 protein_id gnl|my_center|LOCUS_09200 39038 39556 gene locus_tag LOCUS_09210 39038 39556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 39815 40597 gene locus_tag LOCUS_09220 gene rsmA 39815 40597 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_09220 40585 41952 gene locus_tag LOCUS_09230 gene mgtE 40585 41952 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_09230 41960 42892 gene locus_tag LOCUS_09240 41960 42892 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_09240 43033 43506 gene locus_tag LOCUS_09250 gene greA 43033 43506 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_09250 43570 43974 gene locus_tag LOCUS_09260 43570 43974 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_09260 44565 46094 gene locus_tag LOCUS_09270 gene guaA 44565 46094 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_09270 46287 47903 gene locus_tag LOCUS_09280 46287 47903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 47910 49196 gene locus_tag LOCUS_09290 gene hemL 47910 49196 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S3 protein_id gnl|my_center|LOCUS_09290 52375 49256 gene locus_tag LOCUS_09300 52375 49256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_09300 52861 53262 gene locus_tag LOCUS_09310 gene yffB 52861 53262 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_09310 54397 53369 gene locus_tag LOCUS_09320 54397 53369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 55686 54412 gene locus_tag LOCUS_09330 55686 54412 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_09330 56999 55848 gene locus_tag LOCUS_09340 56999 55848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 57139 58722 gene locus_tag LOCUS_09350 57139 58722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_09350 58969 58778 gene locus_tag LOCUS_09360 gene rpmF 58969 58778 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_09360 59544 58987 gene locus_tag LOCUS_09370 59544 58987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 60633 59614 gene locus_tag LOCUS_09380 gene pdxA 60633 59614 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_09380 61945 60818 gene locus_tag LOCUS_09390 61945 60818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 62119 63486 gene locus_tag LOCUS_09400 gene nfeD 62119 63486 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_09400 63912 64310 gene locus_tag LOCUS_09410 63912 64310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 64329 64616 gene locus_tag LOCUS_09420 gene gatC 64329 64616 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06492 protein_id gnl|my_center|LOCUS_09420 64616 67381 gene locus_tag LOCUS_09430 64616 67381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 67460 68176 gene locus_tag LOCUS_09440 67460 68176 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_09440 68197 68745 gene locus_tag LOCUS_09450 68197 68745 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_09450 68752 69819 gene locus_tag LOCUS_09460 gene ilvE 68752 69819 CDS product branched-chain-amino-acid transaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31461 protein_id gnl|my_center|LOCUS_09460 69864 70379 gene locus_tag LOCUS_09470 69864 70379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 70734 71687 gene locus_tag LOCUS_09480 gene prfB 70734 71687 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_09480 73857 71716 gene locus_tag LOCUS_09490 73857 71716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 75353 73896 gene locus_tag LOCUS_09500 75353 73896 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_09500 77670 75355 gene locus_tag LOCUS_09510 77670 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 79422 78070 gene locus_tag LOCUS_09520 gene accC 79422 78070 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_09520 79913 79452 gene locus_tag LOCUS_09530 gene accB 79913 79452 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_09530 80588 80025 gene locus_tag LOCUS_09540 gene efp 80588 80025 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_09540 81607 80606 gene locus_tag LOCUS_09550 gene fabH3 81607 80606 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_09550 81907 82365 gene locus_tag LOCUS_09560 81907 82365 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_09560 82362 84494 gene locus_tag LOCUS_09570 82362 84494 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_09570 85913 84525 gene locus_tag LOCUS_09580 gene hslU 85913 84525 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD63 protein_id gnl|my_center|LOCUS_09580 88404 85918 gene locus_tag LOCUS_09590 gene lon 88404 85918 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_09590 89898 88579 gene locus_tag LOCUS_09600 89898 88579 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_09600 91065 89902 gene locus_tag LOCUS_09610 gene dxr 91065 89902 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_09610 91320 92780 gene locus_tag LOCUS_09620 91320 92780 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_09620 93521 92898 gene locus_tag LOCUS_09630 93521 92898 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_09630 93970 93521 gene locus_tag LOCUS_09640 93970 93521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 94281 94018 gene locus_tag LOCUS_09650 94281 94018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 95031 94351 gene locus_tag LOCUS_09660 95031 94351 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_09660 95880 95179 gene locus_tag LOCUS_09670 gene folE2 95880 95179 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_09670 96250 95840 gene locus_tag LOCUS_09680 gene ygcM 96250 95840 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_09680 96740 97480 gene locus_tag LOCUS_09690 96740 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_09690 99171 97489 gene locus_tag LOCUS_09700 99171 97489 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_09700 100016 99168 gene locus_tag LOCUS_09710 gene kdsA 100016 99168 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_09710 100585 100040 gene locus_tag LOCUS_09720 100585 100040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 102126 100582 gene locus_tag LOCUS_09730 102126 100582 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_09730 102357 103262 gene locus_tag LOCUS_09740 102357 103262 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_09740 103347 104291 gene locus_tag LOCUS_09750 103347 104291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 104418 107192 gene locus_tag LOCUS_09760 gene leuS 104418 107192 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 protein_id gnl|my_center|LOCUS_09760 107475 108437 gene locus_tag LOCUS_09770 107475 108437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 108440 109276 gene locus_tag LOCUS_09780 108440 109276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 110418 109273 gene locus_tag LOCUS_09790 110418 109273 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_09790 112089 111232 gene locus_tag LOCUS_09800 112089 111232 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_09800 112833 112102 gene locus_tag LOCUS_09810 112833 112102 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_09810 114438 112858 gene locus_tag LOCUS_09820 gene prfC 114438 112858 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_09820 114587 115147 gene locus_tag LOCUS_09830 114587 115147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 115140 115946 gene locus_tag LOCUS_09840 115140 115946 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_09840 116673 116029 gene locus_tag LOCUS_09850 gene pyrE 116673 116029 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_09850 116757 117446 gene locus_tag LOCUS_09860 116757 117446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 117889 117434 gene locus_tag LOCUS_09870 gene coaD 117889 117434 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_09870 118734 117886 gene locus_tag LOCUS_09880 118734 117886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 119318 118737 gene locus_tag LOCUS_09890 119318 118737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 119890 119381 gene locus_tag LOCUS_09900 119890 119381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 119907 121334 gene locus_tag LOCUS_09910 119907 121334 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_09910 121378 121770 gene locus_tag LOCUS_09920 121378 121770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 122436 121849 gene locus_tag LOCUS_09930 122436 121849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_09930 123196 122513 gene locus_tag LOCUS_09940 123196 122513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_09940 123640 123801 gene locus_tag LOCUS_09950 123640 123801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09950 124973 124317 gene locus_tag LOCUS_09960 124973 124317 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_09960 126128 125076 gene locus_tag LOCUS_09970 gene ykfA 126128 125076 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_09970 127426 126137 gene locus_tag LOCUS_09980 127426 126137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 127815 127441 gene locus_tag LOCUS_09990 127815 127441 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_09990 128504 127821 gene locus_tag LOCUS_10000 128504 127821 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_10000 129161 132325 gene locus_tag LOCUS_10010 129161 132325 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10010 132344 133948 gene locus_tag LOCUS_10020 132344 133948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_10020 135521 134025 gene locus_tag LOCUS_10030 135521 134025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 135935 139204 gene locus_tag LOCUS_10040 135935 139204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 139316 140686 gene locus_tag LOCUS_10050 gene trpB 139316 140686 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCP2 protein_id gnl|my_center|LOCUS_10050 140705 141619 gene locus_tag LOCUS_10060 140705 141619 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972588.1 protein_id gnl|my_center|LOCUS_10060 141712 143133 gene locus_tag LOCUS_10070 141712 143133 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_10070 144400 143360 gene locus_tag LOCUS_10080 144400 143360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_10080 145295 144393 gene locus_tag LOCUS_10090 145295 144393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 146115 145288 gene locus_tag LOCUS_10100 146115 145288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_10100 146273 146623 gene locus_tag LOCUS_10110 146273 146623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 146624 149017 gene locus_tag LOCUS_10120 gene mutS2 146624 149017 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_10120 149435 149058 gene locus_tag LOCUS_10130 149435 149058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 149989 149504 gene locus_tag LOCUS_10140 149989 149504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 150662 150036 gene locus_tag LOCUS_10150 150662 150036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 151444 150665 gene locus_tag LOCUS_10160 gene lpxA 151444 150665 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_10160 152835 151441 gene locus_tag LOCUS_10170 gene fabZ 152835 151441 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_10170 153907 152885 gene locus_tag LOCUS_10180 gene lpxD 153907 152885 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_10180 155166 153925 gene locus_tag LOCUS_10190 155166 153925 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_10190 155219 156772 gene locus_tag LOCUS_10200 gene porX 155219 156772 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_10200 156780 157208 gene locus_tag LOCUS_10210 156780 157208 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_10210 157205 158425 gene locus_tag LOCUS_10220 gene ald 157205 158425 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_10220 158906 158442 gene locus_tag LOCUS_10230 158906 158442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 159166 160275 gene locus_tag LOCUS_10240 159166 160275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 160265 160975 gene locus_tag LOCUS_10250 160265 160975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 160962 163106 gene locus_tag LOCUS_10260 160962 163106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 163103 164191 gene locus_tag LOCUS_10270 163103 164191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 164385 164924 gene locus_tag LOCUS_10280 gene ppa 164385 164924 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_10280 167636 165009 gene locus_tag LOCUS_10290 gene valS 167636 165009 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_10290 168656 167760 gene locus_tag LOCUS_10300 168656 167760 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_10300 170428 168668 gene locus_tag LOCUS_10310 170428 168668 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_10310 170507 170995 gene locus_tag LOCUS_10320 gene folK 170507 170995 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66550 protein_id gnl|my_center|LOCUS_10320 171154 171933 gene locus_tag LOCUS_10330 171154 171933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 172906 172028 gene locus_tag LOCUS_10340 gene fabD 172906 172028 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_10340 175829 173085 gene locus_tag LOCUS_10350 175829 173085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 176349 177032 gene locus_tag LOCUS_10360 176349 177032 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_10360 177079 179013 gene locus_tag LOCUS_10370 gene sdhA 177079 179013 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_10370 179043 179792 gene locus_tag LOCUS_10380 gene sdhB 179043 179792 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_10380 179954 181363 gene locus_tag LOCUS_10390 gene putP 179954 181363 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_10390 181397 181837 gene locus_tag LOCUS_10400 181397 181837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 181839 182909 gene locus_tag LOCUS_10410 181839 182909 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_10410 183171 183755 gene locus_tag LOCUS_10420 183171 183755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 184746 183865 gene locus_tag LOCUS_10430 184746 183865 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_10430 186082 184739 gene locus_tag LOCUS_10440 gene xylE 186082 184739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_10440 186922 186338 gene locus_tag LOCUS_10450 186922 186338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 188315 187794 gene locus_tag LOCUS_10460 188315 187794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_10460 189296 188502 gene locus_tag LOCUS_10470 gene truA 189296 188502 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_10470 189496 191004 gene locus_tag LOCUS_10480 189496 191004 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118991.1 protein_id gnl|my_center|LOCUS_10480 191557 191192 gene locus_tag LOCUS_10490 191557 191192 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_10490 193127 191781 gene locus_tag LOCUS_10500 gene RspA 193127 191781 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_10500 194451 193183 gene locus_tag LOCUS_10510 194451 193183 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_10510 196283 194745 gene locus_tag LOCUS_10520 196283 194745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_10520 199419 196288 gene locus_tag LOCUS_10530 199419 196288 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10530 201795 200557 gene locus_tag LOCUS_10540 201795 200557 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969235.1 protein_id gnl|my_center|LOCUS_10540 202022 202435 gene locus_tag LOCUS_10550 202022 202435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 202899 204143 gene locus_tag LOCUS_10560 202899 204143 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 protein_id gnl|my_center|LOCUS_10560 205244 208798 gene locus_tag LOCUS_10570 205244 208798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 208891 209058 gene locus_tag LOCUS_10580 208891 209058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 209882 210097 gene locus_tag LOCUS_10590 209882 210097 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_10590 210103 211677 gene locus_tag LOCUS_10600 210103 211677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 211665 213278 gene locus_tag LOCUS_10610 211665 213278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 213280 213924 gene locus_tag LOCUS_10620 213280 213924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 214887 215042 gene locus_tag LOCUS_10630 214887 215042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 215262 216737 gene locus_tag LOCUS_10640 215262 216737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 218314 219585 gene locus_tag LOCUS_10650 218314 219585 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_10650 220055 220306 gene locus_tag LOCUS_10660 gene parD-1 220055 220306 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_10660 220299 220598 gene locus_tag LOCUS_10670 gene parE-1 220299 220598 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_10670 222658 221468 gene locus_tag LOCUS_10680 gene fdh 222658 221468 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_10680 224999 222933 gene locus_tag LOCUS_10690 gene pepO 224999 222933 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_10690 225374 227029 gene locus_tag LOCUS_10700 225374 227029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 227226 229418 gene locus_tag LOCUS_10710 227226 229418 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_10710 231022 229772 gene locus_tag LOCUS_10720 231022 229772 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_10720 232111 231038 gene locus_tag LOCUS_10730 232111 231038 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_10730 233152 232187 gene locus_tag LOCUS_10740 233152 232187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 233607 234098 gene locus_tag LOCUS_10750 gene blc 233607 234098 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780585.1 protein_id gnl|my_center|LOCUS_10750 234082 234276 gene locus_tag LOCUS_10760 234082 234276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 234418 235344 gene locus_tag LOCUS_10770 234418 235344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 235869 236330 gene locus_tag LOCUS_10780 235869 236330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 236343 237263 gene locus_tag LOCUS_10790 236343 237263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 239456 237807 gene locus_tag LOCUS_10800 239456 237807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 239807 239628 gene locus_tag LOCUS_10810 239807 239628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 240196 240675 gene locus_tag LOCUS_10820 240196 240675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 240681 241799 gene locus_tag LOCUS_10830 240681 241799 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_10830 241855 245016 gene locus_tag LOCUS_10840 241855 245016 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_10840 245009 246373 gene locus_tag LOCUS_10850 245009 246373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_10850 247979 246543 gene locus_tag LOCUS_10860 247979 246543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_10860 251244 247990 gene locus_tag LOCUS_10870 251244 247990 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_10870 252146 253126 gene locus_tag LOCUS_10880 252146 253126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 254675 253485 gene locus_tag LOCUS_10890 gene ycaQ 254675 253485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_10890 256157 254739 gene locus_tag LOCUS_10900 256157 254739 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_10900 256867 257358 gene locus_tag LOCUS_10910 256867 257358 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_10910 257342 257998 gene locus_tag LOCUS_10920 257342 257998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 258046 258510 gene locus_tag LOCUS_10930 258046 258510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 260938 258671 gene locus_tag LOCUS_10940 260938 258671 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_10940 262423 260981 gene locus_tag LOCUS_10950 262423 260981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_10950 263806 262700 gene locus_tag LOCUS_10960 263806 262700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 264734 263787 gene locus_tag LOCUS_10970 264734 263787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 265430 267925 gene locus_tag LOCUS_10980 265430 267925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 269826 268153 gene locus_tag LOCUS_10990 269826 268153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 272545 269948 gene locus_tag LOCUS_11000 272545 269948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 275239 272816 gene locus_tag LOCUS_11010 275239 272816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 276716 275694 gene locus_tag LOCUS_11020 276716 275694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 278491 276785 gene locus_tag LOCUS_11030 278491 276785 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_11030 281446 278510 gene locus_tag LOCUS_11040 281446 278510 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_11040 283352 281571 gene locus_tag LOCUS_11050 283352 281571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767188.1 protein_id gnl|my_center|LOCUS_11050 286958 283371 gene locus_tag LOCUS_11060 286958 283371 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_11060 288101 287061 gene locus_tag LOCUS_11070 288101 287061 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_11070 288765 288136 gene locus_tag LOCUS_11080 288765 288136 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_11080 289085 290338 gene locus_tag LOCUS_11090 289085 290338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 290556 290855 gene locus_tag LOCUS_11100 290556 290855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566769.1 protein_id gnl|my_center|LOCUS_11100 290928 291326 gene locus_tag LOCUS_11110 290928 291326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 291376 292494 gene locus_tag LOCUS_11120 291376 292494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 293166 294800 gene locus_tag LOCUS_11130 gene fadD14 293166 294800 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_11130 295234 296301 gene locus_tag LOCUS_11140 295234 296301 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_11140 296365 297345 gene locus_tag LOCUS_11150 296365 297345 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120895.1 protein_id gnl|my_center|LOCUS_11150 298174 297356 gene locus_tag LOCUS_11160 298174 297356 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11160 298375 299025 gene locus_tag LOCUS_11170 gene sirR 298375 299025 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_11170 299032 299733 gene locus_tag LOCUS_11180 gene ispD 299032 299733 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U8 protein_id gnl|my_center|LOCUS_11180 299958 300578 gene locus_tag LOCUS_11190 299958 300578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 300592 301635 gene locus_tag LOCUS_11200 300592 301635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 301632 302363 gene locus_tag LOCUS_11210 301632 302363 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_11210 302626 302405 gene locus_tag LOCUS_11220 302626 302405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_11220 303953 302703 gene locus_tag LOCUS_11230 303953 302703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 304083 305762 gene locus_tag LOCUS_11240 304083 305762 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_11240 305909 307243 gene locus_tag LOCUS_11250 305909 307243 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_11250 308204 307134 gene locus_tag LOCUS_11260 308204 307134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 308370 308621 gene locus_tag LOCUS_11270 gene rpsT 308370 308621 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_11270 308795 309490 gene locus_tag LOCUS_11280 gene radC 308795 309490 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_11280 309497 310114 gene locus_tag LOCUS_11290 309497 310114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_11290 310169 312580 gene locus_tag LOCUS_11300 gene pheT 310169 312580 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_11300 312582 312869 gene locus_tag LOCUS_11310 312582 312869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 312871 313155 gene locus_tag LOCUS_11320 312871 313155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 313227 314792 gene locus_tag LOCUS_11330 gene rny 313227 314792 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_11330 315245 316282 gene locus_tag LOCUS_11340 315245 316282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 316336 319437 gene locus_tag LOCUS_11350 316336 319437 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_11350 319700 320791 gene locus_tag LOCUS_11360 319700 320791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 321330 321908 gene locus_tag LOCUS_11370 321330 321908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 322208 322741 gene locus_tag LOCUS_11380 322208 322741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 323319 322753 gene locus_tag LOCUS_11390 323319 322753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 323237 323416 gene locus_tag LOCUS_11400 323237 323416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 323694 324722 gene locus_tag LOCUS_11410 323694 324722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405151.1 protein_id gnl|my_center|LOCUS_11410 324727 325287 gene locus_tag LOCUS_11420 324727 325287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 326845 325454 gene locus_tag LOCUS_11430 326845 325454 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_11430 327833 326886 gene locus_tag LOCUS_11440 327833 326886 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_11440 328659 327808 gene locus_tag LOCUS_11450 328659 327808 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_11450 329590 328652 gene locus_tag LOCUS_11460 gene hemC 329590 328652 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_11460 330498 329590 gene locus_tag LOCUS_11470 gene rimK 330498 329590 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_11470 330923 330495 gene locus_tag LOCUS_11480 gene rimK2 330923 330495 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_11480 332101 330980 gene locus_tag LOCUS_11490 332101 330980 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_11490 333317 332112 gene locus_tag LOCUS_11500 333317 332112 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_11500 333635 333390 gene locus_tag LOCUS_11510 gene rpmE2 333635 333390 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_11510 333871 335517 gene locus_tag LOCUS_11520 333871 335517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 335777 337609 gene locus_tag LOCUS_11530 335777 337609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_11530 337644 337997 gene locus_tag LOCUS_11540 337644 337997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 338048 339586 gene locus_tag LOCUS_11550 338048 339586 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_11550 339715 340176 gene locus_tag LOCUS_11560 339715 340176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 341294 340179 gene locus_tag LOCUS_11570 gene metC 341294 340179 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946625.1 protein_id gnl|my_center|LOCUS_11570 341778 341347 gene locus_tag LOCUS_11580 341778 341347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 341928 342683 gene locus_tag LOCUS_11590 gene truA 341928 342683 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_11590 342696 344471 gene locus_tag LOCUS_11600 342696 344471 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_11600 344670 345260 gene locus_tag LOCUS_11610 344670 345260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 345260 345778 gene locus_tag LOCUS_11620 345260 345778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 345928 346464 gene locus_tag LOCUS_11630 345928 346464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 346608 347147 gene locus_tag LOCUS_11640 346608 347147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 347265 348308 gene locus_tag LOCUS_11650 gene hemE 347265 348308 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_11650 348812 349219 gene locus_tag LOCUS_11660 348812 349219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 349543 350250 gene locus_tag LOCUS_11670 349543 350250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 350693 351493 gene locus_tag LOCUS_11680 350693 351493 CDS product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_11680 351565 353940 gene locus_tag LOCUS_11690 351565 353940 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_11690 353977 355353 gene locus_tag LOCUS_11700 353977 355353 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_11700 355341 356630 gene locus_tag LOCUS_11710 355341 356630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_11710 356635 357900 gene locus_tag LOCUS_11720 356635 357900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 357936 358973 gene locus_tag LOCUS_11730 357936 358973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 359016 360347 gene locus_tag LOCUS_11740 359016 360347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 360349 361356 gene locus_tag LOCUS_11750 360349 361356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 361384 363546 gene locus_tag LOCUS_11760 361384 363546 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_11760 363582 364487 gene locus_tag LOCUS_11770 363582 364487 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965495.1 protein_id gnl|my_center|LOCUS_11770 364493 365581 gene locus_tag LOCUS_11780 364493 365581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 365583 366692 gene locus_tag LOCUS_11790 365583 366692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 366708 367922 gene locus_tag LOCUS_11800 366708 367922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_11800 368016 368771 gene locus_tag LOCUS_11810 368016 368771 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_11810 368799 369902 gene locus_tag LOCUS_11820 368799 369902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 369975 370937 gene locus_tag LOCUS_11830 369975 370937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 370948 372060 gene locus_tag LOCUS_11840 370948 372060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence05 324 106 gene locus_tag LOCUS_11850 324 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1818 748 gene locus_tag LOCUS_11860 1818 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2715 2011 gene locus_tag LOCUS_11870 2715 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3206 2889 gene locus_tag LOCUS_11880 3206 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3731 3402 gene locus_tag LOCUS_11890 3731 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4044 3757 gene locus_tag LOCUS_11900 4044 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5156 4563 gene locus_tag LOCUS_11910 5156 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6709 5483 gene locus_tag LOCUS_11920 6709 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7756 7112 gene locus_tag LOCUS_11930 7756 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 16098 7984 gene locus_tag LOCUS_11940 16098 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 16321 17541 gene locus_tag LOCUS_11950 16321 17541 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_11950 17623 19242 gene locus_tag LOCUS_11960 17623 19242 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_11960 20708 19302 gene locus_tag LOCUS_11970 gene nagA 20708 19302 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_11970 21868 20762 gene locus_tag LOCUS_11980 gene nagX 21868 20762 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_11980 23222 22128 gene locus_tag LOCUS_11990 23222 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 23374 24705 gene locus_tag LOCUS_12000 23374 24705 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 protein_id gnl|my_center|LOCUS_12000 25002 26837 gene locus_tag LOCUS_12010 gene glmS 25002 26837 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_12010 26866 29076 gene locus_tag LOCUS_12020 26866 29076 CDS product DUF4954 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956822.1 protein_id gnl|my_center|LOCUS_12020 29314 31281 gene locus_tag LOCUS_12030 29314 31281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 31357 32961 gene locus_tag LOCUS_12040 31357 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 34208 32958 gene locus_tag LOCUS_12050 34208 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 34317 34904 gene locus_tag LOCUS_12060 34317 34904 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_12060 35921 34920 gene locus_tag LOCUS_12070 35921 34920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 37062 35986 gene locus_tag LOCUS_12080 gene idh 37062 35986 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_12080 37958 37131 gene locus_tag LOCUS_12090 37958 37131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_12090 41097 37993 gene locus_tag LOCUS_12100 41097 37993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 41996 41112 gene locus_tag LOCUS_12110 41996 41112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 42789 42028 gene locus_tag LOCUS_12120 42789 42028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 44114 42816 gene locus_tag LOCUS_12130 44114 42816 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_12130 44306 47191 gene locus_tag LOCUS_12140 44306 47191 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_12140 47279 48772 gene locus_tag LOCUS_12150 47279 48772 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_12150 49708 48836 gene locus_tag LOCUS_12160 49708 48836 CDS product regucalcin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181677.1 protein_id gnl|my_center|LOCUS_12160 50652 49768 gene locus_tag LOCUS_12170 50652 49768 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_12170 51466 50675 gene locus_tag LOCUS_12180 51466 50675 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_12180 52494 51469 gene locus_tag LOCUS_12190 52494 51469 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120389.1 protein_id gnl|my_center|LOCUS_12190 53215 52517 gene locus_tag LOCUS_12200 53215 52517 CDS product D-arabino 3-hexulose 6-phosphate aldehyde lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_12200 53668 54024 gene locus_tag LOCUS_12210 53668 54024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 54027 55175 gene locus_tag LOCUS_12220 54027 55175 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_12220 56240 55218 gene locus_tag LOCUS_12230 56240 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 57417 56245 gene locus_tag LOCUS_12240 57417 56245 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_12240 59147 57414 gene locus_tag LOCUS_12250 59147 57414 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_12250 59770 59573 gene locus_tag LOCUS_12260 59770 59573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 59829 65351 gene locus_tag LOCUS_12270 59829 65351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 65836 71556 gene locus_tag LOCUS_12280 65836 71556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 71553 72584 gene locus_tag LOCUS_12290 71553 72584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 72989 72771 gene locus_tag LOCUS_12300 72989 72771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 72916 73149 gene locus_tag LOCUS_12310 72916 73149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 73394 74773 gene locus_tag LOCUS_12320 73394 74773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 74853 76055 gene locus_tag LOCUS_12330 74853 76055 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_12330 76604 76155 gene locus_tag LOCUS_12340 76604 76155 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_12340 77118 78134 gene locus_tag LOCUS_12350 77118 78134 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_12350 78131 79750 gene locus_tag LOCUS_12360 gene lig2 78131 79750 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_12360 80046 79912 gene locus_tag LOCUS_12370 80046 79912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 80060 80599 gene locus_tag LOCUS_12380 80060 80599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 81254 82333 gene locus_tag LOCUS_12390 81254 82333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 82409 83494 gene locus_tag LOCUS_12400 82409 83494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 83685 85082 gene locus_tag LOCUS_12410 gene atoE 83685 85082 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44051 protein_id gnl|my_center|LOCUS_12410 86246 85221 gene locus_tag LOCUS_12420 gene fjo19 86246 85221 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_12420 89105 86271 gene locus_tag LOCUS_12430 gene rapA 89105 86271 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL5 protein_id gnl|my_center|LOCUS_12430 89556 90548 gene locus_tag LOCUS_12440 89556 90548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_12440 90759 91340 gene locus_tag LOCUS_12450 90759 91340 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_12450 91549 92049 gene locus_tag LOCUS_12460 91549 92049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 92499 94340 gene locus_tag LOCUS_12470 92499 94340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 95107 95448 gene locus_tag LOCUS_12480 95107 95448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 95599 96561 gene locus_tag LOCUS_12490 95599 96561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 96712 97107 gene locus_tag LOCUS_12500 96712 97107 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_12500 97134 97670 gene locus_tag LOCUS_12510 97134 97670 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_12510 97723 98265 gene locus_tag LOCUS_12520 97723 98265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_12520 98639 98295 gene locus_tag LOCUS_12530 98639 98295 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_12530 98734 99393 gene locus_tag LOCUS_12540 98734 99393 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 protein_id gnl|my_center|LOCUS_12540 99718 101274 gene locus_tag LOCUS_12550 99718 101274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 101311 101802 gene locus_tag LOCUS_12560 101311 101802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 102416 105436 gene locus_tag LOCUS_12570 102416 105436 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_12570 105453 106943 gene locus_tag LOCUS_12580 105453 106943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_12580 106962 109094 gene locus_tag LOCUS_12590 106962 109094 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_12590 109106 110653 gene locus_tag LOCUS_12600 gene aslA 109106 110653 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_12600 110769 112085 gene locus_tag LOCUS_12610 110769 112085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 112505 113401 gene locus_tag LOCUS_12620 112505 113401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 113456 114106 gene locus_tag LOCUS_12630 113456 114106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 115794 114700 gene locus_tag LOCUS_12640 115794 114700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 117183 115819 gene locus_tag LOCUS_12650 117183 115819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_12650 117814 118053 gene locus_tag LOCUS_12660 117814 118053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_12660 118074 119669 gene locus_tag LOCUS_12670 118074 119669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 119878 122097 gene locus_tag LOCUS_12680 119878 122097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 122896 123555 gene locus_tag LOCUS_12690 122896 123555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 123944 124768 gene locus_tag LOCUS_12700 123944 124768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 124964 125371 gene locus_tag LOCUS_12710 124964 125371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 125551 126318 gene locus_tag LOCUS_12720 125551 126318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 126530 130291 gene locus_tag LOCUS_12730 126530 130291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 130427 131602 gene locus_tag LOCUS_12740 130427 131602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 131613 132200 gene locus_tag LOCUS_12750 131613 132200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 132209 132655 gene locus_tag LOCUS_12760 132209 132655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 132676 132993 gene locus_tag LOCUS_12770 132676 132993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 132994 133383 gene locus_tag LOCUS_12780 132994 133383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 133639 134097 gene locus_tag LOCUS_12790 133639 134097 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81I71 protein_id gnl|my_center|LOCUS_12790 134101 135051 gene locus_tag LOCUS_12800 gene rlmF 134101 135051 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_12800 135399 137618 gene locus_tag LOCUS_12810 gene nicT 135399 137618 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_12810 138613 137714 gene locus_tag LOCUS_12820 138613 137714 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 protein_id gnl|my_center|LOCUS_12820 139038 139769 gene locus_tag LOCUS_12830 139038 139769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_12830 139803 140264 gene locus_tag LOCUS_12840 139803 140264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 140278 140697 gene locus_tag LOCUS_12850 140278 140697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_12850 141278 144697 gene locus_tag LOCUS_12860 141278 144697 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_12860 144709 146484 gene locus_tag LOCUS_12870 144709 146484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202633.1 protein_id gnl|my_center|LOCUS_12870 146898 147575 gene locus_tag LOCUS_12880 146898 147575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 147962 148540 gene locus_tag LOCUS_12890 147962 148540 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_12890 148606 148968 gene locus_tag LOCUS_12900 148606 148968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 protein_id gnl|my_center|LOCUS_12900 149313 150269 gene locus_tag LOCUS_12910 149313 150269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 150431 151348 gene locus_tag LOCUS_12920 150431 151348 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_12920 151355 152017 gene locus_tag LOCUS_12930 151355 152017 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_12930 152464 153531 gene locus_tag LOCUS_12940 152464 153531 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_12940 154980 153724 gene locus_tag LOCUS_12950 154980 153724 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_12950 156677 155136 gene locus_tag LOCUS_12960 156677 155136 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_12960 157147 158259 gene locus_tag LOCUS_12970 gene pntA 157147 158259 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_12970 158261 158578 gene locus_tag LOCUS_12980 158261 158578 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_12980 158581 159951 gene locus_tag LOCUS_12990 gene pntB 158581 159951 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZW9 protein_id gnl|my_center|LOCUS_12990 160670 160047 gene locus_tag LOCUS_13000 160670 160047 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_13000 164551 160796 gene locus_tag LOCUS_13010 164551 160796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 164815 166716 gene locus_tag LOCUS_13020 164815 166716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 166713 168623 gene locus_tag LOCUS_13030 166713 168623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 169369 168830 gene locus_tag LOCUS_13040 169369 168830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 170010 169681 gene locus_tag LOCUS_13050 170010 169681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_13050 170857 170024 gene locus_tag LOCUS_13060 170857 170024 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 protein_id gnl|my_center|LOCUS_13060 171961 170876 gene locus_tag LOCUS_13070 gene fabH1 171961 170876 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_13070 172963 172328 gene locus_tag LOCUS_13080 172963 172328 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_13080 173193 173265 gene locus_tag LOCUS_t00060 173193 173265 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 175249 173402 gene locus_tag LOCUS_13090 175249 173402 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_13090 176219 175749 gene locus_tag LOCUS_13100 176219 175749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 177618 176320 gene locus_tag LOCUS_13110 177618 176320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 177852 180089 gene locus_tag LOCUS_13120 gene ychM 177852 180089 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067022.1 protein_id gnl|my_center|LOCUS_13120 180130 180963 gene locus_tag LOCUS_13130 180130 180963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_13130 181673 180969 gene locus_tag LOCUS_13140 181673 180969 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_13140 182439 181675 gene locus_tag LOCUS_13150 182439 181675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 182908 185280 gene locus_tag LOCUS_13160 182908 185280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_13160 187206 185815 gene locus_tag LOCUS_13170 187206 185815 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108068.1 protein_id gnl|my_center|LOCUS_13170 190352 187212 gene locus_tag LOCUS_13180 190352 187212 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_13180 191471 190359 gene locus_tag LOCUS_13190 191471 190359 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_13190 192087 191515 gene locus_tag LOCUS_13200 192087 191515 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_13200 192427 194679 gene locus_tag LOCUS_13210 192427 194679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 194865 195161 gene locus_tag LOCUS_13220 194865 195161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 196074 195151 gene locus_tag LOCUS_13230 196074 195151 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_13230 197079 196252 gene locus_tag LOCUS_13240 197079 196252 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_13240 197543 198973 gene locus_tag LOCUS_13250 gene yrbD 197543 198973 CDS product putative sodium/proton-dependent alanine carrier protein YrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32060 protein_id gnl|my_center|LOCUS_13250 199127 201364 gene locus_tag LOCUS_13260 199127 201364 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_13260 201373 203142 gene locus_tag LOCUS_13270 201373 203142 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_13270 204856 203267 gene locus_tag LOCUS_13280 204856 203267 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_13280 206261 204885 gene locus_tag LOCUS_13290 206261 204885 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_13290 207830 206565 gene locus_tag LOCUS_13300 207830 206565 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_13300 208754 207843 gene locus_tag LOCUS_13310 208754 207843 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 protein_id gnl|my_center|LOCUS_13310 209903 208866 gene locus_tag LOCUS_13320 gene cydB 209903 208866 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_13320 211292 209910 gene locus_tag LOCUS_13330 gene cydA 211292 209910 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_13330 211582 211899 gene locus_tag LOCUS_13340 211582 211899 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_13340 211936 212790 gene locus_tag LOCUS_13350 211936 212790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13350 212791 213684 gene locus_tag LOCUS_13360 212791 213684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13360 214119 213721 gene locus_tag LOCUS_13370 214119 213721 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 protein_id gnl|my_center|LOCUS_13370 215710 214184 gene locus_tag LOCUS_13380 215710 214184 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_13380 215892 216824 gene locus_tag LOCUS_13390 215892 216824 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_13390 217160 219469 gene locus_tag LOCUS_13400 217160 219469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 221804 219594 gene locus_tag LOCUS_13410 221804 219594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 223123 221906 gene locus_tag LOCUS_13420 223123 221906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 224961 223234 gene locus_tag LOCUS_13430 224961 223234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_13430 228265 225044 gene locus_tag LOCUS_13440 228265 225044 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_13440 228470 229081 gene locus_tag LOCUS_13450 228470 229081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 229398 231473 gene locus_tag LOCUS_13460 229398 231473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 231710 233098 gene locus_tag LOCUS_13470 gene speA 231710 233098 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_13470 233283 233101 gene locus_tag LOCUS_13480 233283 233101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 235387 233720 gene locus_tag LOCUS_13490 235387 233720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 235703 236242 gene locus_tag LOCUS_13500 235703 236242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 237628 236417 gene locus_tag LOCUS_13510 gene argJ 237628 236417 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG63 protein_id gnl|my_center|LOCUS_13510 238685 237642 gene locus_tag LOCUS_13520 gene argC 238685 237642 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GH7 protein_id gnl|my_center|LOCUS_13520 239877 238672 gene locus_tag LOCUS_13530 239877 238672 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_13530 240704 239880 gene locus_tag LOCUS_13540 240704 239880 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496896.1 protein_id gnl|my_center|LOCUS_13540 241782 241015 gene locus_tag LOCUS_13550 241782 241015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817333.1 protein_id gnl|my_center|LOCUS_13550 243250 241799 gene locus_tag LOCUS_13560 243250 241799 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_13560 244599 243253 gene locus_tag LOCUS_13570 244599 243253 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_13570 246712 244712 gene locus_tag LOCUS_13580 gene glgB 246712 244712 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L3 protein_id gnl|my_center|LOCUS_13580 248177 246759 gene locus_tag LOCUS_13590 248177 246759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 249277 248225 gene locus_tag LOCUS_13600 249277 248225 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_13600 250540 249332 gene locus_tag LOCUS_13610 250540 249332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058301.1 protein_id gnl|my_center|LOCUS_13610 251410 252225 gene locus_tag LOCUS_13620 251410 252225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 252944 252228 gene locus_tag LOCUS_13630 252944 252228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_13630 254741 253398 gene locus_tag LOCUS_13640 254741 253398 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_13640 255290 254859 gene locus_tag LOCUS_13650 255290 254859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13650 256111 255242 gene locus_tag LOCUS_13660 256111 255242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13660 256817 259810 gene locus_tag LOCUS_13670 256817 259810 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_13670 259829 261499 gene locus_tag LOCUS_13680 259829 261499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767367.1 protein_id gnl|my_center|LOCUS_13680 264990 261724 gene locus_tag LOCUS_13690 264990 261724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 266833 265337 gene locus_tag LOCUS_13700 266833 265337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 267295 267903 gene locus_tag LOCUS_13710 267295 267903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_13710 268038 269927 gene locus_tag LOCUS_13720 268038 269927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 271227 270103 gene locus_tag LOCUS_13730 271227 270103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 272605 271235 gene locus_tag LOCUS_13740 272605 271235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_13740 274195 272747 gene locus_tag LOCUS_13750 274195 272747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_13750 277450 274238 gene locus_tag LOCUS_13760 277450 274238 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_13760 278784 277696 gene locus_tag LOCUS_13770 278784 277696 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_13770 279456 280088 gene locus_tag LOCUS_13780 279456 280088 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_13780 280129 281184 gene locus_tag LOCUS_13790 280129 281184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 281415 284651 gene locus_tag LOCUS_13800 281415 284651 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_13800 284712 286112 gene locus_tag LOCUS_13810 284712 286112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_13810 286228 288870 gene locus_tag LOCUS_13820 286228 288870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 288895 290436 gene locus_tag LOCUS_13830 288895 290436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_13830 292312 290630 gene locus_tag LOCUS_13840 292312 290630 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_13840 294032 292323 gene locus_tag LOCUS_13850 294032 292323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 297165 294046 gene locus_tag LOCUS_13860 297165 294046 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_13860 298051 297437 gene locus_tag LOCUS_13870 298051 297437 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107550.1 protein_id gnl|my_center|LOCUS_13870 301428 298477 gene locus_tag LOCUS_13880 301428 298477 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_13880 301562 302533 gene locus_tag LOCUS_13890 gene mtnK 301562 302533 CDS product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HED2 protein_id gnl|my_center|LOCUS_13890 302520 303788 gene locus_tag LOCUS_13900 302520 303788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 303831 304706 gene locus_tag LOCUS_13910 303831 304706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_13910 305822 305217 gene locus_tag LOCUS_13920 305822 305217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 306226 305819 gene locus_tag LOCUS_13930 306226 305819 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_13930 307920 306556 gene locus_tag LOCUS_13940 307920 306556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 308481 308200 gene locus_tag LOCUS_13950 308481 308200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 309420 308683 gene locus_tag LOCUS_13960 309420 308683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 311434 309878 gene locus_tag LOCUS_13970 311434 309878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_13970 314514 311452 gene locus_tag LOCUS_13980 314514 311452 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_13980 317137 315536 gene locus_tag LOCUS_13990 317137 315536 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_13990 320028 317149 gene locus_tag LOCUS_14000 320028 317149 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_14000 322133 320856 gene locus_tag LOCUS_14010 322133 320856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 323664 322225 gene locus_tag LOCUS_14020 323664 322225 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_14020 326629 323669 gene locus_tag LOCUS_14030 326629 323669 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120738.1 protein_id gnl|my_center|LOCUS_14030 327286 330408 gene locus_tag LOCUS_14040 327286 330408 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_14040 330433 332277 gene locus_tag LOCUS_14050 330433 332277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767367.1 protein_id gnl|my_center|LOCUS_14050 332552 332959 gene locus_tag LOCUS_14060 332552 332959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 332956 333156 gene locus_tag LOCUS_14070 332956 333156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_14070 334749 333451 gene locus_tag LOCUS_14080 334749 333451 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_14080 335241 334753 gene locus_tag LOCUS_14090 335241 334753 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_14090 336240 335245 gene locus_tag LOCUS_14100 336240 335245 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_14100 336623 338269 gene locus_tag LOCUS_14110 336623 338269 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529531.1 protein_id gnl|my_center|LOCUS_14110 338294 339109 gene locus_tag LOCUS_14120 338294 339109 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_14120 339106 340299 gene locus_tag LOCUS_14130 gene uxuA 339106 340299 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_14130 340335 341693 gene locus_tag LOCUS_14140 340335 341693 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_14140 343278 341866 gene locus_tag LOCUS_14150 343278 341866 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_14150 343379 346660 gene locus_tag LOCUS_14160 343379 346660 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_14160 347413 346661 gene locus_tag LOCUS_14170 347413 346661 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965495.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence06 2644 326 gene locus_tag LOCUS_14180 2644 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4137 2728 gene locus_tag LOCUS_14190 4137 2728 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_14190 7233 4162 gene locus_tag LOCUS_14200 7233 4162 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_14200 9613 8096 gene locus_tag LOCUS_14210 9613 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_14210 10740 9613 gene locus_tag LOCUS_14220 10740 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 12141 10756 gene locus_tag LOCUS_14230 gene GALNS 12141 10756 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_14230 13097 12216 gene locus_tag LOCUS_14240 13097 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 14075 13134 gene locus_tag LOCUS_14250 14075 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15437 14106 gene locus_tag LOCUS_14260 15437 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 16357 15551 gene locus_tag LOCUS_14270 16357 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 17264 16344 gene locus_tag LOCUS_14280 17264 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 18770 17295 gene locus_tag LOCUS_14290 18770 17295 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_14290 21836 18798 gene locus_tag LOCUS_14300 21836 18798 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_14300 22464 22994 gene locus_tag LOCUS_14310 22464 22994 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_14310 22991 23656 gene locus_tag LOCUS_14320 22991 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23703 24440 gene locus_tag LOCUS_14330 23703 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 25260 28436 gene locus_tag LOCUS_14340 25260 28436 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202210.1 protein_id gnl|my_center|LOCUS_14340 28486 30507 gene locus_tag LOCUS_14350 28486 30507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 30617 31960 gene locus_tag LOCUS_14360 30617 31960 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_14360 32076 33116 gene locus_tag LOCUS_14370 32076 33116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 33149 34027 gene locus_tag LOCUS_14380 33149 34027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 34135 35457 gene locus_tag LOCUS_14390 34135 35457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 37761 36271 gene locus_tag LOCUS_14400 37761 36271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122307.1 protein_id gnl|my_center|LOCUS_14400 39354 37819 gene locus_tag LOCUS_14410 39354 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_14410 40909 39410 gene locus_tag LOCUS_14420 40909 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_14420 45240 41344 gene locus_tag LOCUS_14430 45240 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 45414 46700 gene locus_tag LOCUS_14440 45414 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_14440 48376 47114 gene locus_tag LOCUS_14450 gene amaA 48376 47114 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_14450 48531 48971 gene locus_tag LOCUS_14460 48531 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 49079 49954 gene locus_tag LOCUS_14470 49079 49954 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_14470 51448 50261 gene locus_tag LOCUS_14480 51448 50261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 52502 51492 gene locus_tag LOCUS_14490 52502 51492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123831.1 protein_id gnl|my_center|LOCUS_14490 54056 52554 gene locus_tag LOCUS_14500 54056 52554 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118678.1 protein_id gnl|my_center|LOCUS_14500 55636 54155 gene locus_tag LOCUS_14510 55636 54155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_14510 58797 55654 gene locus_tag LOCUS_14520 58797 55654 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_14520 60622 59180 gene locus_tag LOCUS_14530 60622 59180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 62045 60624 gene locus_tag LOCUS_14540 62045 60624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 63023 62496 gene locus_tag LOCUS_14550 63023 62496 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761425.1 protein_id gnl|my_center|LOCUS_14550 66107 63495 gene locus_tag LOCUS_14560 gene chb 66107 63495 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_14560 66325 67281 gene locus_tag LOCUS_14570 66325 67281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_14570 67337 69151 gene locus_tag LOCUS_14580 67337 69151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 69879 69184 gene locus_tag LOCUS_14590 69879 69184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 70927 69869 gene locus_tag LOCUS_14600 70927 69869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 71438 72016 gene locus_tag LOCUS_14610 gene tdk 71438 72016 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_14610 72028 72714 gene locus_tag LOCUS_14620 gene recO 72028 72714 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM7 protein_id gnl|my_center|LOCUS_14620 73498 72731 gene locus_tag LOCUS_14630 73498 72731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 73720 74700 gene locus_tag LOCUS_14640 73720 74700 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_14640 74710 75918 gene locus_tag LOCUS_14650 74710 75918 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_14650 77209 75992 gene locus_tag LOCUS_14660 77209 75992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 77588 77959 gene locus_tag LOCUS_14670 77588 77959 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_14670 78400 79473 gene locus_tag LOCUS_14680 78400 79473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 79829 81301 gene locus_tag LOCUS_14690 79829 81301 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_14690 81352 82062 gene locus_tag LOCUS_14700 81352 82062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 protein_id gnl|my_center|LOCUS_14700 82103 82702 gene locus_tag LOCUS_14710 82103 82702 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_14710 83211 82813 gene locus_tag LOCUS_14720 83211 82813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 83670 83230 gene locus_tag LOCUS_14730 83670 83230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 83961 83680 gene locus_tag LOCUS_14740 83961 83680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 85563 84562 gene locus_tag LOCUS_14750 85563 84562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 protein_id gnl|my_center|LOCUS_14750 86616 85942 gene locus_tag LOCUS_14760 86616 85942 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_14760 87040 86684 gene locus_tag LOCUS_14770 87040 86684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 89224 87494 gene locus_tag LOCUS_14780 89224 87494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 90767 89400 gene locus_tag LOCUS_14790 90767 89400 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_14790 91474 90905 gene locus_tag LOCUS_14800 91474 90905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_14800 94639 91889 gene locus_tag LOCUS_14810 94639 91889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 95006 95079 gene locus_tag LOCUS_t00070 95006 95079 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 95558 97156 gene locus_tag LOCUS_14820 95558 97156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637181.2 protein_id gnl|my_center|LOCUS_14820 98150 97413 gene locus_tag LOCUS_14830 gene surE 98150 97413 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W92 protein_id gnl|my_center|LOCUS_14830 99259 98465 gene locus_tag LOCUS_14840 99259 98465 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_14840 100918 101340 gene locus_tag LOCUS_14850 100918 101340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 102486 104315 gene locus_tag LOCUS_14860 102486 104315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887627.1 protein_id gnl|my_center|LOCUS_14860 104330 105370 gene locus_tag LOCUS_14870 gene gshB 104330 105370 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_14870 106374 105463 gene locus_tag LOCUS_14880 106374 105463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 106648 107538 gene locus_tag LOCUS_14890 106648 107538 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_14890 109874 107712 gene locus_tag LOCUS_14900 109874 107712 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_14900 111983 110979 gene locus_tag LOCUS_14910 111983 110979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_14910 112948 111980 gene locus_tag LOCUS_14920 112948 111980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 113738 112956 gene locus_tag LOCUS_14930 113738 112956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 114034 114861 gene locus_tag LOCUS_14940 114034 114861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 114943 115347 gene locus_tag LOCUS_14950 114943 115347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 115574 116176 gene locus_tag LOCUS_14960 115574 116176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814895.1 protein_id gnl|my_center|LOCUS_14960 116357 116956 gene locus_tag LOCUS_14970 116357 116956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_14970 117660 117800 gene locus_tag LOCUS_14980 117660 117800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 117962 119200 gene locus_tag LOCUS_14990 117962 119200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_14990 119304 119588 gene locus_tag LOCUS_15000 119304 119588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 119948 120775 gene locus_tag LOCUS_15010 119948 120775 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_15010 122297 121029 gene locus_tag LOCUS_15020 122297 121029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_15020 122516 123100 gene locus_tag LOCUS_15030 122516 123100 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104095.1 protein_id gnl|my_center|LOCUS_15030 123113 124186 gene locus_tag LOCUS_15040 gene adh 123113 124186 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_15040 124257 125408 gene locus_tag LOCUS_15050 124257 125408 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_15050 125411 126094 gene locus_tag LOCUS_15060 125411 126094 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_15060 126261 127004 gene locus_tag LOCUS_15070 126261 127004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 128297 127158 gene locus_tag LOCUS_15080 128297 127158 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_15080 129066 128461 gene locus_tag LOCUS_15090 129066 128461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 129773 129546 gene locus_tag LOCUS_15100 129773 129546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 130189 130845 gene locus_tag LOCUS_15110 gene tal 130189 130845 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_15110 130929 131132 gene locus_tag LOCUS_15120 130929 131132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 131134 131847 gene locus_tag LOCUS_15130 gene ftsE 131134 131847 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_15130 132148 132333 gene locus_tag LOCUS_15140 132148 132333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 132396 132926 gene locus_tag LOCUS_15150 132396 132926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 134024 133155 gene locus_tag LOCUS_15160 gene ykuF 134024 133155 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_15160 134092 134958 gene locus_tag LOCUS_15170 134092 134958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 136000 135050 gene locus_tag LOCUS_15180 136000 135050 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_15180 136152 137198 gene locus_tag LOCUS_15190 gene murB 136152 137198 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY7 protein_id gnl|my_center|LOCUS_15190 137677 137195 gene locus_tag LOCUS_15200 137677 137195 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_15200 138289 138660 gene locus_tag LOCUS_15210 138289 138660 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_15210 138851 139000 gene locus_tag LOCUS_15220 138851 139000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 141190 139592 gene locus_tag LOCUS_15230 141190 139592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_15230 141306 141740 gene locus_tag LOCUS_15240 gene ppi 141306 141740 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_15240 143117 141777 gene locus_tag LOCUS_15250 143117 141777 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_15250 143841 143233 gene locus_tag LOCUS_15260 143841 143233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_15260 144813 143848 gene locus_tag LOCUS_15270 gene etfA 144813 143848 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_15270 145556 144825 gene locus_tag LOCUS_15280 gene etfB 145556 144825 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_15280 145610 145942 gene locus_tag LOCUS_15290 145610 145942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 147522 145939 gene locus_tag LOCUS_15300 gene dnaB 147522 145939 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_15300 148162 148965 gene locus_tag LOCUS_15310 148162 148965 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_15310 149160 149663 gene locus_tag LOCUS_15320 149160 149663 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_15320 150274 149843 gene locus_tag LOCUS_15330 150274 149843 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_15330 151658 150714 gene locus_tag LOCUS_15340 151658 150714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 151962 152864 gene locus_tag LOCUS_15350 151962 152864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 154199 152868 gene locus_tag LOCUS_15360 154199 152868 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_15360 155862 154378 gene locus_tag LOCUS_15370 155862 154378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881379.1 protein_id gnl|my_center|LOCUS_15370 155993 156067 gene locus_tag LOCUS_t00080 155993 156067 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 156123 156196 gene locus_tag LOCUS_t00090 156123 156196 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 159035 156255 gene locus_tag LOCUS_15380 gene acoA 159035 156255 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMF6 protein_id gnl|my_center|LOCUS_15380 160146 159172 gene locus_tag LOCUS_15390 160146 159172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 160895 160143 gene locus_tag LOCUS_15400 160895 160143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_15400 161694 160897 gene locus_tag LOCUS_15410 161694 160897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_15410 162116 161748 gene locus_tag LOCUS_15420 162116 161748 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_15420 165611 162735 gene locus_tag LOCUS_15430 165611 162735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_15430 168824 165612 gene locus_tag LOCUS_15440 168824 165612 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UE7 protein_id gnl|my_center|LOCUS_15440 169049 169765 gene locus_tag LOCUS_15450 169049 169765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_15450 170242 169784 gene locus_tag LOCUS_15460 170242 169784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 171257 170511 gene locus_tag LOCUS_15470 gene cutC 171257 170511 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJF2 protein_id gnl|my_center|LOCUS_15470 172255 171272 gene locus_tag LOCUS_15480 172255 171272 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_15480 172528 173772 gene locus_tag LOCUS_15490 172528 173772 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_15490 173799 176126 gene locus_tag LOCUS_15500 173799 176126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 176291 177190 gene locus_tag LOCUS_15510 176291 177190 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_15510 177506 178891 gene locus_tag LOCUS_15520 177506 178891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 179462 178893 gene locus_tag LOCUS_15530 179462 178893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759723.1 protein_id gnl|my_center|LOCUS_15530 180822 179776 gene locus_tag LOCUS_15540 180822 179776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 181946 181218 gene locus_tag LOCUS_15550 181946 181218 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_15550 182860 181949 gene locus_tag LOCUS_15560 gene ilvE2 182860 181949 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_15560 183887 182922 gene locus_tag LOCUS_15570 gene kel 183887 182922 CDS product ring canal kelch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119438.1 protein_id gnl|my_center|LOCUS_15570 184350 184853 gene locus_tag LOCUS_15580 184350 184853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 186373 185081 gene locus_tag LOCUS_15590 186373 185081 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_15590 187343 186399 gene locus_tag LOCUS_15600 gene thrB 187343 186399 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_15600 189792 187345 gene locus_tag LOCUS_15610 189792 187345 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_15610 191011 190358 gene locus_tag LOCUS_15620 191011 190358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 191751 191071 gene locus_tag LOCUS_15630 191751 191071 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405482.1 protein_id gnl|my_center|LOCUS_15630 191837 192721 gene locus_tag LOCUS_15640 191837 192721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 192705 193043 gene locus_tag LOCUS_15650 gene ogt2 192705 193043 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_15650 193642 194049 gene locus_tag LOCUS_15660 193642 194049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 195468 194167 gene locus_tag LOCUS_15670 195468 194167 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_15670 195666 195953 gene locus_tag LOCUS_15680 195666 195953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 195966 196586 gene locus_tag LOCUS_15690 gene recR 195966 196586 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_15690 196629 196703 gene locus_tag LOCUS_t00100 196629 196703 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 196937 200512 gene locus_tag LOCUS_15700 196937 200512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 201940 200780 gene locus_tag LOCUS_15710 201940 200780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_15710 203311 202001 gene locus_tag LOCUS_15720 gene rimO 203311 202001 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_15720 203777 204421 gene locus_tag LOCUS_15730 gene yplQ 203777 204421 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54175 protein_id gnl|my_center|LOCUS_15730 204592 204984 gene locus_tag LOCUS_15740 204592 204984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_15740 205703 205032 gene locus_tag LOCUS_15750 205703 205032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 206052 207719 gene locus_tag LOCUS_15760 206052 207719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 208481 207720 gene locus_tag LOCUS_15770 208481 207720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 208731 209861 gene locus_tag LOCUS_15780 208731 209861 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_15780 211648 210002 gene locus_tag LOCUS_15790 gene pgi 211648 210002 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_15790 212337 214451 gene locus_tag LOCUS_15800 212337 214451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 214752 215393 gene locus_tag LOCUS_15810 214752 215393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 216896 215412 gene locus_tag LOCUS_15820 216896 215412 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_15820 217899 217015 gene locus_tag LOCUS_15830 217899 217015 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_15830 219177 218008 gene locus_tag LOCUS_15840 219177 218008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_15840 220774 219179 gene locus_tag LOCUS_15850 gene fucI 220774 219179 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 protein_id gnl|my_center|LOCUS_15850 222096 220906 gene locus_tag LOCUS_15860 222096 220906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 223126 222143 gene locus_tag LOCUS_15870 223126 222143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 223201 223404 gene locus_tag LOCUS_15880 223201 223404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 223468 224835 gene locus_tag LOCUS_15890 223468 224835 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_15890 224832 225941 gene locus_tag LOCUS_15900 224832 225941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 227537 226065 gene locus_tag LOCUS_15910 227537 226065 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_15910 227954 227703 gene locus_tag LOCUS_15920 227954 227703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_15920 229103 228420 gene locus_tag LOCUS_15930 229103 228420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 229839 229294 gene locus_tag LOCUS_15940 229839 229294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 230750 229974 gene locus_tag LOCUS_15950 230750 229974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 231144 231902 gene locus_tag LOCUS_15960 231144 231902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 232202 232990 gene locus_tag LOCUS_15970 232202 232990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 233232 238085 gene locus_tag LOCUS_15980 233232 238085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_15980 238385 238227 gene locus_tag LOCUS_15990 238385 238227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 239108 238893 gene locus_tag LOCUS_16000 239108 238893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 240077 239817 gene locus_tag LOCUS_16010 240077 239817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 240696 240421 gene locus_tag LOCUS_16020 240696 240421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 241968 240859 gene locus_tag LOCUS_16030 241968 240859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097975.1 protein_id gnl|my_center|LOCUS_16030 242770 242444 gene locus_tag LOCUS_16040 242770 242444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_16040 243632 243180 gene locus_tag LOCUS_16050 243632 243180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 244960 243668 gene locus_tag LOCUS_16060 gene pepP 244960 243668 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_16060 245364 245101 gene locus_tag LOCUS_16070 245364 245101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 246575 245874 gene locus_tag LOCUS_16080 246575 245874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 247554 246646 gene locus_tag LOCUS_16090 247554 246646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 248003 247665 gene locus_tag LOCUS_16100 248003 247665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 249369 248113 gene locus_tag LOCUS_16110 249369 248113 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_16110 251633 249876 gene locus_tag LOCUS_16120 251633 249876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 254874 251662 gene locus_tag LOCUS_16130 254874 251662 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_16130 256577 256011 gene locus_tag LOCUS_16140 256577 256011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 257294 258172 gene locus_tag LOCUS_16150 257294 258172 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_16150 259348 258239 gene locus_tag LOCUS_16160 259348 258239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 260887 259541 gene locus_tag LOCUS_16170 260887 259541 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027211.1 protein_id gnl|my_center|LOCUS_16170 261945 260920 gene locus_tag LOCUS_16180 261945 260920 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_16180 263234 262110 gene locus_tag LOCUS_16190 263234 262110 CDS product dehydrogenase MviM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706516.1 protein_id gnl|my_center|LOCUS_16190 264072 263221 gene locus_tag LOCUS_16200 264072 263221 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975359.1 protein_id gnl|my_center|LOCUS_16200 265017 264106 gene locus_tag LOCUS_16210 265017 264106 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_16210 268087 265055 gene locus_tag LOCUS_16220 268087 265055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 269074 268142 gene locus_tag LOCUS_16230 269074 268142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 269884 269114 gene locus_tag LOCUS_16240 269884 269114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_16240 270910 269888 gene locus_tag LOCUS_16250 270910 269888 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_16250 271967 270948 gene locus_tag LOCUS_16260 271967 270948 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_16260 273755 272124 gene locus_tag LOCUS_16270 273755 272124 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_16270 276895 273773 gene locus_tag LOCUS_16280 276895 273773 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_16280 278966 277554 gene locus_tag LOCUS_16290 gene arsA 278966 277554 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_16290 279617 280417 gene locus_tag LOCUS_16300 279617 280417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 281934 281560 gene locus_tag LOCUS_16310 281934 281560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 282416 282583 gene locus_tag LOCUS_16320 282416 282583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 282602 283426 gene locus_tag LOCUS_16330 282602 283426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 283823 283644 gene locus_tag LOCUS_16340 283823 283644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 285324 284179 gene locus_tag LOCUS_16350 285324 284179 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_16350 286520 286008 gene locus_tag LOCUS_16360 286520 286008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 287462 286590 gene locus_tag LOCUS_16370 287462 286590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 289001 287463 gene locus_tag LOCUS_16380 289001 287463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 289059 289289 gene locus_tag LOCUS_16390 289059 289289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_16390 290296 289286 gene locus_tag LOCUS_16400 290296 289286 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_16400 290628 290296 gene locus_tag LOCUS_16410 290628 290296 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNB8 protein_id gnl|my_center|LOCUS_16410 292127 290751 gene locus_tag LOCUS_16420 gene hisS 292127 290751 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_16420 292293 292442 gene locus_tag LOCUS_16430 292293 292442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 292977 292477 gene locus_tag LOCUS_16440 292977 292477 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_16440 293261 294241 gene locus_tag LOCUS_16450 gene pdhB 293261 294241 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_16450 295741 294404 gene locus_tag LOCUS_16460 gene ffh 295741 294404 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_16460 296016 296510 gene locus_tag LOCUS_16470 296016 296510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 296967 301328 gene locus_tag LOCUS_16480 296967 301328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 301332 302306 gene locus_tag LOCUS_16490 301332 302306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 304138 302414 gene locus_tag LOCUS_16500 304138 302414 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_16500 304714 305418 gene locus_tag LOCUS_16510 304714 305418 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705346.1 protein_id gnl|my_center|LOCUS_16510 305654 308104 gene locus_tag LOCUS_16520 305654 308104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_16520 308097 308810 gene locus_tag LOCUS_16530 308097 308810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 308829 309851 gene locus_tag LOCUS_16540 308829 309851 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202150.1 protein_id gnl|my_center|LOCUS_16540 309914 311398 gene locus_tag LOCUS_16550 309914 311398 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_16550 313070 311784 gene locus_tag LOCUS_16560 313070 311784 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_16560 314586 313120 gene locus_tag LOCUS_16570 gene leuB 314586 313120 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_16570 315009 315794 gene locus_tag LOCUS_16580 gene crt 315009 315794 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_16580 315807 317324 gene locus_tag LOCUS_16590 315807 317324 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_16590 317326 317757 gene locus_tag LOCUS_16600 gene dut 317326 317757 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_16600 317933 319714 gene locus_tag LOCUS_16610 317933 319714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_16610 319707 320450 gene locus_tag LOCUS_16620 319707 320450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 320485 321705 gene locus_tag LOCUS_16630 320485 321705 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_16630 321820 322029 gene locus_tag LOCUS_16640 gene tatA 321820 322029 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC14 protein_id gnl|my_center|LOCUS_16640 322034 323467 gene locus_tag LOCUS_16650 gene gatA 322034 323467 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_16650 323471 324862 gene locus_tag LOCUS_16660 323471 324862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 324947 326035 gene locus_tag LOCUS_16670 324947 326035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 326070 328334 gene locus_tag LOCUS_16680 gene maeB 326070 328334 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_16680 328331 328933 gene locus_tag LOCUS_16690 gene ruvA 328331 328933 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_16690 329037 336116 gene locus_tag LOCUS_16700 gene sprA 329037 336116 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_16700 336169 336546 gene locus_tag LOCUS_16710 gene gcvH 336169 336546 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_16710 336595 336933 gene locus_tag LOCUS_16720 336595 336933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 336954 337682 gene locus_tag LOCUS_16730 336954 337682 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_16730 337764 338129 gene locus_tag LOCUS_16740 337764 338129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020650.1 protein_id gnl|my_center|LOCUS_16740 338606 338178 gene locus_tag LOCUS_16750 338606 338178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 340744 338879 gene locus_tag LOCUS_16760 340744 338879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 342220 340754 gene locus_tag LOCUS_16770 342220 340754 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_16770 343709 342516 gene locus_tag LOCUS_16780 343709 342516 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence07 341 1531 gene locus_tag LOCUS_16790 341 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2619 1921 gene locus_tag LOCUS_16800 2619 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3193 2840 gene locus_tag LOCUS_16810 3193 2840 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534198.1 protein_id gnl|my_center|LOCUS_16810 4358 5362 gene locus_tag LOCUS_16820 4358 5362 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_16820 5356 7185 gene locus_tag LOCUS_16830 5356 7185 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387211.1 protein_id gnl|my_center|LOCUS_16830 7175 8629 gene locus_tag LOCUS_16840 7175 8629 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_16840 8835 9446 gene locus_tag LOCUS_16850 8835 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_16850 9557 9748 gene locus_tag LOCUS_16860 9557 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16860 9760 10404 gene locus_tag LOCUS_16870 9760 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16870 10454 10915 gene locus_tag LOCUS_16880 10454 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11207 13336 gene locus_tag LOCUS_16890 11207 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122258.1 protein_id gnl|my_center|LOCUS_16890 13443 13970 gene locus_tag LOCUS_16900 13443 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 14135 14452 gene locus_tag LOCUS_16910 14135 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327465.1 protein_id gnl|my_center|LOCUS_16910 14701 15060 gene locus_tag LOCUS_16920 14701 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 15408 15866 gene locus_tag LOCUS_16930 15408 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 16551 17066 gene locus_tag LOCUS_16940 16551 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 17066 17524 gene locus_tag LOCUS_16950 17066 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_16950 18456 18986 gene locus_tag LOCUS_16960 gene folA2 18456 18986 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 protein_id gnl|my_center|LOCUS_16960 19154 19654 gene locus_tag LOCUS_16970 19154 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 19925 21376 gene locus_tag LOCUS_16980 19925 21376 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_16980 21383 22324 gene locus_tag LOCUS_16990 21383 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 22390 23073 gene locus_tag LOCUS_17000 22390 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_17000 23177 23743 gene locus_tag LOCUS_17010 23177 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 23769 24371 gene locus_tag LOCUS_17020 23769 24371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 24641 25429 gene locus_tag LOCUS_17030 24641 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 26486 25629 gene locus_tag LOCUS_17040 26486 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 27285 26581 gene locus_tag LOCUS_17050 27285 26581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_17050 28121 27552 gene locus_tag LOCUS_17060 28121 27552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 30610 28499 gene locus_tag LOCUS_17070 30610 28499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 33508 30641 gene locus_tag LOCUS_17080 33508 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 33969 35606 gene locus_tag LOCUS_17090 33969 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 37773 35794 gene locus_tag LOCUS_17100 37773 35794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_17100 38251 39126 gene locus_tag LOCUS_17110 38251 39126 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_17110 39123 40178 gene locus_tag LOCUS_17120 39123 40178 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_17120 40186 40989 gene locus_tag LOCUS_17130 gene hmuV 40186 40989 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_17130 41041 42090 gene locus_tag LOCUS_17140 gene hmuS 41041 42090 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_17140 42136 44433 gene locus_tag LOCUS_17150 42136 44433 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_17150 44454 45065 gene locus_tag LOCUS_17160 44454 45065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_17160 45401 45234 gene locus_tag LOCUS_17170 45401 45234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 46009 45428 gene locus_tag LOCUS_17180 46009 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 46813 46067 gene locus_tag LOCUS_17190 46813 46067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 47718 49565 gene locus_tag LOCUS_17200 47718 49565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 protein_id gnl|my_center|LOCUS_17200 49574 50470 gene locus_tag LOCUS_17210 49574 50470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_17210 51553 50558 gene locus_tag LOCUS_17220 51553 50558 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_17220 52684 51689 gene locus_tag LOCUS_17230 gene ydjJ 52684 51689 CDS product putative membrane protein YdjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34733 protein_id gnl|my_center|LOCUS_17230 53790 53038 gene locus_tag LOCUS_17240 53790 53038 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088364.1 protein_id gnl|my_center|LOCUS_17240 54764 53799 gene locus_tag LOCUS_17250 54764 53799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206832.1 protein_id gnl|my_center|LOCUS_17250 56142 54781 gene locus_tag LOCUS_17260 gene gntP 56142 54781 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_17260 56320 57036 gene locus_tag LOCUS_17270 56320 57036 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_17270 57041 57982 gene locus_tag LOCUS_17280 57041 57982 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_17280 58043 59710 gene locus_tag LOCUS_17290 58043 59710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 59965 62811 gene locus_tag LOCUS_17300 59965 62811 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_17300 63200 64702 gene locus_tag LOCUS_17310 63200 64702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 64797 67673 gene locus_tag LOCUS_17320 64797 67673 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_17320 67873 68601 gene locus_tag LOCUS_17330 67873 68601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 69415 72690 gene locus_tag LOCUS_17340 69415 72690 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_17340 72762 74231 gene locus_tag LOCUS_17350 72762 74231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 74521 75798 gene locus_tag LOCUS_17360 74521 75798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 77541 76129 gene locus_tag LOCUS_17370 77541 76129 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_17370 78370 77534 gene locus_tag LOCUS_17380 78370 77534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 80402 78393 gene locus_tag LOCUS_17390 80402 78393 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_17390 80908 80492 gene locus_tag LOCUS_17400 80908 80492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 81242 80898 gene locus_tag LOCUS_17410 81242 80898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 82854 81274 gene locus_tag LOCUS_17420 82854 81274 CDS product sigma factor sigB regulation protein rsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016890.1 protein_id gnl|my_center|LOCUS_17420 84910 83678 gene locus_tag LOCUS_17430 84910 83678 CDS product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_17430 85077 85748 gene locus_tag LOCUS_17440 85077 85748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263627.1 protein_id gnl|my_center|LOCUS_17440 87084 85780 gene locus_tag LOCUS_17450 gene phrB1 87084 85780 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_17450 91662 87124 gene locus_tag LOCUS_17460 91662 87124 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_17460 91736 92752 gene locus_tag LOCUS_17470 gene tsaD 91736 92752 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_17470 92745 93209 gene locus_tag LOCUS_17480 gene smpB 92745 93209 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_17480 93175 93990 gene locus_tag LOCUS_17490 93175 93990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 93990 94508 gene locus_tag LOCUS_17500 93990 94508 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_17500 94691 96472 gene locus_tag LOCUS_17510 94691 96472 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_17510 96920 99217 gene locus_tag LOCUS_17520 96920 99217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_17520 99217 99693 gene locus_tag LOCUS_17530 99217 99693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 100178 100107 gene locus_tag LOCUS_t00110 100178 100107 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 100545 101813 gene locus_tag LOCUS_17540 gene actA 100545 101813 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_17540 101846 104944 gene locus_tag LOCUS_17550 gene actB 101846 104944 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_17550 104964 106328 gene locus_tag LOCUS_17560 gene actC 104964 106328 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_17560 106331 106861 gene locus_tag LOCUS_17570 gene actD 106331 106861 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_17570 106876 107502 gene locus_tag LOCUS_17580 106876 107502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 107502 108785 gene locus_tag LOCUS_17590 107502 108785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 108810 109841 gene locus_tag LOCUS_17600 108810 109841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 109867 111759 gene locus_tag LOCUS_17610 gene ctaD 109867 111759 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_17610 111740 112825 gene locus_tag LOCUS_17620 gene ctaA 111740 112825 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_17620 112828 113730 gene locus_tag LOCUS_17630 gene ctaB 112828 113730 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_17630 113732 114313 gene locus_tag LOCUS_17640 113732 114313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 114336 115106 gene locus_tag LOCUS_17650 gene coxP 114336 115106 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_17650 115126 115452 gene locus_tag LOCUS_17660 115126 115452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 115526 116194 gene locus_tag LOCUS_17670 115526 116194 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_17670 116181 116735 gene locus_tag LOCUS_17680 gene yozB 116181 116735 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_17680 116740 117045 gene locus_tag LOCUS_17690 116740 117045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 117194 120901 gene locus_tag LOCUS_17700 117194 120901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 120958 124434 gene locus_tag LOCUS_17710 120958 124434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_17710 124512 125216 gene locus_tag LOCUS_17720 124512 125216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 125219 127210 gene locus_tag LOCUS_17730 gene ispG 125219 127210 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4T0 protein_id gnl|my_center|LOCUS_17730 127240 127428 gene locus_tag LOCUS_17740 127240 127428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 127428 127778 gene locus_tag LOCUS_17750 127428 127778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_17750 127775 128743 gene locus_tag LOCUS_17760 127775 128743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 protein_id gnl|my_center|LOCUS_17760 129255 128758 gene locus_tag LOCUS_17770 gene slyD 129255 128758 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS66 protein_id gnl|my_center|LOCUS_17770 129378 129953 gene locus_tag LOCUS_17780 129378 129953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 129958 130740 gene locus_tag LOCUS_17790 129958 130740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 130904 131929 gene locus_tag LOCUS_17800 130904 131929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 131945 134470 gene locus_tag LOCUS_17810 131945 134470 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202662.1 protein_id gnl|my_center|LOCUS_17810 134566 135018 gene locus_tag LOCUS_17820 134566 135018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 135068 136432 gene locus_tag LOCUS_17830 135068 136432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787102.1 protein_id gnl|my_center|LOCUS_17830 136545 136934 gene locus_tag LOCUS_17840 136545 136934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203034.1 protein_id gnl|my_center|LOCUS_17840 137028 137417 gene locus_tag LOCUS_17850 137028 137417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 137526 139319 gene locus_tag LOCUS_17860 137526 139319 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777303.1 protein_id gnl|my_center|LOCUS_17860 139322 140668 gene locus_tag LOCUS_17870 139322 140668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 140671 144786 gene locus_tag LOCUS_17880 140671 144786 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203031.1 protein_id gnl|my_center|LOCUS_17880 144788 145162 gene locus_tag LOCUS_17890 144788 145162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 145941 146648 gene locus_tag LOCUS_17900 145941 146648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 148136 147249 gene locus_tag LOCUS_17910 148136 147249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 148841 148302 gene locus_tag LOCUS_17920 148841 148302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 151639 149156 gene locus_tag LOCUS_17930 151639 149156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 152835 151636 gene locus_tag LOCUS_17940 152835 151636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 153572 152832 gene locus_tag LOCUS_17950 153572 152832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 154047 153541 gene locus_tag LOCUS_17960 154047 153541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 154866 154117 gene locus_tag LOCUS_17970 154866 154117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 155335 156000 gene locus_tag LOCUS_17980 155335 156000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 156213 156653 gene locus_tag LOCUS_17990 156213 156653 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310150.1 protein_id gnl|my_center|LOCUS_17990 156660 158510 gene locus_tag LOCUS_18000 156660 158510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 158523 159473 gene locus_tag LOCUS_18010 158523 159473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787052.1 protein_id gnl|my_center|LOCUS_18010 159518 160447 gene locus_tag LOCUS_18020 159518 160447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 160454 161671 gene locus_tag LOCUS_18030 160454 161671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202653.1 protein_id gnl|my_center|LOCUS_18030 161690 162220 gene locus_tag LOCUS_18040 161690 162220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 162420 163796 gene locus_tag LOCUS_18050 162420 163796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 163848 164948 gene locus_tag LOCUS_18060 163848 164948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 164887 166632 gene locus_tag LOCUS_18070 164887 166632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 166888 167199 gene locus_tag LOCUS_18080 gene rhaM 166888 167199 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_18080 167224 170034 gene locus_tag LOCUS_18090 167224 170034 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_18090 170149 171198 gene locus_tag LOCUS_18100 170149 171198 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_18100 171326 172714 gene locus_tag LOCUS_18110 171326 172714 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_18110 172711 172902 gene locus_tag LOCUS_18120 172711 172902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 173154 172975 gene locus_tag LOCUS_18130 173154 172975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 173101 177036 gene locus_tag LOCUS_18140 173101 177036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 177300 177902 gene locus_tag LOCUS_18150 177300 177902 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_18150 177928 178110 gene locus_tag LOCUS_18160 177928 178110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 178520 179209 gene locus_tag LOCUS_18170 gene nth 178520 179209 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_18170 179209 181014 gene locus_tag LOCUS_18180 gene asnB 179209 181014 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_18180 181011 182198 gene locus_tag LOCUS_18190 181011 182198 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_18190 183294 182287 gene locus_tag LOCUS_18200 183294 182287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 183731 186391 gene locus_tag LOCUS_18210 183731 186391 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107735.1 protein_id gnl|my_center|LOCUS_18210 186394 187476 gene locus_tag LOCUS_18220 186394 187476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 187605 188804 gene locus_tag LOCUS_18230 187605 188804 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_18230 188836 189678 gene locus_tag LOCUS_18240 188836 189678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 189675 191099 gene locus_tag LOCUS_18250 189675 191099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 191096 192229 gene locus_tag LOCUS_18260 191096 192229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 192222 192923 gene locus_tag LOCUS_18270 192222 192923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 193100 194251 gene locus_tag LOCUS_18280 gene csp2G 193100 194251 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_18280 194270 195427 gene locus_tag LOCUS_18290 194270 195427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803946.1 protein_id gnl|my_center|LOCUS_18290 196286 197281 gene locus_tag LOCUS_18300 196286 197281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 198280 197369 gene locus_tag LOCUS_18310 198280 197369 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 protein_id gnl|my_center|LOCUS_18310 198541 199092 gene locus_tag LOCUS_18320 198541 199092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 protein_id gnl|my_center|LOCUS_18320 199637 202582 gene locus_tag LOCUS_18330 199637 202582 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_18330 202595 204022 gene locus_tag LOCUS_18340 202595 204022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769373.1 protein_id gnl|my_center|LOCUS_18340 204569 204078 gene locus_tag LOCUS_18350 204569 204078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 204661 205242 gene locus_tag LOCUS_18360 204661 205242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_18360 205354 207681 gene locus_tag LOCUS_18370 gene pepN 205354 207681 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_18370 209381 208149 gene locus_tag LOCUS_18380 209381 208149 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_18380 209775 209437 gene locus_tag LOCUS_18390 209775 209437 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813552.1 protein_id gnl|my_center|LOCUS_18390 210156 211055 gene locus_tag LOCUS_18400 210156 211055 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_18400 211227 211646 gene locus_tag LOCUS_18410 211227 211646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_18410 212755 211643 gene locus_tag LOCUS_18420 gene recF 212755 211643 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_18420 212860 213882 gene locus_tag LOCUS_18430 gene pdhA 212860 213882 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_18430 214585 214034 gene locus_tag LOCUS_18440 214585 214034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 214853 215947 gene locus_tag LOCUS_18450 214853 215947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 216201 216785 gene locus_tag LOCUS_18460 216201 216785 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_18460 216789 217766 gene locus_tag LOCUS_18470 216789 217766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 217801 219564 gene locus_tag LOCUS_18480 217801 219564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 219784 220566 gene locus_tag LOCUS_18490 219784 220566 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_18490 220796 222016 gene locus_tag LOCUS_18500 gene exuT 220796 222016 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_18500 222100 223593 gene locus_tag LOCUS_18510 222100 223593 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U88 protein_id gnl|my_center|LOCUS_18510 223622 226801 gene locus_tag LOCUS_18520 223622 226801 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_18520 226819 228252 gene locus_tag LOCUS_18530 226819 228252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_18530 228252 230780 gene locus_tag LOCUS_18540 228252 230780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 230791 232230 gene locus_tag LOCUS_18550 230791 232230 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_18550 232369 235482 gene locus_tag LOCUS_18560 232369 235482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 235518 237122 gene locus_tag LOCUS_18570 235518 237122 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18570 239493 237145 gene locus_tag LOCUS_18580 239493 237145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 239883 240236 gene locus_tag LOCUS_18590 239883 240236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 241804 240842 gene locus_tag LOCUS_18600 241804 240842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_18600 242503 242880 gene locus_tag LOCUS_18610 242503 242880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_18610 243299 243226 gene locus_tag LOCUS_t00120 243299 243226 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 243440 244330 gene locus_tag LOCUS_18620 gene era 243440 244330 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_18620 244342 245655 gene locus_tag LOCUS_18630 gene der 244342 245655 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_18630 245658 246203 gene locus_tag LOCUS_18640 245658 246203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 246966 246316 gene locus_tag LOCUS_18650 gene rsmG 246966 246316 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_18650 247582 246971 gene locus_tag LOCUS_18660 gene sigW 247582 246971 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_18660 248700 247573 gene locus_tag LOCUS_18670 248700 247573 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_18670 248988 250118 gene locus_tag LOCUS_18680 gene tgt 248988 250118 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_18680 250173 251246 gene locus_tag LOCUS_18690 250173 251246 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_18690 251256 252161 gene locus_tag LOCUS_18700 251256 252161 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_18700 253035 252226 gene locus_tag LOCUS_18710 gene ispE 253035 252226 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_18710 253636 255258 gene locus_tag LOCUS_18720 gene ilvD 253636 255258 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_18720 255264 256958 gene locus_tag LOCUS_18730 gene ilvB 255264 256958 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_18730 256964 257464 gene locus_tag LOCUS_18740 gene ilvH 256964 257464 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_18740 257497 258540 gene locus_tag LOCUS_18750 257497 258540 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_18750 258550 260049 gene locus_tag LOCUS_18760 gene leuA 258550 260049 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_18760 260072 261493 gene locus_tag LOCUS_18770 gene leuC 260072 261493 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_18770 261498 262088 gene locus_tag LOCUS_18780 261498 262088 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_18780 262140 263729 gene locus_tag LOCUS_18790 262140 263729 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_18790 263698 264768 gene locus_tag LOCUS_18800 gene leuB 263698 264768 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_18800 265668 264847 gene locus_tag LOCUS_18810 265668 264847 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_18810 267426 265774 gene locus_tag LOCUS_18820 gene recN 267426 265774 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_18820 268418 267474 gene locus_tag LOCUS_18830 268418 267474 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_18830 269795 268566 gene locus_tag LOCUS_18840 269795 268566 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_18840 270114 269797 gene locus_tag LOCUS_18850 270114 269797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_18850 271063 270128 gene locus_tag LOCUS_18860 271063 270128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 271806 271129 gene locus_tag LOCUS_18870 271806 271129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 273609 272062 gene locus_tag LOCUS_18880 273609 272062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_18880 273719 275047 gene locus_tag LOCUS_18890 gene tilS 273719 275047 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_18890 275040 275555 gene locus_tag LOCUS_18900 275040 275555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 275642 276580 gene locus_tag LOCUS_18910 gene mdh 275642 276580 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_18910 276681 279398 gene locus_tag LOCUS_18920 276681 279398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 279441 281117 gene locus_tag LOCUS_18930 279441 281117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 282360 281158 gene locus_tag LOCUS_18940 282360 281158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 282669 283400 gene locus_tag LOCUS_18950 282669 283400 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_18950 283815 284879 gene locus_tag LOCUS_18960 283815 284879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 284997 285623 gene locus_tag LOCUS_18970 284997 285623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 286410 285649 gene locus_tag LOCUS_18980 286410 285649 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_18980 286508 288070 gene locus_tag LOCUS_18990 gene glpA 286508 288070 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_18990 288081 289583 gene locus_tag LOCUS_19000 gene glpK 288081 289583 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_19000 289586 290329 gene locus_tag LOCUS_19010 gene glpF 289586 290329 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_19010 291797 290523 gene locus_tag LOCUS_19020 gene rodA 291797 290523 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_19020 293600 291798 gene locus_tag LOCUS_19030 293600 291798 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_19030 294122 293601 gene locus_tag LOCUS_19040 294122 293601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 294952 294119 gene locus_tag LOCUS_19050 294952 294119 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_19050 295988 294960 gene locus_tag LOCUS_19060 gene mreB 295988 294960 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_19060 297894 296368 gene locus_tag LOCUS_19070 gene purH 297894 296368 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_19070 298585 298028 gene locus_tag LOCUS_19080 gene purN 298585 298028 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_19080 299610 298663 gene locus_tag LOCUS_19090 299610 298663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 300507 299635 gene locus_tag LOCUS_19100 300507 299635 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_19100 301388 300600 gene locus_tag LOCUS_19110 301388 300600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_19110 304000 301463 gene locus_tag LOCUS_19120 304000 301463 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_19120 304457 304041 gene locus_tag LOCUS_19130 304457 304041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 304703 304461 gene locus_tag LOCUS_19140 304703 304461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 305379 304705 gene locus_tag LOCUS_19150 305379 304705 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_19150 306642 306094 gene locus_tag LOCUS_19160 306642 306094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 307374 306712 gene locus_tag LOCUS_19170 307374 306712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 308118 307429 gene locus_tag LOCUS_19180 308118 307429 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence08 783 481 gene locus_tag LOCUS_19190 783 481 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_19190 1001 780 gene locus_tag LOCUS_19200 1001 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1670 1401 gene locus_tag LOCUS_19210 1670 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1936 1703 gene locus_tag LOCUS_19220 1936 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3897 2491 gene locus_tag LOCUS_19230 3897 2491 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_19230 4314 5447 gene locus_tag LOCUS_19240 4314 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5906 5607 gene locus_tag LOCUS_19250 5906 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6124 5897 gene locus_tag LOCUS_19260 6124 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7829 6456 gene locus_tag LOCUS_19270 7829 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 10039 7802 gene locus_tag LOCUS_19280 10039 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 11918 10107 gene locus_tag LOCUS_19290 11918 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 15082 11918 gene locus_tag LOCUS_19300 15082 11918 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_19300 15838 17706 gene locus_tag LOCUS_19310 15838 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 20074 17792 gene locus_tag LOCUS_19320 20074 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 20272 21507 gene locus_tag LOCUS_19330 20272 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 22835 21615 gene locus_tag LOCUS_19340 22835 21615 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948224.1 protein_id gnl|my_center|LOCUS_19340 23041 24063 gene locus_tag LOCUS_19350 gene fadB5 23041 24063 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_19350 24253 24639 gene locus_tag LOCUS_19360 24253 24639 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_19360 24651 25127 gene locus_tag LOCUS_19370 24651 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 25290 26591 gene locus_tag LOCUS_19380 25290 26591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_19380 26725 27267 gene locus_tag LOCUS_19390 26725 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 27277 27885 gene locus_tag LOCUS_19400 27277 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 29448 27955 gene locus_tag LOCUS_19410 29448 27955 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_19410 32625 29455 gene locus_tag LOCUS_19420 32625 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_19420 33305 36430 gene locus_tag LOCUS_19430 33305 36430 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_19430 36499 38277 gene locus_tag LOCUS_19440 36499 38277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_19440 38695 38622 gene locus_tag LOCUS_t00130 38695 38622 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38807 39532 gene locus_tag LOCUS_19450 38807 39532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 40457 39729 gene locus_tag LOCUS_19460 40457 39729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 41142 40573 gene locus_tag LOCUS_19470 41142 40573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_19470 42839 41160 gene locus_tag LOCUS_19480 42839 41160 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_19480 44254 42983 gene locus_tag LOCUS_19490 gene yegT 44254 42983 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_19490 44505 45671 gene locus_tag LOCUS_19500 44505 45671 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_19500 45687 46739 gene locus_tag LOCUS_19510 45687 46739 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_19510 46760 47191 gene locus_tag LOCUS_19520 46760 47191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 47198 47935 gene locus_tag LOCUS_19530 47198 47935 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109262.1 protein_id gnl|my_center|LOCUS_19530 50293 48053 gene locus_tag LOCUS_19540 gene icd 50293 48053 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_19540 51328 50507 gene locus_tag LOCUS_19550 gene panB 51328 50507 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_19550 51836 51330 gene locus_tag LOCUS_19560 gene pyrR2 51836 51330 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_19560 52866 51943 gene locus_tag LOCUS_19570 gene rsgA 52866 51943 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_19570 54107 52863 gene locus_tag LOCUS_19580 gene kdtA 54107 52863 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_19580 54764 54117 gene locus_tag LOCUS_19590 54764 54117 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_19590 55252 54764 gene locus_tag LOCUS_19600 gene cdd 55252 54764 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_19600 55742 58792 gene locus_tag LOCUS_19610 55742 58792 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_19610 58804 60207 gene locus_tag LOCUS_19620 58804 60207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_19620 60588 61826 gene locus_tag LOCUS_19630 gene dacB 60588 61826 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_19630 61955 62635 gene locus_tag LOCUS_19640 61955 62635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_19640 62805 63068 gene locus_tag LOCUS_19650 62805 63068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_19650 63068 63343 gene locus_tag LOCUS_19660 63068 63343 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_19660 63624 65042 gene locus_tag LOCUS_19670 gene sdaA 63624 65042 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_19670 65162 66571 gene locus_tag LOCUS_19680 65162 66571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 66720 67622 gene locus_tag LOCUS_19690 66720 67622 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_19690 67707 69608 gene locus_tag LOCUS_19700 67707 69608 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107131.1 protein_id gnl|my_center|LOCUS_19700 70391 69663 gene locus_tag LOCUS_19710 70391 69663 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_19710 70849 70391 gene locus_tag LOCUS_19720 gene rnhA 70849 70391 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_19720 71167 71943 gene locus_tag LOCUS_19730 71167 71943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 72363 72004 gene locus_tag LOCUS_19740 72363 72004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 72588 73724 gene locus_tag LOCUS_19750 72588 73724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 73901 74893 gene locus_tag LOCUS_19760 73901 74893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 74890 76488 gene locus_tag LOCUS_19770 74890 76488 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_19770 76974 76591 gene locus_tag LOCUS_19780 76974 76591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 77601 77059 gene locus_tag LOCUS_19790 77601 77059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 78147 77623 gene locus_tag LOCUS_19800 78147 77623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 80861 78150 gene locus_tag LOCUS_19810 80861 78150 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_19810 81692 80949 gene locus_tag LOCUS_19820 gene uppS 81692 80949 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_19820 82533 81775 gene locus_tag LOCUS_19830 82533 81775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 83387 82608 gene locus_tag LOCUS_19840 gene nadK 83387 82608 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_19840 84155 83490 gene locus_tag LOCUS_19850 84155 83490 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_19850 84880 84290 gene locus_tag LOCUS_19860 gene trpG 84880 84290 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_19860 85409 84864 gene locus_tag LOCUS_19870 85409 84864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_19870 85869 85417 gene locus_tag LOCUS_19880 85869 85417 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_19880 86016 86732 gene locus_tag LOCUS_19890 gene pdxJ 86016 86732 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_19890 86746 87507 gene locus_tag LOCUS_19900 86746 87507 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_19900 88196 88909 gene locus_tag LOCUS_19910 88196 88909 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_19910 90039 89071 gene locus_tag LOCUS_19920 90039 89071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 91208 90126 gene locus_tag LOCUS_19930 91208 90126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 92790 91600 gene locus_tag LOCUS_19940 92790 91600 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_19940 93793 92795 gene locus_tag LOCUS_19950 93793 92795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 95147 93786 gene locus_tag LOCUS_19960 95147 93786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383516.1 protein_id gnl|my_center|LOCUS_19960 95671 95327 gene locus_tag LOCUS_19970 95671 95327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 95999 96208 gene locus_tag LOCUS_19980 95999 96208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 96591 96376 gene locus_tag LOCUS_19990 96591 96376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 96830 96597 gene locus_tag LOCUS_20000 96830 96597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 97259 98032 gene locus_tag LOCUS_20010 97259 98032 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_20010 98037 99413 gene locus_tag LOCUS_20020 98037 99413 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_20020 99410 99991 gene locus_tag LOCUS_20030 gene lldG 99410 99991 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071697.1 protein_id gnl|my_center|LOCUS_20030 101650 100097 gene locus_tag LOCUS_20040 101650 100097 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108637.1 protein_id gnl|my_center|LOCUS_20040 102728 101637 gene locus_tag LOCUS_20050 102728 101637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202017.1 protein_id gnl|my_center|LOCUS_20050 104230 103268 gene locus_tag LOCUS_20060 104230 103268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 104898 104326 gene locus_tag LOCUS_20070 104898 104326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 106688 104907 gene locus_tag LOCUS_20080 106688 104907 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_20080 107526 108638 gene locus_tag LOCUS_20090 107526 108638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 109318 108689 gene locus_tag LOCUS_20100 109318 108689 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_20100 109781 109368 gene locus_tag LOCUS_20110 gene furR1 109781 109368 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_20110 109951 110442 gene locus_tag LOCUS_20120 109951 110442 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_20120 111769 110501 gene locus_tag LOCUS_20130 gene lysC 111769 110501 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_20130 111824 112840 gene locus_tag LOCUS_20140 gene fbp 111824 112840 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_20140 113196 112876 gene locus_tag LOCUS_20150 113196 112876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 113711 113202 gene locus_tag LOCUS_20160 113711 113202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 114303 113698 gene locus_tag LOCUS_20170 gene engB 114303 113698 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_20170 114420 115142 gene locus_tag LOCUS_20180 gene menG 114420 115142 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_20180 115091 115870 gene locus_tag LOCUS_20190 gene porT 115091 115870 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_20190 115931 116689 gene locus_tag LOCUS_20200 115931 116689 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_20200 116686 117462 gene locus_tag LOCUS_20210 116686 117462 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MM7 protein_id gnl|my_center|LOCUS_20210 117502 118272 gene locus_tag LOCUS_20220 117502 118272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 118681 118980 gene locus_tag LOCUS_20230 118681 118980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 119683 119039 gene locus_tag LOCUS_20240 119683 119039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 121594 119732 gene locus_tag LOCUS_20250 121594 119732 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_20250 122178 121717 gene locus_tag LOCUS_20260 122178 121717 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_20260 122759 122256 gene locus_tag LOCUS_20270 gene msrA 122759 122256 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8C7 protein_id gnl|my_center|LOCUS_20270 124739 124230 gene locus_tag LOCUS_20280 124739 124230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 126557 124749 gene locus_tag LOCUS_20290 126557 124749 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_20290 127814 126642 gene locus_tag LOCUS_20300 127814 126642 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_20300 130309 127904 gene locus_tag LOCUS_20310 130309 127904 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_20310 130726 130331 gene locus_tag LOCUS_20320 130726 130331 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_20320 133314 131638 gene locus_tag LOCUS_20330 133314 131638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 134276 133389 gene locus_tag LOCUS_20340 134276 133389 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_20340 136143 134278 gene locus_tag LOCUS_20350 gene mnmG 136143 134278 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_20350 136642 136196 gene locus_tag LOCUS_20360 gene ybeY 136642 136196 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 protein_id gnl|my_center|LOCUS_20360 137045 136644 gene locus_tag LOCUS_20370 gene spoIIAB 137045 136644 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_20370 137844 137086 gene locus_tag LOCUS_20380 137844 137086 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_20380 138209 137841 gene locus_tag LOCUS_20390 138209 137841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_20390 138348 139040 gene locus_tag LOCUS_20400 138348 139040 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_20400 139813 139043 gene locus_tag LOCUS_20410 139813 139043 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_20410 141023 139833 gene locus_tag LOCUS_20420 141023 139833 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_20420 141546 141007 gene locus_tag LOCUS_20430 141546 141007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 144938 141558 gene locus_tag LOCUS_20440 gene secA 144938 141558 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_20440 145775 144975 gene locus_tag LOCUS_20450 gene dapF 145775 144975 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_20450 146140 147129 gene locus_tag LOCUS_20460 146140 147129 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_20460 147281 148462 gene locus_tag LOCUS_20470 147281 148462 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_20470 148641 149195 gene locus_tag LOCUS_20480 148641 149195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 149212 149790 gene locus_tag LOCUS_20490 149212 149790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 153346 149912 gene locus_tag LOCUS_20500 153346 149912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 154341 153472 gene locus_tag LOCUS_20510 154341 153472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 154503 155507 gene locus_tag LOCUS_20520 154503 155507 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_20520 155504 156214 gene locus_tag LOCUS_20530 155504 156214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_20530 156260 157123 gene locus_tag LOCUS_20540 156260 157123 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_20540 157967 157260 gene locus_tag LOCUS_20550 157967 157260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 158793 161174 gene locus_tag LOCUS_20560 158793 161174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_20560 161174 162346 gene locus_tag LOCUS_20570 161174 162346 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_20570 162691 165063 gene locus_tag LOCUS_20580 162691 165063 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_20580 165078 166310 gene locus_tag LOCUS_20590 165078 166310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 166660 166914 gene locus_tag LOCUS_20600 166660 166914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 166925 167614 gene locus_tag LOCUS_20610 166925 167614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 167718 168134 gene locus_tag LOCUS_20620 167718 168134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 168441 170048 gene locus_tag LOCUS_20630 168441 170048 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_20630 170490 172268 gene locus_tag LOCUS_20640 170490 172268 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_20640 172771 173850 gene locus_tag LOCUS_20650 gene purK 172771 173850 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_20650 173847 174368 gene locus_tag LOCUS_20660 gene purE 173847 174368 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_20660 174866 174513 gene locus_tag LOCUS_20670 174866 174513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_20670 175194 176330 gene locus_tag LOCUS_20680 175194 176330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_20680 176668 178467 gene locus_tag LOCUS_20690 176668 178467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 178895 178506 gene locus_tag LOCUS_20700 178895 178506 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_20700 179155 181044 gene locus_tag LOCUS_20710 gene mscS1 179155 181044 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_20710 181767 181270 gene locus_tag LOCUS_20720 gene msrA 181767 181270 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6A2 protein_id gnl|my_center|LOCUS_20720 183129 181930 gene locus_tag LOCUS_20730 183129 181930 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_20730 185250 183778 gene locus_tag LOCUS_20740 gene gltD 185250 183778 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_20740 189745 185252 gene locus_tag LOCUS_20750 gene gltB 189745 185252 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_20750 191461 190112 gene locus_tag LOCUS_20760 191461 190112 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_20760 191985 191518 gene locus_tag LOCUS_20770 gene ssb 191985 191518 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S565 protein_id gnl|my_center|LOCUS_20770 193015 192032 gene locus_tag LOCUS_20780 gene mutY 193015 192032 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_20780 193274 193582 gene locus_tag LOCUS_20790 193274 193582 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_20790 193602 194420 gene locus_tag LOCUS_20800 193602 194420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 194599 196170 gene locus_tag LOCUS_20810 gene cafA 194599 196170 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_20810 196288 196674 gene locus_tag LOCUS_20820 196288 196674 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_20820 196843 197430 gene locus_tag LOCUS_20830 196843 197430 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_20830 197539 198522 gene locus_tag LOCUS_20840 197539 198522 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_20840 198713 202147 gene locus_tag LOCUS_20850 198713 202147 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_20850 202194 203921 gene locus_tag LOCUS_20860 202194 203921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_20860 203942 205126 gene locus_tag LOCUS_20870 203942 205126 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_20870 205123 205893 gene locus_tag LOCUS_20880 205123 205893 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123085.1 protein_id gnl|my_center|LOCUS_20880 205926 206762 gene locus_tag LOCUS_20890 205926 206762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121844.1 protein_id gnl|my_center|LOCUS_20890 208714 207068 gene locus_tag LOCUS_20900 208714 207068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 209249 210037 gene locus_tag LOCUS_20910 209249 210037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_20910 211042 210128 gene locus_tag LOCUS_20920 211042 210128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 211992 211327 gene locus_tag LOCUS_20930 211992 211327 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 protein_id gnl|my_center|LOCUS_20930 213585 212176 gene locus_tag LOCUS_20940 213585 212176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 214019 213582 gene locus_tag LOCUS_20950 214019 213582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261872.1 protein_id gnl|my_center|LOCUS_20950 214635 214090 gene locus_tag LOCUS_20960 214635 214090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 216168 218756 gene locus_tag LOCUS_20970 216168 218756 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 218716 219315 gene locus_tag LOCUS_20980 218716 219315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 219343 221106 gene locus_tag LOCUS_20990 219343 221106 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_20990 221159 222718 gene locus_tag LOCUS_21000 221159 222718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_21000 222777 224045 gene locus_tag LOCUS_21010 222777 224045 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_21010 224375 225538 gene locus_tag LOCUS_21020 gene fucP 224375 225538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_21020 225571 226341 gene locus_tag LOCUS_21030 gene fabG 225571 226341 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_21030 227095 228447 gene locus_tag LOCUS_21040 gene hemL 227095 228447 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_21040 229426 228896 gene locus_tag LOCUS_21050 229426 228896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 230130 229669 gene locus_tag LOCUS_21060 gene mscL 230130 229669 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJE5 protein_id gnl|my_center|LOCUS_21060 230561 233080 gene locus_tag LOCUS_21070 230561 233080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 233657 234748 gene locus_tag LOCUS_21080 233657 234748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533196.1 protein_id gnl|my_center|LOCUS_21080 234823 235917 gene locus_tag LOCUS_21090 234823 235917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533197.1 protein_id gnl|my_center|LOCUS_21090 236299 236514 gene locus_tag LOCUS_21100 236299 236514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_21100 237504 236863 gene locus_tag LOCUS_21110 237504 236863 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_21110 238823 237516 gene locus_tag LOCUS_21120 238823 237516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 240523 238832 gene locus_tag LOCUS_21130 240523 238832 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_21130 240934 241665 gene locus_tag LOCUS_21140 240934 241665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404764.1 protein_id gnl|my_center|LOCUS_21140 241927 242988 gene locus_tag LOCUS_21150 241927 242988 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_21150 243083 243820 gene locus_tag LOCUS_21160 243083 243820 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_21160 243817 244095 gene locus_tag LOCUS_21170 243817 244095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence09 115 696 gene locus_tag LOCUS_21180 115 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 764 3157 gene locus_tag LOCUS_21190 764 3157 CDS product family 65 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_21190 3316 6078 gene locus_tag LOCUS_21200 3316 6078 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_21200 6082 7035 gene locus_tag LOCUS_21210 6082 7035 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 protein_id gnl|my_center|LOCUS_21210 7639 10026 gene locus_tag LOCUS_21220 7639 10026 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_21220 10072 12822 gene locus_tag LOCUS_21230 10072 12822 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_21230 12877 15540 gene locus_tag LOCUS_21240 12877 15540 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLV8 protein_id gnl|my_center|LOCUS_21240 15568 16965 gene locus_tag LOCUS_21250 15568 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 17017 18444 gene locus_tag LOCUS_21260 gene lpd 17017 18444 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_21260 18463 19893 gene locus_tag LOCUS_21270 gene lpd 18463 19893 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF28 protein_id gnl|my_center|LOCUS_21270 20871 20128 gene locus_tag LOCUS_21280 20871 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 23972 21156 gene locus_tag LOCUS_21290 23972 21156 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_21290 24695 24620 gene locus_tag LOCUS_t00140 24695 24620 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25390 24812 gene locus_tag LOCUS_21300 25390 24812 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_21300 26461 25400 gene locus_tag LOCUS_21310 gene serC 26461 25400 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_21310 26895 26461 gene locus_tag LOCUS_21320 gene aroQ 26895 26461 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_21320 27024 27929 gene locus_tag LOCUS_21330 gene xerD 27024 27929 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_21330 28159 28590 gene locus_tag LOCUS_21340 28159 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 28678 29142 gene locus_tag LOCUS_21350 gene maoC 28678 29142 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_21350 31735 29303 gene locus_tag LOCUS_21360 31735 29303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_21360 32553 31948 gene locus_tag LOCUS_21370 gene sodA 32553 31948 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_21370 33142 32672 gene locus_tag LOCUS_21380 gene tadA 33142 32672 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_21380 34256 33126 gene locus_tag LOCUS_21390 34256 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_21390 34571 35773 gene locus_tag LOCUS_21400 gene nptA 34571 35773 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_21400 36404 35739 gene locus_tag LOCUS_21410 gene deoC 36404 35739 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CD4 protein_id gnl|my_center|LOCUS_21410 36419 37024 gene locus_tag LOCUS_21420 36419 37024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755876.1 protein_id gnl|my_center|LOCUS_21420 37263 37862 gene locus_tag LOCUS_21430 37263 37862 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_21430 38918 37884 gene locus_tag LOCUS_21440 gene hemH 38918 37884 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_21440 39736 39116 gene locus_tag LOCUS_21450 39736 39116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_21450 41967 39943 gene locus_tag LOCUS_21460 gene dsbD 41967 39943 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_21460 43402 42008 gene locus_tag LOCUS_21470 43402 42008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_21470 44507 43572 gene locus_tag LOCUS_21480 44507 43572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_21480 44783 45808 gene locus_tag LOCUS_21490 gene potA 44783 45808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 protein_id gnl|my_center|LOCUS_21490 45946 46629 gene locus_tag LOCUS_21500 45946 46629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 47232 48479 gene locus_tag LOCUS_21510 47232 48479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_21510 48832 48536 gene locus_tag LOCUS_21520 48832 48536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 49136 49612 gene locus_tag LOCUS_21530 49136 49612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 50222 49746 gene locus_tag LOCUS_21540 50222 49746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 50846 50235 gene locus_tag LOCUS_21550 50846 50235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_21550 51525 51148 gene locus_tag LOCUS_21560 51525 51148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 52944 51622 gene locus_tag LOCUS_21570 52944 51622 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_21570 53120 53827 gene locus_tag LOCUS_21580 53120 53827 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_21580 53858 54427 gene locus_tag LOCUS_21590 53858 54427 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E1 protein_id gnl|my_center|LOCUS_21590 54514 54828 gene locus_tag LOCUS_21600 54514 54828 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_21600 54809 55069 gene locus_tag LOCUS_21610 54809 55069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_21610 56271 55225 gene locus_tag LOCUS_21620 56271 55225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 56379 57209 gene locus_tag LOCUS_21630 56379 57209 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_21630 58916 57210 gene locus_tag LOCUS_21640 58916 57210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 59487 58924 gene locus_tag LOCUS_21650 59487 58924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 62169 59698 gene locus_tag LOCUS_21660 gene mur/alr 62169 59698 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_21660 62423 62749 gene locus_tag LOCUS_21670 62423 62749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 62830 63678 gene locus_tag LOCUS_21680 62830 63678 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_21680 63699 64166 gene locus_tag LOCUS_21690 63699 64166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 64907 64272 gene locus_tag LOCUS_21700 64907 64272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 65685 65311 gene locus_tag LOCUS_21710 65685 65311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 66719 65940 gene locus_tag LOCUS_21720 66719 65940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 67558 66719 gene locus_tag LOCUS_21730 67558 66719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 68705 67665 gene locus_tag LOCUS_21740 gene pheS 68705 67665 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_21740 73014 68785 gene locus_tag LOCUS_21750 73014 68785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 74639 73605 gene locus_tag LOCUS_21760 74639 73605 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_21760 74752 75615 gene locus_tag LOCUS_21770 gene dcyD 74752 75615 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_21770 76969 75617 gene locus_tag LOCUS_21780 gene kmo 76969 75617 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_21780 78275 76995 gene locus_tag LOCUS_21790 gene kynU 78275 76995 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_21790 78756 78328 gene locus_tag LOCUS_21800 gene nbaC 78756 78328 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_21800 78787 78963 gene locus_tag LOCUS_21810 78787 78963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 79134 79742 gene locus_tag LOCUS_21820 79134 79742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 80741 79896 gene locus_tag LOCUS_21830 gene prmC 80741 79896 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D7 protein_id gnl|my_center|LOCUS_21830 81435 81115 gene locus_tag LOCUS_21840 81435 81115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 81508 82698 gene locus_tag LOCUS_21850 gene rsmB 81508 82698 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_21850 82709 83374 gene locus_tag LOCUS_21860 82709 83374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117860.1 protein_id gnl|my_center|LOCUS_21860 83506 84984 gene locus_tag LOCUS_21870 gene guaB 83506 84984 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_21870 85628 85068 gene locus_tag LOCUS_21880 85628 85068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 86194 85646 gene locus_tag LOCUS_21890 86194 85646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 87171 86242 gene locus_tag LOCUS_21900 87171 86242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 88204 87155 gene locus_tag LOCUS_21910 gene fjo19 88204 87155 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_21910 88386 88802 gene locus_tag LOCUS_21920 gene ndk 88386 88802 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_21920 88948 90318 gene locus_tag LOCUS_21930 88948 90318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_21930 91394 90333 gene locus_tag LOCUS_21940 91394 90333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_21940 92146 91391 gene locus_tag LOCUS_21950 gene scpA 92146 91391 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_21950 92331 94256 gene locus_tag LOCUS_21960 gene dxs 92331 94256 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_21960 94352 95506 gene locus_tag LOCUS_21970 94352 95506 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_21970 95499 96269 gene locus_tag LOCUS_21980 95499 96269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_21980 97024 96266 gene locus_tag LOCUS_21990 97024 96266 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_21990 97582 97929 gene locus_tag LOCUS_22000 97582 97929 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257335.1 protein_id gnl|my_center|LOCUS_22000 98116 98796 gene locus_tag LOCUS_22010 98116 98796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 98724 98939 gene locus_tag LOCUS_22020 98724 98939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 99135 99944 gene locus_tag LOCUS_22030 99135 99944 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_22030 100018 100731 gene locus_tag LOCUS_22040 100018 100731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 100794 101294 gene locus_tag LOCUS_22050 100794 101294 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_22050 101439 102488 gene locus_tag LOCUS_22060 101439 102488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 102641 103522 gene locus_tag LOCUS_22070 102641 103522 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_22070 103613 104128 gene locus_tag LOCUS_22080 103613 104128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_22080 104895 104137 gene locus_tag LOCUS_22090 104895 104137 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_22090 105581 104910 gene locus_tag LOCUS_22100 gene chd1 105581 104910 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_22100 106124 105624 gene locus_tag LOCUS_22110 106124 105624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 106740 106192 gene locus_tag LOCUS_22120 106740 106192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 106958 107704 gene locus_tag LOCUS_22130 106958 107704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_22130 109768 108242 gene locus_tag LOCUS_22140 109768 108242 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_22140 110872 109772 gene locus_tag LOCUS_22150 110872 109772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_22150 111550 111071 gene locus_tag LOCUS_22160 111550 111071 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_22160 111680 112471 gene locus_tag LOCUS_22170 111680 112471 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_22170 113605 112502 gene locus_tag LOCUS_22180 113605 112502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 113909 116092 gene locus_tag LOCUS_22190 gene pepX1 113909 116092 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_22190 116518 116769 gene locus_tag LOCUS_22200 116518 116769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 117158 117982 gene locus_tag LOCUS_22210 117158 117982 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_22210 118592 118122 gene locus_tag LOCUS_22220 118592 118122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_22220 118966 120327 gene locus_tag LOCUS_22230 118966 120327 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_22230 121137 120382 gene locus_tag LOCUS_22240 121137 120382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 121987 121253 gene locus_tag LOCUS_22250 gene algR 121987 121253 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_22250 123051 122011 gene locus_tag LOCUS_22260 123051 122011 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_22260 124058 123084 gene locus_tag LOCUS_22270 124058 123084 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_22270 124788 124132 gene locus_tag LOCUS_22280 124788 124132 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_22280 125525 124797 gene locus_tag LOCUS_22290 125525 124797 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_22290 125670 125509 gene locus_tag LOCUS_22300 125670 125509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 127813 125720 gene locus_tag LOCUS_22310 gene recG 127813 125720 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_22310 128902 127832 gene locus_tag LOCUS_22320 128902 127832 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_22320 129249 130970 gene locus_tag LOCUS_22330 gene sglT 129249 130970 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_22330 131092 131508 gene locus_tag LOCUS_22340 131092 131508 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 protein_id gnl|my_center|LOCUS_22340 131734 131510 gene locus_tag LOCUS_22350 131734 131510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 132005 132481 gene locus_tag LOCUS_22360 132005 132481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 133480 132560 gene locus_tag LOCUS_22370 133480 132560 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLG7 protein_id gnl|my_center|LOCUS_22370 134803 133484 gene locus_tag LOCUS_22380 134803 133484 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_22380 135802 134822 gene locus_tag LOCUS_22390 135802 134822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_22390 139117 136295 gene locus_tag LOCUS_22400 gene uvrA1 139117 136295 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_22400 141366 139252 gene locus_tag LOCUS_22410 141366 139252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 143076 141499 gene locus_tag LOCUS_22420 143076 141499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 143197 144276 gene locus_tag LOCUS_22430 143197 144276 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_22430 145321 144392 gene locus_tag LOCUS_22440 145321 144392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_22440 146493 145336 gene locus_tag LOCUS_22450 146493 145336 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_22450 147006 146539 gene locus_tag LOCUS_22460 147006 146539 CDS product glcG protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920042.1 protein_id gnl|my_center|LOCUS_22460 147112 147534 gene locus_tag LOCUS_22470 147112 147534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_22470 148928 147627 gene locus_tag LOCUS_22480 148928 147627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_22480 149809 148925 gene locus_tag LOCUS_22490 149809 148925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 151199 149868 gene locus_tag LOCUS_22500 151199 149868 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 protein_id gnl|my_center|LOCUS_22500 152519 151236 gene locus_tag LOCUS_22510 152519 151236 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_22510 154637 152529 gene locus_tag LOCUS_22520 154637 152529 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_22520 155965 155060 gene locus_tag LOCUS_22530 155965 155060 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122640.1 protein_id gnl|my_center|LOCUS_22530 157424 156096 gene locus_tag LOCUS_22540 157424 156096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 158184 157468 gene locus_tag LOCUS_22550 158184 157468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 158910 158404 gene locus_tag LOCUS_22560 158910 158404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 160426 158927 gene locus_tag LOCUS_22570 160426 158927 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_22570 161876 160647 gene locus_tag LOCUS_22580 161876 160647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 163136 162120 gene locus_tag LOCUS_22590 163136 162120 CDS product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124069.1 protein_id gnl|my_center|LOCUS_22590 163652 163251 gene locus_tag LOCUS_22600 163652 163251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 164864 163686 gene locus_tag LOCUS_22610 164864 163686 CDS product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_22610 166385 165609 gene locus_tag LOCUS_22620 gene fabG2 166385 165609 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 protein_id gnl|my_center|LOCUS_22620 168166 166451 gene locus_tag LOCUS_22630 gene ilvD5 168166 166451 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_22630 168555 170297 gene locus_tag LOCUS_22640 168555 170297 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_22640 171094 170588 gene locus_tag LOCUS_22650 171094 170588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 171144 171395 gene locus_tag LOCUS_22660 171144 171395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 171836 171510 gene locus_tag LOCUS_22670 171836 171510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 171944 174166 gene locus_tag LOCUS_22680 171944 174166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 174200 175141 gene locus_tag LOCUS_22690 174200 175141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 175131 175409 gene locus_tag LOCUS_22700 175131 175409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 175515 176063 gene locus_tag LOCUS_22710 175515 176063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 176056 176292 gene locus_tag LOCUS_22720 176056 176292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 176285 176920 gene locus_tag LOCUS_22730 176285 176920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 176907 177308 gene locus_tag LOCUS_22740 176907 177308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 177333 177995 gene locus_tag LOCUS_22750 177333 177995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 177992 178429 gene locus_tag LOCUS_22760 177992 178429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_22760 178536 178826 gene locus_tag LOCUS_22770 178536 178826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 178816 179286 gene locus_tag LOCUS_22780 178816 179286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 179315 179926 gene locus_tag LOCUS_22790 179315 179926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 180310 180744 gene locus_tag LOCUS_22800 180310 180744 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262479.1 protein_id gnl|my_center|LOCUS_22800 180757 181014 gene locus_tag LOCUS_22810 180757 181014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 181173 181388 gene locus_tag LOCUS_22820 181173 181388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 181413 182327 gene locus_tag LOCUS_22830 181413 182327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 182729 182394 gene locus_tag LOCUS_22840 182729 182394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 182907 183122 gene locus_tag LOCUS_22850 182907 183122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 184011 183457 gene locus_tag LOCUS_22860 184011 183457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 184562 184008 gene locus_tag LOCUS_22870 184562 184008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 186577 184559 gene locus_tag LOCUS_22880 186577 184559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 189632 186684 gene locus_tag LOCUS_22890 189632 186684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 190112 189666 gene locus_tag LOCUS_22900 190112 189666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 191686 190124 gene locus_tag LOCUS_22910 191686 190124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 192126 191683 gene locus_tag LOCUS_22920 192126 191683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 192319 193488 gene locus_tag LOCUS_22930 192319 193488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 193488 194408 gene locus_tag LOCUS_22940 193488 194408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 194412 194939 gene locus_tag LOCUS_22950 194412 194939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 194939 195457 gene locus_tag LOCUS_22960 194939 195457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 195457 196692 gene locus_tag LOCUS_22970 195457 196692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 196696 197118 gene locus_tag LOCUS_22980 196696 197118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 197115 197546 gene locus_tag LOCUS_22990 197115 197546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 197730 198326 gene locus_tag LOCUS_23000 197730 198326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 198326 199294 gene locus_tag LOCUS_23010 198326 199294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 199287 199799 gene locus_tag LOCUS_23020 199287 199799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 199789 200088 gene locus_tag LOCUS_23030 199789 200088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 200090 200644 gene locus_tag LOCUS_23040 200090 200644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 200619 200909 gene locus_tag LOCUS_23050 200619 200909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 200912 201757 gene locus_tag LOCUS_23060 200912 201757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 201921 202214 gene locus_tag LOCUS_23070 201921 202214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 202211 203101 gene locus_tag LOCUS_23080 202211 203101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 203105 205312 gene locus_tag LOCUS_23090 203105 205312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 205317 208316 gene locus_tag LOCUS_23100 205317 208316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 208461 209264 gene locus_tag LOCUS_23110 208461 209264 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_23110 209391 210053 gene locus_tag LOCUS_23120 gene pnuC 209391 210053 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_23120 210053 210574 gene locus_tag LOCUS_23130 210053 210574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 210745 211008 gene locus_tag LOCUS_23140 210745 211008 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_23140 211032 212717 gene locus_tag LOCUS_23150 211032 212717 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_23150 212807 214705 gene locus_tag LOCUS_23160 gene acsA 212807 214705 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_23160 214791 216737 gene locus_tag LOCUS_23170 214791 216737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_23170 216739 217413 gene locus_tag LOCUS_23180 gene dnaQ 216739 217413 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_23180 218664 217420 gene locus_tag LOCUS_23190 218664 217420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 218687 218845 gene locus_tag LOCUS_23200 218687 218845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 218974 219312 gene locus_tag LOCUS_23210 gene ytxJ 218974 219312 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence10 600 388 gene locus_tag LOCUS_23220 600 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 986 1669 gene locus_tag LOCUS_23230 986 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2531 1671 gene locus_tag LOCUS_23240 2531 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4167 2542 gene locus_tag LOCUS_23250 gene betT 4167 2542 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813960.1 protein_id gnl|my_center|LOCUS_23250 5346 4204 gene locus_tag LOCUS_23260 5346 4204 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_23260 5845 5773 gene locus_tag LOCUS_t00150 5845 5773 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6034 6693 gene locus_tag LOCUS_23270 6034 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 6708 7238 gene locus_tag LOCUS_23280 gene rimM 6708 7238 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038J9 protein_id gnl|my_center|LOCUS_23280 7245 7970 gene locus_tag LOCUS_23290 gene trmD 7245 7970 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_23290 8019 8387 gene locus_tag LOCUS_23300 gene rplS 8019 8387 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK97 protein_id gnl|my_center|LOCUS_23300 8995 9702 gene locus_tag LOCUS_23310 8995 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 10065 13136 gene locus_tag LOCUS_23320 10065 13136 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_23320 13166 14671 gene locus_tag LOCUS_23330 13166 14671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_23330 14939 17539 gene locus_tag LOCUS_23340 14939 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 17615 18412 gene locus_tag LOCUS_23350 17615 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122498.1 protein_id gnl|my_center|LOCUS_23350 18522 19589 gene locus_tag LOCUS_23360 18522 19589 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_23360 19619 20824 gene locus_tag LOCUS_23370 19619 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_23370 20992 22023 gene locus_tag LOCUS_23380 20992 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_23380 22074 23234 gene locus_tag LOCUS_23390 22074 23234 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_23390 23542 24429 gene locus_tag LOCUS_23400 23542 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 24534 25445 gene locus_tag LOCUS_23410 24534 25445 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_23410 25454 26353 gene locus_tag LOCUS_23420 25454 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 26423 27583 gene locus_tag LOCUS_23430 gene aroB 26423 27583 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_23430 27626 28834 gene locus_tag LOCUS_23440 27626 28834 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_23440 28831 30204 gene locus_tag LOCUS_23450 28831 30204 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_23450 30251 30628 gene locus_tag LOCUS_23460 30251 30628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 30695 31693 gene locus_tag LOCUS_23470 30695 31693 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_23470 32611 31733 gene locus_tag LOCUS_23480 32611 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 33852 32647 gene locus_tag LOCUS_23490 33852 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 34655 34104 gene locus_tag LOCUS_23500 34655 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 35329 34640 gene locus_tag LOCUS_23510 35329 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_23510 35820 35341 gene locus_tag LOCUS_23520 gene ispF 35820 35341 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_23520 37101 35857 gene locus_tag LOCUS_23530 37101 35857 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_23530 37358 37152 gene locus_tag LOCUS_23540 37358 37152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 39647 37449 gene locus_tag LOCUS_23550 39647 37449 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_23550 39836 41434 gene locus_tag LOCUS_23560 gene bshC 39836 41434 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_23560 41394 41978 gene locus_tag LOCUS_23570 gene ygfA 41394 41978 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_23570 41989 42462 gene locus_tag LOCUS_23580 41989 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 43106 43567 gene locus_tag LOCUS_23590 43106 43567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 43598 45082 gene locus_tag LOCUS_23600 43598 45082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 45337 48279 gene locus_tag LOCUS_23610 45337 48279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 48320 49294 gene locus_tag LOCUS_23620 48320 49294 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_23620 49297 51660 gene locus_tag LOCUS_23630 49297 51660 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_23630 53087 51849 gene locus_tag LOCUS_23640 53087 51849 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_23640 54527 53259 gene locus_tag LOCUS_23650 54527 53259 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_23650 54766 56526 gene locus_tag LOCUS_23660 gene aspS 54766 56526 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_23660 57171 56533 gene locus_tag LOCUS_23670 57171 56533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_23670 57845 61219 gene locus_tag LOCUS_23680 57845 61219 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_23680 61506 62582 gene locus_tag LOCUS_23690 61506 62582 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_23690 62592 65654 gene locus_tag LOCUS_23700 62592 65654 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_23700 65656 66981 gene locus_tag LOCUS_23710 65656 66981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_23710 67090 68490 gene locus_tag LOCUS_23720 67090 68490 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_23720 69956 68487 gene locus_tag LOCUS_23730 69956 68487 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_23730 70424 70768 gene locus_tag LOCUS_23740 70424 70768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 70765 71094 gene locus_tag LOCUS_23750 70765 71094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 71075 71860 gene locus_tag LOCUS_23760 gene pcrB 71075 71860 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_23760 72772 71843 gene locus_tag LOCUS_23770 72772 71843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 74053 72914 gene locus_tag LOCUS_23780 74053 72914 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_23780 75074 74382 gene locus_tag LOCUS_23790 75074 74382 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_23790 76105 75116 gene locus_tag LOCUS_23800 76105 75116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_23800 76449 76102 gene locus_tag LOCUS_23810 gene panD 76449 76102 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_23810 77228 76461 gene locus_tag LOCUS_23820 gene panC 77228 76461 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJN7 protein_id gnl|my_center|LOCUS_23820 77443 78255 gene locus_tag LOCUS_23830 77443 78255 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_23830 78269 79597 gene locus_tag LOCUS_23840 78269 79597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 80555 79722 gene locus_tag LOCUS_23850 gene prmA 80555 79722 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_23850 81402 80641 gene locus_tag LOCUS_23860 gene tpiA 81402 80641 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_23860 81476 81991 gene locus_tag LOCUS_23870 gene recX 81476 81991 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_23870 82619 81975 gene locus_tag LOCUS_23880 82619 81975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 83067 82627 gene locus_tag LOCUS_23890 83067 82627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 85104 83068 gene locus_tag LOCUS_23900 gene uvrB 85104 83068 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_23900 86380 85160 gene locus_tag LOCUS_23910 86380 85160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_23910 86597 88951 gene locus_tag LOCUS_23920 86597 88951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 89293 89802 gene locus_tag LOCUS_23930 89293 89802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 90200 91462 gene locus_tag LOCUS_23940 gene GALNS 90200 91462 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_23940 91588 92709 gene locus_tag LOCUS_23950 91588 92709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_23950 92785 94104 gene locus_tag LOCUS_23960 gene gntM 92785 94104 CDS product idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_23960 94126 94590 gene locus_tag LOCUS_23970 94126 94590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_23970 94598 95710 gene locus_tag LOCUS_23980 94598 95710 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_23980 95747 96817 gene locus_tag LOCUS_23990 95747 96817 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_23990 97043 97555 gene locus_tag LOCUS_24000 97043 97555 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_24000 97560 99041 gene locus_tag LOCUS_24010 gene crtI 97560 99041 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_24010 99065 99910 gene locus_tag LOCUS_24020 gene crtB 99065 99910 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_24020 100078 100923 gene locus_tag LOCUS_24030 gene ispH 100078 100923 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_24030 101725 104130 gene locus_tag LOCUS_24040 101725 104130 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_24040 104515 105144 gene locus_tag LOCUS_24050 104515 105144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 105144 105755 gene locus_tag LOCUS_24060 105144 105755 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_24060 105851 106582 gene locus_tag LOCUS_24070 gene nagB 105851 106582 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVM5 protein_id gnl|my_center|LOCUS_24070 109588 106619 gene locus_tag LOCUS_24080 109588 106619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 110900 109728 gene locus_tag LOCUS_24090 110900 109728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 111328 111798 gene locus_tag LOCUS_24100 111328 111798 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_24100 112290 111841 gene locus_tag LOCUS_24110 112290 111841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 113259 112321 gene locus_tag LOCUS_24120 113259 112321 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_24120 114273 113296 gene locus_tag LOCUS_24130 114273 113296 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_24130 115144 114524 gene locus_tag LOCUS_24140 115144 114524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 115477 118821 gene locus_tag LOCUS_24150 gene mfd 115477 118821 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_24150 119083 120321 gene locus_tag LOCUS_24160 119083 120321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 120510 123323 gene locus_tag LOCUS_24170 120510 123323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 124606 123530 gene locus_tag LOCUS_24180 gene prfA 124606 123530 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_24180 124838 125506 gene locus_tag LOCUS_24190 124838 125506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 125723 125538 gene locus_tag LOCUS_24200 125723 125538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 125678 126280 gene locus_tag LOCUS_24210 gene tag 125678 126280 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_24210 128800 126377 gene locus_tag LOCUS_24220 128800 126377 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_24220 129431 131047 gene locus_tag LOCUS_24230 129431 131047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 131049 131912 gene locus_tag LOCUS_24240 131049 131912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 131958 134753 gene locus_tag LOCUS_24250 131958 134753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 134795 136261 gene locus_tag LOCUS_24260 gene glyQS 134795 136261 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_24260 136840 137187 gene locus_tag LOCUS_24270 136840 137187 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852534.1 protein_id gnl|my_center|LOCUS_24270 137194 137592 gene locus_tag LOCUS_24280 gene ctb 137194 137592 CDS product group 3 truncated hemoglobin ctb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB48 protein_id gnl|my_center|LOCUS_24280 138461 139519 gene locus_tag LOCUS_24290 138461 139519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 139699 140970 gene locus_tag LOCUS_24300 139699 140970 CDS product xylitol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_24300 142940 141558 gene locus_tag LOCUS_24310 142940 141558 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_444230.2 protein_id gnl|my_center|LOCUS_24310 143227 142946 gene locus_tag LOCUS_24320 143227 142946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_24320 144326 143286 gene locus_tag LOCUS_24330 144326 143286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 144929 144459 gene locus_tag LOCUS_24340 gene scpB 144929 144459 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_24340 145405 145022 gene locus_tag LOCUS_24350 145405 145022 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_24350 145696 146325 gene locus_tag LOCUS_24360 145696 146325 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_24360 146400 147569 gene locus_tag LOCUS_24370 146400 147569 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_24370 147733 148443 gene locus_tag LOCUS_24380 gene gufA 147733 148443 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_24380 148636 149442 gene locus_tag LOCUS_24390 148636 149442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 149439 149669 gene locus_tag LOCUS_24400 149439 149669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 149733 150353 gene locus_tag LOCUS_24410 149733 150353 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_24410 150356 150637 gene locus_tag LOCUS_24420 150356 150637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 150637 151116 gene locus_tag LOCUS_24430 150637 151116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 151141 151956 gene locus_tag LOCUS_24440 151141 151956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 151943 152545 gene locus_tag LOCUS_24450 151943 152545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 152538 153209 gene locus_tag LOCUS_24460 152538 153209 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_24460 153326 153658 gene locus_tag LOCUS_24470 153326 153658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24470 153881 154213 gene locus_tag LOCUS_24480 153881 154213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 154225 154857 gene locus_tag LOCUS_24490 154225 154857 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_24490 155065 155700 gene locus_tag LOCUS_24500 155065 155700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_24500 155736 157301 gene locus_tag LOCUS_24510 155736 157301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 157597 158298 gene locus_tag LOCUS_24520 157597 158298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 158323 159141 gene locus_tag LOCUS_24530 158323 159141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 159621 160676 gene locus_tag LOCUS_24540 159621 160676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 161002 161598 gene locus_tag LOCUS_24550 161002 161598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 161715 162785 gene locus_tag LOCUS_24560 161715 162785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 162908 163507 gene locus_tag LOCUS_24570 162908 163507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24570 163500 166469 gene locus_tag LOCUS_24580 163500 166469 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_24580 166541 168196 gene locus_tag LOCUS_24590 166541 168196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107903.1 protein_id gnl|my_center|LOCUS_24590 168404 169078 gene locus_tag LOCUS_24600 168404 169078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 169113 170561 gene locus_tag LOCUS_24610 169113 170561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_24610 170596 172899 gene locus_tag LOCUS_24620 170596 172899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 173132 174508 gene locus_tag LOCUS_24630 173132 174508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 175184 174654 gene locus_tag LOCUS_24640 175184 174654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 176349 175213 gene locus_tag LOCUS_24650 176349 175213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 177595 176792 gene locus_tag LOCUS_24660 177595 176792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 178346 177612 gene locus_tag LOCUS_24670 gene fabG 178346 177612 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_24670 179472 178471 gene locus_tag LOCUS_24680 gene yfmJ 179472 178471 CDS product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 protein_id gnl|my_center|LOCUS_24680 180050 179478 gene locus_tag LOCUS_24690 180050 179478 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_24690 180688 180260 gene locus_tag LOCUS_24700 180688 180260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 181879 180794 gene locus_tag LOCUS_24710 181879 180794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 182693 181917 gene locus_tag LOCUS_24720 182693 181917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 183745 183287 gene locus_tag LOCUS_24730 183745 183287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 184928 183996 gene locus_tag LOCUS_24740 184928 183996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 185945 184962 gene locus_tag LOCUS_24750 185945 184962 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_24750 187885 186068 gene locus_tag LOCUS_24760 187885 186068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 188267 188758 gene locus_tag LOCUS_24770 188267 188758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 189533 188805 gene locus_tag LOCUS_24780 189533 188805 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_24780 190585 189530 gene locus_tag LOCUS_24790 190585 189530 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_24790 192076 190730 gene locus_tag LOCUS_24800 192076 190730 CDS product peptide permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501964.1 protein_id gnl|my_center|LOCUS_24800 192876 192088 gene locus_tag LOCUS_24810 gene arsC 192876 192088 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_24810 193323 192988 gene locus_tag LOCUS_24820 193323 192988 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_24820 193888 194400 gene locus_tag LOCUS_24830 193888 194400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 194402 195313 gene locus_tag LOCUS_24840 194402 195313 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_24840 197881 196181 gene locus_tag LOCUS_24850 197881 196181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_24850 201216 197896 gene locus_tag LOCUS_24860 201216 197896 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_24860 202263 201385 gene locus_tag LOCUS_24870 202263 201385 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790969.1 protein_id gnl|my_center|LOCUS_24870 203460 203134 gene locus_tag LOCUS_24880 203460 203134 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_24880 204373 203561 gene locus_tag LOCUS_24890 204373 203561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence11 1052 2866 gene locus_tag LOCUS_24900 1052 2866 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_24900 2870 3724 gene locus_tag LOCUS_24910 2870 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3726 5021 gene locus_tag LOCUS_24920 3726 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_24920 5011 5754 gene locus_tag LOCUS_24930 5011 5754 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_24930 5861 6613 gene locus_tag LOCUS_24940 5861 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 6763 7125 gene locus_tag LOCUS_24950 6763 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 7132 7650 gene locus_tag LOCUS_24960 7132 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 7792 8127 gene locus_tag LOCUS_24970 7792 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 8120 8431 gene locus_tag LOCUS_24980 8120 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 9094 10314 gene locus_tag LOCUS_24990 gene ltrA 9094 10314 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_24990 10564 11688 gene locus_tag LOCUS_25000 10564 11688 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_25000 12180 12380 gene locus_tag LOCUS_25010 12180 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25010 12475 12831 gene locus_tag LOCUS_25020 12475 12831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_25020 13405 13866 gene locus_tag LOCUS_25030 13405 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 13925 14626 gene locus_tag LOCUS_25040 13925 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 15139 15432 gene locus_tag LOCUS_25050 15139 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44191 protein_id gnl|my_center|LOCUS_25050 16252 15662 gene locus_tag LOCUS_25060 16252 15662 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_25060 16589 17167 gene locus_tag LOCUS_25070 16589 17167 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_25070 17207 17836 gene locus_tag LOCUS_25080 gene udk 17207 17836 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_25080 18029 18376 gene locus_tag LOCUS_25090 18029 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 18485 21442 gene locus_tag LOCUS_25100 18485 21442 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_25100 22342 23595 gene locus_tag LOCUS_25110 gene metK 22342 23595 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_25110 24227 24808 gene locus_tag LOCUS_25120 24227 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_25120 24811 25590 gene locus_tag LOCUS_25130 24811 25590 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_25130 26746 25652 gene locus_tag LOCUS_25140 26746 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 27360 26749 gene locus_tag LOCUS_25150 27360 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 27662 28408 gene locus_tag LOCUS_25160 27662 28408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 30091 28508 gene locus_tag LOCUS_25170 30091 28508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 30654 30214 gene locus_tag LOCUS_25180 30654 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 31011 31382 gene locus_tag LOCUS_25190 31011 31382 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_25190 31379 32629 gene locus_tag LOCUS_25200 31379 32629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 33472 32717 gene locus_tag LOCUS_25210 33472 32717 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_25210 34914 33712 gene locus_tag LOCUS_25220 34914 33712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_25220 35514 36746 gene locus_tag LOCUS_25230 35514 36746 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_25230 37707 37033 gene locus_tag LOCUS_25240 37707 37033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 38374 37700 gene locus_tag LOCUS_25250 gene modB 38374 37700 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_25250 39144 38371 gene locus_tag LOCUS_25260 gene modA 39144 38371 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_25260 40339 39332 gene locus_tag LOCUS_25270 40339 39332 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_25270 40967 40467 gene locus_tag LOCUS_25280 40967 40467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_25280 42670 41462 gene locus_tag LOCUS_25290 42670 41462 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_25290 43454 42828 gene locus_tag LOCUS_25300 43454 42828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 44476 43667 gene locus_tag LOCUS_25310 44476 43667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_25310 45266 44610 gene locus_tag LOCUS_25320 45266 44610 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_25320 46103 45528 gene locus_tag LOCUS_25330 46103 45528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 46714 46151 gene locus_tag LOCUS_25340 46714 46151 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727712.1 protein_id gnl|my_center|LOCUS_25340 48372 46855 gene locus_tag LOCUS_25350 gene uxuB 48372 46855 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_25350 50086 48374 gene locus_tag LOCUS_25360 50086 48374 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_25360 51149 50157 gene locus_tag LOCUS_25370 51149 50157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 52544 51585 gene locus_tag LOCUS_25380 52544 51585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 53155 52754 gene locus_tag LOCUS_25390 53155 52754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 53547 53152 gene locus_tag LOCUS_25400 53547 53152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 53842 54627 gene locus_tag LOCUS_25410 53842 54627 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_25410 54624 55976 gene locus_tag LOCUS_25420 54624 55976 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_25420 56104 57366 gene locus_tag LOCUS_25430 56104 57366 CDS product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_25430 59339 58020 gene locus_tag LOCUS_25440 59339 58020 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767567.1 protein_id gnl|my_center|LOCUS_25440 60344 59682 gene locus_tag LOCUS_25450 60344 59682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 61856 60573 gene locus_tag LOCUS_25460 61856 60573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 protein_id gnl|my_center|LOCUS_25460 62764 62036 gene locus_tag LOCUS_25470 62764 62036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 62951 62754 gene locus_tag LOCUS_25480 62951 62754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 63721 63371 gene locus_tag LOCUS_25490 63721 63371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 64360 63908 gene locus_tag LOCUS_25500 64360 63908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 64957 64451 gene locus_tag LOCUS_25510 64957 64451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 65430 65176 gene locus_tag LOCUS_25520 65430 65176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 65743 66468 gene locus_tag LOCUS_25530 65743 66468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 67735 66767 gene locus_tag LOCUS_25540 67735 66767 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_25540 70134 69139 gene locus_tag LOCUS_25550 70134 69139 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_25550 70803 71621 gene locus_tag LOCUS_25560 70803 71621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 71618 71962 gene locus_tag LOCUS_25570 71618 71962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 72455 71985 gene locus_tag LOCUS_25580 72455 71985 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_25580 73482 72448 gene locus_tag LOCUS_25590 gene ribD 73482 72448 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_25590 74299 73496 gene locus_tag LOCUS_25600 74299 73496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 75423 74362 gene locus_tag LOCUS_25610 75423 74362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 75679 76863 gene locus_tag LOCUS_25620 75679 76863 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_25620 76867 80046 gene locus_tag LOCUS_25630 76867 80046 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_25630 80118 81479 gene locus_tag LOCUS_25640 80118 81479 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_25640 81531 82859 gene locus_tag LOCUS_25650 gene dgt 81531 82859 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_25650 83639 87013 gene locus_tag LOCUS_25660 gene ileS 83639 87013 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9K9 protein_id gnl|my_center|LOCUS_25660 87017 87649 gene locus_tag LOCUS_25670 gene lspA 87017 87649 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_25670 88050 89222 gene locus_tag LOCUS_25680 88050 89222 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_25680 89219 89731 gene locus_tag LOCUS_25690 89219 89731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_25690 94835 89967 gene locus_tag LOCUS_25700 94835 89967 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_25700 97043 94968 gene locus_tag LOCUS_25710 97043 94968 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_25710 97751 97053 gene locus_tag LOCUS_25720 97751 97053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 98467 97754 gene locus_tag LOCUS_25730 98467 97754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_25730 98875 98480 gene locus_tag LOCUS_25740 98875 98480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 99118 99867 gene locus_tag LOCUS_25750 99118 99867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 101743 100040 gene locus_tag LOCUS_25760 101743 100040 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_25760 102283 101759 gene locus_tag LOCUS_25770 102283 101759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 102452 104704 gene locus_tag LOCUS_25780 102452 104704 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404049.1 protein_id gnl|my_center|LOCUS_25780 104728 105339 gene locus_tag LOCUS_25790 104728 105339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 105336 105950 gene locus_tag LOCUS_25800 105336 105950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 106049 107116 gene locus_tag LOCUS_25810 106049 107116 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_25810 107345 109747 gene locus_tag LOCUS_25820 107345 109747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_25820 110937 109813 gene locus_tag LOCUS_25830 110937 109813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_25830 111050 113542 gene locus_tag LOCUS_25840 111050 113542 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_25840 114352 113606 gene locus_tag LOCUS_25850 114352 113606 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_25850 115284 114349 gene locus_tag LOCUS_25860 115284 114349 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_25860 116077 115316 gene locus_tag LOCUS_25870 116077 115316 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_25870 117526 116114 gene locus_tag LOCUS_25880 117526 116114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_25880 118599 117625 gene locus_tag LOCUS_25890 118599 117625 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_25890 119371 118616 gene locus_tag LOCUS_25900 119371 118616 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_25900 119922 119371 gene locus_tag LOCUS_25910 gene rmlC 119922 119371 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_25910 120153 121418 gene locus_tag LOCUS_25920 gene hflX 120153 121418 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_25920 121727 122347 gene locus_tag LOCUS_25930 gene mtgA 121727 122347 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8H2 protein_id gnl|my_center|LOCUS_25930 122959 122357 gene locus_tag LOCUS_25940 122959 122357 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_25940 124308 123118 gene locus_tag LOCUS_25950 gene yycB 124308 123118 CDS product putative transporter YycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37482 protein_id gnl|my_center|LOCUS_25950 125360 124854 gene locus_tag LOCUS_25960 125360 124854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 125788 126825 gene locus_tag LOCUS_25970 125788 126825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 128376 126913 gene locus_tag LOCUS_25980 128376 126913 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_25980 130933 128378 gene locus_tag LOCUS_25990 130933 128378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 131477 133975 gene locus_tag LOCUS_26000 131477 133975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 133991 135418 gene locus_tag LOCUS_26010 133991 135418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_26010 135428 136495 gene locus_tag LOCUS_26020 gene pam 135428 136495 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_26020 138586 136604 gene locus_tag LOCUS_26030 138586 136604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 139871 138903 gene locus_tag LOCUS_26040 139871 138903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 139973 140962 gene locus_tag LOCUS_26050 gene ddl 139973 140962 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_26050 140978 141706 gene locus_tag LOCUS_26060 140978 141706 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_26060 143133 142324 gene locus_tag LOCUS_26070 gene nagD 143133 142324 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_26070 144688 143852 gene locus_tag LOCUS_26080 144688 143852 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_26080 145389 145739 gene locus_tag LOCUS_26090 145389 145739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 145775 146446 gene locus_tag LOCUS_26100 145775 146446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 146439 147206 gene locus_tag LOCUS_26110 146439 147206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 147196 147840 gene locus_tag LOCUS_26120 147196 147840 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 protein_id gnl|my_center|LOCUS_26120 148554 147892 gene locus_tag LOCUS_26130 gene psd 148554 147892 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_26130 149507 148668 gene locus_tag LOCUS_26140 149507 148668 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_26140 149697 149491 gene locus_tag LOCUS_26150 149697 149491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 150628 149690 gene locus_tag LOCUS_26160 150628 149690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 150777 151766 gene locus_tag LOCUS_26170 150777 151766 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_26170 151814 152731 gene locus_tag LOCUS_26180 gene fjo11 151814 152731 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_26180 152795 153706 gene locus_tag LOCUS_26190 152795 153706 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_26190 154277 153774 gene locus_tag LOCUS_26200 154277 153774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 155856 154669 gene locus_tag LOCUS_26210 155856 154669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 155913 156767 gene locus_tag LOCUS_26220 155913 156767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 156779 160414 gene locus_tag LOCUS_26230 156779 160414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 161552 160473 gene locus_tag LOCUS_26240 161552 160473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 163554 161542 gene locus_tag LOCUS_26250 gene ppk 163554 161542 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS12 protein_id gnl|my_center|LOCUS_26250 164995 164012 gene locus_tag LOCUS_26260 164995 164012 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_26260 166005 165514 gene locus_tag LOCUS_26270 166005 165514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_26270 166289 166008 gene locus_tag LOCUS_26280 166289 166008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 168131 167043 gene locus_tag LOCUS_26290 168131 167043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 169186 168434 gene locus_tag LOCUS_26300 169186 168434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_26300 169335 169709 gene locus_tag LOCUS_26310 169335 169709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 169706 171466 gene locus_tag LOCUS_26320 169706 171466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 172132 171527 gene locus_tag LOCUS_26330 172132 171527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 173088 172228 gene locus_tag LOCUS_26340 173088 172228 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_26340 174972 174070 gene locus_tag LOCUS_26350 174972 174070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_26350 175119 175394 gene locus_tag LOCUS_26360 175119 175394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 175474 175683 gene locus_tag LOCUS_26370 175474 175683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 177976 175853 gene locus_tag LOCUS_26380 177976 175853 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_26380 180050 178089 gene locus_tag LOCUS_26390 gene gyrB 180050 178089 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A277 protein_id gnl|my_center|LOCUS_26390 180867 180490 gene locus_tag LOCUS_26400 180867 180490 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_26400 182477 180906 gene locus_tag LOCUS_26410 182477 180906 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_26410 183452 182481 gene locus_tag LOCUS_26420 183452 182481 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_26420 184689 183631 gene locus_tag LOCUS_26430 184689 183631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 184800 185774 gene locus_tag LOCUS_26440 gene trpS 184800 185774 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_26440 186379 185957 gene locus_tag LOCUS_26450 186379 185957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 186580 188307 gene locus_tag LOCUS_26460 186580 188307 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_26460 188958 188530 gene locus_tag LOCUS_26470 188958 188530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 190016 188955 gene locus_tag LOCUS_26480 gene menE 190016 188955 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_26480 190130 190966 gene locus_tag LOCUS_26490 gene menB 190130 190966 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_26490 191209 192786 gene locus_tag LOCUS_26500 gene pckA2 191209 192786 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_26500 192794 193969 gene locus_tag LOCUS_26510 192794 193969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 193993 195180 gene locus_tag LOCUS_26520 193993 195180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 195222 196013 gene locus_tag LOCUS_26530 195222 196013 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_26530 197129 196383 gene locus_tag LOCUS_26540 197129 196383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_26540 197608 197682 gene locus_tag LOCUS_t00160 197608 197682 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 1318 353 gene locus_tag LOCUS_26550 1318 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3379 2363 gene locus_tag LOCUS_26560 3379 2363 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_26560 3826 4749 gene locus_tag LOCUS_26570 3826 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 5027 7366 gene locus_tag LOCUS_26580 5027 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 7369 8310 gene locus_tag LOCUS_26590 7369 8310 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967365.1 protein_id gnl|my_center|LOCUS_26590 8535 9731 gene locus_tag LOCUS_26600 8535 9731 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_26600 9920 10804 gene locus_tag LOCUS_26610 9920 10804 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_26610 10902 11630 gene locus_tag LOCUS_26620 10902 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 11869 12690 gene locus_tag LOCUS_26630 11869 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 12687 13634 gene locus_tag LOCUS_26640 12687 13634 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199788.1 protein_id gnl|my_center|LOCUS_26640 13693 14625 gene locus_tag LOCUS_26650 13693 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 14615 15391 gene locus_tag LOCUS_26660 14615 15391 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_26660 15372 16190 gene locus_tag LOCUS_26670 15372 16190 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015757.1 protein_id gnl|my_center|LOCUS_26670 16224 16613 gene locus_tag LOCUS_26680 16224 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895964.1 protein_id gnl|my_center|LOCUS_26680 16610 17698 gene locus_tag LOCUS_26690 16610 17698 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_26690 17728 19092 gene locus_tag LOCUS_26700 17728 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_26700 19118 19771 gene locus_tag LOCUS_26710 19118 19771 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_26710 21200 19854 gene locus_tag LOCUS_26720 gene rmuC 21200 19854 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260923.1 protein_id gnl|my_center|LOCUS_26720 22018 21221 gene locus_tag LOCUS_26730 22018 21221 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_26730 23217 21970 gene locus_tag LOCUS_26740 23217 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 23269 24045 gene locus_tag LOCUS_26750 23269 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 27096 24121 gene locus_tag LOCUS_26760 27096 24121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_26760 27510 28700 gene locus_tag LOCUS_26770 27510 28700 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337933.1 protein_id gnl|my_center|LOCUS_26770 28932 30134 gene locus_tag LOCUS_26780 28932 30134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404922.1 protein_id gnl|my_center|LOCUS_26780 30345 30827 gene locus_tag LOCUS_26790 30345 30827 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_26790 30884 31423 gene locus_tag LOCUS_26800 30884 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 31436 32806 gene locus_tag LOCUS_26810 gene norM 31436 32806 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_26810 32974 33705 gene locus_tag LOCUS_26820 gene yueD 32974 33705 CDS product benzil reductase ((S)-benzoin forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32099 protein_id gnl|my_center|LOCUS_26820 34087 33692 gene locus_tag LOCUS_26830 34087 33692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 36174 34702 gene locus_tag LOCUS_26840 36174 34702 CDS product PhoPQ-regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_26840 37226 36240 gene locus_tag LOCUS_26850 37226 36240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 39190 37805 gene locus_tag LOCUS_26860 39190 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_26860 41344 39377 gene locus_tag LOCUS_26870 41344 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 42598 41717 gene locus_tag LOCUS_26880 gene sucD 42598 41717 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_26880 42730 43125 gene locus_tag LOCUS_26890 42730 43125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 43209 44489 gene locus_tag LOCUS_26900 43209 44489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 44530 45708 gene locus_tag LOCUS_26910 44530 45708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 45715 46353 gene locus_tag LOCUS_26920 45715 46353 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593893.1 protein_id gnl|my_center|LOCUS_26920 46350 47570 gene locus_tag LOCUS_26930 46350 47570 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_26930 47581 48006 gene locus_tag LOCUS_26940 47581 48006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 48036 48506 gene locus_tag LOCUS_26950 48036 48506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 48947 48507 gene locus_tag LOCUS_26960 48947 48507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 49596 48928 gene locus_tag LOCUS_26970 49596 48928 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_26970 50165 49629 gene locus_tag LOCUS_26980 50165 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_26980 50215 50622 gene locus_tag LOCUS_26990 50215 50622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 52088 50664 gene locus_tag LOCUS_27000 gene dnaA 52088 50664 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_27000 52572 54446 gene locus_tag LOCUS_27010 52572 54446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 54641 55078 gene locus_tag LOCUS_27020 54641 55078 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340074.1 protein_id gnl|my_center|LOCUS_27020 55304 55864 gene locus_tag LOCUS_27030 55304 55864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 57930 56023 gene locus_tag LOCUS_27040 57930 56023 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_27040 58926 58069 gene locus_tag LOCUS_27050 58926 58069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 59844 61313 gene locus_tag LOCUS_27060 59844 61313 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101381.1 protein_id gnl|my_center|LOCUS_27060 61350 61943 gene locus_tag LOCUS_27070 61350 61943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 61945 62850 gene locus_tag LOCUS_27080 gene cysD 61945 62850 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_27080 63001 64260 gene locus_tag LOCUS_27090 gene cysN 63001 64260 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_27090 64442 65197 gene locus_tag LOCUS_27100 64442 65197 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_27100 66090 67439 gene locus_tag LOCUS_27110 gene ugd 66090 67439 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_27110 68142 67777 gene locus_tag LOCUS_27120 68142 67777 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_27120 69025 68465 gene locus_tag LOCUS_27130 69025 68465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 69399 70010 gene locus_tag LOCUS_27140 69399 70010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 70119 71186 gene locus_tag LOCUS_27150 70119 71186 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_27150 71341 74604 gene locus_tag LOCUS_27160 71341 74604 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_27160 74626 76140 gene locus_tag LOCUS_27170 74626 76140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_27170 77615 76290 gene locus_tag LOCUS_27180 77615 76290 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_27180 77799 78464 gene locus_tag LOCUS_27190 77799 78464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 78467 79789 gene locus_tag LOCUS_27200 78467 79789 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_27200 80856 79786 gene locus_tag LOCUS_27210 80856 79786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 81298 82887 gene locus_tag LOCUS_27220 81298 82887 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_27220 83227 83802 gene locus_tag LOCUS_27230 83227 83802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 83802 84485 gene locus_tag LOCUS_27240 83802 84485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 85123 84662 gene locus_tag LOCUS_27250 85123 84662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 85493 87136 gene locus_tag LOCUS_27260 85493 87136 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_27260 87158 88648 gene locus_tag LOCUS_27270 87158 88648 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_27270 88687 90000 gene locus_tag LOCUS_27280 gene xylA 88687 90000 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_27280 91494 90079 gene locus_tag LOCUS_27290 gene uxaB 91494 90079 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_27290 92210 93616 gene locus_tag LOCUS_27300 92210 93616 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_27300 93652 94920 gene locus_tag LOCUS_27310 93652 94920 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_27310 94947 96122 gene locus_tag LOCUS_27320 94947 96122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 96133 97020 gene locus_tag LOCUS_27330 96133 97020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 97208 99304 gene locus_tag LOCUS_27340 97208 99304 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_27340 100639 99578 gene locus_tag LOCUS_27350 gene fbaA 100639 99578 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_27350 100839 101696 gene locus_tag LOCUS_27360 100839 101696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_27360 102631 101840 gene locus_tag LOCUS_27370 102631 101840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_27370 102808 103755 gene locus_tag LOCUS_27380 102808 103755 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_27380 104022 104429 gene locus_tag LOCUS_27390 104022 104429 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_27390 104422 105627 gene locus_tag LOCUS_27400 104422 105627 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_27400 106991 105738 gene locus_tag LOCUS_27410 106991 105738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 107127 108308 gene locus_tag LOCUS_27420 107127 108308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 109660 108332 gene locus_tag LOCUS_27430 109660 108332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 110790 109657 gene locus_tag LOCUS_27440 110790 109657 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_27440 111711 110809 gene locus_tag LOCUS_27450 111711 110809 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_27450 113131 111704 gene locus_tag LOCUS_27460 113131 111704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 protein_id gnl|my_center|LOCUS_27460 115291 113150 gene locus_tag LOCUS_27470 115291 113150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_27470 116051 115293 gene locus_tag LOCUS_27480 116051 115293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 116204 116866 gene locus_tag LOCUS_27490 116204 116866 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257512.1 protein_id gnl|my_center|LOCUS_27490 116913 117614 gene locus_tag LOCUS_27500 116913 117614 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_27500 121923 117808 gene locus_tag LOCUS_27510 121923 117808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 122132 123298 gene locus_tag LOCUS_27520 122132 123298 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_27520 123568 124344 gene locus_tag LOCUS_27530 123568 124344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 124462 125070 gene locus_tag LOCUS_27540 124462 125070 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_27540 125217 126215 gene locus_tag LOCUS_27550 125217 126215 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791673.1 protein_id gnl|my_center|LOCUS_27550 126385 129621 gene locus_tag LOCUS_27560 126385 129621 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_27560 129635 131314 gene locus_tag LOCUS_27570 129635 131314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_27570 131773 133275 gene locus_tag LOCUS_27580 131773 133275 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_27580 133390 135102 gene locus_tag LOCUS_27590 133390 135102 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_27590 135187 136590 gene locus_tag LOCUS_27600 135187 136590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 136709 138391 gene locus_tag LOCUS_27610 136709 138391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 138517 140295 gene locus_tag LOCUS_27620 gene atsA 138517 140295 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_27620 140305 142329 gene locus_tag LOCUS_27630 140305 142329 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_27630 143158 142550 gene locus_tag LOCUS_27640 143158 142550 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_27640 144119 143178 gene locus_tag LOCUS_27650 144119 143178 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_27650 145541 144195 gene locus_tag LOCUS_27660 145541 144195 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_27660 146675 146178 gene locus_tag LOCUS_27670 146675 146178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 147140 146709 gene locus_tag LOCUS_27680 147140 146709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 147636 147121 gene locus_tag LOCUS_27690 147636 147121 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_27690 148057 148260 gene locus_tag LOCUS_27700 148057 148260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 149943 148513 gene locus_tag LOCUS_27710 149943 148513 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_27710 153160 149933 gene locus_tag LOCUS_27720 153160 149933 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_27720 154154 153186 gene locus_tag LOCUS_27730 154154 153186 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_27730 154839 154402 gene locus_tag LOCUS_27740 154839 154402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 156221 155322 gene locus_tag LOCUS_27750 156221 155322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_27750 156734 156480 gene locus_tag LOCUS_27760 156734 156480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 158172 157081 gene locus_tag LOCUS_27770 158172 157081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 160263 158272 gene locus_tag LOCUS_27780 160263 158272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 162192 160351 gene locus_tag LOCUS_27790 162192 160351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 162551 163828 gene locus_tag LOCUS_27800 162551 163828 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_27800 164453 164635 gene locus_tag LOCUS_27810 164453 164635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 165317 165904 gene locus_tag LOCUS_27820 165317 165904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 165894 166340 gene locus_tag LOCUS_27830 gene rcp1 165894 166340 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_27830 167090 168118 gene locus_tag LOCUS_27840 167090 168118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 168296 168763 gene locus_tag LOCUS_27850 168296 168763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 169130 169579 gene locus_tag LOCUS_27860 169130 169579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 169707 172238 gene locus_tag LOCUS_27870 169707 172238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 172540 172995 gene locus_tag LOCUS_27880 172540 172995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 174163 174750 gene locus_tag LOCUS_27890 174163 174750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 174785 175834 gene locus_tag LOCUS_27900 174785 175834 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_27900 176063 179287 gene locus_tag LOCUS_27910 176063 179287 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_27910 179301 180911 gene locus_tag LOCUS_27920 179301 180911 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_27920 181343 182923 gene locus_tag LOCUS_27930 181343 182923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 183554 183033 gene locus_tag LOCUS_27940 183554 183033 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_27940 184408 185283 gene locus_tag LOCUS_27950 gene yedI 184408 185283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 protein_id gnl|my_center|LOCUS_27950 185407 186771 gene locus_tag LOCUS_27960 185407 186771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 186877 188118 gene locus_tag LOCUS_27970 186877 188118 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_27970 189343 188339 gene locus_tag LOCUS_27980 189343 188339 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_27980 189925 192054 gene locus_tag LOCUS_27990 189925 192054 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR9 protein_id gnl|my_center|LOCUS_27990 192160 192393 gene locus_tag LOCUS_28000 192160 192393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_28000 193071 193550 gene locus_tag LOCUS_28010 193071 193550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 protein_id gnl|my_center|LOCUS_28010 193980 194756 gene locus_tag LOCUS_28020 193980 194756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037160.1 protein_id gnl|my_center|LOCUS_28020 195222 195148 gene locus_tag LOCUS_t00170 195222 195148 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 900 427 gene locus_tag LOCUS_28030 900 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4375 1223 gene locus_tag LOCUS_28040 gene res 4375 1223 CDS product type III restriction-modification system restriction subunit Res inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_28040 4921 4556 gene locus_tag LOCUS_28050 4921 4556 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_28050 6254 5181 gene locus_tag LOCUS_28060 6254 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_28060 7490 6336 gene locus_tag LOCUS_28070 7490 6336 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_28070 8528 7947 gene locus_tag LOCUS_28080 gene yojM 8528 7947 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ4 protein_id gnl|my_center|LOCUS_28080 9329 8790 gene locus_tag LOCUS_28090 9329 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 9834 9304 gene locus_tag LOCUS_28100 9834 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 10259 9837 gene locus_tag LOCUS_28110 10259 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 10734 10249 gene locus_tag LOCUS_28120 10734 10249 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_28120 11131 11058 gene locus_tag LOCUS_t00180 11131 11058 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11220 12551 gene locus_tag LOCUS_28130 11220 12551 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_28130 12564 13358 gene locus_tag LOCUS_28140 12564 13358 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_28140 13538 14026 gene locus_tag LOCUS_28150 13538 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_28150 14133 15998 gene locus_tag LOCUS_28160 14133 15998 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_28160 16044 17213 gene locus_tag LOCUS_28170 16044 17213 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_28170 17282 18565 gene locus_tag LOCUS_28180 17282 18565 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_28180 19167 18514 gene locus_tag LOCUS_28190 19167 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 20062 19217 gene locus_tag LOCUS_28200 20062 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 20164 20793 gene locus_tag LOCUS_28210 20164 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 21051 21827 gene locus_tag LOCUS_28220 21051 21827 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_28220 21921 22529 gene locus_tag LOCUS_28230 21921 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 22588 25008 gene locus_tag LOCUS_28240 22588 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 26284 26898 gene locus_tag LOCUS_28250 26284 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 27980 28237 gene locus_tag LOCUS_28260 27980 28237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 28975 28241 gene locus_tag LOCUS_28270 28975 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_28270 30056 28989 gene locus_tag LOCUS_28280 30056 28989 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_28280 30214 31251 gene locus_tag LOCUS_28290 gene ruvB 30214 31251 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M0 protein_id gnl|my_center|LOCUS_28290 31280 32212 gene locus_tag LOCUS_28300 gene queG 31280 32212 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_28300 32784 32209 gene locus_tag LOCUS_28310 32784 32209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 33439 33882 gene locus_tag LOCUS_28320 33439 33882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 33882 34577 gene locus_tag LOCUS_28330 33882 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 34540 34932 gene locus_tag LOCUS_28340 34540 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 34929 35756 gene locus_tag LOCUS_28350 34929 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 35830 36588 gene locus_tag LOCUS_28360 35830 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 37202 36564 gene locus_tag LOCUS_28370 37202 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 37442 37248 gene locus_tag LOCUS_28380 37442 37248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 39011 37476 gene locus_tag LOCUS_28390 gene gltX 39011 37476 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_28390 39140 39757 gene locus_tag LOCUS_28400 39140 39757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 39900 40352 gene locus_tag LOCUS_28410 39900 40352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 41322 41008 gene locus_tag LOCUS_28420 41322 41008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 41661 44477 gene locus_tag LOCUS_28430 gene polA 41661 44477 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_28430 44537 45913 gene locus_tag LOCUS_28440 gene radA 44537 45913 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_28440 46712 45996 gene locus_tag LOCUS_28450 46712 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 48344 46869 gene locus_tag LOCUS_28460 48344 46869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 48453 49463 gene locus_tag LOCUS_28470 gene ykfB 48453 49463 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_28470 49478 50536 gene locus_tag LOCUS_28480 gene kbl 49478 50536 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MRI6 protein_id gnl|my_center|LOCUS_28480 50624 52126 gene locus_tag LOCUS_28490 50624 52126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 52901 53461 gene locus_tag LOCUS_28500 52901 53461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 53665 53856 gene locus_tag LOCUS_28510 53665 53856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 55903 54029 gene locus_tag LOCUS_28520 55903 54029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 56555 59173 gene locus_tag LOCUS_28530 56555 59173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 59565 60311 gene locus_tag LOCUS_28540 59565 60311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 62007 60328 gene locus_tag LOCUS_28550 62007 60328 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_28550 62265 63365 gene locus_tag LOCUS_28560 gene vdh 62265 63365 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_28560 63513 64697 gene locus_tag LOCUS_28570 63513 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 64707 65015 gene locus_tag LOCUS_28580 64707 65015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 65027 65572 gene locus_tag LOCUS_28590 65027 65572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_28590 65575 65895 gene locus_tag LOCUS_28600 gene yajC 65575 65895 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_28600 65908 66873 gene locus_tag LOCUS_28610 65908 66873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 66866 67474 gene locus_tag LOCUS_28620 gene coaE 66866 67474 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_28620 67729 67484 gene locus_tag LOCUS_28630 67729 67484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 68810 70312 gene locus_tag LOCUS_28640 gene atpD 68810 70312 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_28640 70366 70611 gene locus_tag LOCUS_28650 70366 70611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 71514 70705 gene locus_tag LOCUS_28660 gene murQ 71514 70705 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA1 protein_id gnl|my_center|LOCUS_28660 72361 71549 gene locus_tag LOCUS_28670 gene hpcH 72361 71549 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_28670 74604 72364 gene locus_tag LOCUS_28680 74604 72364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 77201 74961 gene locus_tag LOCUS_28690 77201 74961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 78624 77443 gene locus_tag LOCUS_28700 78624 77443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_28700 79670 78621 gene locus_tag LOCUS_28710 79670 78621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 80787 79684 gene locus_tag LOCUS_28720 80787 79684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_28720 82034 80784 gene locus_tag LOCUS_28730 82034 80784 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_28730 82452 83309 gene locus_tag LOCUS_28740 82452 83309 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_28740 83392 84639 gene locus_tag LOCUS_28750 83392 84639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109360.1 protein_id gnl|my_center|LOCUS_28750 84643 85806 gene locus_tag LOCUS_28760 84643 85806 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_28760 85978 87276 gene locus_tag LOCUS_28770 85978 87276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 89359 87674 gene locus_tag LOCUS_28780 89359 87674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 92733 89380 gene locus_tag LOCUS_28790 92733 89380 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_28790 93093 92878 gene locus_tag LOCUS_28800 93093 92878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 93388 95064 gene locus_tag LOCUS_28810 93388 95064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 95465 99751 gene locus_tag LOCUS_28820 gene dnaE 95465 99751 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_28820 99839 100159 gene locus_tag LOCUS_28830 99839 100159 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_28830 101656 100415 gene locus_tag LOCUS_28840 101656 100415 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_28840 102883 101660 gene locus_tag LOCUS_28850 gene selA 102883 101660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_28850 103465 102935 gene locus_tag LOCUS_28860 103465 102935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_28860 104768 103521 gene locus_tag LOCUS_28870 104768 103521 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_28870 105532 104780 gene locus_tag LOCUS_28880 105532 104780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 107325 105568 gene locus_tag LOCUS_28890 107325 105568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 108879 107989 gene locus_tag LOCUS_28900 108879 107989 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_28900 109321 108872 gene locus_tag LOCUS_28910 gene crtZ 109321 108872 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_28910 109795 109373 gene locus_tag LOCUS_28920 109795 109373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 110171 110476 gene locus_tag LOCUS_28930 110171 110476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_28930 111009 110503 gene locus_tag LOCUS_28940 111009 110503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 113710 111155 gene locus_tag LOCUS_28950 113710 111155 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_28950 114700 113807 gene locus_tag LOCUS_28960 114700 113807 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_28960 115143 116441 gene locus_tag LOCUS_28970 115143 116441 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_28970 116578 116814 gene locus_tag LOCUS_28980 116578 116814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 117210 118676 gene locus_tag LOCUS_28990 117210 118676 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_28990 119185 118769 gene locus_tag LOCUS_29000 119185 118769 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_29000 119527 120555 gene locus_tag LOCUS_29010 119527 120555 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_29010 121120 120854 gene locus_tag LOCUS_29020 121120 120854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 121516 121169 gene locus_tag LOCUS_29030 121516 121169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 121736 121497 gene locus_tag LOCUS_29040 121736 121497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 123667 122126 gene locus_tag LOCUS_29050 123667 122126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_29050 124288 123872 gene locus_tag LOCUS_29060 124288 123872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 124880 124425 gene locus_tag LOCUS_29070 124880 124425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 126699 125269 gene locus_tag LOCUS_29080 126699 125269 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038264.1 protein_id gnl|my_center|LOCUS_29080 127134 126922 gene locus_tag LOCUS_29090 127134 126922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 127405 128727 gene locus_tag LOCUS_29100 127405 128727 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_29100 128991 129323 gene locus_tag LOCUS_29110 128991 129323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_29110 129496 130128 gene locus_tag LOCUS_29120 gene arsC 129496 130128 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_29120 130334 131443 gene locus_tag LOCUS_29130 gene pyrD 130334 131443 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_29130 131646 134000 gene locus_tag LOCUS_29140 gene ftsK 131646 134000 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_29140 134019 134675 gene locus_tag LOCUS_29150 134019 134675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 134722 135540 gene locus_tag LOCUS_29160 gene pyrF 134722 135540 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_29160 135613 136917 gene locus_tag LOCUS_29170 135613 136917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_29170 136971 137609 gene locus_tag LOCUS_29180 136971 137609 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_29180 137661 138647 gene locus_tag LOCUS_29190 137661 138647 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTV8 protein_id gnl|my_center|LOCUS_29190 138628 139488 gene locus_tag LOCUS_29200 gene udp 138628 139488 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_29200 141415 139529 gene locus_tag LOCUS_29210 141415 139529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_29210 141941 143119 gene locus_tag LOCUS_29220 141941 143119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 143664 143353 gene locus_tag LOCUS_29230 143664 143353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 143990 143799 gene locus_tag LOCUS_29240 143990 143799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 144129 145574 gene locus_tag LOCUS_29250 144129 145574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 145578 146654 gene locus_tag LOCUS_29260 gene aroC 145578 146654 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_29260 146668 147999 gene locus_tag LOCUS_29270 gene gltP 146668 147999 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_29270 148100 148681 gene locus_tag LOCUS_29280 148100 148681 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_29280 148915 148712 gene locus_tag LOCUS_29290 148915 148712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 149034 149786 gene locus_tag LOCUS_29300 149034 149786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 150792 150016 gene locus_tag LOCUS_29310 150792 150016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 153001 151367 gene locus_tag LOCUS_29320 gene ade 153001 151367 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_29320 153161 153838 gene locus_tag LOCUS_29330 gene cmk 153161 153838 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 protein_id gnl|my_center|LOCUS_29330 153843 154745 gene locus_tag LOCUS_29340 gene ispH 153843 154745 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_29340 154879 156240 gene locus_tag LOCUS_29350 gene nqrA 154879 156240 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_29350 156246 157448 gene locus_tag LOCUS_29360 gene nqrB 156246 157448 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_29360 157435 158202 gene locus_tag LOCUS_29370 gene nqrC 157435 158202 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_29370 158231 158914 gene locus_tag LOCUS_29380 gene nqrD 158231 158914 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_29380 158928 159539 gene locus_tag LOCUS_29390 gene nqrE 158928 159539 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_29390 159644 160264 gene locus_tag LOCUS_29400 159644 160264 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_29400 161593 160553 gene locus_tag LOCUS_29410 161593 160553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 164005 161762 gene locus_tag LOCUS_29420 164005 161762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 164872 164036 gene locus_tag LOCUS_29430 164872 164036 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085021.1 protein_id gnl|my_center|LOCUS_29430 165492 165962 gene locus_tag LOCUS_29440 165492 165962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 166014 167084 gene locus_tag LOCUS_29450 166014 167084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 167211 168167 gene locus_tag LOCUS_29460 167211 168167 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_29460 171605 168303 gene locus_tag LOCUS_29470 171605 168303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 173304 171694 gene locus_tag LOCUS_29480 173304 171694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766966.1 protein_id gnl|my_center|LOCUS_29480 176333 173316 gene locus_tag LOCUS_29490 176333 173316 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_29490 176945 177655 gene locus_tag LOCUS_29500 176945 177655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 177848 179029 gene locus_tag LOCUS_29510 177848 179029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 180324 179098 gene locus_tag LOCUS_29520 180324 179098 CDS product metal ion (Mn2+/Fe2+) transporter (Nramp) family metal ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788100.1 protein_id gnl|my_center|LOCUS_29520 180581 181852 gene locus_tag LOCUS_29530 180581 181852 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_29530 181868 183088 gene locus_tag LOCUS_29540 181868 183088 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_29540 183094 184713 gene locus_tag LOCUS_29550 183094 184713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 184849 185385 gene locus_tag LOCUS_29560 184849 185385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186314.1 protein_id gnl|my_center|LOCUS_29560 185498 186688 gene locus_tag LOCUS_29570 185498 186688 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 protein_id gnl|my_center|LOCUS_29570 186685 187617 gene locus_tag LOCUS_29580 186685 187617 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_29580 189791 188334 gene locus_tag LOCUS_29590 189791 188334 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_29590 190179 190808 gene locus_tag LOCUS_29600 190179 190808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 191220 190990 gene locus_tag LOCUS_29610 191220 190990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 191258 191545 gene locus_tag LOCUS_29620 191258 191545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence14 1403 357 gene locus_tag LOCUS_29630 1403 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1818 2519 gene locus_tag LOCUS_29640 1818 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2599 2817 gene locus_tag LOCUS_29650 2599 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3405 4589 gene locus_tag LOCUS_29660 3405 4589 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123785.1 protein_id gnl|my_center|LOCUS_29660 5920 7107 gene locus_tag LOCUS_29670 5920 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 7117 8259 gene locus_tag LOCUS_29680 7117 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 8261 8920 gene locus_tag LOCUS_29690 8261 8920 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_29690 9041 9298 gene locus_tag LOCUS_29700 9041 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 12749 9558 gene locus_tag LOCUS_29710 12749 9558 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122060.1 protein_id gnl|my_center|LOCUS_29710 13039 14499 gene locus_tag LOCUS_29720 13039 14499 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_29720 16072 14861 gene locus_tag LOCUS_29730 16072 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 18652 16106 gene locus_tag LOCUS_29740 gene gyrA 18652 16106 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_29740 19816 18818 gene locus_tag LOCUS_29750 19816 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 20414 19905 gene locus_tag LOCUS_29760 20414 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 21186 20533 gene locus_tag LOCUS_29770 gene rpe 21186 20533 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_29770 22893 21256 gene locus_tag LOCUS_29780 22893 21256 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_29780 23521 22880 gene locus_tag LOCUS_29790 23521 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 23622 24251 gene locus_tag LOCUS_29800 23622 24251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 24913 24248 gene locus_tag LOCUS_29810 gene trmB 24913 24248 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_29810 26223 24916 gene locus_tag LOCUS_29820 26223 24916 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_29820 27186 26233 gene locus_tag LOCUS_29830 27186 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 27582 27190 gene locus_tag LOCUS_29840 27582 27190 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_29840 28285 27584 gene locus_tag LOCUS_29850 28285 27584 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_29850 28949 28287 gene locus_tag LOCUS_29860 28949 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 30761 29088 gene locus_tag LOCUS_29870 30761 29088 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_29870 33763 30761 gene locus_tag LOCUS_29880 33763 30761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_29880 34803 33778 gene locus_tag LOCUS_29890 34803 33778 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_29890 34866 35633 gene locus_tag LOCUS_29900 34866 35633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 36456 35620 gene locus_tag LOCUS_29910 gene uspA 36456 35620 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_29910 37403 36477 gene locus_tag LOCUS_29920 37403 36477 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_29920 37714 38484 gene locus_tag LOCUS_29930 37714 38484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_29930 40327 38597 gene locus_tag LOCUS_29940 40327 38597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 42766 40421 gene locus_tag LOCUS_29950 42766 40421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 43182 44126 gene locus_tag LOCUS_29960 43182 44126 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_29960 46316 44139 gene locus_tag LOCUS_29970 46316 44139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 47684 46491 gene locus_tag LOCUS_29980 47684 46491 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_29980 47939 48619 gene locus_tag LOCUS_29990 47939 48619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 48722 49921 gene locus_tag LOCUS_30000 48722 49921 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_30000 50287 49934 gene locus_tag LOCUS_30010 50287 49934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 51666 50434 gene locus_tag LOCUS_30020 51666 50434 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_30020 53302 51689 gene locus_tag LOCUS_30030 53302 51689 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_30030 53840 53433 gene locus_tag LOCUS_30040 53840 53433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 54324 53872 gene locus_tag LOCUS_30050 54324 53872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 55150 55779 gene locus_tag LOCUS_30060 55150 55779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 57333 56731 gene locus_tag LOCUS_30070 57333 56731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 58163 57348 gene locus_tag LOCUS_30080 gene dapD 58163 57348 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_30080 58200 59327 gene locus_tag LOCUS_30090 58200 59327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 59580 60251 gene locus_tag LOCUS_30100 gene sirR 59580 60251 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_30100 60423 60875 gene locus_tag LOCUS_30110 60423 60875 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_30110 60875 62257 gene locus_tag LOCUS_30120 gene mnmE 60875 62257 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_30120 62755 63408 gene locus_tag LOCUS_30130 62755 63408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 63450 63617 gene locus_tag LOCUS_30140 63450 63617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 63955 64314 gene locus_tag LOCUS_30150 63955 64314 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_30150 64625 65197 gene locus_tag LOCUS_30160 64625 65197 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_30160 65316 66524 gene locus_tag LOCUS_30170 65316 66524 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973720.1 protein_id gnl|my_center|LOCUS_30170 66627 66899 gene locus_tag LOCUS_30180 66627 66899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 66920 67591 gene locus_tag LOCUS_30190 66920 67591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30190 68307 69107 gene locus_tag LOCUS_30200 gene rsbQ 68307 69107 CDS product sigma factor SigB regulation protein RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07015 protein_id gnl|my_center|LOCUS_30200 69110 70225 gene locus_tag LOCUS_30210 69110 70225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 71384 70860 gene locus_tag LOCUS_30220 71384 70860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_30220 72058 73233 gene locus_tag LOCUS_30230 72058 73233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 73339 73584 gene locus_tag LOCUS_30240 73339 73584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 73581 73733 gene locus_tag LOCUS_30250 73581 73733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 74049 73828 gene locus_tag LOCUS_30260 74049 73828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 77758 74495 gene locus_tag LOCUS_30270 77758 74495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 79686 78589 gene locus_tag LOCUS_30280 79686 78589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 79984 80259 gene locus_tag LOCUS_30290 79984 80259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 80453 81034 gene locus_tag LOCUS_30300 80453 81034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 82871 81210 gene locus_tag LOCUS_30310 82871 81210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122167.1 protein_id gnl|my_center|LOCUS_30310 83982 83128 gene locus_tag LOCUS_30320 83982 83128 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_30320 84557 85393 gene locus_tag LOCUS_30330 84557 85393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 85629 86753 gene locus_tag LOCUS_30340 85629 86753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 88857 87679 gene locus_tag LOCUS_30350 88857 87679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_30350 90380 88857 gene locus_tag LOCUS_30360 90380 88857 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_30360 91848 90367 gene locus_tag LOCUS_30370 91848 90367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 94887 91861 gene locus_tag LOCUS_30380 94887 91861 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_30380 97533 96061 gene locus_tag LOCUS_30390 97533 96061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_30390 101040 97564 gene locus_tag LOCUS_30400 101040 97564 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_30400 102151 101150 gene locus_tag LOCUS_30410 102151 101150 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_30410 103048 102425 gene locus_tag LOCUS_30420 103048 102425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 103442 103924 gene locus_tag LOCUS_30430 103442 103924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 104690 105274 gene locus_tag LOCUS_30440 104690 105274 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881106.1 protein_id gnl|my_center|LOCUS_30440 107034 105445 gene locus_tag LOCUS_30450 107034 105445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 107958 107056 gene locus_tag LOCUS_30460 107958 107056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 109752 107962 gene locus_tag LOCUS_30470 109752 107962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_30470 113191 109772 gene locus_tag LOCUS_30480 113191 109772 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_30480 114916 113678 gene locus_tag LOCUS_30490 114916 113678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 115514 114975 gene locus_tag LOCUS_30500 115514 114975 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_30500 116632 116132 gene locus_tag LOCUS_30510 116632 116132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 118080 118871 gene locus_tag LOCUS_30520 118080 118871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 119462 119656 gene locus_tag LOCUS_30530 119462 119656 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30530 119691 119885 gene locus_tag LOCUS_30540 119691 119885 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30540 120216 120614 gene locus_tag LOCUS_30550 120216 120614 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969737.1 protein_id gnl|my_center|LOCUS_30550 120641 121072 gene locus_tag LOCUS_30560 120641 121072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 121454 122200 gene locus_tag LOCUS_30570 121454 122200 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_30570 123296 122187 gene locus_tag LOCUS_30580 123296 122187 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_30580 123407 124666 gene locus_tag LOCUS_30590 123407 124666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_30590 124671 125603 gene locus_tag LOCUS_30600 gene fmt 124671 125603 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_30600 125787 126335 gene locus_tag LOCUS_30610 125787 126335 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_30610 126368 126739 gene locus_tag LOCUS_30620 126368 126739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 126723 127196 gene locus_tag LOCUS_30630 126723 127196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 127488 128816 gene locus_tag LOCUS_30640 127488 128816 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y1 protein_id gnl|my_center|LOCUS_30640 128797 128997 gene locus_tag LOCUS_30650 128797 128997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 129118 131598 gene locus_tag LOCUS_30660 gene ligA 129118 131598 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_30660 131605 132099 gene locus_tag LOCUS_30670 131605 132099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 132101 132994 gene locus_tag LOCUS_30680 gene dapA 132101 132994 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_30680 133250 133077 gene locus_tag LOCUS_30690 133250 133077 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_30690 134522 133347 gene locus_tag LOCUS_30700 134522 133347 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_30700 134908 135510 gene locus_tag LOCUS_30710 134908 135510 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_30710 136201 135704 gene locus_tag LOCUS_30720 136201 135704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 136415 137155 gene locus_tag LOCUS_30730 136415 137155 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249291.1 protein_id gnl|my_center|LOCUS_30730 137152 137871 gene locus_tag LOCUS_30740 137152 137871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 137951 138736 gene locus_tag LOCUS_30750 137951 138736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 protein_id gnl|my_center|LOCUS_30750 139457 138759 gene locus_tag LOCUS_30760 139457 138759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 140068 139454 gene locus_tag LOCUS_30770 140068 139454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 141818 140160 gene locus_tag LOCUS_30780 141818 140160 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_30780 143798 141912 gene locus_tag LOCUS_30790 143798 141912 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GR0 protein_id gnl|my_center|LOCUS_30790 146562 144406 gene locus_tag LOCUS_30800 146562 144406 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_30800 147026 146565 gene locus_tag LOCUS_30810 147026 146565 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_30810 147386 148189 gene locus_tag LOCUS_30820 147386 148189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 148227 149963 gene locus_tag LOCUS_30830 148227 149963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 150041 150574 gene locus_tag LOCUS_30840 150041 150574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 150571 152673 gene locus_tag LOCUS_30850 150571 152673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 155047 152708 gene locus_tag LOCUS_30860 155047 152708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 156746 155031 gene locus_tag LOCUS_30870 156746 155031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 158184 156757 gene locus_tag LOCUS_30880 158184 156757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 158678 158265 gene locus_tag LOCUS_30890 158678 158265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 159168 158671 gene locus_tag LOCUS_30900 159168 158671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 160074 159190 gene locus_tag LOCUS_30910 160074 159190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 161097 160084 gene locus_tag LOCUS_30920 161097 160084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 164004 161491 gene locus_tag LOCUS_30930 gene priA 164004 161491 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A451 protein_id gnl|my_center|LOCUS_30930 166047 164020 gene locus_tag LOCUS_30940 gene yyaL 166047 164020 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_30940 167050 166067 gene locus_tag LOCUS_30950 167050 166067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_30950 167286 167534 gene locus_tag LOCUS_30960 167286 167534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 168032 167589 gene locus_tag LOCUS_30970 gene rplI 168032 167589 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_30970 168322 168071 gene locus_tag LOCUS_30980 gene rpsR 168322 168071 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_30980 168690 168319 gene locus_tag LOCUS_30990 gene rpsF 168690 168319 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_30990 169693 168770 gene locus_tag LOCUS_31000 169693 168770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 170964 170191 gene locus_tag LOCUS_31010 170964 170191 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_31010 171361 170975 gene locus_tag LOCUS_31020 gene apaG 171361 170975 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_31020 171434 172096 gene locus_tag LOCUS_31030 gene ung2 171434 172096 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_31030 173308 172232 gene locus_tag LOCUS_31040 173308 172232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 174044 173319 gene locus_tag LOCUS_31050 gene dapB 174044 173319 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_31050 174633 174046 gene locus_tag LOCUS_31060 174633 174046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 175578 174655 gene locus_tag LOCUS_31070 gene parB 175578 174655 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_31070 176371 175592 gene locus_tag LOCUS_31080 176371 175592 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_31080 177061 176378 gene locus_tag LOCUS_31090 177061 176378 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_31090 179259 177439 gene locus_tag LOCUS_31100 gene yidC 179259 177439 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_31100 180933 179311 gene locus_tag LOCUS_31110 gene pyrG 180933 179311 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_31110 181961 181125 gene locus_tag LOCUS_31120 gene hpaG 181961 181125 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence15 296 108 gene locus_tag LOCUS_31130 296 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2793 1720 gene locus_tag LOCUS_31140 gene metE 2793 1720 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_31140 4683 3316 gene locus_tag LOCUS_31150 4683 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 7146 4687 gene locus_tag LOCUS_31160 7146 4687 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_31160 9755 7725 gene locus_tag LOCUS_31170 9755 7725 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_31170 10984 10286 gene locus_tag LOCUS_31180 10984 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 12051 11305 gene locus_tag LOCUS_31190 12051 11305 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_31190 12111 14486 gene locus_tag LOCUS_31200 12111 14486 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_31200 14506 15411 gene locus_tag LOCUS_31210 gene hemF 14506 15411 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_31210 15415 16008 gene locus_tag LOCUS_31220 gene lpxF 15415 16008 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_31220 16582 15995 gene locus_tag LOCUS_31230 gene ribE 16582 15995 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_31230 16862 17518 gene locus_tag LOCUS_31240 gene pcm 16862 17518 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_31240 17530 18069 gene locus_tag LOCUS_31250 17530 18069 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_31250 18102 18662 gene locus_tag LOCUS_31260 18102 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 18667 18990 gene locus_tag LOCUS_31270 gene ydzA 18667 18990 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_31270 19011 20033 gene locus_tag LOCUS_31280 19011 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 20262 20756 gene locus_tag LOCUS_31290 gene dps 20262 20756 CDS product general stress protein 20U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80879 protein_id gnl|my_center|LOCUS_31290 23264 20814 gene locus_tag LOCUS_31300 23264 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 24090 23251 gene locus_tag LOCUS_31310 24090 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 24665 24087 gene locus_tag LOCUS_31320 24665 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 25096 24695 gene locus_tag LOCUS_31330 25096 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 26651 25521 gene locus_tag LOCUS_31340 26651 25521 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_31340 28128 26644 gene locus_tag LOCUS_31350 gene gatB 28128 26644 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_31350 30728 28197 gene locus_tag LOCUS_31360 gene alaS 30728 28197 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0M6 protein_id gnl|my_center|LOCUS_31360 30989 31966 gene locus_tag LOCUS_31370 30989 31966 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_31370 32130 32483 gene locus_tag LOCUS_31380 32130 32483 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_31380 32464 33594 gene locus_tag LOCUS_31390 gene smf 32464 33594 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_31390 33755 34324 gene locus_tag LOCUS_31400 33755 34324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 35770 34370 gene locus_tag LOCUS_31410 35770 34370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 36311 35748 gene locus_tag LOCUS_31420 gene pfpI 36311 35748 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_31420 37835 36711 gene locus_tag LOCUS_31430 gene dnaN 37835 36711 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_31430 39749 38070 gene locus_tag LOCUS_31440 39749 38070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 40464 39742 gene locus_tag LOCUS_31450 gene gldF 40464 39742 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_31450 41377 40469 gene locus_tag LOCUS_31460 gene gldA 41377 40469 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_31460 42908 41709 gene locus_tag LOCUS_31470 gene pgk 42908 41709 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_31470 43909 42947 gene locus_tag LOCUS_31480 43909 42947 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_31480 44622 43909 gene locus_tag LOCUS_31490 44622 43909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 45256 44705 gene locus_tag LOCUS_31500 45256 44705 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_31500 45847 45260 gene locus_tag LOCUS_31510 45847 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 47766 45844 gene locus_tag LOCUS_31520 47766 45844 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_31520 49807 47846 gene locus_tag LOCUS_31530 49807 47846 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_31530 50954 50394 gene locus_tag LOCUS_31540 50954 50394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 51436 50999 gene locus_tag LOCUS_31550 gene yjcF 51436 50999 CDS product putative N-acetyltransferase YjcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31628 protein_id gnl|my_center|LOCUS_31550 52395 51433 gene locus_tag LOCUS_31560 52395 51433 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_31560 52496 53266 gene locus_tag LOCUS_31570 gene fjo14 52496 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_31570 53433 53515 gene locus_tag LOCUS_t00190 53433 53515 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54121 53771 gene locus_tag LOCUS_31580 54121 53771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 54625 54134 gene locus_tag LOCUS_31590 54625 54134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 54952 54653 gene locus_tag LOCUS_31600 54952 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 55646 55362 gene locus_tag LOCUS_31610 55646 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 55741 55923 gene locus_tag LOCUS_31620 55741 55923 CDS product toxin HicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957073.1 protein_id gnl|my_center|LOCUS_31620 55972 56358 gene locus_tag LOCUS_31630 55972 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 59929 56498 gene locus_tag LOCUS_31640 59929 56498 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123348.1 protein_id gnl|my_center|LOCUS_31640 61229 60030 gene locus_tag LOCUS_31650 61229 60030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 62856 61222 gene locus_tag LOCUS_31660 62856 61222 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123361.1 protein_id gnl|my_center|LOCUS_31660 63664 63083 gene locus_tag LOCUS_31670 63664 63083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 63989 63654 gene locus_tag LOCUS_31680 63989 63654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 64512 64264 gene locus_tag LOCUS_31690 64512 64264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 65049 65402 gene locus_tag LOCUS_31700 65049 65402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 66198 65470 gene locus_tag LOCUS_31710 66198 65470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_31710 67262 66303 gene locus_tag LOCUS_31720 67262 66303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 68141 67266 gene locus_tag LOCUS_31730 68141 67266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 69156 70106 gene locus_tag LOCUS_31740 69156 70106 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_31740 72864 70216 gene locus_tag LOCUS_31750 72864 70216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 73674 72982 gene locus_tag LOCUS_31760 73674 72982 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_31760 74954 73797 gene locus_tag LOCUS_31770 74954 73797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_31770 75315 75989 gene locus_tag LOCUS_31780 75315 75989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 75995 76903 gene locus_tag LOCUS_31790 75995 76903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 77519 78367 gene locus_tag LOCUS_31800 77519 78367 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_31800 79654 78536 gene locus_tag LOCUS_31810 79654 78536 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700645.1 protein_id gnl|my_center|LOCUS_31810 80840 79788 gene locus_tag LOCUS_31820 80840 79788 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_31820 82561 80879 gene locus_tag LOCUS_31830 82561 80879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 83033 82566 gene locus_tag LOCUS_31840 83033 82566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 83527 83030 gene locus_tag LOCUS_31850 83527 83030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 84393 83527 gene locus_tag LOCUS_31860 84393 83527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 85510 84395 gene locus_tag LOCUS_31870 85510 84395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 86549 85593 gene locus_tag LOCUS_31880 86549 85593 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_31880 87672 86542 gene locus_tag LOCUS_31890 87672 86542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 88568 87714 gene locus_tag LOCUS_31900 88568 87714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 91311 88690 gene locus_tag LOCUS_31910 91311 88690 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_31910 92963 91818 gene locus_tag LOCUS_31920 gene gmd 92963 91818 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_31920 93955 93002 gene locus_tag LOCUS_31930 gene wcaG 93955 93002 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_31930 94955 93960 gene locus_tag LOCUS_31940 94955 93960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 95338 95838 gene locus_tag LOCUS_31950 95338 95838 CDS product transcription antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_31950 95966 97753 gene locus_tag LOCUS_31960 95966 97753 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_31960 98168 97743 gene locus_tag LOCUS_31970 98168 97743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 98332 98676 gene locus_tag LOCUS_31980 98332 98676 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_31980 99072 99368 gene locus_tag LOCUS_31990 99072 99368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 99955 99413 gene locus_tag LOCUS_32000 gene hslV 99955 99413 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGY8 protein_id gnl|my_center|LOCUS_32000 101696 100047 gene locus_tag LOCUS_32010 gene pdhC 101696 100047 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_32010 101819 102787 gene locus_tag LOCUS_32020 101819 102787 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_32020 102839 103504 gene locus_tag LOCUS_32030 102839 103504 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_32030 103504 104406 gene locus_tag LOCUS_32040 103504 104406 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_32040 105001 105717 gene locus_tag LOCUS_32050 105001 105717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 106780 105980 gene locus_tag LOCUS_32060 106780 105980 CDS product beta-1,4-N-acetyl- mannosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_32060 108310 112317 gene locus_tag LOCUS_32070 108310 112317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 114800 113928 gene locus_tag LOCUS_32080 114800 113928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 116362 115628 gene locus_tag LOCUS_32090 116362 115628 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119435.1 protein_id gnl|my_center|LOCUS_32090 117178 116390 gene locus_tag LOCUS_32100 117178 116390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 117783 117175 gene locus_tag LOCUS_32110 117783 117175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 120223 118850 gene locus_tag LOCUS_32120 120223 118850 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_32120 122604 120448 gene locus_tag LOCUS_32130 122604 120448 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 protein_id gnl|my_center|LOCUS_32130 123528 122752 gene locus_tag LOCUS_32140 123528 122752 CDS product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_32140 124970 124356 gene locus_tag LOCUS_32150 124970 124356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 125161 126159 gene locus_tag LOCUS_32160 gene fabH2 125161 126159 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_32160 126153 126755 gene locus_tag LOCUS_32170 126153 126755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 127010 128494 gene locus_tag LOCUS_32180 127010 128494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 128520 128690 gene locus_tag LOCUS_32190 128520 128690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 129768 129586 gene locus_tag LOCUS_32200 129768 129586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 131361 130438 gene locus_tag LOCUS_32210 gene lolI 131361 130438 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_32210 132989 133357 gene locus_tag LOCUS_32220 132989 133357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 138418 133364 gene locus_tag LOCUS_32230 138418 133364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 139511 138405 gene locus_tag LOCUS_32240 139511 138405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_32240 139903 140241 gene locus_tag LOCUS_32250 139903 140241 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765090.1 protein_id gnl|my_center|LOCUS_32250 140292 142193 gene locus_tag LOCUS_32260 140292 142193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_32260 142840 143235 gene locus_tag LOCUS_32270 142840 143235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 143355 143927 gene locus_tag LOCUS_32280 143355 143927 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_32280 143917 144672 gene locus_tag LOCUS_32290 143917 144672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 144685 145710 gene locus_tag LOCUS_32300 144685 145710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 145732 146652 gene locus_tag LOCUS_32310 145732 146652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 147225 146713 gene locus_tag LOCUS_32320 147225 146713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 148322 147225 gene locus_tag LOCUS_32330 gene paaE 148322 147225 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_32330 148562 149272 gene locus_tag LOCUS_32340 148562 149272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 149406 150749 gene locus_tag LOCUS_32350 gene purB 149406 150749 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_32350 152981 150924 gene locus_tag LOCUS_32360 152981 150924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 153599 153057 gene locus_tag LOCUS_32370 153599 153057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 153872 153699 gene locus_tag LOCUS_32380 153872 153699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 154360 153878 gene locus_tag LOCUS_32390 154360 153878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 155109 154363 gene locus_tag LOCUS_32400 155109 154363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_32400 155572 156801 gene locus_tag LOCUS_32410 155572 156801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 157136 158260 gene locus_tag LOCUS_32420 157136 158260 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 protein_id gnl|my_center|LOCUS_32420 159221 163786 gene locus_tag LOCUS_32430 159221 163786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence16 1695 3179 gene locus_tag LOCUS_32440 1695 3179 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_32440 3775 3194 gene locus_tag LOCUS_32450 gene rnhB 3775 3194 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_32450 6422 3750 gene locus_tag LOCUS_32460 6422 3750 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_32460 7916 6801 gene locus_tag LOCUS_32470 7916 6801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403218.1 protein_id gnl|my_center|LOCUS_32470 8739 7927 gene locus_tag LOCUS_32480 8739 7927 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_32480 10248 8905 gene locus_tag LOCUS_32490 10248 8905 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_32490 11617 10238 gene locus_tag LOCUS_32500 11617 10238 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_32500 11818 12246 gene locus_tag LOCUS_32510 11818 12246 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_32510 12737 12306 gene locus_tag LOCUS_32520 12737 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 13728 12889 gene locus_tag LOCUS_32530 13728 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 14527 13703 gene locus_tag LOCUS_32540 gene lpxH 14527 13703 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_32540 16695 14656 gene locus_tag LOCUS_32550 gene ftsH 16695 14656 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_32550 17115 16762 gene locus_tag LOCUS_32560 gene rsfS 17115 16762 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_32560 17216 17977 gene locus_tag LOCUS_32570 17216 17977 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_32570 18044 19363 gene locus_tag LOCUS_32580 gene ahcY 18044 19363 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_32580 19571 19416 gene locus_tag LOCUS_32590 19571 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 19773 20162 gene locus_tag LOCUS_32600 19773 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 20173 20838 gene locus_tag LOCUS_32610 20173 20838 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_32610 21132 25244 gene locus_tag LOCUS_32620 21132 25244 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_32620 25276 27303 gene locus_tag LOCUS_32630 25276 27303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_32630 28088 27705 gene locus_tag LOCUS_32640 28088 27705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_32640 28860 28066 gene locus_tag LOCUS_32650 28860 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_32650 31351 29297 gene locus_tag LOCUS_32660 31351 29297 CDS product 7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403897.1 protein_id gnl|my_center|LOCUS_32660 32262 31435 gene locus_tag LOCUS_32670 32262 31435 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_32670 33098 32901 gene locus_tag LOCUS_32680 33098 32901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 33927 33088 gene locus_tag LOCUS_32690 33927 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 35150 34542 gene locus_tag LOCUS_32700 35150 34542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 protein_id gnl|my_center|LOCUS_32700 35535 36665 gene locus_tag LOCUS_32710 35535 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799324.1 protein_id gnl|my_center|LOCUS_32710 36715 37854 gene locus_tag LOCUS_32720 36715 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_32720 37857 38060 gene locus_tag LOCUS_32730 37857 38060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 38112 39008 gene locus_tag LOCUS_32740 38112 39008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 40243 39239 gene locus_tag LOCUS_32750 40243 39239 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_32750 41072 40272 gene locus_tag LOCUS_32760 gene proC 41072 40272 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_32760 42812 41142 gene locus_tag LOCUS_32770 42812 41142 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_32770 43588 42827 gene locus_tag LOCUS_32780 43588 42827 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_32780 43745 44596 gene locus_tag LOCUS_32790 43745 44596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 46028 44640 gene locus_tag LOCUS_32800 46028 44640 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_32800 47032 46055 gene locus_tag LOCUS_32810 47032 46055 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_32810 47836 47036 gene locus_tag LOCUS_32820 gene uspA 47836 47036 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_32820 47939 48454 gene locus_tag LOCUS_32830 47939 48454 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_32830 49520 48579 gene locus_tag LOCUS_32840 49520 48579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 51999 49987 gene locus_tag LOCUS_32850 51999 49987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_32850 52303 53133 gene locus_tag LOCUS_32860 52303 53133 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_32860 54488 53163 gene locus_tag LOCUS_32870 54488 53163 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_32870 55214 54633 gene locus_tag LOCUS_32880 55214 54633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 57223 55562 gene locus_tag LOCUS_32890 gene araB 57223 55562 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJI2 protein_id gnl|my_center|LOCUS_32890 58017 57508 gene locus_tag LOCUS_32900 58017 57508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 59887 58337 gene locus_tag LOCUS_32910 59887 58337 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_32910 61025 60510 gene locus_tag LOCUS_32920 61025 60510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 61873 61523 gene locus_tag LOCUS_32930 61873 61523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 62155 64563 gene locus_tag LOCUS_32940 62155 64563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_32940 64567 66024 gene locus_tag LOCUS_32950 64567 66024 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_32950 66151 67107 gene locus_tag LOCUS_32960 66151 67107 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_32960 67135 68091 gene locus_tag LOCUS_32970 67135 68091 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_32970 68655 69083 gene locus_tag LOCUS_32980 68655 69083 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_32980 69270 70712 gene locus_tag LOCUS_32990 gene arsA 69270 70712 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_32990 70852 72270 gene locus_tag LOCUS_33000 70852 72270 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_33000 73358 72492 gene locus_tag LOCUS_33010 73358 72492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_33010 74490 73390 gene locus_tag LOCUS_33020 74490 73390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 74656 76068 gene locus_tag LOCUS_33030 74656 76068 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_33030 76251 77849 gene locus_tag LOCUS_33040 76251 77849 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_33040 79012 77852 gene locus_tag LOCUS_33050 79012 77852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 82097 79014 gene locus_tag LOCUS_33060 82097 79014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 82497 82309 gene locus_tag LOCUS_33070 82497 82309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 83562 82783 gene locus_tag LOCUS_33080 83562 82783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 85128 83611 gene locus_tag LOCUS_33090 85128 83611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_33090 86644 85307 gene locus_tag LOCUS_33100 86644 85307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 86788 87576 gene locus_tag LOCUS_33110 86788 87576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 87570 88577 gene locus_tag LOCUS_33120 87570 88577 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_33120 91554 88597 gene locus_tag LOCUS_33130 91554 88597 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_33130 93151 91652 gene locus_tag LOCUS_33140 93151 91652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_33140 93735 94601 gene locus_tag LOCUS_33150 gene nhoA 93735 94601 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195415.1 protein_id gnl|my_center|LOCUS_33150 95027 94725 gene locus_tag LOCUS_33160 95027 94725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 95639 96928 gene locus_tag LOCUS_33170 95639 96928 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_33170 97260 97033 gene locus_tag LOCUS_33180 97260 97033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 98631 97492 gene locus_tag LOCUS_33190 98631 97492 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_33190 100157 98748 gene locus_tag LOCUS_33200 gene GALNS 100157 98748 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_33200 100326 101882 gene locus_tag LOCUS_33210 100326 101882 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_33210 101931 103283 gene locus_tag LOCUS_33220 101931 103283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119396.1 protein_id gnl|my_center|LOCUS_33220 103465 105387 gene locus_tag LOCUS_33230 103465 105387 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_33230 105601 107481 gene locus_tag LOCUS_33240 105601 107481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 107553 109328 gene locus_tag LOCUS_33250 gene sglT 107553 109328 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_33250 110145 112496 gene locus_tag LOCUS_33260 110145 112496 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_33260 112497 113429 gene locus_tag LOCUS_33270 112497 113429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 114160 113546 gene locus_tag LOCUS_33280 114160 113546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_33280 114363 116045 gene locus_tag LOCUS_33290 114363 116045 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_33290 116617 116042 gene locus_tag LOCUS_33300 gene maa 116617 116042 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536391.1 protein_id gnl|my_center|LOCUS_33300 117163 116621 gene locus_tag LOCUS_33310 117163 116621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 117330 118697 gene locus_tag LOCUS_33320 117330 118697 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_33320 118736 119755 gene locus_tag LOCUS_33330 118736 119755 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_33330 119928 120725 gene locus_tag LOCUS_33340 119928 120725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 122257 121559 gene locus_tag LOCUS_33350 gene cobB 122257 121559 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H9 protein_id gnl|my_center|LOCUS_33350 124436 122280 gene locus_tag LOCUS_33360 124436 122280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 125557 124439 gene locus_tag LOCUS_33370 125557 124439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 129393 125986 gene locus_tag LOCUS_33380 129393 125986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 130687 129422 gene locus_tag LOCUS_33390 130687 129422 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_33390 130858 131115 gene locus_tag LOCUS_33400 130858 131115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 131102 131341 gene locus_tag LOCUS_33410 131102 131341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_33410 134410 132059 gene locus_tag LOCUS_33420 gene topA 134410 132059 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_33420 134571 135056 gene locus_tag LOCUS_33430 134571 135056 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_33430 135096 136169 gene locus_tag LOCUS_33440 gene speB 135096 136169 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_33440 136343 137737 gene locus_tag LOCUS_33450 136343 137737 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_33450 140181 138226 gene locus_tag LOCUS_33460 140181 138226 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_33460 140904 140620 gene locus_tag LOCUS_33470 140904 140620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 141548 140901 gene locus_tag LOCUS_33480 gene thiE 141548 140901 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RI59 protein_id gnl|my_center|LOCUS_33480 142597 141545 gene locus_tag LOCUS_33490 142597 141545 CDS product AIR synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_33490 143332 142598 gene locus_tag LOCUS_33500 143332 142598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 143656 145572 gene locus_tag LOCUS_33510 143656 145572 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 protein_id gnl|my_center|LOCUS_33510 >Feature sequence17 254 469 gene locus_tag LOCUS_33520 254 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 1886 663 gene locus_tag LOCUS_33530 1886 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 2257 1883 gene locus_tag LOCUS_33540 2257 1883 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_33540 3114 3482 gene locus_tag LOCUS_33550 3114 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4776 3604 gene locus_tag LOCUS_33560 4776 3604 CDS product protein up-regulated by thyroid hormone- PQQ-dependent glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122629.1 protein_id gnl|my_center|LOCUS_33560 6172 7008 gene locus_tag LOCUS_33570 6172 7008 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_33570 7069 7398 gene locus_tag LOCUS_33580 7069 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 7400 8038 gene locus_tag LOCUS_33590 7400 8038 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_33590 8041 8502 gene locus_tag LOCUS_33600 8041 8502 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_33600 8877 10298 gene locus_tag LOCUS_33610 8877 10298 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_33610 10520 11101 gene locus_tag LOCUS_33620 10520 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_33620 11129 11620 gene locus_tag LOCUS_33630 11129 11620 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_33630 15288 11728 gene locus_tag LOCUS_33640 gene smc 15288 11728 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBS6 protein_id gnl|my_center|LOCUS_33640 15778 16239 gene locus_tag LOCUS_33650 15778 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 16901 16362 gene locus_tag LOCUS_33660 16901 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 17192 17707 gene locus_tag LOCUS_33670 17192 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 17761 18957 gene locus_tag LOCUS_33680 17761 18957 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_33680 19008 20057 gene locus_tag LOCUS_33690 19008 20057 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_33690 20068 21129 gene locus_tag LOCUS_33700 20068 21129 CDS product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_33700 22870 21134 gene locus_tag LOCUS_33710 22870 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 23186 25240 gene locus_tag LOCUS_33720 23186 25240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 26206 25499 gene locus_tag LOCUS_33730 26206 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 27614 26226 gene locus_tag LOCUS_33740 27614 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_33740 28316 27642 gene locus_tag LOCUS_33750 28316 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 29707 28322 gene locus_tag LOCUS_33760 29707 28322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 31092 29842 gene locus_tag LOCUS_33770 31092 29842 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_33770 31394 33556 gene locus_tag LOCUS_33780 gene glnA 31394 33556 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_33780 34180 33710 gene locus_tag LOCUS_33790 34180 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 35285 34278 gene locus_tag LOCUS_33800 35285 34278 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_33800 36978 35407 gene locus_tag LOCUS_33810 36978 35407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 37304 36942 gene locus_tag LOCUS_33820 37304 36942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 39210 37381 gene locus_tag LOCUS_33830 39210 37381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 39566 40582 gene locus_tag LOCUS_33840 gene dlgD 39566 40582 CDS product 2,3-diketo-L-gulonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37672 protein_id gnl|my_center|LOCUS_33840 42436 40925 gene locus_tag LOCUS_33850 42436 40925 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ33 protein_id gnl|my_center|LOCUS_33850 43999 42614 gene locus_tag LOCUS_33860 43999 42614 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_33860 44562 44783 gene locus_tag LOCUS_33870 44562 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 44787 46898 gene locus_tag LOCUS_33880 gene feoB 44787 46898 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_33880 48496 47069 gene locus_tag LOCUS_33890 48496 47069 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_33890 51649 48575 gene locus_tag LOCUS_33900 51649 48575 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_33900 52919 51774 gene locus_tag LOCUS_33910 52919 51774 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_33910 53217 53432 gene locus_tag LOCUS_33920 53217 53432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 55086 53434 gene locus_tag LOCUS_33930 55086 53434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 56219 55563 gene locus_tag LOCUS_33940 56219 55563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 56736 56221 gene locus_tag LOCUS_33950 56736 56221 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_33950 58216 57212 gene locus_tag LOCUS_33960 58216 57212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 protein_id gnl|my_center|LOCUS_33960 59547 58456 gene locus_tag LOCUS_33970 59547 58456 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_33970 59795 59553 gene locus_tag LOCUS_33980 59795 59553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 63752 60060 gene locus_tag LOCUS_33990 gene purL 63752 60060 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Z2 protein_id gnl|my_center|LOCUS_33990 64167 64703 gene locus_tag LOCUS_34000 64167 64703 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_34000 64708 66054 gene locus_tag LOCUS_34010 64708 66054 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_34010 66068 67213 gene locus_tag LOCUS_34020 66068 67213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 67221 70628 gene locus_tag LOCUS_34030 67221 70628 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_34030 71438 70731 gene locus_tag LOCUS_34040 71438 70731 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_34040 71671 73146 gene locus_tag LOCUS_34050 gene araA 71671 73146 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_34050 74070 73246 gene locus_tag LOCUS_34060 74070 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 74628 74299 gene locus_tag LOCUS_34070 74628 74299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 76634 74721 gene locus_tag LOCUS_34080 76634 74721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 79158 76759 gene locus_tag LOCUS_34090 79158 76759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 79701 81863 gene locus_tag LOCUS_34100 79701 81863 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_34100 82268 83275 gene locus_tag LOCUS_34110 82268 83275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 83684 83331 gene locus_tag LOCUS_34120 83684 83331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 83833 86097 gene locus_tag LOCUS_34130 83833 86097 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_34130 86260 86517 gene locus_tag LOCUS_34140 86260 86517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 86514 87287 gene locus_tag LOCUS_34150 86514 87287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 88062 87301 gene locus_tag LOCUS_34160 88062 87301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 88221 88841 gene locus_tag LOCUS_34170 88221 88841 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269267.1 protein_id gnl|my_center|LOCUS_34170 89286 88855 gene locus_tag LOCUS_34180 89286 88855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 91477 89417 gene locus_tag LOCUS_34190 gene metG 91477 89417 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_34190 92983 91649 gene locus_tag LOCUS_34200 92983 91649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 93218 94798 gene locus_tag LOCUS_34210 93218 94798 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_34210 96144 94846 gene locus_tag LOCUS_34220 96144 94846 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_34220 96403 97446 gene locus_tag LOCUS_34230 96403 97446 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_34230 99950 97920 gene locus_tag LOCUS_34240 gene dcp1 99950 97920 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_34240 99996 100529 gene locus_tag LOCUS_34250 99996 100529 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_34250 100614 100931 gene locus_tag LOCUS_34260 100614 100931 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_34260 101156 100944 gene locus_tag LOCUS_34270 101156 100944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 101289 101477 gene locus_tag LOCUS_34280 101289 101477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 101720 102520 gene locus_tag LOCUS_34290 101720 102520 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_34290 104979 102565 gene locus_tag LOCUS_34300 104979 102565 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_34300 105543 105184 gene locus_tag LOCUS_34310 105543 105184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 107686 105833 gene locus_tag LOCUS_34320 107686 105833 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_34320 107868 110144 gene locus_tag LOCUS_34330 107868 110144 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_34330 111138 110119 gene locus_tag LOCUS_34340 111138 110119 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_34340 111491 112060 gene locus_tag LOCUS_34350 111491 112060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 112057 114465 gene locus_tag LOCUS_34360 112057 114465 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_34360 114467 114829 gene locus_tag LOCUS_34370 114467 114829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 115148 117322 gene locus_tag LOCUS_34380 115148 117322 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_34380 118248 117535 gene locus_tag LOCUS_34390 118248 117535 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_34390 119608 122784 gene locus_tag LOCUS_34400 119608 122784 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_34400 122806 124581 gene locus_tag LOCUS_34410 122806 124581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_34410 125200 127002 gene locus_tag LOCUS_34420 125200 127002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 127080 129200 gene locus_tag LOCUS_34430 127080 129200 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 protein_id gnl|my_center|LOCUS_34430 129271 130683 gene locus_tag LOCUS_34440 129271 130683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 130742 132226 gene locus_tag LOCUS_34450 130742 132226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 132246 134381 gene locus_tag LOCUS_34460 132246 134381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 134402 136354 gene locus_tag LOCUS_34470 134402 136354 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_34470 136915 137430 gene locus_tag LOCUS_34480 136915 137430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence18 1725 202 gene locus_tag LOCUS_34490 1725 202 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_34490 3031 1961 gene locus_tag LOCUS_34500 3031 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3235 3393 gene locus_tag LOCUS_34510 3235 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 3657 3902 gene locus_tag LOCUS_34520 3657 3902 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_34520 3893 4216 gene locus_tag LOCUS_34530 3893 4216 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_34530 4982 7075 gene locus_tag LOCUS_34540 4982 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119909.1 protein_id gnl|my_center|LOCUS_34540 7590 9779 gene locus_tag LOCUS_34550 7590 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 10447 10097 gene locus_tag LOCUS_34560 10447 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 11201 10809 gene locus_tag LOCUS_34570 11201 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 11507 11214 gene locus_tag LOCUS_34580 11507 11214 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_34580 13353 12951 gene locus_tag LOCUS_tm00010 13353 12951 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14501 15919 gene locus_tag LOCUS_34590 14501 15919 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 protein_id gnl|my_center|LOCUS_34590 15933 16817 gene locus_tag LOCUS_34600 15933 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 16992 18542 gene locus_tag LOCUS_34610 16992 18542 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_34610 18844 19947 gene locus_tag LOCUS_34620 18844 19947 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107390.1 protein_id gnl|my_center|LOCUS_34620 19951 22998 gene locus_tag LOCUS_34630 19951 22998 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107391.1 protein_id gnl|my_center|LOCUS_34630 24263 23019 gene locus_tag LOCUS_34640 24263 23019 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_34640 25215 24358 gene locus_tag LOCUS_34650 25215 24358 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_34650 26085 25312 gene locus_tag LOCUS_34660 26085 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_34660 27062 26082 gene locus_tag LOCUS_34670 27062 26082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_34670 28505 27078 gene locus_tag LOCUS_34680 28505 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_34680 31162 29102 gene locus_tag LOCUS_34690 gene ptrB 31162 29102 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_34690 31276 31695 gene locus_tag LOCUS_34700 gene mscL 31276 31695 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG6 protein_id gnl|my_center|LOCUS_34700 33838 31736 gene locus_tag LOCUS_34710 33838 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_34710 34662 33835 gene locus_tag LOCUS_34720 34662 33835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 36196 34739 gene locus_tag LOCUS_34730 36196 34739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 37603 36494 gene locus_tag LOCUS_34740 37603 36494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 39490 37634 gene locus_tag LOCUS_34750 gene nadE 39490 37634 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_34750 40273 39530 gene locus_tag LOCUS_34760 40273 39530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 41529 40276 gene locus_tag LOCUS_34770 41529 40276 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_34770 41785 41549 gene locus_tag LOCUS_34780 gene acpP 41785 41549 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_34780 41934 42362 gene locus_tag LOCUS_34790 41934 42362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 42374 43804 gene locus_tag LOCUS_34800 gene pykA 42374 43804 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_34800 45549 43984 gene locus_tag LOCUS_34810 gene fbpA 45549 43984 CDS product fibronectin-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_34810 46312 45551 gene locus_tag LOCUS_34820 gene phnP 46312 45551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_34820 46587 46309 gene locus_tag LOCUS_34830 46587 46309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 46969 46589 gene locus_tag LOCUS_34840 46969 46589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 47720 46962 gene locus_tag LOCUS_34850 47720 46962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 47794 48678 gene locus_tag LOCUS_34860 gene miaA1 47794 48678 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_34860 49037 48666 gene locus_tag LOCUS_34870 49037 48666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 50017 49040 gene locus_tag LOCUS_34880 gene pfkA 50017 49040 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_34880 52003 50195 gene locus_tag LOCUS_34890 52003 50195 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_34890 52567 52121 gene locus_tag LOCUS_34900 52567 52121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 55057 52892 gene locus_tag LOCUS_34910 55057 52892 CDS product glycosyl hydrolase family 31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_34910 55206 56585 gene locus_tag LOCUS_34920 55206 56585 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_34920 56881 57264 gene locus_tag LOCUS_34930 56881 57264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 58508 58218 gene locus_tag LOCUS_34940 58508 58218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 59230 58574 gene locus_tag LOCUS_34950 59230 58574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_34950 60555 59338 gene locus_tag LOCUS_34960 60555 59338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 60865 60686 gene locus_tag LOCUS_34970 60865 60686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34970 61050 61259 gene locus_tag LOCUS_34980 61050 61259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 61934 61482 gene locus_tag LOCUS_34990 61934 61482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 63171 61936 gene locus_tag LOCUS_35000 63171 61936 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_35000 64052 63354 gene locus_tag LOCUS_35010 64052 63354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_35010 64363 64049 gene locus_tag LOCUS_35020 64363 64049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 64385 64609 gene locus_tag LOCUS_35030 64385 64609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 65658 66518 gene locus_tag LOCUS_35040 65658 66518 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_35040 66699 67844 gene locus_tag LOCUS_35050 66699 67844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 67931 68422 gene locus_tag LOCUS_35060 67931 68422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 69668 68676 gene locus_tag LOCUS_35070 69668 68676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_35070 71311 69713 gene locus_tag LOCUS_35080 71311 69713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 71960 71325 gene locus_tag LOCUS_35090 71960 71325 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_35090 73195 71966 gene locus_tag LOCUS_35100 73195 71966 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_35100 73842 74051 gene locus_tag LOCUS_35110 73842 74051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 75250 74174 gene locus_tag LOCUS_35120 75250 74174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 76256 75261 gene locus_tag LOCUS_35130 76256 75261 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_35130 77089 76343 gene locus_tag LOCUS_35140 77089 76343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_35140 78220 77093 gene locus_tag LOCUS_35150 gene mauG 78220 77093 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_35150 78726 78421 gene locus_tag LOCUS_35160 78726 78421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 80321 81493 gene locus_tag LOCUS_35170 80321 81493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_35170 81490 81786 gene locus_tag LOCUS_35180 81490 81786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 83153 82440 gene locus_tag LOCUS_35190 83153 82440 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_35190 84296 83223 gene locus_tag LOCUS_35200 gene phoR 84296 83223 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_35200 84979 84293 gene locus_tag LOCUS_35210 gene phoP 84979 84293 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_35210 85930 85136 gene locus_tag LOCUS_35220 85930 85136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_35220 86111 87160 gene locus_tag LOCUS_35230 gene recA 86111 87160 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_35230 88402 87200 gene locus_tag LOCUS_35240 88402 87200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_35240 88560 89609 gene locus_tag LOCUS_35250 gene queA 88560 89609 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_35250 91800 89785 gene locus_tag LOCUS_35260 91800 89785 CDS product potassium transporter KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_35260 92753 94243 gene locus_tag LOCUS_35270 92753 94243 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_35270 94240 94842 gene locus_tag LOCUS_35280 94240 94842 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_35280 95431 94835 gene locus_tag LOCUS_35290 95431 94835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_35290 95487 96491 gene locus_tag LOCUS_35300 95487 96491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 97778 96501 gene locus_tag LOCUS_35310 97778 96501 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_35310 98989 97775 gene locus_tag LOCUS_35320 gene porV 98989 97775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_35320 102237 98986 gene locus_tag LOCUS_35330 gene porU 102237 98986 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_35330 102925 102221 gene locus_tag LOCUS_35340 gene pssA 102925 102221 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_35340 103575 102922 gene locus_tag LOCUS_35350 103575 102922 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_35350 103632 104687 gene locus_tag LOCUS_35360 gene fjo30 103632 104687 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_35360 104718 108137 gene locus_tag LOCUS_35370 104718 108137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 108155 109033 gene locus_tag LOCUS_35380 108155 109033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_35380 110412 109042 gene locus_tag LOCUS_35390 gene aldH 110412 109042 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Z3 protein_id gnl|my_center|LOCUS_35390 112926 110509 gene locus_tag LOCUS_35400 112926 110509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_35400 114139 113462 gene locus_tag LOCUS_35410 114139 113462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 114913 114350 gene locus_tag LOCUS_35420 114913 114350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 115344 116420 gene locus_tag LOCUS_35430 115344 116420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 116463 116969 gene locus_tag LOCUS_35440 116463 116969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 117294 117929 gene locus_tag LOCUS_35450 117294 117929 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537803.1 protein_id gnl|my_center|LOCUS_35450 118589 119743 gene locus_tag LOCUS_35460 118589 119743 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_35460 119786 121111 gene locus_tag LOCUS_35470 gene hemL1 119786 121111 CDS product glutamate-1-semialdehyde 2,1-aminomutase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNZ1 protein_id gnl|my_center|LOCUS_35470 121406 124315 gene locus_tag LOCUS_35480 121406 124315 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_35480 124420 125931 gene locus_tag LOCUS_35490 124420 125931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_35490 125947 127191 gene locus_tag LOCUS_35500 125947 127191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 127604 128110 gene locus_tag LOCUS_35510 127604 128110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 128498 128181 gene locus_tag LOCUS_35520 128498 128181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_35520 128618 129130 gene locus_tag LOCUS_35530 128618 129130 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_35530 130299 129238 gene locus_tag LOCUS_35540 130299 129238 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107777.1 protein_id gnl|my_center|LOCUS_35540 >Feature sequence19 1213 185 gene locus_tag LOCUS_35550 1213 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3531 1210 gene locus_tag LOCUS_35560 3531 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 5307 4036 gene locus_tag LOCUS_35570 gene purA 5307 4036 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_35570 5768 5424 gene locus_tag LOCUS_35580 gene spoIIAA 5768 5424 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GQ8 protein_id gnl|my_center|LOCUS_35580 6267 5779 gene locus_tag LOCUS_35590 6267 5779 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_35590 8546 6327 gene locus_tag LOCUS_35600 gene relA 8546 6327 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_35600 8782 8864 gene locus_tag LOCUS_t00200 8782 8864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8954 10282 gene locus_tag LOCUS_35610 gene tig 8954 10282 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_35610 10366 11037 gene locus_tag LOCUS_35620 gene clpP 10366 11037 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_35620 11045 12268 gene locus_tag LOCUS_35630 gene clpX 11045 12268 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_35630 13371 12265 gene locus_tag LOCUS_35640 gene lpxB 13371 12265 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_35640 13822 13403 gene locus_tag LOCUS_35650 13822 13403 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_35650 14671 15453 gene locus_tag LOCUS_35660 14671 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 15486 16901 gene locus_tag LOCUS_35670 15486 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 20520 17074 gene locus_tag LOCUS_35680 20520 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 21550 20726 gene locus_tag LOCUS_35690 21550 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 22992 21550 gene locus_tag LOCUS_35700 22992 21550 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_35700 25975 23000 gene locus_tag LOCUS_35710 25975 23000 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_35710 28000 26135 gene locus_tag LOCUS_35720 28000 26135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 28690 28061 gene locus_tag LOCUS_35730 gene queE 28690 28061 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_35730 29642 28743 gene locus_tag LOCUS_35740 gene folD 29642 28743 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_35740 31521 29728 gene locus_tag LOCUS_35750 gene lepA 31521 29728 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_35750 31660 32259 gene locus_tag LOCUS_35760 31660 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 32271 32810 gene locus_tag LOCUS_35770 32271 32810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 34748 32820 gene locus_tag LOCUS_35780 34748 32820 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_35780 34825 35430 gene locus_tag LOCUS_35790 34825 35430 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_35790 35450 35866 gene locus_tag LOCUS_35800 35450 35866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 37122 36070 gene locus_tag LOCUS_35810 37122 36070 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_35810 39021 37135 gene locus_tag LOCUS_35820 gene purF 39021 37135 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_35820 39982 39167 gene locus_tag LOCUS_35830 gene murI 39982 39167 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_35830 40248 40652 gene locus_tag LOCUS_35840 40248 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 40749 42116 gene locus_tag LOCUS_35850 40749 42116 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_35850 44665 42113 gene locus_tag LOCUS_35860 44665 42113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 45470 44835 gene locus_tag LOCUS_35870 45470 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932420.1 protein_id gnl|my_center|LOCUS_35870 46873 45506 gene locus_tag LOCUS_35880 46873 45506 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_35880 47854 46931 gene locus_tag LOCUS_35890 gene pyrB 47854 46931 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_35890 48408 47860 gene locus_tag LOCUS_35900 gene pyrR1 48408 47860 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_35900 50030 48459 gene locus_tag LOCUS_35910 50030 48459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 50408 52063 gene locus_tag LOCUS_35920 50408 52063 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_35920 52060 52347 gene locus_tag LOCUS_35930 52060 52347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 52344 53009 gene locus_tag LOCUS_35940 52344 53009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 53088 54035 gene locus_tag LOCUS_35950 53088 54035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_35950 54638 54039 gene locus_tag LOCUS_35960 54638 54039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 56925 55171 gene locus_tag LOCUS_35970 56925 55171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 57471 57064 gene locus_tag LOCUS_35980 57471 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 58435 57995 gene locus_tag LOCUS_35990 58435 57995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249810.1 protein_id gnl|my_center|LOCUS_35990 58635 58432 gene locus_tag LOCUS_36000 58635 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 59205 58705 gene locus_tag LOCUS_36010 59205 58705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 59673 62492 gene locus_tag LOCUS_36020 gene carB 59673 62492 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_36020 62688 62942 gene locus_tag LOCUS_36030 62688 62942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 63878 63102 gene locus_tag LOCUS_36040 63878 63102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 64322 64906 gene locus_tag LOCUS_36050 64322 64906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 66638 65004 gene locus_tag LOCUS_36060 gene cstA 66638 65004 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_36060 66933 67844 gene locus_tag LOCUS_36070 66933 67844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 67954 68796 gene locus_tag LOCUS_36080 gene accD 67954 68796 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_36080 68918 70222 gene locus_tag LOCUS_36090 gene nqrF 68918 70222 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_36090 70475 71632 gene locus_tag LOCUS_36100 gene fjo29 70475 71632 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_36100 71678 71911 gene locus_tag LOCUS_36110 71678 71911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 71912 72754 gene locus_tag LOCUS_36120 71912 72754 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_36120 72751 73560 gene locus_tag LOCUS_36130 gene murQ 72751 73560 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_36130 74646 73570 gene locus_tag LOCUS_36140 74646 73570 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_36140 75617 74649 gene locus_tag LOCUS_36150 gene kdsD 75617 74649 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_36150 75716 77893 gene locus_tag LOCUS_36160 75716 77893 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_36160 77911 79206 gene locus_tag LOCUS_36170 gene purD 77911 79206 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_36170 79342 80631 gene locus_tag LOCUS_36180 gene fjo17 79342 80631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_36180 80621 81094 gene locus_tag LOCUS_36190 80621 81094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 85187 81189 gene locus_tag LOCUS_36200 85187 81189 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865167.1 protein_id gnl|my_center|LOCUS_36200 85999 85187 gene locus_tag LOCUS_36210 85999 85187 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_36210 87007 86510 gene locus_tag LOCUS_36220 87007 86510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 87604 89004 gene locus_tag LOCUS_36230 87604 89004 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_36230 89001 89378 gene locus_tag LOCUS_36240 89001 89378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 90442 89411 gene locus_tag LOCUS_36250 gene thiL 90442 89411 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_36250 90745 91071 gene locus_tag LOCUS_36260 gene sufA 90745 91071 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_36260 91530 94598 gene locus_tag LOCUS_36270 91530 94598 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_36270 94610 95983 gene locus_tag LOCUS_36280 94610 95983 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_36280 96281 97372 gene locus_tag LOCUS_36290 gene gcvT 96281 97372 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_36290 97369 98073 gene locus_tag LOCUS_36300 gene comB 97369 98073 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_36300 98657 98115 gene locus_tag LOCUS_36310 98657 98115 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_36310 99481 99071 gene locus_tag LOCUS_36320 99481 99071 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_36320 100099 99494 gene locus_tag LOCUS_36330 gene hisI 100099 99494 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT3 protein_id gnl|my_center|LOCUS_36330 100910 100149 gene locus_tag LOCUS_36340 gene hisF 100910 100149 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_36340 101634 100912 gene locus_tag LOCUS_36350 gene hisA 101634 100912 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_36350 102218 101634 gene locus_tag LOCUS_36360 gene hisH 102218 101634 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_36360 103986 103093 gene locus_tag LOCUS_36370 103986 103093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 104160 105101 gene locus_tag LOCUS_36380 104160 105101 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_36380 105260 106210 gene locus_tag LOCUS_36390 gene lolI 105260 106210 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_36390 107013 107639 gene locus_tag LOCUS_36400 107013 107639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_36400 107696 107938 gene locus_tag LOCUS_36410 107696 107938 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_36410 108385 109629 gene locus_tag LOCUS_36420 108385 109629 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence20 1462 506 gene locus_tag LOCUS_36430 1462 506 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_36430 2424 1462 gene locus_tag LOCUS_36440 2424 1462 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_36440 2983 2432 gene locus_tag LOCUS_36450 2983 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3510 2995 gene locus_tag LOCUS_36460 3510 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 4750 3503 gene locus_tag LOCUS_36470 gene pyrC2 4750 3503 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_36470 5874 5143 gene locus_tag LOCUS_36480 5874 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 7295 5871 gene locus_tag LOCUS_36490 7295 5871 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_36490 7756 7292 gene locus_tag LOCUS_36500 7756 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 8835 7882 gene locus_tag LOCUS_36510 8835 7882 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_36510 11670 8956 gene locus_tag LOCUS_36520 11670 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36520 12718 11675 gene locus_tag LOCUS_36530 12718 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36530 14587 13280 gene locus_tag LOCUS_36540 14587 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 18622 14666 gene locus_tag LOCUS_36550 18622 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 19158 18907 gene locus_tag LOCUS_36560 19158 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 20439 19171 gene locus_tag LOCUS_36570 20439 19171 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_36570 21080 20421 gene locus_tag LOCUS_36580 21080 20421 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_36580 21281 23008 gene locus_tag LOCUS_36590 gene aceK 21281 23008 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_36590 23525 23010 gene locus_tag LOCUS_36600 23525 23010 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_36600 24001 24723 gene locus_tag LOCUS_36610 24001 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 24807 26087 gene locus_tag LOCUS_36620 gene pabB 24807 26087 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_36620 26088 27437 gene locus_tag LOCUS_36630 gene gdhA 26088 27437 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_36630 27446 28522 gene locus_tag LOCUS_36640 gene dinB2 27446 28522 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_36640 29053 29265 gene locus_tag LOCUS_36650 29053 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 31743 29470 gene locus_tag LOCUS_36660 31743 29470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_36660 36814 31793 gene locus_tag LOCUS_36670 36814 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 38432 36921 gene locus_tag LOCUS_36680 38432 36921 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMS0 protein_id gnl|my_center|LOCUS_36680 38727 40187 gene locus_tag LOCUS_36690 gene miaB 38727 40187 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_36690 40202 41515 gene locus_tag LOCUS_36700 40202 41515 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_36700 41502 42035 gene locus_tag LOCUS_36710 41502 42035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_36710 42077 42955 gene locus_tag LOCUS_36720 42077 42955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_36720 42969 43337 gene locus_tag LOCUS_36730 42969 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 43498 44487 gene locus_tag LOCUS_36740 43498 44487 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_36740 45250 44537 gene locus_tag LOCUS_36750 45250 44537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 45479 45757 gene locus_tag LOCUS_36760 gene groS 45479 45757 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_36760 45811 47442 gene locus_tag LOCUS_36770 gene groL 45811 47442 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_36770 47807 48181 gene locus_tag LOCUS_36780 47807 48181 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_36780 49388 48348 gene locus_tag LOCUS_36790 49388 48348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 50785 49385 gene locus_tag LOCUS_36800 50785 49385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140023.1 protein_id gnl|my_center|LOCUS_36800 52137 50782 gene locus_tag LOCUS_36810 52137 50782 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_36810 53857 52142 gene locus_tag LOCUS_36820 53857 52142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_36820 54528 53854 gene locus_tag LOCUS_36830 54528 53854 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_36830 55040 54645 gene locus_tag LOCUS_36840 55040 54645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_36840 55255 55052 gene locus_tag LOCUS_36850 55255 55052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 55518 57410 gene locus_tag LOCUS_36860 55518 57410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 57899 58822 gene locus_tag LOCUS_36870 57899 58822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 58904 59857 gene locus_tag LOCUS_36880 58904 59857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 59881 60384 gene locus_tag LOCUS_36890 gene dfrA 59881 60384 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_36890 60476 61735 gene locus_tag LOCUS_36900 60476 61735 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_36900 61818 63083 gene locus_tag LOCUS_36910 gene bfmBB 61818 63083 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_36910 65976 63076 gene locus_tag LOCUS_36920 65976 63076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 66381 66145 gene locus_tag LOCUS_36930 66381 66145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 66831 66592 gene locus_tag LOCUS_36940 66831 66592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 67244 66828 gene locus_tag LOCUS_36950 gene yhfA 67244 66828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 protein_id gnl|my_center|LOCUS_36950 67661 67960 gene locus_tag LOCUS_36960 67661 67960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 69894 68008 gene locus_tag LOCUS_36970 69894 68008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 71549 70248 gene locus_tag LOCUS_36980 71549 70248 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640098.1 protein_id gnl|my_center|LOCUS_36980 72312 71878 gene locus_tag LOCUS_36990 72312 71878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 73279 72314 gene locus_tag LOCUS_37000 73279 72314 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_37000 74262 73276 gene locus_tag LOCUS_37010 74262 73276 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_37010 75217 74522 gene locus_tag LOCUS_37020 75217 74522 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119732.1 protein_id gnl|my_center|LOCUS_37020 75407 75207 gene locus_tag LOCUS_37030 75407 75207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 75852 79850 gene locus_tag LOCUS_37040 75852 79850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 79976 80902 gene locus_tag LOCUS_37050 gene prsA 79976 80902 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_37050 80932 81522 gene locus_tag LOCUS_37060 gene rplY 80932 81522 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_37060 81804 82364 gene locus_tag LOCUS_37070 gene pth 81804 82364 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_37070 82369 82662 gene locus_tag LOCUS_37080 82369 82662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047969.1 protein_id gnl|my_center|LOCUS_37080 83221 82799 gene locus_tag LOCUS_37090 83221 82799 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_37090 83659 84066 gene locus_tag LOCUS_37100 83659 84066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 87176 84150 gene locus_tag LOCUS_37110 87176 84150 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_37110 87292 88728 gene locus_tag LOCUS_37120 87292 88728 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_37120 90511 89114 gene locus_tag LOCUS_37130 gene aslA 90511 89114 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_37130 90918 90730 gene locus_tag LOCUS_37140 90918 90730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 90824 91240 gene locus_tag LOCUS_37150 90824 91240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 91647 92519 gene locus_tag LOCUS_37160 gene xynB 91647 92519 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_37160 93166 94512 gene locus_tag LOCUS_37170 93166 94512 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_37170 95657 95178 gene locus_tag LOCUS_37180 95657 95178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 95838 95629 gene locus_tag LOCUS_37190 95838 95629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 101750 96438 gene locus_tag LOCUS_37200 101750 96438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 105860 102714 gene locus_tag LOCUS_37210 105860 102714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 109120 106601 gene locus_tag LOCUS_37220 109120 106601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence21 849 1670 gene locus_tag LOCUS_37230 849 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 1677 4109 gene locus_tag LOCUS_37240 gene wzc 1677 4109 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_37240 4757 6055 gene locus_tag LOCUS_37250 4757 6055 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_37250 6316 7062 gene locus_tag LOCUS_37260 6316 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 7059 8201 gene locus_tag LOCUS_37270 7059 8201 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_37270 8208 9377 gene locus_tag LOCUS_37280 8208 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 9367 10803 gene locus_tag LOCUS_37290 9367 10803 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102965.1 protein_id gnl|my_center|LOCUS_37290 10790 12511 gene locus_tag LOCUS_37300 10790 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 12648 13730 gene locus_tag LOCUS_37310 12648 13730 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_37310 13732 14382 gene locus_tag LOCUS_37320 13732 14382 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_37320 14468 15520 gene locus_tag LOCUS_37330 14468 15520 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_37330 16690 16857 gene locus_tag LOCUS_37340 16690 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 16820 17968 gene locus_tag LOCUS_37350 16820 17968 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_37350 17975 19321 gene locus_tag LOCUS_37360 17975 19321 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_37360 19325 20512 gene locus_tag LOCUS_37370 19325 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 20496 21599 gene locus_tag LOCUS_37380 20496 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 21601 22500 gene locus_tag LOCUS_37390 21601 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 22487 23527 gene locus_tag LOCUS_37400 gene fnlA 22487 23527 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963420.1 protein_id gnl|my_center|LOCUS_37400 23534 23959 gene locus_tag LOCUS_37410 23534 23959 CDS product sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963419.1 protein_id gnl|my_center|LOCUS_37410 23987 25108 gene locus_tag LOCUS_37420 gene capG 23987 25108 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_37420 25120 25980 gene locus_tag LOCUS_37430 25120 25980 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_37430 26002 27213 gene locus_tag LOCUS_37440 26002 27213 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_37440 27218 28144 gene locus_tag LOCUS_37450 27218 28144 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_37450 28266 29222 gene locus_tag LOCUS_37460 28266 29222 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039951.1 protein_id gnl|my_center|LOCUS_37460 29429 30595 gene locus_tag LOCUS_37470 29429 30595 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_37470 30606 31202 gene locus_tag LOCUS_37480 30606 31202 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_37480 31222 31800 gene locus_tag LOCUS_37490 31222 31800 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_37490 33047 34507 gene locus_tag LOCUS_37500 33047 34507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 37184 39121 gene locus_tag LOCUS_37510 37184 39121 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_37510 39540 40946 gene locus_tag LOCUS_37520 gene trpE 39540 40946 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_37520 40969 41544 gene locus_tag LOCUS_37530 40969 41544 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_37530 41551 42561 gene locus_tag LOCUS_37540 gene trpD 41551 42561 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_37540 42564 43385 gene locus_tag LOCUS_37550 gene trpC 42564 43385 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_37550 43382 44056 gene locus_tag LOCUS_37560 gene trpF 43382 44056 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_37560 44043 45221 gene locus_tag LOCUS_37570 gene trpB 44043 45221 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_37570 45221 46000 gene locus_tag LOCUS_37580 gene trpA 45221 46000 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_37580 45997 47016 gene locus_tag LOCUS_37590 gene aroF1 45997 47016 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_37590 48522 48061 gene locus_tag LOCUS_37600 48522 48061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_37600 49494 50258 gene locus_tag LOCUS_37610 gene phhA 49494 50258 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_37610 50412 51929 gene locus_tag LOCUS_37620 50412 51929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 52026 52523 gene locus_tag LOCUS_37630 52026 52523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 52543 54447 gene locus_tag LOCUS_37640 gene parE 52543 54447 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_37640 54604 57198 gene locus_tag LOCUS_37650 gene parC 54604 57198 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_37650 57209 57901 gene locus_tag LOCUS_37660 gene trmH 57209 57901 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_37660 58474 58058 gene locus_tag LOCUS_37670 58474 58058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_37670 58931 60886 gene locus_tag LOCUS_37680 gene thrS 58931 60886 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_37680 60972 61523 gene locus_tag LOCUS_37690 gene infC 60972 61523 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_37690 61546 61740 gene locus_tag LOCUS_37700 gene rpmI 61546 61740 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_37700 61836 62180 gene locus_tag LOCUS_37710 gene rplT 61836 62180 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_37710 62836 62760 gene locus_tag LOCUS_t00210 62836 62760 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 62930 63331 gene locus_tag LOCUS_37720 62930 63331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 63553 65373 gene locus_tag LOCUS_37730 63553 65373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 65437 65712 gene locus_tag LOCUS_37740 gene rpsO 65437 65712 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_37740 65817 67949 gene locus_tag LOCUS_37750 gene pnp 65817 67949 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_37750 68053 68916 gene locus_tag LOCUS_37760 68053 68916 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_37760 69011 70009 gene locus_tag LOCUS_37770 gene trxB1 69011 70009 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_37770 70022 71053 gene locus_tag LOCUS_37780 70022 71053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 71084 71800 gene locus_tag LOCUS_37790 71084 71800 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_37790 72537 71899 gene locus_tag LOCUS_37800 gene pdxH 72537 71899 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_37800 72636 73205 gene locus_tag LOCUS_37810 72636 73205 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_37810 73265 75337 gene locus_tag LOCUS_37820 73265 75337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_37820 75485 75558 gene locus_tag LOCUS_t00220 75485 75558 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 75959 77341 gene locus_tag LOCUS_37830 75959 77341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 77369 78661 gene locus_tag LOCUS_37840 77369 78661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 78897 80210 gene locus_tag LOCUS_37850 78897 80210 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635937.2 protein_id gnl|my_center|LOCUS_37850 81011 80298 gene locus_tag LOCUS_37860 81011 80298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 81690 81115 gene locus_tag LOCUS_37870 81690 81115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_37870 82482 83018 gene locus_tag LOCUS_37880 82482 83018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 84679 83225 gene locus_tag LOCUS_37890 84679 83225 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_37890 87906 84736 gene locus_tag LOCUS_37900 87906 84736 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_37900 89149 87926 gene locus_tag LOCUS_37910 89149 87926 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_37910 89686 89318 gene locus_tag LOCUS_37920 89686 89318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 91515 89941 gene locus_tag LOCUS_37930 gene yidK 91515 89941 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_37930 92468 91587 gene locus_tag LOCUS_37940 92468 91587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 94322 92727 gene locus_tag LOCUS_37950 gene menD 94322 92727 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_37950 95632 94424 gene locus_tag LOCUS_37960 95632 94424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_37960 96057 95638 gene locus_tag LOCUS_37970 gene menI 96057 95638 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y233 protein_id gnl|my_center|LOCUS_37970 96111 96734 gene locus_tag LOCUS_37980 gene gpm 96111 96734 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_37980 97139 96729 gene locus_tag LOCUS_37990 97139 96729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 98005 97238 gene locus_tag LOCUS_38000 98005 97238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_38000 99109 98009 gene locus_tag LOCUS_38010 99109 98009 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_38010 99154 100224 gene locus_tag LOCUS_38020 gene lpxK 99154 100224 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN6 protein_id gnl|my_center|LOCUS_38020 100205 102163 gene locus_tag LOCUS_38030 100205 102163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_38030 102173 102784 gene locus_tag LOCUS_38040 gene miaE 102173 102784 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_38040 103020 104264 gene locus_tag LOCUS_38050 103020 104264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_38050 104276 105964 gene locus_tag LOCUS_38060 104276 105964 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_38060 106101 107690 gene locus_tag LOCUS_38070 106101 107690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence22 753 1319 gene locus_tag LOCUS_38080 753 1319 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_38080 2032 1322 gene locus_tag LOCUS_38090 2032 1322 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_38090 2448 2825 gene locus_tag LOCUS_38100 2448 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3001 3447 gene locus_tag LOCUS_38110 3001 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4377 3715 gene locus_tag LOCUS_38120 4377 3715 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_38120 4918 4466 gene locus_tag LOCUS_38130 4918 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_38130 5966 4941 gene locus_tag LOCUS_38140 5966 4941 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_38140 7051 6263 gene locus_tag LOCUS_38150 7051 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 7541 7080 gene locus_tag LOCUS_38160 7541 7080 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_38160 7659 8453 gene locus_tag LOCUS_38170 7659 8453 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_38170 9313 8450 gene locus_tag LOCUS_38180 9313 8450 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_38180 9840 9424 gene locus_tag LOCUS_38190 9840 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 10669 10070 gene locus_tag LOCUS_38200 10669 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 11264 11061 gene locus_tag LOCUS_38210 11264 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 11519 12151 gene locus_tag LOCUS_38220 11519 12151 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_38220 12253 13260 gene locus_tag LOCUS_38230 12253 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 16263 13684 gene locus_tag LOCUS_38240 16263 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 16790 17791 gene locus_tag LOCUS_38250 16790 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 17875 18915 gene locus_tag LOCUS_38260 17875 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 19108 20124 gene locus_tag LOCUS_38270 19108 20124 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_38270 20461 21231 gene locus_tag LOCUS_38280 gene kduD1 20461 21231 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_38280 21507 21280 gene locus_tag LOCUS_38290 21507 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 22607 21564 gene locus_tag LOCUS_38300 22607 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 23945 23625 gene locus_tag LOCUS_38310 23945 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 24706 24960 gene locus_tag LOCUS_38320 24706 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 24938 25225 gene locus_tag LOCUS_38330 24938 25225 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971677.1 protein_id gnl|my_center|LOCUS_38330 25743 26945 gene locus_tag LOCUS_38340 25743 26945 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_38340 27053 28171 gene locus_tag LOCUS_38350 27053 28171 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_38350 28186 28995 gene locus_tag LOCUS_38360 gene yscE 28186 28995 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255244.1 protein_id gnl|my_center|LOCUS_38360 29406 29014 gene locus_tag LOCUS_38370 29406 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 29730 29425 gene locus_tag LOCUS_38380 29730 29425 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704671.1 protein_id gnl|my_center|LOCUS_38380 31300 30173 gene locus_tag LOCUS_38390 31300 30173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_38390 32501 31305 gene locus_tag LOCUS_38400 gene moeA 32501 31305 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_38400 33521 32532 gene locus_tag LOCUS_38410 gene moaA 33521 32532 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59038 protein_id gnl|my_center|LOCUS_38410 33972 33559 gene locus_tag LOCUS_38420 33972 33559 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_38420 34213 33974 gene locus_tag LOCUS_38430 gene moaD 34213 33974 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_38430 34844 35431 gene locus_tag LOCUS_38440 34844 35431 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_38440 35561 36571 gene locus_tag LOCUS_38450 35561 36571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 36615 40076 gene locus_tag LOCUS_38460 36615 40076 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_38460 40127 41659 gene locus_tag LOCUS_38470 40127 41659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_38470 41813 42586 gene locus_tag LOCUS_38480 gene hpaI1 41813 42586 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886713.1 protein_id gnl|my_center|LOCUS_38480 42591 44024 gene locus_tag LOCUS_38490 gene gntP 42591 44024 CDS product gluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_38490 44047 45207 gene locus_tag LOCUS_38500 gene uxuA 44047 45207 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_38500 45269 46144 gene locus_tag LOCUS_38510 45269 46144 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_38510 46163 47476 gene locus_tag LOCUS_38520 46163 47476 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_38520 47638 48489 gene locus_tag LOCUS_38530 47638 48489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 48622 49899 gene locus_tag LOCUS_38540 48622 49899 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_38540 49916 51403 gene locus_tag LOCUS_38550 49916 51403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 51560 52444 gene locus_tag LOCUS_38560 51560 52444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 56724 52600 gene locus_tag LOCUS_38570 56724 52600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 57774 57379 gene locus_tag LOCUS_38580 57774 57379 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_38580 57890 58795 gene locus_tag LOCUS_38590 57890 58795 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_38590 58788 59084 gene locus_tag LOCUS_38600 58788 59084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 59165 59090 gene locus_tag LOCUS_t00230 59165 59090 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59513 61051 gene locus_tag LOCUS_38610 gene hly 59513 61051 CDS product listeriolysin O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13128 protein_id gnl|my_center|LOCUS_38610 63743 61188 gene locus_tag LOCUS_38620 63743 61188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 64299 63751 gene locus_tag LOCUS_38630 64299 63751 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_38630 66050 64695 gene locus_tag LOCUS_38640 66050 64695 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_38640 67414 66050 gene locus_tag LOCUS_38650 67414 66050 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_38650 67621 68967 gene locus_tag LOCUS_38660 67621 68967 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_38660 68971 70221 gene locus_tag LOCUS_38670 68971 70221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_38670 70275 70970 gene locus_tag LOCUS_38680 70275 70970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_38680 71019 73415 gene locus_tag LOCUS_38690 71019 73415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_38690 73505 75937 gene locus_tag LOCUS_38700 73505 75937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38700 75949 78345 gene locus_tag LOCUS_38710 75949 78345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38710 78439 80808 gene locus_tag LOCUS_38720 78439 80808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107499.1 protein_id gnl|my_center|LOCUS_38720 80820 83234 gene locus_tag LOCUS_38730 80820 83234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38730 83246 85675 gene locus_tag LOCUS_38740 83246 85675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38740 85864 88281 gene locus_tag LOCUS_38750 85864 88281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38750 88343 90709 gene locus_tag LOCUS_38760 88343 90709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_38760 90747 91415 gene locus_tag LOCUS_38770 90747 91415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_38770 91694 91942 gene locus_tag LOCUS_38780 91694 91942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 92056 93660 gene locus_tag LOCUS_38790 gene sulP 92056 93660 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_38790 93860 94504 gene locus_tag LOCUS_38800 93860 94504 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_38800 96350 95028 gene locus_tag LOCUS_38810 96350 95028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_38810 96930 98777 gene locus_tag LOCUS_38820 96930 98777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 101449 99371 gene locus_tag LOCUS_38830 101449 99371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 101666 102250 gene locus_tag LOCUS_38840 101666 102250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 102777 103367 gene locus_tag LOCUS_38850 102777 103367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 103364 103912 gene locus_tag LOCUS_38860 103364 103912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 103909 104502 gene locus_tag LOCUS_38870 103909 104502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence23 245 742 gene locus_tag LOCUS_38880 245 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 748 1110 gene locus_tag LOCUS_38890 748 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1100 1708 gene locus_tag LOCUS_38900 1100 1708 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_38900 1721 2290 gene locus_tag LOCUS_38910 1721 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 2441 2824 gene locus_tag LOCUS_38920 2441 2824 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_38920 2829 3230 gene locus_tag LOCUS_38930 2829 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 3255 3653 gene locus_tag LOCUS_38940 3255 3653 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072501.1 protein_id gnl|my_center|LOCUS_38940 4163 4585 gene locus_tag LOCUS_38950 4163 4585 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972513.1 protein_id gnl|my_center|LOCUS_38950 4732 5184 gene locus_tag LOCUS_38960 4732 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 5458 5772 gene locus_tag LOCUS_38970 5458 5772 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_38970 5788 6252 gene locus_tag LOCUS_38980 5788 6252 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_38980 6260 6544 gene locus_tag LOCUS_38990 6260 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38990 6617 6787 gene locus_tag LOCUS_39000 6617 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 6792 7169 gene locus_tag LOCUS_39010 6792 7169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_39010 7172 7528 gene locus_tag LOCUS_39020 7172 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 7535 7894 gene locus_tag LOCUS_39030 7535 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_39030 8555 8923 gene locus_tag LOCUS_39040 8555 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 9940 9053 gene locus_tag LOCUS_39050 9940 9053 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709527.1 protein_id gnl|my_center|LOCUS_39050 10252 11115 gene locus_tag LOCUS_39060 10252 11115 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325516.1 protein_id gnl|my_center|LOCUS_39060 11998 11483 gene locus_tag LOCUS_39070 11998 11483 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722684.1 protein_id gnl|my_center|LOCUS_39070 13163 12750 gene locus_tag LOCUS_39080 13163 12750 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_39080 14329 13637 gene locus_tag LOCUS_39090 14329 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 14558 14307 gene locus_tag LOCUS_39100 14558 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 15572 17011 gene locus_tag LOCUS_39110 15572 17011 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_39110 17464 17093 gene locus_tag LOCUS_39120 17464 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 18249 18019 gene locus_tag LOCUS_39130 18249 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 18791 19366 gene locus_tag LOCUS_39140 18791 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 19388 19834 gene locus_tag LOCUS_39150 19388 19834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_39150 20001 24089 gene locus_tag LOCUS_39160 20001 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 24452 25096 gene locus_tag LOCUS_39170 24452 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 26044 25580 gene locus_tag LOCUS_39180 26044 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 27200 26049 gene locus_tag LOCUS_39190 27200 26049 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_39190 27417 27268 gene locus_tag LOCUS_39200 27417 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 28276 28842 gene locus_tag LOCUS_39210 28276 28842 CDS product protein MG115 homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EXC9 protein_id gnl|my_center|LOCUS_39210 30010 29210 gene locus_tag LOCUS_39220 30010 29210 CDS product methyltransferase, TIGR04290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_39220 31111 30032 gene locus_tag LOCUS_39230 31111 30032 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969526.1 protein_id gnl|my_center|LOCUS_39230 32293 31124 gene locus_tag LOCUS_39240 32293 31124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533197.1 protein_id gnl|my_center|LOCUS_39240 33468 32341 gene locus_tag LOCUS_39250 33468 32341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969524.1 protein_id gnl|my_center|LOCUS_39250 34638 33571 gene locus_tag LOCUS_39260 34638 33571 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533195.1 protein_id gnl|my_center|LOCUS_39260 35661 34642 gene locus_tag LOCUS_39270 35661 34642 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975139.1 protein_id gnl|my_center|LOCUS_39270 36677 35661 gene locus_tag LOCUS_39280 36677 35661 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975138.1 protein_id gnl|my_center|LOCUS_39280 38701 36674 gene locus_tag LOCUS_39290 38701 36674 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338288.1 protein_id gnl|my_center|LOCUS_39290 39893 38778 gene locus_tag LOCUS_39300 39893 38778 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975137.1 protein_id gnl|my_center|LOCUS_39300 40633 39911 gene locus_tag LOCUS_39310 40633 39911 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_39310 42472 41411 gene locus_tag LOCUS_39320 42472 41411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 43381 43956 gene locus_tag LOCUS_39330 43381 43956 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368448.1 protein_id gnl|my_center|LOCUS_39330 44062 44310 gene locus_tag LOCUS_39340 44062 44310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 45607 45774 gene locus_tag LOCUS_39350 45607 45774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 46138 46731 gene locus_tag LOCUS_39360 46138 46731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 48173 47316 gene locus_tag LOCUS_39370 48173 47316 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_39370 49253 48477 gene locus_tag LOCUS_39380 49253 48477 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_39380 50516 49254 gene locus_tag LOCUS_39390 50516 49254 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_39390 51564 51806 gene locus_tag LOCUS_39400 51564 51806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 51854 52687 gene locus_tag LOCUS_39410 51854 52687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 54022 52871 gene locus_tag LOCUS_39420 54022 52871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 55487 54201 gene locus_tag LOCUS_39430 55487 54201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_39430 57056 55713 gene locus_tag LOCUS_39440 gene rifK 57056 55713 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_39440 57751 57083 gene locus_tag LOCUS_39450 57751 57083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 59529 57769 gene locus_tag LOCUS_39460 59529 57769 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_39460 62632 59540 gene locus_tag LOCUS_39470 62632 59540 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_39470 64169 67189 gene locus_tag LOCUS_39480 64169 67189 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_39480 67277 69016 gene locus_tag LOCUS_39490 67277 69016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109037.1 protein_id gnl|my_center|LOCUS_39490 69137 72160 gene locus_tag LOCUS_39500 69137 72160 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_39500 72222 73865 gene locus_tag LOCUS_39510 72222 73865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_39510 73871 74932 gene locus_tag LOCUS_39520 73871 74932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 75311 75460 gene locus_tag LOCUS_39530 75311 75460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 75533 77095 gene locus_tag LOCUS_39540 75533 77095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 77267 78751 gene locus_tag LOCUS_39550 77267 78751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730930.1 protein_id gnl|my_center|LOCUS_39550 79483 82605 gene locus_tag LOCUS_39560 79483 82605 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_39560 82626 84116 gene locus_tag LOCUS_39570 82626 84116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 84123 85652 gene locus_tag LOCUS_39580 84123 85652 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_39580 85777 87819 gene locus_tag LOCUS_39590 85777 87819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 87927 89303 gene locus_tag LOCUS_39600 87927 89303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 90396 89347 gene locus_tag LOCUS_39610 90396 89347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 91938 90484 gene locus_tag LOCUS_39620 91938 90484 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_39620 93923 92208 gene locus_tag LOCUS_39630 93923 92208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767367.1 protein_id gnl|my_center|LOCUS_39630 97107 93952 gene locus_tag LOCUS_39640 97107 93952 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_39640 97547 99739 gene locus_tag LOCUS_39650 97547 99739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 100033 100773 gene locus_tag LOCUS_39660 100033 100773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence24 <1 541 gene locus_tag LOCUS_39670 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761338.1:IS256 family transposase 796 629 gene locus_tag LOCUS_39680 796 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1718 1524 gene locus_tag LOCUS_39690 1718 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 2584 1715 gene locus_tag LOCUS_39700 2584 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 2743 3768 gene locus_tag LOCUS_39710 2743 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4396 4262 gene locus_tag LOCUS_39720 4396 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4659 4387 gene locus_tag LOCUS_39730 4659 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5094 4915 gene locus_tag LOCUS_39740 5094 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 7898 5595 gene locus_tag LOCUS_39750 7898 5595 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_39750 8249 8752 gene locus_tag LOCUS_39760 8249 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 8979 10004 gene locus_tag LOCUS_39770 8979 10004 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037531.1 protein_id gnl|my_center|LOCUS_39770 10008 10730 gene locus_tag LOCUS_39780 10008 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 10990 12330 gene locus_tag LOCUS_39790 10990 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 13224 12919 gene locus_tag LOCUS_39800 13224 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 13448 13221 gene locus_tag LOCUS_39810 13448 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 14615 14307 gene locus_tag LOCUS_39820 14615 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 15011 14619 gene locus_tag LOCUS_39830 15011 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 17325 16330 gene locus_tag LOCUS_39840 17325 16330 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_39840 18605 17322 gene locus_tag LOCUS_39850 18605 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_39850 20159 18615 gene locus_tag LOCUS_39860 20159 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 21281 20223 gene locus_tag LOCUS_39870 gene galE 21281 20223 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119071.1 protein_id gnl|my_center|LOCUS_39870 22089 21769 gene locus_tag LOCUS_39880 22089 21769 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_39880 22759 22208 gene locus_tag LOCUS_39890 22759 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 23510 22977 gene locus_tag LOCUS_39900 23510 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 24121 23564 gene locus_tag LOCUS_39910 24121 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_39910 26132 24339 gene locus_tag LOCUS_39920 26132 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 27462 26227 gene locus_tag LOCUS_39930 27462 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 31283 27459 gene locus_tag LOCUS_39940 31283 27459 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_39940 31779 31393 gene locus_tag LOCUS_39950 31779 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 33524 32529 gene locus_tag LOCUS_39960 gene uxuA 33524 32529 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_39960 34304 33561 gene locus_tag LOCUS_39970 34304 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 35405 34557 gene locus_tag LOCUS_39980 gene uxuB 35405 34557 CDS product putative oxidoreductase UxuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34896 protein_id gnl|my_center|LOCUS_39980 36813 35410 gene locus_tag LOCUS_39990 gene uxaC 36813 35410 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FH3 protein_id gnl|my_center|LOCUS_39990 38486 36831 gene locus_tag LOCUS_40000 38486 36831 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_40000 38698 39612 gene locus_tag LOCUS_40010 38698 39612 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_40010 41890 39761 gene locus_tag LOCUS_40020 41890 39761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 43446 42007 gene locus_tag LOCUS_40030 43446 42007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 43743 43525 gene locus_tag LOCUS_40040 43743 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 45141 43816 gene locus_tag LOCUS_40050 45141 43816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40050 48267 45313 gene locus_tag LOCUS_40060 48267 45313 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_40060 49329 48967 gene locus_tag LOCUS_40070 49329 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 49508 49723 gene locus_tag LOCUS_40080 49508 49723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 50093 49764 gene locus_tag LOCUS_40090 50093 49764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 51205 50102 gene locus_tag LOCUS_40100 51205 50102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 52123 51752 gene locus_tag LOCUS_40110 52123 51752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 53028 52387 gene locus_tag LOCUS_40120 53028 52387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 54379 53003 gene locus_tag LOCUS_40130 54379 53003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40130 55382 54522 gene locus_tag LOCUS_40140 55382 54522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 56208 55369 gene locus_tag LOCUS_40150 56208 55369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 56452 57126 gene locus_tag LOCUS_40160 56452 57126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 58430 57501 gene locus_tag LOCUS_40170 58430 57501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 58876 58436 gene locus_tag LOCUS_40180 58876 58436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 59041 60729 gene locus_tag LOCUS_40190 59041 60729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 61537 60851 gene locus_tag LOCUS_40200 61537 60851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 62121 61747 gene locus_tag LOCUS_40210 62121 61747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 62487 62206 gene locus_tag LOCUS_40220 62487 62206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 63474 64796 gene locus_tag LOCUS_40230 63474 64796 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_40230 64814 65689 gene locus_tag LOCUS_40240 64814 65689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 65927 66112 gene locus_tag LOCUS_40250 65927 66112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 66370 66203 gene locus_tag LOCUS_40260 66370 66203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 68880 66610 gene locus_tag LOCUS_40270 68880 66610 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_40270 69350 68892 gene locus_tag LOCUS_40280 69350 68892 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_40280 71706 69466 gene locus_tag LOCUS_40290 71706 69466 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_40290 73034 71925 gene locus_tag LOCUS_40300 73034 71925 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202725.1 protein_id gnl|my_center|LOCUS_40300 73574 73107 gene locus_tag LOCUS_40310 73574 73107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 75654 73747 gene locus_tag LOCUS_40320 75654 73747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 76979 75714 gene locus_tag LOCUS_40330 76979 75714 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_40330 78205 77354 gene locus_tag LOCUS_40340 78205 77354 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347746.1 protein_id gnl|my_center|LOCUS_40340 78706 78266 gene locus_tag LOCUS_40350 78706 78266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 79364 78756 gene locus_tag LOCUS_40360 79364 78756 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_40360 79830 79378 gene locus_tag LOCUS_40370 79830 79378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 80292 79843 gene locus_tag LOCUS_40380 80292 79843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 81413 80328 gene locus_tag LOCUS_40390 81413 80328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211257.1 protein_id gnl|my_center|LOCUS_40390 81729 82727 gene locus_tag LOCUS_40400 81729 82727 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_40400 82724 83431 gene locus_tag LOCUS_40410 82724 83431 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_40410 83974 83531 gene locus_tag LOCUS_40420 83974 83531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 84840 84217 gene locus_tag LOCUS_40430 84840 84217 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_40430 85915 85409 gene locus_tag LOCUS_40440 85915 85409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 86970 85915 gene locus_tag LOCUS_40450 86970 85915 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_40450 87215 87442 gene locus_tag LOCUS_40460 87215 87442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_40460 87489 88358 gene locus_tag LOCUS_40470 87489 88358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 88371 89234 gene locus_tag LOCUS_40480 88371 89234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 90776 89346 gene locus_tag LOCUS_40490 90776 89346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence25 964 260 gene locus_tag LOCUS_40500 964 260 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_40500 1959 961 gene locus_tag LOCUS_40510 1959 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 2196 2699 gene locus_tag LOCUS_40520 2196 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2717 3163 gene locus_tag LOCUS_40530 2717 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 3267 3851 gene locus_tag LOCUS_40540 3267 3851 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_40540 3903 6152 gene locus_tag LOCUS_40550 3903 6152 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_40550 6270 6728 gene locus_tag LOCUS_40560 6270 6728 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_40560 6741 9011 gene locus_tag LOCUS_40570 6741 9011 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_40570 10446 9292 gene locus_tag LOCUS_40580 10446 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 11092 14433 gene locus_tag LOCUS_40590 11092 14433 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_40590 14443 16170 gene locus_tag LOCUS_40600 14443 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_40600 16337 17413 gene locus_tag LOCUS_40610 16337 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 17629 19047 gene locus_tag LOCUS_40620 17629 19047 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_40620 19083 19667 gene locus_tag LOCUS_40630 19083 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 19651 20733 gene locus_tag LOCUS_40640 19651 20733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 21727 20984 gene locus_tag LOCUS_40650 21727 20984 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_40650 22389 21724 gene locus_tag LOCUS_40660 22389 21724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 23770 22790 gene locus_tag LOCUS_40670 23770 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_40670 25027 23777 gene locus_tag LOCUS_40680 25027 23777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 25338 26543 gene locus_tag LOCUS_40690 25338 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 26587 27012 gene locus_tag LOCUS_40700 26587 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 27812 27135 gene locus_tag LOCUS_40710 27812 27135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 28511 29686 gene locus_tag LOCUS_40720 28511 29686 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_40720 31687 30110 gene locus_tag LOCUS_40730 31687 30110 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6X5 protein_id gnl|my_center|LOCUS_40730 32297 33073 gene locus_tag LOCUS_40740 32297 33073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_40740 33138 34433 gene locus_tag LOCUS_40750 33138 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 34571 34990 gene locus_tag LOCUS_40760 34571 34990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 36021 35020 gene locus_tag LOCUS_40770 36021 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 36754 40314 gene locus_tag LOCUS_40780 36754 40314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 40340 40489 gene locus_tag LOCUS_40790 40340 40489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 40875 42410 gene locus_tag LOCUS_40800 gene arsA 40875 42410 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_40800 42593 43135 gene locus_tag LOCUS_40810 42593 43135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 43352 44899 gene locus_tag LOCUS_40820 43352 44899 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_40820 45611 48733 gene locus_tag LOCUS_40830 45611 48733 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_40830 48777 50495 gene locus_tag LOCUS_40840 48777 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 50505 52034 gene locus_tag LOCUS_40850 50505 52034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_40850 52484 52813 gene locus_tag LOCUS_40860 52484 52813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 52810 53697 gene locus_tag LOCUS_40870 52810 53697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 53815 54096 gene locus_tag LOCUS_40880 53815 54096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 55686 54100 gene locus_tag LOCUS_40890 gene ggt 55686 54100 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_40890 56209 55871 gene locus_tag LOCUS_40900 56209 55871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 56647 57291 gene locus_tag LOCUS_40910 56647 57291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 57905 57288 gene locus_tag LOCUS_40920 57905 57288 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_40920 58312 59697 gene locus_tag LOCUS_40930 58312 59697 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388785.1 protein_id gnl|my_center|LOCUS_40930 59694 61058 gene locus_tag LOCUS_40940 59694 61058 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_40940 61104 62252 gene locus_tag LOCUS_40950 61104 62252 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337398.1 protein_id gnl|my_center|LOCUS_40950 62256 62999 gene locus_tag LOCUS_40960 62256 62999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 63002 64366 gene locus_tag LOCUS_40970 63002 64366 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_40970 64627 67185 gene locus_tag LOCUS_40980 64627 67185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 67882 67379 gene locus_tag LOCUS_40990 67882 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 69382 67898 gene locus_tag LOCUS_41000 69382 67898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 72734 69396 gene locus_tag LOCUS_41010 72734 69396 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_41010 73521 74642 gene locus_tag LOCUS_41020 73521 74642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_41020 74996 75991 gene locus_tag LOCUS_41030 gene dgoK1 74996 75991 CDS product putative 2-dehydro-3-deoxygalactonokinase DgoK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RN7 protein_id gnl|my_center|LOCUS_41030 75960 76601 gene locus_tag LOCUS_41040 75960 76601 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_41040 76671 78035 gene locus_tag LOCUS_41050 76671 78035 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_41050 78175 82578 gene locus_tag LOCUS_41060 78175 82578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 83039 86338 gene locus_tag LOCUS_41070 83039 86338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence26 559 1998 gene locus_tag LOCUS_41080 559 1998 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 protein_id gnl|my_center|LOCUS_41080 2170 3897 gene locus_tag LOCUS_41090 2170 3897 CDS product type I restriction endonuclease EcoAI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110082.1 protein_id gnl|my_center|LOCUS_41090 3914 5047 gene locus_tag LOCUS_41100 3914 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 5052 5465 gene locus_tag LOCUS_41110 5052 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 5591 6394 gene locus_tag LOCUS_41120 5591 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 7842 6661 gene locus_tag LOCUS_41130 7842 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 8874 7888 gene locus_tag LOCUS_41140 8874 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 9545 8874 gene locus_tag LOCUS_41150 9545 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 10835 9558 gene locus_tag LOCUS_41160 10835 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 11633 12025 gene locus_tag LOCUS_41170 11633 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 12027 13022 gene locus_tag LOCUS_41180 12027 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_41180 14393 13524 gene locus_tag LOCUS_41190 14393 13524 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 protein_id gnl|my_center|LOCUS_41190 15365 14394 gene locus_tag LOCUS_41200 15365 14394 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_41200 16241 17980 gene locus_tag LOCUS_41210 16241 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 18047 20269 gene locus_tag LOCUS_41220 18047 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 20426 20977 gene locus_tag LOCUS_41230 20426 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 21086 22114 gene locus_tag LOCUS_41240 21086 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 22818 22366 gene locus_tag LOCUS_41250 22818 22366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 24313 23579 gene locus_tag LOCUS_41260 24313 23579 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_41260 25363 24320 gene locus_tag LOCUS_41270 25363 24320 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_41270 26580 25360 gene locus_tag LOCUS_41280 26580 25360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_41280 27326 26583 gene locus_tag LOCUS_41290 27326 26583 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_41290 28537 27338 gene locus_tag LOCUS_41300 28537 27338 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_41300 29874 28549 gene locus_tag LOCUS_41310 29874 28549 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_41310 30073 30747 gene locus_tag LOCUS_41320 30073 30747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053861.1 protein_id gnl|my_center|LOCUS_41320 30957 30733 gene locus_tag LOCUS_41330 30957 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 30901 32052 gene locus_tag LOCUS_41340 gene nhaP 30901 32052 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_41340 33898 32486 gene locus_tag LOCUS_41350 33898 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 34358 34050 gene locus_tag LOCUS_41360 34358 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 34790 35113 gene locus_tag LOCUS_41370 34790 35113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 38285 35169 gene locus_tag LOCUS_41380 gene czcA 38285 35169 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_41380 39397 38297 gene locus_tag LOCUS_41390 39397 38297 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_41390 40803 39457 gene locus_tag LOCUS_41400 gene ibeB 40803 39457 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_41400 41924 41121 gene locus_tag LOCUS_41410 41924 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 42503 46708 gene locus_tag LOCUS_41420 42503 46708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 47344 46985 gene locus_tag LOCUS_41430 47344 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 48057 47425 gene locus_tag LOCUS_41440 48057 47425 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_41440 49756 48050 gene locus_tag LOCUS_41450 49756 48050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 51126 49969 gene locus_tag LOCUS_41460 51126 49969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 51938 51171 gene locus_tag LOCUS_41470 51938 51171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 53231 51957 gene locus_tag LOCUS_41480 53231 51957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_41480 54385 53228 gene locus_tag LOCUS_41490 54385 53228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 55086 54382 gene locus_tag LOCUS_41500 55086 54382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_41500 56230 55097 gene locus_tag LOCUS_41510 56230 55097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 56790 56227 gene locus_tag LOCUS_41520 56790 56227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 58592 57063 gene locus_tag LOCUS_41530 58592 57063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 59112 58627 gene locus_tag LOCUS_41540 59112 58627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 60214 59201 gene locus_tag LOCUS_41550 60214 59201 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081533.1 protein_id gnl|my_center|LOCUS_41550 60954 61913 gene locus_tag LOCUS_41560 60954 61913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 61986 63053 gene locus_tag LOCUS_41570 61986 63053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 63154 64401 gene locus_tag LOCUS_41580 gene arsA 63154 64401 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_41580 64833 64594 gene locus_tag LOCUS_41590 64833 64594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 68082 64927 gene locus_tag LOCUS_41600 68082 64927 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_41600 69140 68091 gene locus_tag LOCUS_41610 69140 68091 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262152.1 protein_id gnl|my_center|LOCUS_41610 70541 69180 gene locus_tag LOCUS_41620 70541 69180 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_41620 71077 70616 gene locus_tag LOCUS_41630 71077 70616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 71472 73928 gene locus_tag LOCUS_41640 71472 73928 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141907.1 protein_id gnl|my_center|LOCUS_41640 73951 75294 gene locus_tag LOCUS_41650 73951 75294 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080345.1 protein_id gnl|my_center|LOCUS_41650 77522 75624 gene locus_tag LOCUS_41660 77522 75624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 77642 78856 gene locus_tag LOCUS_41670 gene mnmA 77642 78856 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_41670 78858 79583 gene locus_tag LOCUS_41680 gene truC 78858 79583 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_41680 79679 81106 gene locus_tag LOCUS_41690 79679 81106 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265821.1 protein_id gnl|my_center|LOCUS_41690 81912 81151 gene locus_tag LOCUS_41700 81912 81151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 83830 82040 gene locus_tag LOCUS_41710 83830 82040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence27 263 189 gene locus_tag LOCUS_t00240 263 189 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 449 1183 gene locus_tag LOCUS_41720 449 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 3326 1872 gene locus_tag LOCUS_41730 gene rpoN 3326 1872 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_41730 3505 4956 gene locus_tag LOCUS_41740 gene asnS 3505 4956 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_41740 5330 5983 gene locus_tag LOCUS_41750 5330 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 6134 7222 gene locus_tag LOCUS_41760 6134 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 7456 10839 gene locus_tag LOCUS_41770 7456 10839 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_41770 10858 12606 gene locus_tag LOCUS_41780 10858 12606 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_41780 12688 13323 gene locus_tag LOCUS_41790 12688 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 13405 14802 gene locus_tag LOCUS_41800 13405 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 15561 16976 gene locus_tag LOCUS_41810 15561 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 17023 18372 gene locus_tag LOCUS_41820 17023 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 18422 18922 gene locus_tag LOCUS_41830 18422 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 20658 19168 gene locus_tag LOCUS_41840 20658 19168 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_41840 21964 20651 gene locus_tag LOCUS_41850 21964 20651 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_41850 23248 22022 gene locus_tag LOCUS_41860 23248 22022 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_41860 23753 24298 gene locus_tag LOCUS_41870 23753 24298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 25418 24321 gene locus_tag LOCUS_41880 25418 24321 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_41880 26368 25616 gene locus_tag LOCUS_41890 26368 25616 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJC9 protein_id gnl|my_center|LOCUS_41890 31476 26374 gene locus_tag LOCUS_41900 31476 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 31602 32606 gene locus_tag LOCUS_41910 31602 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 32619 33848 gene locus_tag LOCUS_41920 32619 33848 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_41920 33921 34718 gene locus_tag LOCUS_41930 33921 34718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 35563 34775 gene locus_tag LOCUS_41940 35563 34775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 36463 35654 gene locus_tag LOCUS_41950 36463 35654 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120356.1 protein_id gnl|my_center|LOCUS_41950 37760 36693 gene locus_tag LOCUS_41960 gene gpsA 37760 36693 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_41960 39459 37732 gene locus_tag LOCUS_41970 39459 37732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 39545 40519 gene locus_tag LOCUS_41980 39545 40519 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_41980 40776 41294 gene locus_tag LOCUS_41990 gene mraZ 40776 41294 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q039S3 protein_id gnl|my_center|LOCUS_41990 41317 42192 gene locus_tag LOCUS_42000 gene rsmH 41317 42192 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_42000 42195 42575 gene locus_tag LOCUS_42010 42195 42575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 42671 44680 gene locus_tag LOCUS_42020 gene ftsI 42671 44680 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_42020 44677 46143 gene locus_tag LOCUS_42030 gene murE 44677 46143 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_42030 46145 47356 gene locus_tag LOCUS_42040 gene mraY 46145 47356 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_42040 47357 48703 gene locus_tag LOCUS_42050 gene murD 47357 48703 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_42050 48703 49872 gene locus_tag LOCUS_42060 gene ftsW 48703 49872 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_42060 49876 50988 gene locus_tag LOCUS_42070 gene murG 49876 50988 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_42070 50985 52385 gene locus_tag LOCUS_42080 50985 52385 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A259 protein_id gnl|my_center|LOCUS_42080 52414 53139 gene locus_tag LOCUS_42090 52414 53139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 53151 54467 gene locus_tag LOCUS_42100 gene ftsA 53151 54467 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_42100 54503 56113 gene locus_tag LOCUS_42110 54503 56113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 56641 56117 gene locus_tag LOCUS_42120 56641 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 56863 57747 gene locus_tag LOCUS_42130 56863 57747 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_42130 57948 58613 gene locus_tag LOCUS_42140 57948 58613 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_42140 58693 59862 gene locus_tag LOCUS_42150 58693 59862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 59892 60941 gene locus_tag LOCUS_42160 59892 60941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_42160 61497 60997 gene locus_tag LOCUS_42170 gene greB 61497 60997 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFI0 protein_id gnl|my_center|LOCUS_42170 62859 61978 gene locus_tag LOCUS_42180 62859 61978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_42180 63142 65076 gene locus_tag LOCUS_42190 gene sdhA 63142 65076 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_42190 65076 65804 gene locus_tag LOCUS_42200 gene sdhB 65076 65804 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_42200 65813 67345 gene locus_tag LOCUS_42210 gene ppx 65813 67345 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_42210 67964 67605 gene locus_tag LOCUS_42220 67964 67605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 69005 68136 gene locus_tag LOCUS_42230 gene rfbA 69005 68136 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_42230 69328 70002 gene locus_tag LOCUS_42240 69328 70002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 70559 71305 gene locus_tag LOCUS_42250 70559 71305 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_42250 71615 72139 gene locus_tag LOCUS_42260 71615 72139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 72309 73136 gene locus_tag LOCUS_42270 gene uspA 72309 73136 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_42270 73579 74919 gene locus_tag LOCUS_42280 73579 74919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_42280 75951 75055 gene locus_tag LOCUS_42290 75951 75055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 76193 77620 gene locus_tag LOCUS_42300 gene uxaC 76193 77620 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_42300 79098 77788 gene locus_tag LOCUS_42310 79098 77788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_42310 80156 79122 gene locus_tag LOCUS_42320 gene fucO 80156 79122 CDS product L-fucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120627.1 protein_id gnl|my_center|LOCUS_42320 81139 80189 gene locus_tag LOCUS_42330 81139 80189 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_42330 81978 81145 gene locus_tag LOCUS_42340 81978 81145 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_42340 82255 83094 gene locus_tag LOCUS_42350 82255 83094 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_42350 83372 83172 gene locus_tag LOCUS_42360 83372 83172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence28 926 408 gene locus_tag LOCUS_42370 926 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 4122 1618 gene locus_tag LOCUS_42380 4122 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4859 4128 gene locus_tag LOCUS_42390 4859 4128 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_42390 5793 4888 gene locus_tag LOCUS_42400 5793 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 7108 5795 gene locus_tag LOCUS_42410 7108 5795 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_42410 8078 7113 gene locus_tag LOCUS_42420 8078 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 8748 8560 gene locus_tag LOCUS_42430 8748 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 9095 10039 gene locus_tag LOCUS_42440 9095 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933730.1 protein_id gnl|my_center|LOCUS_42440 11348 10332 gene locus_tag LOCUS_42450 11348 10332 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_42450 11562 11909 gene locus_tag LOCUS_42460 gene fdx1 11562 11909 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_42460 12082 12435 gene locus_tag LOCUS_42470 12082 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 12570 13661 gene locus_tag LOCUS_42480 12570 13661 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_42480 13667 14764 gene locus_tag LOCUS_42490 gene ychF 13667 14764 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_42490 14876 15769 gene locus_tag LOCUS_42500 14876 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 17417 16143 gene locus_tag LOCUS_42510 17417 16143 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_42510 19439 17520 gene locus_tag LOCUS_42520 19439 17520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_42520 20352 19519 gene locus_tag LOCUS_42530 20352 19519 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 protein_id gnl|my_center|LOCUS_42530 20583 20501 gene locus_tag LOCUS_t00250 20583 20501 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21204 20743 gene locus_tag LOCUS_42540 21204 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 21740 21255 gene locus_tag LOCUS_42550 21740 21255 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBF1 protein_id gnl|my_center|LOCUS_42550 22789 22154 gene locus_tag LOCUS_42560 22789 22154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 22969 24159 gene locus_tag LOCUS_42570 gene dinB 22969 24159 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_42570 24434 24258 gene locus_tag LOCUS_42580 24434 24258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 25371 24682 gene locus_tag LOCUS_42590 25371 24682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 25656 25417 gene locus_tag LOCUS_42600 25656 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 26183 25788 gene locus_tag LOCUS_42610 26183 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 26860 26183 gene locus_tag LOCUS_42620 26860 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 27251 27520 gene locus_tag LOCUS_42630 27251 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 27864 28124 gene locus_tag LOCUS_42640 27864 28124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 29193 28141 gene locus_tag LOCUS_42650 29193 28141 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_42650 31033 29168 gene locus_tag LOCUS_42660 31033 29168 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_42660 32811 31030 gene locus_tag LOCUS_42670 32811 31030 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_42670 33601 34848 gene locus_tag LOCUS_42680 33601 34848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701462.1 protein_id gnl|my_center|LOCUS_42680 36114 35236 gene locus_tag LOCUS_42690 36114 35236 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 protein_id gnl|my_center|LOCUS_42690 36734 36183 gene locus_tag LOCUS_42700 36734 36183 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_42700 37059 38294 gene locus_tag LOCUS_42710 37059 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 38476 39579 gene locus_tag LOCUS_42720 38476 39579 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_42720 39695 41707 gene locus_tag LOCUS_42730 39695 41707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_42730 44064 42157 gene locus_tag LOCUS_42740 44064 42157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755913.1 protein_id gnl|my_center|LOCUS_42740 45137 44049 gene locus_tag LOCUS_42750 45137 44049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42750 46128 45172 gene locus_tag LOCUS_42760 46128 45172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42760 47358 46393 gene locus_tag LOCUS_42770 47358 46393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 49150 47408 gene locus_tag LOCUS_42780 49150 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 50624 49308 gene locus_tag LOCUS_42790 50624 49308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 52000 50732 gene locus_tag LOCUS_42800 52000 50732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_42800 52434 53735 gene locus_tag LOCUS_42810 52434 53735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 53877 56066 gene locus_tag LOCUS_42820 53877 56066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 56579 56211 gene locus_tag LOCUS_42830 56579 56211 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_42830 57303 57806 gene locus_tag LOCUS_42840 57303 57806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 58424 59254 gene locus_tag LOCUS_42850 58424 59254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 59308 60138 gene locus_tag LOCUS_42860 59308 60138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 60358 61185 gene locus_tag LOCUS_42870 60358 61185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 61249 61659 gene locus_tag LOCUS_42880 61249 61659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_42880 61813 63609 gene locus_tag LOCUS_42890 61813 63609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 63853 64251 gene locus_tag LOCUS_42900 63853 64251 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_42900 64244 65665 gene locus_tag LOCUS_42910 64244 65665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 66774 65839 gene locus_tag LOCUS_42920 66774 65839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_42920 68087 66966 gene locus_tag LOCUS_42930 68087 66966 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_42930 69973 68237 gene locus_tag LOCUS_42940 69973 68237 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_42940 73076 69990 gene locus_tag LOCUS_42950 73076 69990 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_42950 74120 73194 gene locus_tag LOCUS_42960 gene rbsK 74120 73194 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_42960 74297 75799 gene locus_tag LOCUS_42970 74297 75799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 76183 78456 gene locus_tag LOCUS_42980 gene katG 76183 78456 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_42980 78816 79610 gene locus_tag LOCUS_42990 gene rsbQ 78816 79610 CDS product sigma factor SigB regulation protein RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07015 protein_id gnl|my_center|LOCUS_42990 79674 79991 gene locus_tag LOCUS_43000 79674 79991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 >Feature sequence29 1962 388 gene locus_tag LOCUS_43010 1962 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 2336 2527 gene locus_tag LOCUS_43020 2336 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4649 2754 gene locus_tag LOCUS_43030 4649 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 7175 8779 gene locus_tag LOCUS_43040 7175 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 10343 8931 gene locus_tag LOCUS_43050 10343 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 10612 10349 gene locus_tag LOCUS_43060 10612 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 10689 11336 gene locus_tag LOCUS_43070 10689 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 11752 12669 gene locus_tag LOCUS_43080 gene rbsK 11752 12669 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_43080 12807 13712 gene locus_tag LOCUS_43090 12807 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 13856 14803 gene locus_tag LOCUS_43100 13856 14803 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_43100 15063 14875 gene locus_tag LOCUS_43110 15063 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 16180 15353 gene locus_tag LOCUS_43120 16180 15353 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_43120 17026 16280 gene locus_tag LOCUS_43130 17026 16280 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_43130 17246 18643 gene locus_tag LOCUS_43140 gene lpdA2 17246 18643 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_43140 18697 19230 gene locus_tag LOCUS_43150 18697 19230 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_43150 19230 20078 gene locus_tag LOCUS_43160 19230 20078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 20322 20780 gene locus_tag LOCUS_43170 20322 20780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_43170 20777 21811 gene locus_tag LOCUS_43180 gene ltaE 20777 21811 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_43180 21856 23118 gene locus_tag LOCUS_43190 21856 23118 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_43190 23564 23124 gene locus_tag LOCUS_43200 23564 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 23766 24251 gene locus_tag LOCUS_43210 23766 24251 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_43210 25544 24504 gene locus_tag LOCUS_43220 25544 24504 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_43220 30004 25670 gene locus_tag LOCUS_43230 30004 25670 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_43230 31636 30245 gene locus_tag LOCUS_43240 31636 30245 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_43240 32301 31633 gene locus_tag LOCUS_43250 32301 31633 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_43250 33202 32612 gene locus_tag LOCUS_43260 33202 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_43260 35343 34093 gene locus_tag LOCUS_43270 gene proA 35343 34093 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_43270 36456 35371 gene locus_tag LOCUS_43280 gene proB 36456 35371 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 protein_id gnl|my_center|LOCUS_43280 36771 38156 gene locus_tag LOCUS_43290 36771 38156 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_43290 38153 39259 gene locus_tag LOCUS_43300 gene glxK 38153 39259 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 protein_id gnl|my_center|LOCUS_43300 39535 39350 gene locus_tag LOCUS_43310 39535 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 39534 41477 gene locus_tag LOCUS_43320 39534 41477 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_43320 42124 44541 gene locus_tag LOCUS_43330 42124 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 44922 44602 gene locus_tag LOCUS_43340 44922 44602 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_43340 45942 44938 gene locus_tag LOCUS_43350 45942 44938 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_43350 46471 46037 gene locus_tag LOCUS_43360 46471 46037 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_43360 46639 47424 gene locus_tag LOCUS_43370 46639 47424 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_43370 47991 47419 gene locus_tag LOCUS_43380 47991 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43380 49547 48531 gene locus_tag LOCUS_43390 49547 48531 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_43390 50581 49559 gene locus_tag LOCUS_43400 50581 49559 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_43400 51644 50586 gene locus_tag LOCUS_43410 51644 50586 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_43410 52225 54111 gene locus_tag LOCUS_43420 52225 54111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_43420 54108 55151 gene locus_tag LOCUS_43430 54108 55151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_43430 56032 55436 gene locus_tag LOCUS_43440 56032 55436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 57310 56036 gene locus_tag LOCUS_43450 57310 56036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 57864 57448 gene locus_tag LOCUS_43460 57864 57448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 58511 57936 gene locus_tag LOCUS_43470 gene ruvC 58511 57936 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_43470 58538 59668 gene locus_tag LOCUS_43480 58538 59668 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_43480 59712 59963 gene locus_tag LOCUS_43490 59712 59963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 59965 61182 gene locus_tag LOCUS_43500 59965 61182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 61184 61810 gene locus_tag LOCUS_43510 61184 61810 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_43510 61814 62914 gene locus_tag LOCUS_43520 61814 62914 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249713.1 protein_id gnl|my_center|LOCUS_43520 62911 63693 gene locus_tag LOCUS_43530 gene tatD 62911 63693 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_43530 63683 64759 gene locus_tag LOCUS_43540 gene ansA 63683 64759 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_43540 64920 65007 gene locus_tag LOCUS_t00260 64920 65007 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65599 65189 gene locus_tag LOCUS_43550 65599 65189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 65876 65670 gene locus_tag LOCUS_43560 65876 65670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 66293 66502 gene locus_tag LOCUS_43570 66293 66502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence30 847 86 gene locus_tag LOCUS_43580 847 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1440 943 gene locus_tag LOCUS_43590 1440 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 2683 1427 gene locus_tag LOCUS_43600 2683 1427 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_43600 3005 2920 gene locus_tag LOCUS_t00270 3005 2920 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4128 3172 gene locus_tag LOCUS_43610 gene yfkH 4128 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_43610 4541 4125 gene locus_tag LOCUS_43620 4541 4125 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_43620 5591 4542 gene locus_tag LOCUS_43630 5591 4542 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_43630 5812 6441 gene locus_tag LOCUS_43640 5812 6441 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_43640 6505 7134 gene locus_tag LOCUS_43650 6505 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_43650 7226 9751 gene locus_tag LOCUS_43660 gene clpC 7226 9751 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_43660 9947 10876 gene locus_tag LOCUS_43670 9947 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_43670 11092 12438 gene locus_tag LOCUS_43680 11092 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 12458 13762 gene locus_tag LOCUS_43690 12458 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 15003 13804 gene locus_tag LOCUS_43700 15003 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43700 16086 15010 gene locus_tag LOCUS_43710 16086 15010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43710 17114 16095 gene locus_tag LOCUS_43720 17114 16095 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_43720 17576 17770 gene locus_tag LOCUS_43730 gene rpsU 17576 17770 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_43730 17828 18712 gene locus_tag LOCUS_43740 gene xerC 17828 18712 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_43740 18744 19049 gene locus_tag LOCUS_43750 18744 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_43750 20715 19105 gene locus_tag LOCUS_43760 20715 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 20796 21008 gene locus_tag LOCUS_43770 20796 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 22152 21058 gene locus_tag LOCUS_43780 gene gfo 22152 21058 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_43780 22479 23432 gene locus_tag LOCUS_43790 22479 23432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_43790 23467 24261 gene locus_tag LOCUS_43800 23467 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_43800 25092 24454 gene locus_tag LOCUS_43810 25092 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 26226 25396 gene locus_tag LOCUS_43820 gene tsf 26226 25396 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_43820 27096 26335 gene locus_tag LOCUS_43830 gene rpsB 27096 26335 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_43830 27527 27141 gene locus_tag LOCUS_43840 gene rpsI 27527 27141 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_43840 27983 27540 gene locus_tag LOCUS_43850 gene rplM 27983 27540 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_43850 28779 28381 gene locus_tag LOCUS_43860 gene rnk 28779 28381 CDS product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ43 protein_id gnl|my_center|LOCUS_43860 29418 30710 gene locus_tag LOCUS_43870 29418 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 30777 32018 gene locus_tag LOCUS_43880 30777 32018 CDS product Mn transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_43880 32159 33385 gene locus_tag LOCUS_43890 32159 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 35062 33563 gene locus_tag LOCUS_43900 35062 33563 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_43900 36241 35234 gene locus_tag LOCUS_43910 36241 35234 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_43910 36868 36305 gene locus_tag LOCUS_43920 36868 36305 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_43920 37720 37235 gene locus_tag LOCUS_43930 37720 37235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 40263 37882 gene locus_tag LOCUS_43940 40263 37882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_43940 41597 40653 gene locus_tag LOCUS_43950 gene ephA 41597 40653 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_43950 42374 41685 gene locus_tag LOCUS_43960 42374 41685 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_43960 43782 42829 gene locus_tag LOCUS_43970 43782 42829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_43970 44070 45056 gene locus_tag LOCUS_43980 44070 45056 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_43980 45563 45057 gene locus_tag LOCUS_43990 45563 45057 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_43990 46968 46015 gene locus_tag LOCUS_44000 46968 46015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 47762 46965 gene locus_tag LOCUS_44010 47762 46965 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_44010 48628 47765 gene locus_tag LOCUS_44020 48628 47765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 49689 48640 gene locus_tag LOCUS_44030 49689 48640 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_44030 50698 50330 gene locus_tag LOCUS_44040 50698 50330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 51190 50741 gene locus_tag LOCUS_44050 51190 50741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44050 51991 51326 gene locus_tag LOCUS_44060 51991 51326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 52489 52301 gene locus_tag LOCUS_44070 52489 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 53015 52491 gene locus_tag LOCUS_44080 53015 52491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 53408 53139 gene locus_tag LOCUS_44090 53408 53139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44090 54014 53442 gene locus_tag LOCUS_44100 54014 53442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44100 55003 54107 gene locus_tag LOCUS_44110 55003 54107 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_44110 56056 57192 gene locus_tag LOCUS_44120 56056 57192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_44120 57983 57474 gene locus_tag LOCUS_44130 57983 57474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 >Feature sequence31 <1 1554 gene locus_tag LOCUS_44140 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003568911.1:transposase 1963 1799 gene locus_tag LOCUS_44150 1963 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 2196 1954 gene locus_tag LOCUS_44160 2196 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 3256 2810 gene locus_tag LOCUS_44170 3256 2810 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_44170 3511 3257 gene locus_tag LOCUS_44180 3511 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_44180 4632 4195 gene locus_tag LOCUS_44190 4632 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 4961 4629 gene locus_tag LOCUS_44200 4961 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_44200 5452 5111 gene locus_tag LOCUS_44210 5452 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 7969 5828 gene locus_tag LOCUS_44220 7969 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204831.1 protein_id gnl|my_center|LOCUS_44220 9454 7973 gene locus_tag LOCUS_44230 9454 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204832.1 protein_id gnl|my_center|LOCUS_44230 10242 9562 gene locus_tag LOCUS_44240 10242 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 12108 10954 gene locus_tag LOCUS_44250 12108 10954 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_44250 13124 12132 gene locus_tag LOCUS_44260 13124 12132 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_44260 14610 13114 gene locus_tag LOCUS_44270 gene cysS 14610 13114 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F4 protein_id gnl|my_center|LOCUS_44270 14769 15239 gene locus_tag LOCUS_44280 gene rimP 14769 15239 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_44280 15245 16489 gene locus_tag LOCUS_44290 gene nusA 15245 16489 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_44290 16560 19592 gene locus_tag LOCUS_44300 gene infB 16560 19592 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_44300 21692 20568 gene locus_tag LOCUS_44310 21692 20568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_44310 22717 21692 gene locus_tag LOCUS_44320 22717 21692 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T01 protein_id gnl|my_center|LOCUS_44320 23563 22820 gene locus_tag LOCUS_44330 23563 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 24465 23560 gene locus_tag LOCUS_44340 24465 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 24926 24468 gene locus_tag LOCUS_44350 24926 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 25849 24944 gene locus_tag LOCUS_44360 25849 24944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_44360 27122 25863 gene locus_tag LOCUS_44370 27122 25863 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_44370 27736 27119 gene locus_tag LOCUS_44380 27736 27119 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_44380 29301 28096 gene locus_tag LOCUS_44390 29301 28096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_44390 30291 29302 gene locus_tag LOCUS_44400 gene asd 30291 29302 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_44400 30396 35648 gene locus_tag LOCUS_44410 30396 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 35735 36718 gene locus_tag LOCUS_44420 35735 36718 CDS product sialic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017179.1 protein_id gnl|my_center|LOCUS_44420 36715 37176 gene locus_tag LOCUS_44430 36715 37176 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_44430 37173 38447 gene locus_tag LOCUS_44440 37173 38447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_44440 39211 40269 gene locus_tag LOCUS_44450 39211 40269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 40299 41618 gene locus_tag LOCUS_44460 gene nagA 40299 41618 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_44460 42321 42725 gene locus_tag LOCUS_44470 42321 42725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 43214 43669 gene locus_tag LOCUS_44480 43214 43669 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_44480 44175 46052 gene locus_tag LOCUS_44490 44175 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 47315 46188 gene locus_tag LOCUS_44500 47315 46188 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970240.1 protein_id gnl|my_center|LOCUS_44500 48718 47342 gene locus_tag LOCUS_44510 48718 47342 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_44510 49524 48823 gene locus_tag LOCUS_44520 49524 48823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 51704 50352 gene locus_tag LOCUS_44530 51704 50352 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence32 114 497 gene locus_tag LOCUS_44540 114 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 932 642 gene locus_tag LOCUS_44550 932 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1301 3457 gene locus_tag LOCUS_44560 1301 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4325 3531 gene locus_tag LOCUS_44570 4325 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 4717 4633 gene locus_tag LOCUS_t00280 4717 4633 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4883 4810 gene locus_tag LOCUS_t00290 4883 4810 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7619 5019 gene locus_tag LOCUS_44580 gene mutS 7619 5019 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_44580 7806 8342 gene locus_tag LOCUS_44590 7806 8342 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_44590 9495 8398 gene locus_tag LOCUS_44600 9495 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 9716 10795 gene locus_tag LOCUS_44610 9716 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 10997 12052 gene locus_tag LOCUS_44620 10997 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 12170 13324 gene locus_tag LOCUS_44630 12170 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 13601 16861 gene locus_tag LOCUS_44640 13601 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_44640 16867 18330 gene locus_tag LOCUS_44650 16867 18330 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_44650 18340 19404 gene locus_tag LOCUS_44660 gene pam 18340 19404 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_44660 19875 22202 gene locus_tag LOCUS_44670 gene metE 19875 22202 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 protein_id gnl|my_center|LOCUS_44670 23457 22255 gene locus_tag LOCUS_44680 23457 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 25109 23451 gene locus_tag LOCUS_44690 25109 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_44690 28504 25142 gene locus_tag LOCUS_44700 28504 25142 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_44700 30071 29055 gene locus_tag LOCUS_44710 30071 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 31687 30977 gene locus_tag LOCUS_44720 31687 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_44720 32941 31739 gene locus_tag LOCUS_44730 gene aspC1 32941 31739 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_44730 33215 34039 gene locus_tag LOCUS_44740 33215 34039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 34389 34033 gene locus_tag LOCUS_44750 34389 34033 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_44750 34431 35165 gene locus_tag LOCUS_44760 gene lipB 34431 35165 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_44760 35162 35563 gene locus_tag LOCUS_44770 35162 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_44770 35569 36303 gene locus_tag LOCUS_44780 35569 36303 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_44780 36388 38565 gene locus_tag LOCUS_44790 gene rnr 36388 38565 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_44790 38555 39541 gene locus_tag LOCUS_44800 38555 39541 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_44800 39546 40175 gene locus_tag LOCUS_44810 39546 40175 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_44810 40539 40231 gene locus_tag LOCUS_44820 40539 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 40929 40669 gene locus_tag LOCUS_44830 gene rpmA 40929 40669 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_44830 41202 40963 gene locus_tag LOCUS_44840 41202 40963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 41825 41655 gene locus_tag LOCUS_44850 41825 41655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 41868 42848 gene locus_tag LOCUS_44860 gene nrdB 41868 42848 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_44860 42878 45274 gene locus_tag LOCUS_44870 gene nrdA 42878 45274 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_44870 46723 45665 gene locus_tag LOCUS_44880 46723 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 47260 46919 gene locus_tag LOCUS_44890 47260 46919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 protein_id gnl|my_center|LOCUS_44890 47618 49516 gene locus_tag LOCUS_44900 47618 49516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 49624 50862 gene locus_tag LOCUS_44910 49624 50862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 51852 51223 gene locus_tag LOCUS_44920 51852 51223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence33 445 594 gene locus_tag LOCUS_44930 445 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 1034 1666 gene locus_tag LOCUS_44940 1034 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 3716 2133 gene locus_tag LOCUS_44950 3716 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_44950 5622 3754 gene locus_tag LOCUS_44960 5622 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 6822 5776 gene locus_tag LOCUS_44970 6822 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 8426 6885 gene locus_tag LOCUS_44980 8426 6885 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_44980 11529 8440 gene locus_tag LOCUS_44990 11529 8440 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_44990 13900 12014 gene locus_tag LOCUS_45000 13900 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 15748 14321 gene locus_tag LOCUS_45010 15748 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118143.1 protein_id gnl|my_center|LOCUS_45010 16466 16086 gene locus_tag LOCUS_45020 16466 16086 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_45020 16844 16692 gene locus_tag LOCUS_45030 16844 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 18727 17312 gene locus_tag LOCUS_45040 18727 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 21115 18737 gene locus_tag LOCUS_45050 21115 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 22572 21127 gene locus_tag LOCUS_45060 22572 21127 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_45060 24149 22572 gene locus_tag LOCUS_45070 24149 22572 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_45070 25294 24161 gene locus_tag LOCUS_45080 25294 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_45080 27223 25403 gene locus_tag LOCUS_45090 27223 25403 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_45090 29027 27306 gene locus_tag LOCUS_45100 29027 27306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 31336 29138 gene locus_tag LOCUS_45110 31336 29138 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_45110 34072 31379 gene locus_tag LOCUS_45120 34072 31379 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_45120 35652 34165 gene locus_tag LOCUS_45130 35652 34165 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_45130 37202 36855 gene locus_tag LOCUS_45140 gene cas2 37202 36855 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_45140 38091 37195 gene locus_tag LOCUS_45150 gene cas1 38091 37195 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_45150 38765 38154 gene locus_tag LOCUS_45160 38765 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 42172 38768 gene locus_tag LOCUS_45170 gene cas9 42172 38768 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZR9 protein_id gnl|my_center|LOCUS_45170 >Feature sequence34 1607 441 gene locus_tag LOCUS_45180 1607 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 1847 3049 gene locus_tag LOCUS_45190 1847 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3100 6633 gene locus_tag LOCUS_45200 3100 6633 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_45200 8512 7118 gene locus_tag LOCUS_45210 8512 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 10433 9144 gene locus_tag LOCUS_45220 10433 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 10849 10508 gene locus_tag LOCUS_45230 10849 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 11443 10967 gene locus_tag LOCUS_45240 11443 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 12724 11873 gene locus_tag LOCUS_45250 12724 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_45250 13440 13000 gene locus_tag LOCUS_45260 13440 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 13564 13403 gene locus_tag LOCUS_45270 13564 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 14203 13907 gene locus_tag LOCUS_45280 14203 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 14415 14200 gene locus_tag LOCUS_45290 14415 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 15534 15355 gene locus_tag LOCUS_45300 15534 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 15788 16942 gene locus_tag LOCUS_45310 15788 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 18754 17108 gene locus_tag LOCUS_45320 gene trxB 18754 17108 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118394.1 protein_id gnl|my_center|LOCUS_45320 19039 18767 gene locus_tag LOCUS_45330 19039 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_45330 19306 19106 gene locus_tag LOCUS_45340 19306 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 19780 19322 gene locus_tag LOCUS_45350 19780 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45350 20322 20149 gene locus_tag LOCUS_45360 20322 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 20870 20451 gene locus_tag LOCUS_45370 20870 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 22074 21244 gene locus_tag LOCUS_45380 22074 21244 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_45380 21995 22216 gene locus_tag LOCUS_45390 21995 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 22761 22441 gene locus_tag LOCUS_45400 22761 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 24021 23551 gene locus_tag LOCUS_45410 24021 23551 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_45410 24872 24186 gene locus_tag LOCUS_45420 24872 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 25724 24876 gene locus_tag LOCUS_45430 25724 24876 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_45430 26680 26120 gene locus_tag LOCUS_45440 26680 26120 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 protein_id gnl|my_center|LOCUS_45440 27893 26826 gene locus_tag LOCUS_45450 27893 26826 CDS product ribosome small subunit-dependent GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_45450 27926 28123 gene locus_tag LOCUS_45460 27926 28123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 29535 28180 gene locus_tag LOCUS_45470 29535 28180 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_45470 30486 30079 gene locus_tag LOCUS_45480 30486 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 31078 30575 gene locus_tag LOCUS_45490 31078 30575 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_45490 32230 31202 gene locus_tag LOCUS_45500 32230 31202 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_45500 32345 32217 gene locus_tag LOCUS_45510 32345 32217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 32935 32537 gene locus_tag LOCUS_45520 32935 32537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 33772 33083 gene locus_tag LOCUS_45530 33772 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45530 34439 33663 gene locus_tag LOCUS_45540 34439 33663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45540 36781 34817 gene locus_tag LOCUS_45550 36781 34817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence35 726 3767 gene locus_tag LOCUS_45560 726 3767 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_45560 3799 5490 gene locus_tag LOCUS_45570 3799 5490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_45570 5583 7013 gene locus_tag LOCUS_45580 5583 7013 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C863 protein_id gnl|my_center|LOCUS_45580 7049 9121 gene locus_tag LOCUS_45590 7049 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 9162 10505 gene locus_tag LOCUS_45600 9162 10505 CDS product 4,5-dihydroxyphthalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_45600 10578 11924 gene locus_tag LOCUS_45610 10578 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 12086 12832 gene locus_tag LOCUS_45620 gene nagB 12086 12832 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_45620 14029 12977 gene locus_tag LOCUS_45630 14029 12977 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_45630 14760 15455 gene locus_tag LOCUS_45640 14760 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 15599 16633 gene locus_tag LOCUS_45650 15599 16633 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_45650 16933 20313 gene locus_tag LOCUS_45660 16933 20313 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_45660 20313 21941 gene locus_tag LOCUS_45670 20313 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_45670 22039 23883 gene locus_tag LOCUS_45680 22039 23883 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702957.1 protein_id gnl|my_center|LOCUS_45680 24132 24683 gene locus_tag LOCUS_45690 24132 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 24799 25884 gene locus_tag LOCUS_45700 24799 25884 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_45700 25970 27769 gene locus_tag LOCUS_45710 25970 27769 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_45710 27948 29309 gene locus_tag LOCUS_45720 27948 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 29648 31345 gene locus_tag LOCUS_45730 29648 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 32439 32819 gene locus_tag LOCUS_45740 32439 32819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_45740 32923 34374 gene locus_tag LOCUS_45750 gene aslA 32923 34374 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence36 1221 556 gene locus_tag LOCUS_45760 1221 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 1402 2427 gene locus_tag LOCUS_45770 1402 2427 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_45770 3801 2524 gene locus_tag LOCUS_45780 gene serS 3801 2524 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_45780 3921 4841 gene locus_tag LOCUS_45790 3921 4841 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_45790 4880 5638 gene locus_tag LOCUS_45800 4880 5638 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_45800 5662 6522 gene locus_tag LOCUS_45810 gene hpaG 5662 6522 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_45810 7276 6575 gene locus_tag LOCUS_45820 7276 6575 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203531.1 protein_id gnl|my_center|LOCUS_45820 8014 11235 gene locus_tag LOCUS_45830 8014 11235 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_45830 11263 12750 gene locus_tag LOCUS_45840 11263 12750 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795013.1 protein_id gnl|my_center|LOCUS_45840 12782 13942 gene locus_tag LOCUS_45850 12782 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 13994 14800 gene locus_tag LOCUS_45860 13994 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 14912 16045 gene locus_tag LOCUS_45870 14912 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 16051 17592 gene locus_tag LOCUS_45880 16051 17592 CDS product putative sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702286.1 protein_id gnl|my_center|LOCUS_45880 17601 18719 gene locus_tag LOCUS_45890 17601 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 18772 19539 gene locus_tag LOCUS_45900 18772 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 19545 20438 gene locus_tag LOCUS_45910 19545 20438 CDS product succinylglutamate desuccinylase/aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_45910 20446 21270 gene locus_tag LOCUS_45920 20446 21270 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_45920 21267 22358 gene locus_tag LOCUS_45930 21267 22358 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_45930 22373 23284 gene locus_tag LOCUS_45940 22373 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 23432 23812 gene locus_tag LOCUS_45950 23432 23812 CDS product RutC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25598 protein_id gnl|my_center|LOCUS_45950 23802 25289 gene locus_tag LOCUS_45960 23802 25289 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 protein_id gnl|my_center|LOCUS_45960 25295 26164 gene locus_tag LOCUS_45970 25295 26164 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085065.1 protein_id gnl|my_center|LOCUS_45970 26185 27171 gene locus_tag LOCUS_45980 26185 27171 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_45980 27201 29759 gene locus_tag LOCUS_45990 27201 29759 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_45990 30361 31812 gene locus_tag LOCUS_46000 30361 31812 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_46000 >Feature sequence37 742 86 gene locus_tag LOCUS_46010 742 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 1879 953 gene locus_tag LOCUS_46020 1879 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 3096 1975 gene locus_tag LOCUS_46030 3096 1975 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_46030 4518 3445 gene locus_tag LOCUS_46040 4518 3445 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_46040 6179 4887 gene locus_tag LOCUS_46050 gene murF 6179 4887 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_46050 6365 8494 gene locus_tag LOCUS_46060 6365 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 9519 8728 gene locus_tag LOCUS_46070 9519 8728 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_46070 10105 9557 gene locus_tag LOCUS_46080 gene def 10105 9557 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_46080 10515 10102 gene locus_tag LOCUS_46090 10515 10102 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_46090 11273 10515 gene locus_tag LOCUS_46100 11273 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 11495 13078 gene locus_tag LOCUS_46110 11495 13078 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_46110 13399 13800 gene locus_tag LOCUS_46120 13399 13800 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145269.1 protein_id gnl|my_center|LOCUS_46120 15840 13888 gene locus_tag LOCUS_46130 15840 13888 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_46130 16086 17912 gene locus_tag LOCUS_46140 16086 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142049.1 protein_id gnl|my_center|LOCUS_46140 19308 18088 gene locus_tag LOCUS_46150 19308 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 21284 19656 gene locus_tag LOCUS_46160 21284 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 22757 21297 gene locus_tag LOCUS_46170 gene arsA 22757 21297 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_46170 24253 22820 gene locus_tag LOCUS_46180 24253 22820 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_46180 27740 24324 gene locus_tag LOCUS_46190 27740 24324 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_46190 28697 27795 gene locus_tag LOCUS_46200 28697 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 29407 28811 gene locus_tag LOCUS_46210 29407 28811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 >Feature sequence38 631 287 gene locus_tag LOCUS_46220 631 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46220 1407 631 gene locus_tag LOCUS_46230 1407 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46230 2677 1457 gene locus_tag LOCUS_46240 2677 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_46240 4530 3460 gene locus_tag LOCUS_46250 4530 3460 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_46250 5062 5907 gene locus_tag LOCUS_46260 5062 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 6331 6104 gene locus_tag LOCUS_46270 6331 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 7650 6343 gene locus_tag LOCUS_46280 7650 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 8123 9259 gene locus_tag LOCUS_46290 gene rhlE 8123 9259 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_46290 10239 9376 gene locus_tag LOCUS_46300 10239 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 10714 12879 gene locus_tag LOCUS_46310 10714 12879 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_46310 13363 12908 gene locus_tag LOCUS_46320 13363 12908 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_46320 13857 13402 gene locus_tag LOCUS_46330 13857 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 14456 14103 gene locus_tag LOCUS_46340 14456 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 14689 14453 gene locus_tag LOCUS_46350 14689 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_46350 16550 16155 gene locus_tag LOCUS_46360 16550 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 17736 16618 gene locus_tag LOCUS_46370 17736 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 18716 18255 gene locus_tag LOCUS_46380 18716 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 18876 19349 gene locus_tag LOCUS_46390 18876 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46390 20471 19482 gene locus_tag LOCUS_46400 20471 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 21863 20946 gene locus_tag LOCUS_46410 21863 20946 CDS product dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_46410 22532 21948 gene locus_tag LOCUS_46420 22532 21948 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_46420 23850 22747 gene locus_tag LOCUS_46430 23850 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 >Feature sequence39 584 1798 gene locus_tag LOCUS_46440 gene sucC 584 1798 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_46440 1835 1909 gene locus_tag LOCUS_t00300 1835 1909 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3035 2616 gene locus_tag LOCUS_46450 3035 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 3715 6060 gene locus_tag LOCUS_46460 3715 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 6185 7393 gene locus_tag LOCUS_46470 6185 7393 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_46470 7386 8522 gene locus_tag LOCUS_46480 gene uxuA 7386 8522 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_46480 8689 10269 gene locus_tag LOCUS_46490 8689 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 10284 10739 gene locus_tag LOCUS_46500 10284 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_46500 11793 10789 gene locus_tag LOCUS_46510 11793 10789 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQJ8 protein_id gnl|my_center|LOCUS_46510 12066 12977 gene locus_tag LOCUS_46520 12066 12977 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_46520 12958 13974 gene locus_tag LOCUS_46530 12958 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 14308 14943 gene locus_tag LOCUS_46540 14308 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 15457 15044 gene locus_tag LOCUS_46550 15457 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 15958 17484 gene locus_tag LOCUS_46560 15958 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_46560 17806 18993 gene locus_tag LOCUS_46570 17806 18993 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_46570 18990 19775 gene locus_tag LOCUS_46580 18990 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_46580 20876 19818 gene locus_tag LOCUS_46590 20876 19818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_46590 22284 20863 gene locus_tag LOCUS_46600 gene opuD 22284 20863 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 protein_id gnl|my_center|LOCUS_46600 >Feature sequence40 15 264 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtctactctttttaagatactcacttcaaccc 1565 2162 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtctaccctttttaagatactcacttcaac 2628 2320 gene locus_tag LOCUS_46610 2628 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 3607 2609 gene locus_tag LOCUS_46620 gene cas1 3607 2609 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZH4 protein_id gnl|my_center|LOCUS_46620 4587 3607 gene locus_tag LOCUS_46630 4587 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 4920 4747 gene locus_tag LOCUS_46640 4920 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5177 6056 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtctaccctttttaagatactcacttcaac 6264 6518 gene locus_tag LOCUS_46650 6264 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 7076 8034 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtctaccctttttaagatactcacttcaac 9054 8293 gene locus_tag LOCUS_46660 9054 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 10109 9051 gene locus_tag LOCUS_46670 10109 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 10590 10192 gene locus_tag LOCUS_46680 10590 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986671.1 protein_id gnl|my_center|LOCUS_46680 11374 10583 gene locus_tag LOCUS_46690 11374 10583 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_46690 12462 11386 gene locus_tag LOCUS_46700 12462 11386 CDS product CRISPR-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986673.1 protein_id gnl|my_center|LOCUS_46700 14080 12455 gene locus_tag LOCUS_46710 14080 12455 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_46710 15219 14077 gene locus_tag LOCUS_46720 15219 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_46720 17702 15225 gene locus_tag LOCUS_46730 17702 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 18621 18214 gene locus_tag LOCUS_46740 18621 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 <20953 18689 gene locus_tag LOCUS_46750 <20953 18689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence41 1049 279 gene locus_tag LOCUS_46760 1049 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 1327 1773 gene locus_tag LOCUS_46770 1327 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 2098 2310 gene locus_tag LOCUS_46780 2098 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 2325 2975 gene locus_tag LOCUS_46790 2325 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 3689 6136 gene locus_tag LOCUS_46800 3689 6136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_46800 8145 6616 gene locus_tag LOCUS_46810 8145 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 8544 10805 gene locus_tag LOCUS_46820 8544 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 11820 12023 gene locus_tag LOCUS_46830 11820 12023 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_46830 12078 13934 gene locus_tag LOCUS_46840 gene thiC 12078 13934 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_46840 13946 14542 gene locus_tag LOCUS_46850 gene thiE1 13946 14542 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 protein_id gnl|my_center|LOCUS_46850 14517 15290 gene locus_tag LOCUS_46860 gene thiD 14517 15290 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_46860 15287 15922 gene locus_tag LOCUS_46870 gene thiE 15287 15922 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_46870 15919 16698 gene locus_tag LOCUS_46880 gene thiG 15919 16698 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_46880 16691 17800 gene locus_tag LOCUS_46890 gene thiH 16691 17800 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_46890 17802 18860 gene locus_tag LOCUS_46900 17802 18860 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_46900 >Feature sequence42 1996 1920 gene locus_tag LOCUS_t00310 1996 1920 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2186 2815 gene locus_tag LOCUS_46910 2186 2815 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_46910 2808 3920 gene locus_tag LOCUS_46920 2808 3920 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_46920 4241 3936 gene locus_tag LOCUS_46930 4241 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 6071 4248 gene locus_tag LOCUS_46940 6071 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 6845 6072 gene locus_tag LOCUS_46950 6845 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 10015 6995 gene locus_tag LOCUS_46960 10015 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 10279 10031 gene locus_tag LOCUS_46970 10279 10031 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_46970 11382 10285 gene locus_tag LOCUS_46980 11382 10285 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P46 protein_id gnl|my_center|LOCUS_46980 11781 13718 gene locus_tag LOCUS_46990 gene dnaG 11781 13718 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_46990 13797 15014 gene locus_tag LOCUS_47000 gene ribBA 13797 15014 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_47000 15215 15751 gene locus_tag LOCUS_47010 15215 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 15751 16542 gene locus_tag LOCUS_47020 gene surE 15751 16542 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_47020 >Feature sequence43 1299 205 gene locus_tag LOCUS_47030 1299 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 1713 1390 gene locus_tag LOCUS_47040 1713 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 2863 1853 gene locus_tag LOCUS_47050 2863 1853 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089280.1 protein_id gnl|my_center|LOCUS_47050 4048 3251 gene locus_tag LOCUS_47060 4048 3251 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887136.1 protein_id gnl|my_center|LOCUS_47060 4460 4080 gene locus_tag LOCUS_47070 4460 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 5181 4606 gene locus_tag LOCUS_47080 5181 4606 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_47080 6593 5592 gene locus_tag LOCUS_47090 6593 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 7808 7269 gene locus_tag LOCUS_47100 7808 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 8262 7792 gene locus_tag LOCUS_47110 8262 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 9842 9024 gene locus_tag LOCUS_47120 9842 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 10311 10150 gene locus_tag LOCUS_47130 10311 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 10942 10376 gene locus_tag LOCUS_47140 10942 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 12001 12342 gene locus_tag LOCUS_47150 12001 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47150 13191 12781 gene locus_tag LOCUS_47160 13191 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 13532 13203 gene locus_tag LOCUS_47170 13532 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 14814 14233 gene locus_tag LOCUS_47180 14814 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 15442 14807 gene locus_tag LOCUS_47190 15442 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 16479 15832 gene locus_tag LOCUS_47200 16479 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 >Feature sequence44 3224 3589 gene locus_tag LOCUS_47210 3224 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 3732 4040 gene locus_tag LOCUS_47220 3732 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_47220 4030 4356 gene locus_tag LOCUS_47230 4030 4356 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_47230 6509 4398 gene locus_tag LOCUS_47240 6509 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 8052 7165 gene locus_tag LOCUS_47250 8052 7165 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_47250 8651 9517 gene locus_tag LOCUS_47260 8651 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 10067 12061 gene locus_tag LOCUS_47270 10067 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 14083 12407 gene locus_tag LOCUS_47280 14083 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_47280 <16455 14095 gene locus_tag LOCUS_47290 <16455 14095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405560.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence45 3202 650 gene locus_tag LOCUS_47300 gene ppc 3202 650 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_47300 3585 3391 gene locus_tag LOCUS_47310 3585 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 3782 5752 gene locus_tag LOCUS_47320 3782 5752 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 protein_id gnl|my_center|LOCUS_47320 5875 6165 gene locus_tag LOCUS_47330 5875 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 6167 6520 gene locus_tag LOCUS_47340 gene mrpC 6167 6520 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_47340 6517 8025 gene locus_tag LOCUS_47350 gene mrpD 6517 8025 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_47350 8038 8517 gene locus_tag LOCUS_47360 gene mrpE 8038 8517 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_47360 8514 8789 gene locus_tag LOCUS_47370 gene mrpF 8514 8789 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_47370 8782 9177 gene locus_tag LOCUS_47380 gene mrpG 8782 9177 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_47380 9191 10312 gene locus_tag LOCUS_47390 9191 10312 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_47390 10416 11453 gene locus_tag LOCUS_47400 gene asnA 10416 11453 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM4 protein_id gnl|my_center|LOCUS_47400 11613 11810 gene locus_tag LOCUS_47410 11613 11810 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_47410 13053 12103 gene locus_tag LOCUS_47420 13053 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 13444 13046 gene locus_tag LOCUS_47430 13444 13046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_47430 13728 13429 gene locus_tag LOCUS_47440 13728 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 13981 14901 gene locus_tag LOCUS_47450 13981 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 >Feature sequence46 2 499 gene locus_tag LOCUS_47460 2 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47460 496 1194 gene locus_tag LOCUS_47470 496 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47470 1253 2008 gene locus_tag LOCUS_47480 1253 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459359.1 protein_id gnl|my_center|LOCUS_47480 3187 2564 gene locus_tag LOCUS_47490 3187 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 4189 3398 gene locus_tag LOCUS_47500 4189 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 4752 4441 gene locus_tag LOCUS_47510 4752 4441 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_47510 5096 4749 gene locus_tag LOCUS_47520 5096 4749 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203069.1 protein_id gnl|my_center|LOCUS_47520 5874 5500 gene locus_tag LOCUS_47530 5874 5500 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_47530 6199 5852 gene locus_tag LOCUS_47540 6199 5852 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_47540 7277 6828 gene locus_tag LOCUS_47550 7277 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 8277 7327 gene locus_tag LOCUS_47560 8277 7327 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59745 protein_id gnl|my_center|LOCUS_47560 9045 8641 gene locus_tag LOCUS_47570 9045 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 9886 9125 gene locus_tag LOCUS_47580 9886 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 10546 10881 gene locus_tag LOCUS_47590 10546 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 11003 11188 gene locus_tag LOCUS_47600 11003 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 12595 12182 gene locus_tag LOCUS_47610 12595 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 13330 12683 gene locus_tag LOCUS_47620 13330 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 13657 13343 gene locus_tag LOCUS_47630 13657 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 >Feature sequence47 1595 999 gene locus_tag LOCUS_47640 1595 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 3335 2247 gene locus_tag LOCUS_47650 3335 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 4093 3332 gene locus_tag LOCUS_47660 4093 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 4882 4250 gene locus_tag LOCUS_47670 4882 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 5084 4890 gene locus_tag LOCUS_47680 5084 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 6936 5062 gene locus_tag LOCUS_47690 6936 5062 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_47690 7531 8856 gene locus_tag LOCUS_47700 7531 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 8861 10270 gene locus_tag LOCUS_47710 8861 10270 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_47710 10263 11219 gene locus_tag LOCUS_47720 10263 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_47720 11434 12756 gene locus_tag LOCUS_47730 11434 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 >Feature sequence48 533 135 gene locus_tag LOCUS_47740 533 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 988 698 gene locus_tag LOCUS_47750 988 698 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_47750 2326 1691 gene locus_tag LOCUS_47760 2326 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 2399 3277 gene locus_tag LOCUS_47770 2399 3277 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_47770 3316 4422 gene locus_tag LOCUS_47780 3316 4422 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_47780 4832 4524 gene locus_tag LOCUS_47790 4832 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 5305 4835 gene locus_tag LOCUS_47800 5305 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 6218 5499 gene locus_tag LOCUS_47810 gene yoxD 6218 5499 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_47810 7261 6230 gene locus_tag LOCUS_47820 7261 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 7757 7254 gene locus_tag LOCUS_47830 7757 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 8271 7783 gene locus_tag LOCUS_47840 8271 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 8934 8362 gene locus_tag LOCUS_47850 8934 8362 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_47850 9091 8900 gene locus_tag LOCUS_47860 9091 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 10638 9877 gene locus_tag LOCUS_47870 10638 9877 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_47870 12248 11856 gene locus_tag LOCUS_47880 12248 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 12901 12254 gene locus_tag LOCUS_47890 12901 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 >Feature sequence49 1967 759 gene locus_tag LOCUS_47900 1967 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_47900 2125 2571 gene locus_tag LOCUS_47910 2125 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 2735 4069 gene locus_tag LOCUS_47920 2735 4069 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_47920 4089 6137 gene locus_tag LOCUS_47930 4089 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47930 6154 6870 gene locus_tag LOCUS_47940 6154 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 8587 6944 gene locus_tag LOCUS_47950 8587 6944 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_47950 8908 9282 gene locus_tag LOCUS_47960 gene rnpA 8908 9282 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_47960 9279 10940 gene locus_tag LOCUS_47970 9279 10940 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_47970 11182 11871 gene locus_tag LOCUS_47980 11182 11871 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_47980 11868 12380 gene locus_tag LOCUS_47990 11868 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_47990 >Feature sequence50 309 2348 gene locus_tag LOCUS_48000 309 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 3089 6334 gene locus_tag LOCUS_48010 3089 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 6661 11322 gene locus_tag LOCUS_48020 6661 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 11328 11831 gene locus_tag LOCUS_48030 11328 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence51 3484 620 gene locus_tag LOCUS_48040 gene hsdR 3484 620 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_48040 4690 3497 gene locus_tag LOCUS_48050 4690 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 6087 4870 gene locus_tag LOCUS_48060 gene hsdS 6087 4870 CDS product HsdS specificity protein of type I restriction-modification system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068836.1 protein_id gnl|my_center|LOCUS_48060 7665 6097 gene locus_tag LOCUS_48070 gene hsdM 7665 6097 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_48070 9354 8281 gene locus_tag LOCUS_48080 9354 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 9801 9562 gene locus_tag LOCUS_48090 9801 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 10282 10055 gene locus_tag LOCUS_48100 10282 10055 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_48100 11578 10925 gene locus_tag LOCUS_48110 11578 10925 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_48110 >Feature sequence52 1668 2450 gene locus_tag LOCUS_48120 1668 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 3510 2566 gene locus_tag LOCUS_48130 3510 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 5934 3535 gene locus_tag LOCUS_48140 5934 3535 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_48140 7037 6393 gene locus_tag LOCUS_48150 7037 6393 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_48150 8935 7139 gene locus_tag LOCUS_48160 8935 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 >Feature sequence53 2374 944 gene locus_tag LOCUS_48170 2374 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 4184 4312 gene locus_tag LOCUS_48180 4184 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 4357 5163 gene locus_tag LOCUS_48190 4357 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5399 6358 gene locus_tag LOCUS_48200 5399 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 >Feature sequence54 3442 1766 gene locus_tag LOCUS_48210 3442 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_48210 <5814 3454 gene locus_tag LOCUS_48220 <5814 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405560.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence55 1739 558 gene locus_tag LOCUS_48230 1739 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 2107 3108 gene locus_tag LOCUS_48240 2107 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48240 3148 4479 gene locus_tag LOCUS_48250 3148 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48250 4505 4990 gene locus_tag LOCUS_48260 4505 4990 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence56 772 590 gene locus_tag LOCUS_48270 772 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 1577 927 gene locus_tag LOCUS_48280 1577 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 3532 1790 gene locus_tag LOCUS_48290 3532 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 >Feature sequence57 248 3097 gene locus_tag LOCUS_48300 248 3097 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_48300 >Feature sequence58 >Feature sequence59 806 87 gene locus_tag LOCUS_48310 806 87 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708757.1 protein_id gnl|my_center|LOCUS_48310 2376 793 gene locus_tag LOCUS_48320 2376 793 CDS product putative transposase y4uI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53201 protein_id gnl|my_center|LOCUS_48320 >Feature sequence60 >Feature sequence61 1619 63 gene locus_tag LOCUS_48330 1619 63 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_48330 2026 1679 gene locus_tag LOCUS_48340 2026 1679 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887079.1 protein_id gnl|my_center|LOCUS_48340 2332 2030 gene locus_tag LOCUS_48350 2332 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 >Feature sequence62 97 444 gene locus_tag LOCUS_48360 97 444 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_48360 >Feature sequence63 290 1654 gene locus_tag LOCUS_48370 290 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 >Feature sequence64 <1 786 gene locus_tag LOCUS_48380 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761338.1:IS256 family transposase <1632 847 gene locus_tag LOCUS_48390 <1632 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761338.1:IS256 family transposase >Feature sequence65 >Feature sequence66 768 316 gene locus_tag LOCUS_48400 768 316 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_48400 >Feature sequence67 602 345 gene locus_tag LOCUS_48410 602 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 711 636 gene locus_tag LOCUS_t00320 711 636 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1043 968 gene locus_tag LOCUS_t00330 1043 968 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38